CN101341256A - Recurrent gene fusions in prostate cancer - Google Patents

Recurrent gene fusions in prostate cancer Download PDF

Info

Publication number
CN101341256A
CN101341256A CNA2006800418266A CN200680041826A CN101341256A CN 101341256 A CN101341256 A CN 101341256A CN A2006800418266 A CNA2006800418266 A CN A2006800418266A CN 200680041826 A CN200680041826 A CN 200680041826A CN 101341256 A CN101341256 A CN 101341256A
Authority
CN
China
Prior art keywords
gene
tmprss2
erg
cancer
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2006800418266A
Other languages
Chinese (zh)
Other versions
CN101341256B (en
Inventor
A·齐恩耐彦
S·汤姆林斯
D·洛德斯
R·梅尔拉
M·A·鲁宾
孙晓葳
F·德米彻里斯
S·珀纳
C·李
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Brigham and Womens Hospital Inc
University of Michigan
Original Assignee
Brigham and Womens Hospital Inc
University of Michigan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham and Womens Hospital Inc, University of Michigan filed Critical Brigham and Womens Hospital Inc
Priority claimed from PCT/US2006/035507 external-priority patent/WO2007033187A2/en
Publication of CN101341256A publication Critical patent/CN101341256A/en
Application granted granted Critical
Publication of CN101341256B publication Critical patent/CN101341256B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Recurrent gene fusions of androgen regulated genes and ETS family member genes in prostate cancer are described. Compositions and methods having utility in prostate cancer diagnosis, research, and therapy are also provided.

Description

Recurrence gene fusion in the prostate cancer
The application requires to enjoy the temporary patent application submitted on September 12nd, 2005 number 60/716,436,60/779 of submission on March 3rd, 2006,041,60/730 of submission on October 27th, 2005,60/795 of submission on April 28th, 358 and 2006,590 right of priority, they are whole in this article separately incorporated by reference.
The present invention has partly obtained the support of the prostate gland SPORE P50CA69568 of NIH, RO1CA97063, U01CA111275 and the grant number AG022404 of NIH.Government may have some right of the present invention.
Invention field
The present invention relates to be used for the composition and the method for cancer diagnosis, research and treatment, include but not limited to cancer markers.More specifically, the present invention relates to as the diagnostic flag of prostate cancer and the recurrence gene fusion of clinical target thing.
Background of invention
A focus target of cancer research is that the reason ground that identification changes participates in the gene that tumour generates.Identified a few class somatic mutations, comprised that base substitution, insertion, disappearance, transposition and karyomit(e) increase and reduces, they all can cause the active change of oncogene or tumor suppressor gene.Suppose have unambiguous evidence to show now, the origin cause of formation effect (Rowley, Nat Rev Cancer 1:245 (2001)) of chromosome rearrangement in cancer in early days first at twentieth century.Think that the chromosome aberration of recurrence is the essential characteristic of leukemia, lymphoma and sarcoma.Epithelial tumor (cancer) is more common, and can facilitate the most relatively M ﹠ M relevant with human cancer, and it comprises the known disease specific chromosome rearrangement (Mitelman, Mutat Res 462:247 (2000)) less than 1%.Although hematologic malignancies often is characterized by the chromosome rearrangement of equilibrated, disease specific, most of solid tumors have the distored plethora of unspecific staining body.Think that the karyotypic complicacy of solid tumor is owing to change by the secondary that cancer is evolved or progress obtains.
2 basic mechanism of chromosome rearrangement have been described.In a mechanism, the promotor/enhancer element of a gene is rearranged near the proto-oncogene, thus the change that causes carcinogenic protein to express.The example of this class transposition is, immunoglobulin (Ig) (IG) and T-cell receptors (TCR) gene are to the apposition of MYC, and this causes this oncogene active in B-and the T-cell malignancies (Rabbitts, Nature 372:143 (1994)) respectively.In second mechanism, rearrangement can cause 2 gene Fusion, and this produces fusion rotein, and it may have the new function or the activity of change.The prototype example of this transposition is BCR-ABL gene fusion (Rowley, the Nature 243:290 (1973) in the chronic granulocytic leukemia (CML); De Klein etc., Nature 300:765 (1982)).Importantly, this discovery causes the reasonable development of imatinib mesylate (Gleevec), and this medicine is target BCR-ABL kinases (Deininger etc., Blood 105:2640 (2005)) successfully.Thereby, discern the recurrence gene rearrangement in the common epithelial tumor, may have far-reaching influence to cancer drug development and patient treatment.
Summary of the invention
The invention provides, but be not limited to, the method for diagnosis patient's prostate cancer, it comprises: the sample from the patient is provided; With, whether exist in the test sample to have from 5 of the transcriptional regulatory district of male sex hormone regulatory gene (ARG) ' part with from the gene fusion of 3 of ETS family member gene ' part, the existence of wherein said gene fusion in sample is the index of prostate cancer among the patient.Described ARG can be TMPRSS2 or PSA.Described ETS family member gene can be ERG, ETV1 (ER81), FLI1, ETS1, ETS2, ELK1, ETV6 (TEL1), ETV7 (TEL2), GABP α, ELF1, ETV4 (E1AF; PEA3), ETV5 (ERM), ERF, PEA3/E1AF, PU.1, ESE1/ESX, SAP1 (ELK4), ETV3 (METS), EWS/FLI1, ESE1, ESE2 (ELF5), ESE3, PDEF, NET (ELK3; SAP2), NERF (ELF2), or FEV.The transcriptional regulatory district of ARG can comprise the promoter region of ARG.The promoter region of ARG can also comprise the androgen response element (ARE) of ARG.
Whether there is gene fusion in the test sample, can comprises detecting to have from the 5 ' part in the transcriptional regulatory district of ARG with from the chromosome rearrangement of the genomic dna of 3 of ETS family member gene ' part.Many technology can be used to detect the chromosome rearrangement of genomic dna, comprise nucleic acid sequencing, nucleic acid hybridization and nucleic acid amplification.Nucleic acid hybridization technique comprises in situ hybridization (ISH), microarray and southern blotting technique.Nucleic acid amplification technologies comprises the amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA) of polymerase chain reaction (PCR), inverse transcription polymerase chain reaction (RT-PCR), transcriptive intermediate and based on the amplification (NASBA) of nucleotide sequence.
Whether there is gene fusion in the test sample, can alternatively comprises detecting to have from the 5 ' part in the transcriptional regulatory district of ARG with from the chimeric mRNA transcript of 3 of ETS family member gene ' part.Many technology can be used to detect chimeric mRNA, comprise nucleic acid sequencing, nucleic acid hybridization and nucleic acid amplification.Nucleic acid hybridization technique comprises in situ hybridization (ISH) (for example, fluorescence in situ hybridization (FISH)), microarray and RNA trace.Nucleic acid amplification technologies comprises the amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA) of polymerase chain reaction (PCR), inverse transcription polymerase chain reaction (RT-PCR), transcriptive intermediate and based on the amplification (NASBA) of nucleotide sequence.
Whether there is gene fusion in the test sample, can also alternatively comprise the ETS family member albumen of the aminoterminal brachymemma that detection is produced by the transcriptional regulatory district of ARG and ETS family member gene fusion, or detect and have from the aminoterminal part in the transcriptional regulatory district of ARG with from the chimeric protein of the carboxyl terminal part of ETS family member gene.Many technology can be used to detect the ETS family member albumen or the chimeric protein of described brachymemma: protein sequencing; With, immunoassay.Immunoassay comprises immunoprecipitation, Western blot, ELISA, immunohistochemistry, immunocytochemistry, flow cytometry and immunity-PCR.
The present invention also provides, but is not limited to, and is used to diagnose the composition and the test kit of patient's prostate cancer.Described composition and test kit can comprise: the probe of an independent mark, its comprise can and from 5 of the transcriptional regulatory district of the ARG ' part and the sequence of hybridizing from the fusion joint between 3 of ETS family member gene ' part; The probe of a pair of mark, wherein the probe of first mark comprise can with the sequence of the transcriptional regulatory district of ARG hybridization, the probe of second mark comprise can with the sequence of ETS family member gene recombination; A pair of amplification oligonucleotide, wherein first amplification oligonucleotide comprise can with the sequence of the transcriptional regulatory district of ARG hybridization, second amplification oligonucleotide comprise can with the sequence of ETS family member gene recombination; The proteic antibody of ETS family member of the aminoterminal brachymemma that produces by the transcriptional regulatory district of ARG and ETS family member gene fusion; Or have from the aminoterminal part in the transcriptional regulatory district of ARG with from the antibody of the chimeric protein of the carboxyl terminal part of ETS family member gene.
The present invention also provides, but be not limited to, the method of treatment patient's prostate cancer, it comprises: use a kind of reagent to the patient, described reagent can suppress to have from 5 of the transcriptional regulatory district of male sex hormone regulatory gene (ARG) ' part with from least a biological activity of the gene fusion of 3 of ETS family member gene ' part.Described ARG can be TMPRSS2 or PSA.Described ETS family member gene can be ERG, ETV1 (ER81), FLI1, ETS1, ETS2, ELK1, ETV6 (TEL1), ETV7 (TEL2), GABP α, ELF1, ETV4 (E1AF; PEA3), ETV5 (ERM), ERF, PEA3/E1AF, PU.1, ESE1/ESX, SAP1 (ELK4), ETV3 (METS), EWS/FLI1, ESE1, ESE2 (ELF5), ESE3, PDEF, NET (ELK3; SAP2), NERF (ELF2) and FEV.The transcriptional regulatory district of ARG can comprise the promoter region of ARG.The promoter region of ARG can also comprise the androgen response element (ARE) of ARG.Described reagent can be small molecules, siRNA, antisense nucleic acid, or antibody.
In below the description and embodiment, provide other embodiment of the present invention.
Description of drawings
Fig. 1 has shown the cancer outlier analysis (COPA) of microarray data.(A) shown that ETV1 (left figure) and ERG (middle figure) from all specimen in 2 extensive gene expression research express (standardized ceneme).(B) except using data, with (A) from laser capture micro-dissections sample.(C) in checking multiple myeloma oncogene (FGFR3 and CCND1) to the known transposition of heavy chain immunoglobulin promotor (IgH), with (A).
Fig. 2 has shown the identification and the sign of middle TMPRSS2:ETV1 of prostate cancer (PCA) and TMPRSS2:ERG gene fusion.(A) by quantitative PCR (QPCR), the ERG (■) and ETV1 () mRNA that have analyzed transitivity (MET) prostate cancer tissue of prostate cancer cell line (DuCaP, LnCaP and VCaP) and hormone resistance express.(B) compare ETV1 exon 2 and 3 the forfeiture of cross expressing among the MET26 with the LNCaP cell.(C) rapid amplifying cDNA end (RLM-RACE) result schematic diagram of 5 ' RNA ligase enzyme of ETV1 among the MET26-LN and the ERG among MET28-LN mediation has disclosed the gene fusion with TMPRSS2.(D) the transposition specificity QPCR among use MET26-LN and the MET26-RP, checking TMPRSS2:ETV1 expresses.(E) the transposition specificity QPCR in use clone and the PCA sample, checking TMPRSS2:ERG expresses.
Interkinesis fluorescence in situ hybridization (FISH) on Fig. 3 has shown tissue slice formalin fixedization, paraffin-embedded, it has confirmed TMPRSS2:ETV1 gene fusion and ERG gene rearrangement.(A and B) shown double-colored fusion-signaling plan, to detect the fusion of TMPRSS2 (green) and ETV1 (danger signal).(C and D) uses double-colored division-signaling plan, with 2 probes of striding 5 of ERG ' (green) and 3 ' (danger signal) zone, detects ERG gene rearrangement.(E) use the probe identical with (A-D), the FISH result's of independent body's microarray matrix representation, described independent body microarray contain from the 13 examples core (core) of limitation prostate cancer (PCA) and 16 routine metastatic prostate cancers (MET) clinically.
Fig. 4 has shown the male sex hormone adjusting of ERG in the prostate cancer cell that carries the TMPRSS2:ERG transposition.
Fig. 5 has shown cancer outlier analysis (COPA).Fig. 5 A has shown the synoptic diagram that COPA analyzes.Fig. 5 B shows that RUNX1T1 (ETO) has higher assessment branch outlier in 90% acute myelogenous leukemia data sets (n=293) such as Valk.
Fig. 6 has shown rapid amplifying cDNA end (RLM-RACE) result schematic diagram of the RNA ligase enzyme mediation of ETV1 among the MET26-LN and the ERG among the PCA4, has disclosed the gene fusion (TMPRSS2:ERGb fusion) with TMPRSS2.
Fig. 7 has shown that crossing of ETS family member expressed in the prostate cancer.Use Oncomine, observed the tissue (A) that cuts from rough lumber or benign prostate, prostatic intraepithelial neoplasm by the isolating tissue of laser capture micro-dissections (B) and formed (PIN), the ETS family member's of all supervision in limitation prostate cancer and the metastatic prostate cancer expression clinically.
Fig. 8 has shown and has crossed that TMPRSS2 and crossing of ETV4 locus express in the cases for prostate cancer of expressing ETV4.A. at blended benign prostate tissue (CPP) but express ETV4 and be the prostate cancer of TMPRSS2:ERG male (PCA1-2) or negative (PCA3-4) and cross in the cases for prostate cancer (PCA5) of expressing the LCM group expression in the appointment exon of ETV4 or zone from our ETV4.B.RLM-RACE has disclosed among the PCA5 in the sequence of TMPRSS2 upstream and the fusion of ETV4.C. pass through QPCR, TMPRSS2:ETV4a and the TMPRSS2:ETV4b expression in PCA5.D. formalin fixedization, paraffin-embedded structural interkinesis fluorescence in situ hybridization confirmed the fusion of TMPRSS2 and ETV4 locus among the PCA5.
Fig. 9 has shown the mRNA sequence of exemplary ETS family gene.
Figure 10 has shown the mRNA sequence of TMPRSS2.
Figure 11 has shown the TMPRSS2:ERG gene fusion analysis of being undertaken by FISH.Figure A: this idiogram has been described and has been used for the tearing test that indirect detection TMPRSS2:ERG merges.Figure B: the interkinesis nucleus of stroma cell (left side) and prostate cancer gland (right side).Figure C: show interkinesis nucleus (amplification of 100x oil-immersion objective) by the fracture of losing indication of terminal centromeric probe and the prostate cancer gland deleted simultaneously.The enlarged view in picture frame district among the figure D.C, it demonstrates 2 and has the fracture of terminal centromeric probe and the nucleus of losing (amplification of 60x oil-immersion objective).
Figure 12 has shown the genomic deletion between ERG and TMPRSS2 on the karyomit(e) 21.Figure A:, characterized the sample TMPRSS2:ERG and the TMPRSS2:ETV1 state (grey bar represent feminine gender, and blue bar is represented positive) of (comprising 6 clones, 13 heterograft and 11 transitivity PCA samples) by qPCR and/or by FISH.The amplification of green frame box among the figure B:A.The amplification of black box box among the figure C:A.
Figure 13 has shown that the TMPRSS2:ERG in the limitation prostate cancer clinically resets related with the pathology parameters.Figure A., identifies TMPRSS2:ERG and resets just in the transitivity LN sample in the prohormone of 49.2% primary PCA sample and 41.2%.Figure B. has the TMPRSS2:ERG rearrangement tumour of disappearance and tend to find (p=0.03) in the PCA case with late tumor of higher per-cent.
Figure 14 has shown the ERG (centric) that is positioned at 21q22-23 and the known between the TMPRSS2 (telomeric).The direction of the gene on black line is 5 '-kinetochore to 3 '-terminal kinetochore, the direction of the gene below black line is 5 '-terminal kinetochore to 3 '-kinetochore.In lower part of image, the amplification of ERG locus has been described with the FISH probe.
Figure 15 shown that main demonstration has that the TMPRSS2:ERG of disappearance resets ' allos ' cases for prostate cancer (nucleus is on the right side) and showing not have the only small portion (nucleus is in the left side) of the TMPRSS2:ERG rearrangement that lacks.
Figure 16 has shown and has striden 8 disclosed expression array data collection, the meta-analysis of the gene between TMPRSS2 and ERG (meta-analysis).
Figure 17 shows that the FISH test can detect the feature disappearance relevant with the TMPRSS2:ERG gene fusion, and described TMPRSS2:ERG gene fusion is relevant with progression of disease.Figure A and B: for the ERG that analyzes on the karyomit(e) 21q22.2 resets, used the fracture probe system, it is made up of the BAC clone RP11-24A11 (finally puting together to produce danger signal) of vitamin H-14-dCTP mark and the BAC clone RP11-137J13 (finally puting together to produce green) of digoxigenin-dUTP mark, and the two strides the zone, contiguous kinetochore and the zone, terminal kinetochore of ERG locus respectively.Use this fracture probe system, the nucleus that does not have ERG to reset shows 2 pairs of redness arranged side by side and green.Redness-green arranged side by side forms the yellow signal (figure B, arrow) that merges.Figure C: in accumulation incidence regression model, TMPRSS2:ERG is evaluated as the determinative of accumulation incidence or transfer or prostate cancer-specificity death.
Figure 18 has shown that the FLI1 that does not merge transcript crosses expression.
Figure 19 has shown male sex hormone inducing ERG protein expression in the TMPRSS2-ERG+ cell.
Figure 20 has shown synoptic diagram endogenous and fusion ERG polypeptide.
Figure 21 has shown the nucleus interaction factor of ERG2.
Figure 22 has shown the sequence of peptide antibody and has produced at the aqua probe of ERG1.
Figure 23 has shown the sequence of peptide antibody and has produced at the aqua probe of ETV1.
Figure 24 has shown the sequence of peptide antibody and has produced at the aqua probe of FLI1.
Figure 25 has shown the sequence of peptide antibody and has produced at the aqua probe of ETV4.
Figure 26 has shown that crossing of ETV1 expressed and the male sex hormone adjusting in the LNCaP prostate cancer cell line.Figure 26 A has shown the presentation markup of gene in VCaP and LNCaP prostate cancer cell line of male sex hormone-adjusting.Figure 26 B has shown by male sex hormone inducing PSA in the VCaP of quantitative PCR (QPCR) confirmation and the LNCaP cell.Figure 26 C has shown male sex hormone inducing ETV1 in the LNCaP cell.Figure 26 D shows that ETV1 remarkable mistake in the LNCaP cell expressed.
Figure 27 has shown the rearrangement of ETV1 in the LNCaP cell.Figure 27 A has shown the synoptic diagram as the BAC of the probe of fluorescence in situ hybridization (FISH).Figure 27 B shows that RP11-124L22 and RP11-1149J13 co are on the karyomit(e) 7 of normal peripheral lymphocyte (NPL).Figure 27 C has shown BAC#1 and the location (last figure) of BAC#4 on distributing metaphase, and is measuring interkinesis cell (figure below) near in the tetraploid LNCaP clone.Figure 27 D shows, is positioned karyomit(e) 14 from the signal of RP11-124L22 in the LNCaP cell.
Figure 28 shows that whole ETV1 locus is inserted in the karyomit(e) 14 of LNCaP cell.Figure 28 A has shown the synoptic diagram of the BAC that uses in this experiment.Figure 28 B has shown RP11-124L22 (BAC#1) and the location (last figure) of RP11-313C20 (BAC#2) on distributing metaphase, and has measured interkinesis cell (figure below) by FISH in LNCaP clone.
Figure 29 has shown that the siRNA of ETV1 suppresses among the LnCaP.
Figure 30 has shown that the siRNA of ERG suppresses among the VCAP.
Figure 31 has shown the viral expression system of crossing.
Figure 32 has shown the synoptic diagram of transgenic mice.
Figure 33 has shown the detection of ERG and ETV1 transcript in the urine.Figure 33 A has shown the detection of ERG and ETV1 in LNCaP (high ETV1 expresses) or VCaP (high ERG and the TMPRSS2:ERG express) prostate cancer cell.Figure 33 B has shown the detection of ERG and ETV1 in the patient's who the suffers from prostate cancer under a cloud urine.
Figure 34 has shown the assay method of the TMPRSS2:ETS gene fusion that is used for detecting prostate cancer.Figure 34 A has shown the fracture assay method of TMPRSS2 and ERG.Shown that in left figure ERG resets male case (not disappearance), as a pair of division 5 ' and 3 ' signal is indicated.Shown that in right figure TMPRSS2 resets male case (disappearance is arranged), indicated as a 3 ' signal deletion.Figure 34 B has shown the fusion mensuration of TMPRSS2:ETV1 gene fusion.Figure 34 C has shown the fracture mensuration of ETV4.
Figure 35 has shown by the detected TMPRSS2 of FISH, ERG, ETV1 and ETV4 rearrangement.Figure 35 A has shown the table as a result of the rearrangement among TMPRSS2, ERG, ETV1 and the ETV4 that records by assay method shown in Figure 34.Figure 34 B has shown that wherein all 4 assay methods are described valuable as A from the thermal map of the TMPRSS2 of 38 cases, ERG, ETV1 and ETV4 state (heat map) expression.Figure 34 C has shown that having the thermal map that inconsistent TMPRSS2 and ETS reset the case of state represents.
Figure 36 has shown the sequence of gene fusion of the present invention.
Figure 37 has shown the primer and the probe of FLI-1 expression analysis.
Definition
For helping to understand the present invention, the below's many terms of definition and phrase:
As used herein, term " gene fusion " refers to mosaic gene group DNA, chimeric mRNA, the albumen of brachymemma or merge the chimeric protein that produces by at least a portion of at least a portion of first gene and second gene. Gene fusion not necessarily comprises the extron of whole gene or gene.
As used herein, term " transcriptional regulatory district " refers to the non-coding upstream regulatory sequence of gene, is also referred to as 5 ' untranslated region (5 ' UTR).
As used herein, term " androgen regulatory gene " refers to that its expression meeting is started or the gene of enhancing or the part of gene by androgen (for example, testosterone). The promoter region of androgen regulatory gene can contain and androgen or androgen signal transmission molecule (for example, downstream signal transmits molecule) interactional " androgen response element ".
As used herein, the general behavior of finding or distinguishing can be described in term " detection ", maybe can detect the specific observations of the composition of ground mark.
As used herein, term " at least a biologically active that suppressor merges " refers to, any agent by direct contact gene fusion albumen, contact gene fusion mRNA or genomic DNA, cause the gene fusion polypeptide conformation change, reduce gene fusion protein level or interference and signal transmission companion's gene fusion interaction and affect the expression of gene fusion target gene, reduce any activity (for example, including but not limited to activity described herein) of gene fusion of the present invention. Inhibitor comprises that also transmitting molecule by the blocking-up stream signal comes the bioactive molecule of indirect regulation gene fusion.
As used herein, term " siRNA " refers to short interfering rna. In some embodiment, siRNA comprises about 18-25 nucleotides long double helix or double-stranded region; Usually siRNA comprises about 2 to 4 unpaired nucleotides at 3 ' end of each chain. At least one chain of the double helix of siRNA or double-stranded region and target RNA molecule be homology or basically complementary basically. With the chain of target RNA complementary element be " antisense strand "; With the chain of described target RNA molecule homology be " sense strand ", and also complementary with the siRNA antisense strand. SiRNA also can comprise extra sequence; The non-limiting example of this class sequence comprises catenation sequence or ring and stem and other foldable structure. The as if effect of the vital intermediate of performance in the degraded of initiation sequence-specific RNA in causing the RNA interference and in the PTGS process plant in without vertebra or vertebrate of siRNA.
Term " RNA interference " or " RNAi " are meant the reticent or minimizing genetic expression by siRNAs.In animal and plant, it is by the sequence-specific of siRNA startup, the process of PTGS, and described siRNA is in its duplex zone gene order homology reticent with quilt.Described gene pairs organism can be endogenous or external source, exists or is present in the infectious vector that is not integrated in the genome to be integrated into intrachromosomal form.Described expression of gene is completely or partially suppressed.Also can consider to suppress the function of target RNA with RNAi; The function of target RNA can be completely or the part.
As used herein, term " carcinoma stage " refers to the qualitative or quantitative judgement of cancer progression level.The standard that is used for definite carcinoma stage includes but not limited to the size and the metastasis range (for example, local or distant place) of tumour.
As used herein, term " gene delivery system " refers to and will comprise any means of the delivery of composition of nucleotide sequence to cell or tissue.For example, gene delivery system includes but not limited to that carrier (for example, retrovirus delivery system, adenovirus delivery system, adeno-associated virus delivery system and other delivery system) based on nucleic acid, the microinjection of naked nucleic acid, based on the delivery system of polymkeric substance (for example, based on the system of liposome with based on the system of metallic particles), the biolistic injection, etc.As used herein, term " virogene delivery system " refers to, comprises to be used to promote the gene delivery system of sample to the viral element of the conveying of target cell or tissue (for example, intact virus, the virus of change and virus component be nucleic acid or albumen for example).As used herein, term " adenoviral gene delivery system " refers to, comprises the gene delivery system of the virus that belongs to the complete of Adenoviridae family or change.
As used herein, term " site-specific reorganization target sequence " refers to, the nucleotide sequence of the recognition sequence of recombinant factor and reorganization occurrence positions is provided.
As used herein, term " nucleic acid molecule " refers to contain arbitrarily the molecule of nucleic acid, includes but not limited to DNA or RNA.This term comprises the sequence of any known base analogue that contains DNA and RNA, described base analogue includes but not limited to the 4-acetylcytosine, 8-hydroxy-n 6-methyladenosine, the aziridinyl cytosine(Cyt), false iso-cytosine, 5-(carboxyl hydroxymethyl) uridylic, 5 FU 5 fluorouracil, 5-bromouracil, 5-carboxyl methylamino methyl-2-thiouracil, 5-carboxyl methylamino 6-Methyl Uracil, dihydrouracil, inosine, the N6-isopentenyl gland purine, the 1-methyladenine, 1-methyl pseudouracil, the 1-methyl guanine, the 1-methyl hypoxanthine nucleosides, 2, the 2-dimethylguanine, the 2-methyladenine, the 2-methyl guanine, the 3-methylcystein, 5-methylcytosine, the N6-methyladenine, the 7-methyl guanine, 5-methylamino 6-Methyl Uracil, 5-methoxyl group amino methyl-2-thiouracil, β-D-mannosylqueosine, 5 '-the methoxycarbonyl 6-Methyl Uracil, the 5-methoxyuracil, 2-methyl sulphur-N6-isopentenyl gland purine, uridylic-5-oxy acetic acid methyl ester, uridylic-5-fluoroacetic acid, oxybutoxosine, pseudouracil, queosine, 2-sulphur cytosine(Cyt), 5-methyl-2-thiouracil, the 2-thiouracil, the 4-thiouracil, methyl uracil, N-uridylic-5-oxy acetic acid methyl ester, uridylic-5-fluoroacetic acid, pseudouracil, queosine, 2-sulphur cytosine(Cyt) and 2,6-diaminopurine.
Term " gene " is meant and comprises the nucleic acid that is used to produce the necessary encoding sequence of polypeptide, precursor or RNA (for example, rRNA, tRNA) (for example, DNA) sequence.Polypeptide can be by any part coding of complete encoding sequence or described encoding sequence, as long as total length or the segmental activity of wanting or functional character (for example, enzymic activity, part associativity, signal conduction, immunogenicity etc.) are kept.Described term also comprise structure gene the coding region and with coding region 5 ' and 3 ' two sequences that end is adjacent, the arbitrary end of described sequence distance is approximately 1kb or longer, described like this gene is just corresponding to the length of full length mRNA.Be positioned at coding region 5 ' and the sequence that is present on the mRNA be known as 5 ' non-translated sequence.Be positioned at 3 ' or downstream, coding region and the sequence that is present on the mRNA be called 3 ' non-translated sequence.Term " gene " comprises the gene of cDNA and genome form.The genome form of gene or clone comprise the coding region of being interrupted by the non-coding sequence that is called " intron " or " transcribed spacer " or " intervening sequence ".Intron is the gene fragment that is transcribed into nRNA (hnRNA); Intron can contain for example enhanser of controlling element; Intron is removed from nucleus or primary transcript or " splicing is fallen "; Therefore intron does not exist in messenger RNA(mRNA) (mRNA) transcript.The function of mRNA is to determine the sequence or the amino-acid sequence of newborn polypeptide in translation process.
As used herein, term " heterologous gene " is meant and is not the gene that exists with its natural surroundings.For example, heterologous gene comprises the gene from species that imports in another species.Heterologous gene also comprises organism institute's inherent but the gene that changes in some modes (for example, through sudden change, add a plurality of copies, be connected to non-natural regulating and controlling sequence etc.).The difference of heterologous gene and native gene is that the heterologous gene sequence is connected on the dna sequence dna usually, described dna sequence dna be not with karyomit(e) in gene natural that be connected or with link to each other in the undiscovered chromosomal part of occurring in nature (for example, the gene of on the locus of the improper expression of gene, expressing).
As used herein, term " oligonucleotide " refers to the short length of strand polynucleotide chain.The length of oligonucleotide is usually less than 200 residues (for example, 15 to 100), and still, as used herein, this term also is intended to comprise longer polynucleotide chain.Oligonucleotide is represented through the length of using them always.For example, 24 residue oligonucleotide are called " 24-aggressiveness ".By oneself hybridization or by with other multi-nucleotide hybrid, oligonucleotide can form secondary and tertiary structure.Such structure can include but not limited to duplex, hair clip, cruciform, bending and triplex.
As used herein, term " complementary " or " complementation " are used to refer to the polynucleotide (being nucleotide sequence) that are associated by base pairing rules.For example, sequence " 5 '-A-G-T-3 ' " and sequence " 3 '-T-C-A-5 ' " complementation.Complementation can be " part ", and wherein only some nucleic acid base mates according to base pairing rules.Perhaps, can there be the complementation of " fully " or " all " between the nucleic acid.Complementary degree between the nucleic acid chains has great effect for the efficient and the intensity of nucleic acid chains intermolecular hybrid.This is at amplified reaction and depend in the bonded detection method between the nucleic acid particularly important.
Term " homology " is meant complementary degree.Can there be portion homologous or complete homology (promptly identical).Part complementary sequence is to suppress the nucleic acid molecule of complete complementary nucleic acid molecule and the hybridization of " homologous basically " target nucleic acid at least in part.The inhibition of the hybridization of complementary sequence and target sequence can be used hybridization assays (DNA or RNA trace, solution hybridization etc.) fully, checks under low preciseness condition.Under low preciseness condition, combine (i.e. the hybridization) of complete homologous nucleic acid molecule and target will be competed and suppress to homologous sequence or probe basically.This is not that low preciseness condition is the condition that allows non-specific binding; Low preciseness conditional request two sequences combination each other is the interaction of specificity (being selectivity).Second target that not existing of non-specific binding can be not complementary basically by using (as less than about 30% identity) is tested; When non-specific binding does not exist, probe will be not can with the second not complementary target hybridization.
When being used in reference to double-strandednucleic acid sequence such as cDNA or genomic clone, term " homology basically " be meant under low preciseness condition as indicated above can with any probes of one or two chain hybridization of described double-strandednucleic acid sequence.
Gene can produce multiple RNA, and they are that otherness montage by elementary rna transcription thing produces.CDNA as same gene splicing variant will contain the identical or complete homologous of sequence zone (representing a part that has same exon or same exon on two cDNA), and diverse zone (for example, represent to have exon " A " on the cDNA1, and cDNA2 contains exon " B ").Because two cDNA contain the identical zone of sequence, they all will with derived from complete genome or contain the probe hybridization of the Gene Partial that sees the sequence on two cDNA; Therefore these two splice variants are probe and homology basically therewith each other.
When being used in reference to the single-chain nucleic acid sequence, term " homology basically " be meant under low preciseness condition as indicated above can with any probe of described single-chain nucleic acid sequence hybridization (promptly being its complement).
As used herein, term " hybridization " is used to refer to the pairing of complementary nucleic acid.Hybridization and intensity for hybridization (being the bonding strength between the nucleic acid) are subjected to the T such as the hybridization chain of the preciseness of complementary degree between the nucleic acid, the condition that relates to, formation m, and nucleic acid in G: C the influence of factor such as compare.In its structure, comprise complementary nucleic acid paired individual molecule and be expressed as " hybridizing certainly ".
As used herein, term " preciseness " is used for carrying out relevant temperature, the ionic strength of nucleic acid hybridization and has compound such as the condition that has situation of organic solvent.Under " low preciseness condition ", the purpose nucleotide sequence will complement accurate with it, the sequence with single base mismatch, closely-related sequence (as have 90% or the sequence of higher homology) and the sequence sequence of 50-90% homology (as have) hybridization that portion homologous is only arranged.Under " middle preciseness condition ", the purpose nucleotide sequence will be only complement accurate, sequence and closely-related sequence with single base mismatch with it (as 90% or higher homology) hybridization.In high preciseness condition " under, the purpose nucleotide sequence will be only complement accurate and (depending on condition such as temperature) with it have the sequence hybridization of single base mismatch.In other words, under high preciseness condition, get rid of and hybridization with single base mismatch sequence thereby can improve temperature.
When " high preciseness condition " when being used in reference to nucleic acid hybridization, comprise the following condition that is equal to: by 5 * SSPE (43.8g/l NaCl, 6.9g/l NaH 2PO 4H 2O and 1.85g/l EDTA, pH is adjusted to 7.4 by NaOH), in the solution formed of 0.5%SDS, 5 * Denhardt ' s reagent and 100 μ g/ml sex change salmon sperm dnas in 42 ℃ of combinations or hybridization, then in the solution that comprises 0.1 * SSPE, 1.0%SDS in 42 ℃ of washings (if use is the probe of about 500 Nucleotide of length).
When " middle preciseness condition " when being used in reference to nucleic acid hybridization, comprise the following condition that is equal to: by 5 * SSPE (43.8g/l NaCl, 6.9g/l NaH 2PO 4H 2O and 1.85g/l EDTA, pH is adjusted to 7.4 by NaOH), in the solution formed of 0.5%SDS, 5 * Denhardt ' s reagent and 100 μ g/ml sex change salmon sperm dnas in 42 ℃ of combinations or hybridization, then in the solution that comprises 1.0 * SSPE, 1.0%SDS in 42 ℃ of washings (if use is the probe of about 500 Nucleotide of length).
" low preciseness condition " comprises the following condition that is equal to: by 5 * SSPE (43.8g/lNaCl, 6.9g/l NaH 2PO 4H 2O and 1.85g/l EDTA, pH is adjusted to 7.4 by NaOH), 0.1%SDS, 5 * Denhardt ' s reagent [the every 500ml of 50 * Denhardt ' s contains: 5gFicoll (model 400, Pharamcia), 5g BSA (fraction V; Sigma)] and in the solution formed of 100 μ g/ml sex change salmon sperm dnas in 42 ℃ of combinations or hybridization, then in the solution that comprises 5 * SSPE, 0.1%SDS in 42 ℃ of washings (if use is the probe of about 500 Nucleotide of length).
Well knownly adopt numerous condition of equivalent to constitute low preciseness condition; Can consider such as the length of probe and the character of character (DNA, RNA, based composition) and target (DNA, RNA, based composition, be present among the solution or fixed etc.) and salt and other component concentrations factors such as (whether), and can change hybridization solution and be different from generation but be equal to the above low rigorous hybridization conditions of listed condition as the existence of methane amide, T 500, polyoxyethylene glycol.In addition, the promotion known in this field condition of under high preciseness condition, hybridizing (as the temperature that improves hybridization and/or washing step, in hybridization solution, use methane amide etc.) (" preciseness " definition sees above).
As used herein, term " the amplification oligonucleotide " refer to target nucleic acid or the hybridization of its complement and participate in the oligonucleotide of nucleic acid amplification reaction.An example of amplification oligonucleotide is " primer " of hybridizing and contain the 3 ' OH end that is aggregated the enzyme extension in amplification procedure with template nucleic acid.Another example of amplification oligonucleotide be not aggregated enzyme extend (for example, because it has 3 ' blind end), but participate in or promote the oligonucleotide of amplification.The amplification oligonucleotide can randomly comprise the Nucleotide of modification or analogue or participate in amplified reaction, but not complementary or be included in other Nucleotide in the target nucleic acid with target nucleic acid.The amplification oligonucleotide can contain not and target thing or template sequence complementary sequence.For example, 5 ' zone of primer can comprise not and target nucleic acid complementary promoter sequence (being called " promotor-primer ").Skilled person in the art will appreciate that and the oligonucleotides-modified one-tenth of the amplification that plays the primer effect can be comprised 5 ' promoter sequence, thereby play promotor-primer.Similarly, by removing or the synthetic promoter sequence, can modify promotor-primer, and still play primer.The amplification oligonucleotide of 3 ' sealing can provide promoter sequence, and as polymerizing template (being called " promotor-supplier ").
As used herein, term " primer " refers to oligonucleotide, no matter be natural generation or synthetic production in the restriction digest of purifying, when placing under the condition of inducing synthetic and nucleic acid chains complementary primer extension product (promptly, Nucleotide and inductor are being arranged for example in the presence of the archaeal dna polymerase, and at suitable temperature and pH) time, it can be as the synthetic starting point.Described primer is strand preferably, realizing the maximum efficiency of amplification, but or can be double-stranded.If double-stranded, before being used to prepare extension products, handle described primer earlier to separate its chain.Preferably, described primer is an oligodeoxyribonucleotide.Described primer must sufficiently long, to cause inductor in the presence of synthesizing of extension products having.The definite length of primer depends on many factors, comprises temperature, primer source and using method.
As used herein, term " probe " refers to that oligonucleotide (promptly, nucleotide sequence), no matter be in the restriction digest of purifying natural generation or produce by reorganization or by pcr amplification is synthetic, its can with at least a portion hybridization of another target oligonucleotide.Probe can be strand or double-stranded.Probe is used for specific detection based on sequence, discriminating and separates.Predict any probe that can use in the present invention with " reporter molecules " mark arbitrarily, so that can detect in the detection system arbitrarily, include but not limited to enzyme (for example, ELISA and based on the Histochemistry of enzyme), fluorescence, radioactive and luminous system.The present invention is not intended to be limited to arbitrarily concrete detection system or mark.
When term " separation " when being used for nucleic acid, as in " isolating oligonucleotide " or " isolating polynucleotide ", be meant from least one component or impurity and identify and isolated nucleic acid sequences that described component or impurity combine in its natural origin with described nucleotide sequence usually.Isolating nucleic acid exists like this or exists in the found form of occurring in nature to be different from it.On the contrary, unsegregated nucleic acid is for example with the nucleic acid of found DNA of its naturally occurring state and RNA.For example, find that on host cell chromosome given dna sequence dna (for example, gene) and adjacent gene are approaching; The RNA sequence, the specific mRNA sequence of encode specific protein for example is to be found in the cell with a large amount of other a large amount of proteic mRNAs blended forms of encoding.Yet, the given proteic nucleic acid of separated coding comprises the described given proteic nucleic acid of common expression in cell that (by the mode of example) is such, wherein said nucleic acid is present on the chromosome position of the chromosome position that is different from n cell, or flank connects the nucleotide sequence of the nucleotide sequence that is different from natural discovery.Described isolating nucleic acid, oligonucleotide or polynucleotide can strand or double-stranded form existence.When using isolating nucleic acid, oligonucleotide or polynucleotide expressing protein, described oligonucleotide or polynucleotide comprise sense strand or coding strand (promptly at least, described oligonucleotide or polynucleotide can be strands), also can include justice and antisense strand (that is, described oligonucleotide or polynucleotide can be double-stranded) simultaneously.
As used herein, term " purifying " or " purifying " are meant removes component (as pollutent) from sample.For example, antibody can be by removing the NIg proteinoid depollute purifying; They also can be by removing the not purifying with target molecule bonded immunoglobulin (Ig).The removal of NIg proteinoid and/or not with the removal of target molecule bonded immunoglobulin (Ig) cause sample hit-per-cent of reactive immunoglobulin (Ig) increases.In another example, recombinant polypeptide is expressed in bacterial host cell, and by removing host cell proteins the described polypeptide of purifying; Improve the per-cent of recombinant polypeptide in the sample thus.
Detailed Description Of The Invention
The present invention is based on the discovery of recurrence gene fusion in prostate cancer.The invention provides diagnosis, research and methods of treatment, it can directly or indirectly detect or the described gene fusion of target.The present invention also provide be used to diagnose, the composition of research and therapeutic purpose.
I. gene fusion
The present invention identifies the recurrence gene fusion of indication prostate cancer.Described gene fusion is the result of the chromosome rearrangement of male sex hormone regulatory gene (ARG) and ETS family member gene.Although their recurrences, the joint of ARG and ETS family member gene fusion can change.Described gene fusion comprises usually from 5 of the transcriptional regulatory district of ARG ' part with from 3 ' part of ETS family member gene.Described recurrence gene fusion can be as the diagnostic flag and the clinical target thing of prostate cancer.
A. male sex hormone regulatory gene
The gene that male sex hormone is regulated is vital for the human prostate normal physiological function.They are also made contributions for the development of prostate cancer and progress.The ARG that identifies includes but not limited to: TMPRSS2; PSA; PSMA; KLK2; SNRK; Seladin-1; With, FKBP51 (Paoloni-Giacobino etc., Genomics 44:309 (1997); Velasco etc., Endocrinology145 (8): 3913 (2004)).More specifically, verifiedly compare with other health adult tissue, TMPRSS2 (NM_005656) expresses (Lin etc., CancerResearch 59:4180 (1999)) at the prostatic epithelium camber.The TMPRSS2 gene is positioned on the karyomit(e) 21.This gene is positioned at from pter 41,750,797-41,801,948 base pairs (totally 51,151 base pairs; Minus strand towards) the position.People TMPRSS2 protein sequence can be referring to GenBank registration number AAC51784 (Swiss Protein registration number 015393)), corresponding cDNA be GenBank registration number U75329 (also referring to, Paoloni-Giacobino, etc., Genomics 44:309 (1997)).
Coding region or the non-coding region of ARG can be contained in the transcriptional regulatory district of ARG, comprises promoter region.The promoter region of ARG can also contain the androgen response element (ARE) of ARG.More specifically, the promoter region of TMPRSS2 is provided at GenBank registration number AJ276404.
B.ETS family member gene
The transcription factor of ETS family is regulated the interior signal pipeline of cell that controlling gene is expressed.As downstream effect, they activate or inhibition particular target gene.As the upstream effector, they are responsible for the room and time of many growth factor receptorses and express.Identified this family near 30 members, and involve in many physiology and pathologic process.They include but not limited to: ERG; ETV1 (ER81); FLI1; ETS1; ETS2; ELK1; ETV6 (TEL1); ETV7 (TEL2); GABP α; ELF1; ETV4 (E1AF; PEA3); ETV5 (ERM); ERF; PEA3/E1AF; PU.1; ESE1/ESX; SAP1 (ELK4); ETV3 (METS); EWS/FLI1; ESE1; ESE2 (ELF5); ESE3; PDEF; NET (ELK3; SAP2); NERF (ELF2); And FEV.Exemplary ETS family member gene order as shown in Figure 9.
More specifically, verifiedly compare with other health adult tissue, ERG (NM_004449) expresses at the prostatic epithelium camber.The ERG gene is positioned on the karyomit(e) 21.This gene is positioned at from pter38, and 675,671-38, the position of 955,488 base pairs.The ERG gene is totally 279,817 base pairs; Minus strand towards.Corresponding ERG cDNA and protein sequence are seen GenBank registration number M17254 and GenBank registration number NP04440 (Swiss Protein registration number P11308) respectively.
The ETV1 gene is positioned at (GenBank registration number NC_000007.11 on the karyomit(e) 7; NC_086703.11; And NT_007819.15).This gene is positioned at from pter 13,708330-13, the position of 803,555 base pairs.The ETV1 gene is totally 95,225 base pairs; Minus strand towards.Corresponding ETV1cDNA and protein sequence are seen GenBank registration number NM_004956 and GenBank registration number NP_004947 (Swiss albumen registration number P50549) respectively.
People ETV4 gene is positioned at (GenBank registration number NC_000017.9 on the karyomit(e) 14; NT_010783.14; And NT_086880.1).This gene is positioned at from pter 38,960,740-38, the position of 979,228 base pairs.The ETV4 gene is totally 18,488 base pairs; Minus strand towards.Corresponding ETV4cDNA and protein sequence are seen GenBank registration number NM_001986 and GenBank registration number NP_01977 (Swiss albumen registration number P43268) respectively.
The C.ARG/ETS gene fusion
As mentioned above, the invention provides ARG and ETS family member gene Fusion.In Figure 36, provided exemplary gene fusion sequence.About all genes that relate to (TMPRSS2, ERG, ETV1 and ETV4), GenBank canonical sequence ID is provided, and has used in May, the 2004 set comparison exon of UCSC human genome.About all fusions that identifies, Figure 36 provides the complete sequence of passing the terminator codon of described fusion and ETS family member gene from the beginning of TMPRSS2 gene.The GenBank sequence of the preservation of each disclosed variant also is provided.Some TMPRSS2:ERG and TMPRSS2:ETV1 fusion are described by the breaking point exon of TMPRSS2 and ETS family member gene.For example, TMPRSS2:ERGa (it merges the exons 1 of TMPRSS2 and the exon 4-11 of ERG) is differentiated to be TMPRSS2:ERG (1,4).
ARG and ETS family member gene Fusion can be used as DNA, RNA or Protein Detection arrives.At first, the chromosome rearrangement that gene fusion can be used as genomic dna detects, and described colour solid is reset to have from the 5 ' part in the transcriptional regulatory district of ARG with from 3 ' part of ETS family member gene.After transcribing, described gene fusion can be used as chimeric mRNA and detects, and described chimeric mRNA has from 5 of the transcriptional regulatory district of ARG ' part with from 3 ' part of ETS family member gene.After the translation, described gene fusion can be used as following Protein Detection and arrives: the ETS family member albumen of the aminoterminal brachymemma that is produced by the transcriptional regulatory district of ARG and ETS family member gene fusion; Have from the aminoterminal part in the transcriptional regulatory district of ARG with from the chimeric protein of the carboxyl terminal part of ETS family member gene; Or unadjusted, but otherwise the natural ETS family member albumen that can not distinguish.The ETS family member albumen of brachymemma and the aminoacid sequence of chimeric protein, translation post-treatment and/or secondary, three grades or quaternary structure may be different from their native proteins separately.If exist, such difference can be used for the existence that sldh gene merges.Be described in more detail below concrete detection method.
In prostate cancer, some gene fusion is more common than other gene fusion.The present invention differentiates the prostate cancer of 50-80% for having the recurrence gene fusion of TMPRSS2 and ERG, ETV1, ETV4 or FLI1.Wherein, 50-70% is TMPRSS2-ERG, and 50%-60% wherein is derived from the karyomit(e) 21 disappearance (being described in more detail below) of genetic information between the TMPRSS2 and ERG locus, and 5-10% is TMPRSS2-ETV1,1-2% is TMPRSS2-ETV4, and 1-2% is TMPRSS2-FLI1.
The experiment of carrying out in the process of the present invention in exploitation shows that some fusion gene can be expressed the fusion transcript, and other fusion gene then can expressive function transcript (Tomlins etc., Science, 310:644-648 (2005); Tomlins etc., Cancer Research 66:3396-3400 (2006)).
Other experiment of carrying out in exploitation process of the present invention has identified at the significant genomic deletion between TMPRSS2 and the ERG on the karyomit(e) 21q22.2-3.In TMPRSS2:ERG fusion male PCA sample, observe disappearance.This disappearance appears at total zone, but shows variability in this zone.In (Hum.MoI.Genet.13:1303-13 (2004)) previously disclosed work such as Paris, the CGH analyzing and testing goes out the disappearance in the centric CTD-210307BAC of TMPRSS26kb.Observe these disappearances in PCA sample of limitation clinically 12.5% (9/72) and 33% (5/15) the transitivity PCA sample.These results have supported from when the SNP array data of its research, and show any PCA disappearance along with progress becomes more common, or disappearance more normal identifying in the PCA that tends to make progress more quickly.Homogeneity in the significant tumour of resetting in view of TMPRSS2:ERG, these molecular isoforms more may be made progress feature with various disease and be associated.
Estimated 118 limitation PCA cases clinically, wherein 49.2% has the ERG rearrangement.These TMPRSS2:ERG 60.3% merge in the male case, observe disappearance in the gene.The PCA sample that nearly all remarkable mistake is expressed ERG has rearrangement, and described the expression excessively occurs in and reset in the case of roughly the same number.Use Oncomine (the gene expression data summary that can openly obtain), identify 4 genes of regulating significantly down, they are positioned at common deletion segment zone (Figure 16).
The invention is not restricted to specific mechanism.In fact, the understanding to mechanism is not that enforcement is essential to the invention.Even so, the result shows, can reset to determine by TMPRSS2:ERG near the PCA of half.Most of such tumours show disappearance in the gene, and their size is variable according to oligonucleotide SNP array gene group analysis.But about 30-40% does not show disappearance, thereby may have the balanced translocation of TMRPSS2 and ERG.In range of loss this variability may with use the observed progression of disease of CML relevant.This research has identified remarkable clinical related with tumour stage and lymphoglandula state.The tumour with disappearance that TMPRSS2:ERG resets also shows the trend to higher PSA biological chemistry failure rate.
Other experiment of carrying out in exploitation process of the present invention based on the existence of TMPRSS2:ERG gene fusion in the early prostate cancer warning wait group of long term follow-up, has been probed into the risk that transfer or prostatic cancer specific death take place.Use 92 cases, assessed the frequency of TMPRSS2:ERG gene fusion.Should be 15.2% (14/92) based on the frequency of TMPRSS2:ERG gene fusion in the group of colony, be lower than observed 50% frequency in 2 groups based on hospital.The invention is not restricted to specific mechanism.In fact, the understanding to mechanism is not that enforcement is essential to the invention.Even so, the difference of this TMPRSS2:ERG gene fusion prostate cancer may be owing to the hereditary difference of race and ethnic group.Compare with other research based on non-colony, the late case of lower per-cent also can be explained these differences in this warning wait group.
(P=0.004,95% fiducial interval=1.5-8.9) are observed the remarkable association between the development of TMPRSS2:ERG gene fusion and distant metastasis and prostatic cancer specific death to accumulation incidence with 3.6.These data show that TMPRSS2:ERG gene fusion prostate cancer has higher invasive phenotype.Other experiment shows, the genomic deletion in the TMPRSS2:ERG gene fusion relevant with late period and/or metastatic prostate cancer (referring to for example, embodiment 5).
The present invention is also verified, and male sex hormone can induce crossing of ERG to express in the TMPRSS2-ERG positive cell line, and inferring is to pass through ARE.The invention is not restricted to specific mechanism.In fact, the understanding to mechanism is not that enforcement is essential to the invention.Even so, the result shows that together the ARE imbalance ETS family active by the TMPRSS2 upstream can drive the prostate cancer development.
Predict, stage, aggressive or the progress of the existence of gene fusion expression, molecular isoform or amount and disease or the existence or the risk that shift are relevant.Also predict, the recurrence gene fusion that similarly relates to ETS family member gene occurs in other epithelial cancer.
II. antibody
Gene fusion albumen of the present invention comprises its fragment, derivative and analogue, can produce antibody as immunogen, and it can be used for following diagnosis, research and methods of treatment.Antibody can be polyclone or monoclonal, chimeric, the peopleization, strand or Fab fragment.The known different methods of those of ordinary skills can be used to produce antibody and the fragment such with mark.Referring to, for example, Burns, ed., Immunochemical Protocols, the 3rd edition, Humana Press (2005); Harlow and Lane, Antibodies:A LaboratoryManual, Cold Spring Harbor Laboratory (1988); Kozbor etc., Immunology Today 4:72 (1983);
Figure A20068004182600271
And Milstein, Nature 256:495 (1975).It is particularly preferred utilizing the ETS family member albumen of brachymemma or the antibody or the fragment of the difference between chimeric protein and their native proteins separately.
III. diagnostic uses
The invention provides based on DNA, RNA and proteic diagnostic method, it can directly or indirectly detect gene fusion.The present invention also provides composition and the test kit that is used for diagnostic purpose.
Diagnostic method of the present invention can be qualitatively or quantitative.Quantitative diagnostic method can be used for, and for example, by cutoff or threshold level, distinguishes painless and invasive cancer.Work as where applicable, qualitative or quantitative Diagnosis method also can comprise the amplification of target thing, signal or intermediate (for example, universal primer).
Rough determination can confirm the existence of gene fusion, but can not differentiate that described specificity merges.If desired, carry out second mensuration then, determine the consistence of specific fusion.Second mensuration can be used the detection technique different with rough determination.
Gene fusion of the present invention can detect with multichannel or grid (panel) form with other mark.Individually or with the combined ground of gene fusion, the predictive value of selective marker.Exemplary prostate cancer markers includes but not limited to: AMACR/P504S (U.S. Patent number 6,262,245); PCA3 (U.S. Patent number 7,008,765); PCGEM1 (U.S. Patent number 6,828,429); Prostein/P501S, P503S, P504S, P509S, P510S, prostase/P703P, P710P (US publication 20030185830); With, at U.S. Patent number 5,854,206 and 6,034,218 and US publication 20030175736 in those disclosed, they are whole in this article separately incorporated by reference.Also predict, in multichannel or grid form, comprise the mark of other cancer, disease, interference and metabolic disorder.
With reference to stage, infectivity or progress or the existence of transfer or the data that risk be associated of specific gene fusion, also can revise diagnostic method of the present invention with disease.At last, by the information that method of the present invention provides, can assist the doctor to select for particular patient best course of treatment.
A. sample
The method according to this invention can be tested any patient's sample that contains described gene fusion under a cloud.As limiting examples, sample can be tissue (for example, biopsy of prostate's sample or the tissue sample that obtains by prostatectomy), blood, urine, seminal fluid, prostatic secretion or its fraction (for example, blood plasma, serum, urine supernatant liquor, urine cell precipitation or prostatic cell).Urine samples is preferably collected behind careful digital rectal examination (DRE) immediately, and described digital rectal examination can cause prostatic cell from the prostate gland into urethra that comes off.
Patient's sample needs roughing usually, its objective is to gene fusion or contains the cellular segregation or the enriched sample of described gene fusion.The known many technology of those of ordinary skills can be used for this purpose, include but not limited to: centrifugal; Immunocapture; Lysis; Catch with, nucleic acid target material (referring to, for example, the EP patent No. 1409727, whole in this article incorporated by reference).
B.DNA and RNA detect
Use the known many nucleic acid technology of those of ordinary skills, include but not limited to: nucleic acid sequencing; Nucleic acid hybridization; With, nucleic acid amplification can be the chromosome rearrangement of genomic dna or chimeric mRNA with gene fusion detection of the present invention.
1. order-checking
The explanatory limiting examples of nucleic acid sequencing technology includes but not limited to chain terminator (Sanger) order-checking and the order-checking of dyestuff terminator.Those of ordinary skills will appreciate that, because RNA is more unstable in cell, and more are subject to the nuclease attack in experiment, before order-checking the RNA reverse transcription are become DNA usually.
The chain terminator order-checking uses sequence-specific synthesis reaction of DNA to stop, and wherein uses the Nucleotide substrate of modifying.Specificity site on template DNA begins to extend, and wherein uses the Oligonucleolide primers of lacking radioactive or other mark in this zone with the template complementary.Use the 4 kinds of deoxynucleotide bases of archaeal dna polymerase, standard and the strand terminating nucleotide (modal is di-deoxynucleoside acid) of lower concentration, extend Oligonucleolide primers.This is reflected in 4 test tubes that separate and repeats, and every kind of base is in turn as di-deoxynucleoside acid.Archaeal dna polymerase mixes the limited of chain termination nucleotide, causes a series of relevant dna fragmentations, and they only stop in the position of using specific di-deoxynucleoside acid.About each reaction tube, by electrophoresis, isolated fragment by size in the kapillary of dull and stereotyped polyacrylamide gel or filling sticky polymers.Along with from of the scanning of gel top,, measure sequence by reading the visable indicia of which swimming lane generation from the primer of mark to the bottom.
Perhaps, the order-checking of dyestuff terminator can the mark terminator.By being used in every kind of di-deoxynucleoside acid of the fluorescigenic fluorochrome label that separates of different wave length chain-terminator, can in single reaction, check order fully.
2. hybridization
The explanatory limiting examples of nucleic acid hybridization technique includes but not limited in situ hybridization (ISH), microarray and DNA or RNA trace.
In situ hybridization (ISH) is class hybridization, complementary DNA of its applying marking or RNA chain are as probe, come the part of position tissue or specific DNA or the RNA sequence (original position) in the section, if described tissue is enough little, then whole tissue (whole mount ISH).DNA ISH can be used to measure chromosomal structure.RNA ISH is used to measure and be positioned at tissue slice or interior mRNA and other transcript of whole mount.Often handle sample cell and tissue, with the position of fixed target transcript with increase the approaching of probe.Probe is at high temperature hybridized with target sequence, washes unnecessary probe then off.Use radioautography, fluorescent microscopy or immunohistochemistry respectively, in tissue the location and quantitatively with radioactivity-, fluorescence-or the probe of the base mark of antigen-mark.ISH also can use 2 kinds or multiple probe with radioactivity or other non-radioactive marker's mark, to detect 2 kinds or multiple transcript simultaneously.
2.1 FISH
In some embodiment, use fluorescence in situ hybridization (FISH), detect fusion sequence.Preferred FISH assay method of the present invention is used bacterial artificial chromosome (BAC).They have been widely used for people's gene group order-checking project (seeing Nature 409:953-958 (2001)), and the clone who contains particular B AC can obtain from the dealer, and they can find the address by many approach, for example, and NCBI.Each BAC clone from the people's gene group has provided one with reference to name, and this can discern it clearly.These titles can be used to find corresponding GenBank sequence and order clone's copy from the dealer.
In some embodiment, described detection assay is that FISH measures, and it uses the probe (for example, bac RP11-692L4) of ETV1, one group of probe of c-ERG:t-ERG fracture (for example, bac RP11-24A11 and as the probe of t-ERG RP11-372017 or RP11-137J13).In other embodiments, by with one group of probe test ETV1 disappearance or amplification, carry out described FISH and measure, one of them probe (is for example striden the ETV1 locus, bac RP11-692L4), another probe and karyomit(e) 7 hybridization (for example, the probe on chromosomal kinetochore).In other embodiments, by with one group of probe test ERG disappearance or amplification, carry out described method, one of them probe is striden ERG locus (for example, bac RP11-476D17), and one with reference to probe (for example, PR11-32L6 on karyomit(e) 21; RP11-752M23; RP11-1107H21; RP11-639A7 or RP11-1077M21).In other embodiments, by with one group of probe test TMPRSS2 disappearance/amplification, carry out described method, one of them probe is striden TMPRSS2 (for example, RP11-121A5; RP11-120C17; PR11-814F13; Or RR11-535H11) locus, one with reference to probe (for example, PR11-32L6 on karyomit(e) 21; RP11-752M23; RP11-1107H21; RP11-639A7 or RP11-1077M21).In some embodiment, described method also comprises use and is selected from following probe hybridization: include but not limited to RP11-121A5; RP11-120C17; PR11-814F13; And RR11-535H11.
The present invention also provides and has carried out the FISH method for measuring on human prostate cell, the human prostate tissue or on the liquid around described human prostate cell or the human prostate tissue, in some embodiment, described mensuration comprises a hybridization step, it uses and is selected from following probe: include but not limited to RP11-372017; RP11-137J13; RP11-692L4; RP11-476D17; PR11-32L6; RP11-752M23; RP11-1107H21; RP11-639A7; RP11-1077M21; RP11-121A5; RP11-120C17; PR11-814F13; And RR11-535H11.
The concrete BAC clone of FISH method that can be used for detecting the rearrangement that the present invention relates to is as follows:
● merge in order to test ETV1-TMPRSS2, can use a probe and a probe of striding the TMPRSS2 locus of striding ETV1:
The BAC:RP11-692L4 of ETV1
The BAC:RP11-121A5 of TMPRSS2, (RP11-120C17, PR11-814F13, RR11-535H11)
● the ERG transposition is tested in the probe set with the c-ERG:t-ERG fracture:
The BAC:RP11-24A11 of c-ERG
The BAC:RP11-372017 of t-ERG, RP11-137J13
● with probe set test ETV1 disappearance/amplification, stride the ETV1 locus for one, one with reference to probe on karyomit(e) 7:
The BAC:RP11-692L4 of ETV1
With probe set test ERG disappearance/amplification, stride the ERG locus for one, one with reference to probe on karyomit(e) 21:
The BAC:RP11-476D17 of ERG
BAC:* on karyomit(e) 21 with reference to probe
● with probe set test TMPRSS2 disappearance/amplification, stride the TMPRSS2 locus for one, one with reference to probe on karyomit(e) 21:
The BAC:RP11-121A5 of TMPRSS2, (RP11-120C17, PR11-814F13, RR11-535H11)
BAC:PR11-32L6 on karyomit(e) 21 with reference to probe, RP11-752M23, RP11-1107H21, RP11-639A7, (RP11-1077M21).
The most preferably probe that is used to detect the deletion mutantion that causes the fusion between TMPRSS2 and the ERG is RP11-24A11 and RP11-137J13.These probes or above-mentioned those come mark with suitable fluorescent mark or other mark, are used for hybridization then.Embodiment provided herein has partly illustrated the concrete grammar that can effectively measure disappearance, but those of skill in the art will recognize that many variants of this mensuration also can use equally well.Concrete grammar is well-known in the art, and can easily be applicable to the present invention.About the guide of method, can obtain from many documents, comprising: In situ Hybridization:Medical Applications(editor G.R.Coulton and J.de Belleroche), Kluwer Academic Publishers, Boston (1992); In situ Hybridization:In Neurobiology; Advances In Methodology(editor J.H.Eberwine, K.L.Valentino, and J.D.Barchas), Oxford University Press Inc., England (1994); In situ Hybridization:A Practical Approach(editor D.G.Wilkinson), Oxford University Press Inc., England (1992)); Kuo, etc., Am.J.Hum.Genet.42:112-119 (1991); Klinger, etc., Am.J.Hum.Genet.51:55-65 (1992); And Ward, etc., Am.J.Hum.Genet.52:854-865 (1993)).Also can commercially obtain test kit, they provide carries out FISH method for measuring (can be from for example, Oncor, Inc., Gaithersburg, MD obtains).Provide the patent of Methods Instruction to comprise United States Patent (USP) 5,225,326; 5,545,524; 6,121,489 and 6,573,043.All these documents are all whole in this article incorporated by reference, and the information that can partly provide with similar document and this paper embodiment of this area uses, and set up the operation steps that special laboratory is suitable for.
Following table 13 has shown can be as other BAC clone of FISH probe.
Table 13
Figure A20068004182600321
2.2 microarray
Dissimilar bioassay methods are known as microarray, include but not limited to: dna microarray (for example, cDNA microarray and oligonucleotide microarray); Arrays of immobilized protein; Micro-array tissue; Transfection or cell microarray; The chemical compound microarray; With, the antibody microarray.The so-called gene chip of dna microarray, DNA chip or biochip, be to be attached to the set that solid surface (for example glass, plastics or silicon) is gone up the microcosmic southern blotting technique that forms array, the purpose of the array of described formation is to describe to express or monitor simultaneously thousands of expression of gene levels.The fixed dna fragmentation is called probe, and thousands of probes can be used in the single DNA microarray.Microarray can be used for the genetic expression by contrast disease and normal cell, identifying disease gene.Microarray can use many technology to assemble, and includes but not limited to: apicule needle is printed onto on the slide glass; Use the photolithography of prefabricated shade; Use the photolithography of dynamic micro-mirror device; Spray ink Printing; Or the electrochemistry on microelectrode array.
DNA and RNA trace are respectively applied for and detect specific DNA or RNA sequence.Broken DNA or RNA from sample extraction, electrophoretic separation on matrix gel, and transfer on the membrane filter.Filter bonded DNA or RNA are hybridized, wherein use probe with target sequence complementary mark.Detection is attached to the probe of the hybridization on the filter.The variant of this operation is the RNA trace of counter-rotating, and the substrate nucleic acid that wherein is fixed on the film is the segmental set of separated DNA, and probe is the RNA from tissue extraction and mark.
3. amplification
Can be before detecting or simultaneously, the chromosome rearrangement of amplifying genom DNA and chimeric mRNA.The indicative limiting examples of nucleic acid amplification technologies includes but not limited to polymerase chain reaction (PCR), inverse transcription polymerase chain reaction (RT-PCR), the amplification of transcribing-mediating (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA) and based on the amplification (NASBA) of nucleotide sequence.Those of ordinary skills will appreciate that, some amplification technique (for example, PCR) need be before amplification becomes the RNA reverse transcription DNA (for example, RT-PCR), and the direct cloning RNA of other amplification technique (for example, TMA and NASBA).
Polymerase chain reaction (U.S. Patent number 4,683,195,4,683,202,4,800,159 and 4,965,188, they are whole in this article separately incorporated by reference) so-called PCR, use a plurality of sex change, primer to being annealed into the circulation of opposite strand and primer extension, increase the copy number of target nucleic acid sequence with index.In being called the variant of RT-PCR, ThermoScript II (RT) is used for preparing complementary DNA (cDNA) from mRNA, then by pcr amplification cDNA, produces a plurality of DNA copies.For other different conversion of PCR, referring to for example, U.S. Patent number 4,683,195,4,683,202 and 4,800,159; Mullis etc., Meth.Enzymol.155:335 (1987); With, Murakawa etc., DNA 7:287 (1988), they are whole in this article separately incorporated by reference.
The amplification of transcriptive intermediate (U.S. Patent number 5,480,784 and 5,399,491, they are whole in this article separately incorporated by reference) so-called TMA, meeting autocatalysis ground under temperature, ionic strength and the pH condition of substantially constant synthesize a plurality of copies of target nucleic acid sequence, and wherein a plurality of RNA copy autocatalysis ground of target sequence produces other copies.Referring to, for example, U.S. Patent number 5,399,491 and 5,824,518, they are whole in this article separately incorporated by reference.In the described variant of US publication 20060046265 (whole in this article incorporated by reference), TMA randomly comprises use enclosure portion, dwell section and other modification part, to improve TMA process sensitivity and accuracy.
Ligase chain reaction (Weiss, R., Science 254:1292 (1991), whole in this article incorporated by reference) so-called LCR, use 2 groups of complementary DNA oligonucleotide of hybridizing with the adjacent domain of target nucleic acid.In thermally denature, hybridization and the recirculation that is connected, the covalently bound DNA oligonucleotide of dna ligase generates the oligonucleotide product of the connection of detectable two strands.
Strand displacement amplification (Walker, G. etc., Proc.Natl.Acad.Sci.USA 89:392-396 (1992); U.S. Patent number 5,270,184 and 5,455,166, they are whole in this article separately incorporated by reference) so-called SDA, use following circulation: with primer sequence to being annealed into the opposite strand of target sequence, carry out primer extension having in the presence of the dNTP α S, produce the primer extension product of double-stranded half thiophosphoric acidization, the restriction endonuclease recognition site that the cutting of endonuclease-mediation half is modified, and the primer extension from 3 of otch ' end of polysaccharase-mediation, be used for the next round primer annealing to replace existing chain and generation, the chain of cutting and strand displacement causes how much amplifications of product.Thermophilic SDA (tSDA) uses thermophilic endonuclease and polysaccharase (the EP patent No. 0684315) with substantially the same method under higher temperature.
Other amplification method comprises, for example: based on the amplification (U.S. Patent number 5,130,238, whole in this article incorporated by reference) of nucleotide sequence, so-called NASBA; Use the rna replicon enzyme to come the amplification method (Lizardi etc., BioTechnol.6:1197 (1988), whole in this article incorporated by reference) of amplification probe molecule self, so-called Q β replicative enzyme; Based on the amplification method of transcribing (Kwoh etc., Proc.Natl.Acad.Sci.USA 86:1173 (1989)); With, self-sustained sequence replicating (they are whole in this article separately incorporated by reference for Guatelli etc., Proc.Natl.Acad.Sci.USA 87:1874 (1990)).Further discussion about known amplification method, referring to Persing, David H., " In Vitro Nucleic AcidAmplification Techniques " in Diagnostic Medical Microbiology:Principlesa and Applications (Persing etc., Eds.), pp.51-87 (American Society for Microbiology, Washington, DC (1993)).
4. detection method
By any conventional mode, can detect gene fusion nucleic acid not amplification or amplification.For example, the heterozygote by producing with probe hybridization that can detect ground mark and measurement can detect gene fusion.The indicative limiting examples of detection method is described below.
A kind of indicative detection method hybridization protection assay (HPA) comprises; (for example make chemiluminescent oligonucleotide probe; (AE) probe of acridinium ester-mark) with target sequence hybridization; the chemiluminescent mark that exists on the probe that hydrolysis is not hybridized and in photometer, measure the chemoluminescence that produces from the residue probe optionally.Referring to, for example, U.S. Patent number 5,283,174 and NormanC.Nelson etc., Nonisotopic Probing, Blotting, and Sequencing, ch.17 (they are whole in this article separately incorporated by reference for Larry J.Kricka ed., the 2nd edition .1995).
Another kind of indicative detection method provides the real-time quantitative evaluation of amplification procedure." in real time " of amplification procedure estimated and comprised, in the amplified reaction process, and the amount of amplicon and use measured value to come the amount of the initial target sequence that exists in the calculation sample in the assaying reaction mixture continuously or regularly.Many methods based on the amount of the primary target sequence that exists in the real-time amplification assay sample are well-known in the art.They comprise, at U.S. Patent number 6,303, and disclosed method in 305 and 6,541,205, they are whole in this article separately incorporated by reference.In the whole in this article U.S. Patent number incorporated by reference 5,710,029, the non-method based on real-time amplification of the amount of the initial target sequence that exists in the another kind of working sample is disclosed.
Multiple by using from hybridization probe (major part wherein has stem-ring structure), can detect amplified production in real time.Mark such from hybridization probe, make they by with the hybridization of target sequence, launch different detectable signals, this depends on that probe is at hybridization state or the state that changes certainly.As limiting examples, " molecule torch " is that a class is from hybridization probe, it comprises from complementary different zones (being called " the target thing is in conjunction with the territory " and " target thing closed domain "), these zones by the joining region (for example, the non-nucleotide connector) link to each other, and hybridization each other under predetermined hybridization assays condition.In a preferred embodiment, the molecule torch contains strand base district at the target thing in conjunction with the territory, and its length is about 20 bases of 1-, and easily is amplified the target sequence hybridization that exists in the reaction under the strand displacement condition.Under the strand displacement condition, help the hybridization in 2 of the molecule torch complementary districts (they can be complementary) wholly or in part, exception is to have in the presence of the target sequence, and described target sequence can be in conjunction with the target thing in conjunction with the strand district that exists in the territory, and all or part of of displacement target thing closed domain.The target thing of molecule torch (for example comprises certification mark or a pair of interaction mark in conjunction with territory and target thing closed domain, luminous/cancellation), they are placed to, signal when the generation when hybridizing of molecule torch is different from molecule torch and target sequence hybridization, thereby allow in the presence of the molecule torch that not hybridization is arranged the probe in the test experience sample: target thing duplex.In the whole in this article U.S. Patent number incorporated by reference 6,534,274, the interaction mark that discloses molecule torch and many types is right.
Another example that has from complementary detection probes is " molecular beacon ".Molecular beacon comprises the nucleic acid molecule with following content: a target thing complementary sequence, under the situation of the target sequence that in not having amplified reaction, exists, probe is remained on sealing one of conformation, and affine to be in when sealing conformation an interactional mark right to (or nucleic acid arm) with when probe.The hybridization of target sequence and target thing complementary sequence can separate affine right member, thereby convert probe to open conformation.Because the interaction of the right minimizing of mark is detectable to the conversion of opening conformation, described mark be to can being, for example, and fluorophore and cancellation group (for example, DABCYL and EDANS).Molecular beacon is disclosed in U.S. Patent number 5,925, and 517 and 6,150,097, it is whole in this article incorporated by reference.
Other is that those of ordinary skills are well-known from hybridization probe.As limiting examples, the probe with interaction mark is in conjunction with right, and for example at U.S. Patent number 5,928, those disclosed in 862 (whole in this article incorporated by reference) goes among the present invention.The probe system that is used to detect single nucleotide polymorphism (SNP) also can be used for the present invention.Other detection system comprises " molecular switch ", and it is disclosed in the whole herein US publication incorporated by reference 20050042638.Other probe for example comprises the probe of intercalating dye and/or fluorescence dye, also can be used for the detection of amplified production of the present invention.Referring to, for example, U.S. Patent number 5,814,447 (whole in this article incorporated by reference).
C. Protein Detection
Use the known multiple protein technology of those of ordinary skills, include but not limited to: protein sequencing; With, immunoassay can be the ETS family member albumen or the chimeric protein of brachymemma with gene fusion detection of the present invention.
1. order-checking
The indicative limiting examples of protein sequencing technology includes but not limited to mass spectroscopy and edman degradation.
The mass spectroscopy arbitrarily albumen of size that can check order in principle, but along with the increase of size, becoming more is difficult to calculate.Use the endo-protease digestible protein, make the solution that obtains pass the high pressure liquid chromatography post.At the end of this post, solution advances mass spectrograph from the narrow nozzle ejection with high positive potential.Electric charge on the droplet makes their fragmentations, up to only keeping single ion.Fragmented peptide is measured segmental mass-to-charge ratio then.By the computer for analysis mass spectrum, and often compare, so that definite fragments sequence with the proteic database of order-checking in the past.Repeat this process with different digestive ferments then, the lap in the sequence is used to make up proteic sequence.
In edman degradation reaction, peptide to be checked order is adsorbed onto on the solid surface (for example, with 1,5-dimethyl-1,5-phenodiazine 11 methylene radical gather the glass fibre of Methobromide bag quilt).The alkalescence buffer solution of edman's reagent thiocarbanil (PTC) with 12% Trimethylamine added in the peptide of absorption, with the amino reaction of-terminal amino acid.Then can be by adding anhydrous acid, optionally desorption terminal amino group acid derivative.The derivative isomerization forms the phenylthiohydantoin that replaces, and they can be washed off, and differentiates by chromatogram, can repeat this circulation.The efficient of each step is about 98%, and this allows to measure reliably about 50 seed amino acids.
2. immunoassay
The indicative limiting examples of immunoassay includes but not limited to: immunoprecipitation; Western blot; ELISA; Immunohistochemistry; Immunocytochemistry; Flow cytometry; With, immunity-PCR.The known multiple technologies of use those of ordinary skills (for example, colorimetry, fluorescence, chemiluminescent or radioactive) can detect ground mark polyclone or monoclonal antibody, be applicable in the immunoassay.
Immunoprecipitation is to use the specific antibody of antigen is settled out antigenic technology from solution.This method can be considered to be in albumen in the mixture by target, is used for differentiating the albumen composition that exists at cell extract.Can from solution, extract mixture from insoluble antibody-conjugated protein (for example albumin A and the Protein G) of bacterium initial separation.Also can be to the agarose pearl with antibody coupling, described pearl can easily separate from solution.After the washing, other method of the component in the discriminating mixture of use mass spectroscopy, Western blot or any amount can be analyzed precipitation.
Western blot or immunoblotting are a kind of proteic methods that detects in given tissue homogenate or the extract sample.It uses the next albumen according to the mass separation sex change of gel electrophoresis.Then albumen is migrated out gel, forward on the film (normally poly-difluoroethylene or nitrocellulose), here use the specific antibody of target protein is surveyed them.As a result, the researchist can check proteic amount in the given sample, and contrasts the level between several groups.
ELISA is the abbreviation of enzyme-linked immunosorbent assay, is a kind of biochemical technology that detects antibody or the existence of antigen in sample.It uses minimum 2 kinds of antibody, and a kind of is specific to antigen, and another kind is coupled on the enzyme.Second kind of antibody can cause substrate color development or fluorescigenic to produce signal.The variant of ELISA comprises sandwich ELISA, competitive ELISA and ELISPOT.Because can carry out the existence that ELISA comes antigenic existence in the assess sample or antibody, it is the useful tool of measuring serum antibody concentration and detecting antigenic existence.
Immunohistochemistry and immunocytochemistry are meant, by the principle of the antigen in tissue or the cell in conjunction with their antibody separately, distinguish the proteic method in position tissue section or the cell.By coming traget antibody, can realize visual with producing color marker or fluorescent mark.The representative instance of color mark includes but not limited to horseradish peroxidase and alkaline phosphatase.The representative instance of fluorophore mark includes but not limited to fluorescein isothiocyanate (FITC) or phycoerythrin (PE).
Flow cytometry is the technology that a kind of counting, inspection and sorting are suspended in the microscopic particles in the fluid stream.It allows while multiparameter ground analysis stream to cross the single celled physics and/or the chemical feature of light/electrical detection device.The light beam of single-frequency or color (for example, laser) points to the liquid flow that ydrodynamics is concentrated.Many detectors are concentrated one's gaze on fluid and are passed light beam; One and light beam (forward scatter or FSC) on a line, several vertical with it (lateral scattering (SSC) and one or more fluorimetric detectors).Each suspended particle that passes beam divergence can be with some mode scattered light, and the fluorescent chemicals in the particle can be stimulated, and is luminous with the frequency lower than light source.Detect the combination of scattered light and fluorescence by detector, and, can reason out the different facts about each particulate physics and chemical structure by analyzing the fluctuation of locating brightness at each detector (the corresponding fluorescence emission peak of detector).FSC is relevant with cell volume, SSC relevant with particulate density or inner complicacy (for example, the shape of nuclear, the quantity of cytoplasmic granule and type, or film roughness).
Immunity-polymerase chain reaction (IPCR) is used nucleic acid amplification technologies to increase based on the signal in the immunoassay of antibody and is produced.Because there is not the albumen equivalence of PCR, that is to say, can not with the mode replication protein that replicating nucleic acid is identical in the PCR process, the unique channel that improves detection sensitivity is to pass through amplification of signal.Target protein is combined on the antibody that directly or indirectly is conjugated on the oligonucleotide.Unconjugated antibody is washed off, and the oligonucleotide of remaining bonded antibody is amplified.Detect the oligonucleotide that increases by the nucleic acid detection method (comprising real-time method) that uses standard, carry out Protein Detection.
D. data analysis
In some embodiment, use the raw data that the computer based routine analyzer will produce by detection assay (for example, the existence of given mark, do not exist or measure) to translate into predictor data to clinician's use.By using any suitable means clinician can obtain predicted data.Therefore, in some preferred embodiments, the invention provides further favourable aspect, promptly those can not need to understand raw data the clinician that genetics or molecular biology are trained.Described data directly offer the clinician with its most useful form.The clinician can use the treatment of described information with the optimization experimenter immediately then.
The present invention relates to any method that can receive, handle and transmit information, transmission information is given laboratory, informant, healthcare givers and the experimenter who carries out described mensuration, or from its acquired information.For example, in some embodiment of the present invention, (for example obtain sample from the experimenter, biopsy or serum or urine sample) and offer and (for example be positioned at all over the world, living with the experimenter or finally using the national different country of described information) analysis (profiling) department (for example, for example the clinical labororatory of medical institutions, genome analysis enterprise etc.) with the generation raw data.Wherein said sample comprises tissue or other biological sample, and the experimenter can go medical centre to obtain sample and provide it to analytic centre, or the experimenter can collect the sample (for example, urine sample) of himself, and directly it is delivered to analytic centre.When described sample comprises the biological information of determining the front, described information can be passed through experimenter's (for example, can comprise the release of described information and use electrical communication system data transfer to be given the computer of analysis institution by computer scanning) and directly deliver to analysis institution.When sample is received by analysis institution, (for example, expression data) analytical results is handled and produced to described sample, described analytical results is specific diagnosis of wanting or the prognosis information at the experimenter.
Prepare analytical data with the form that is fit to treatment doctor explanation then.For example, except original expression data is provided, the form of preparation can be represented at experimenter's diagnosis and evaluation of risk (possibility that for example, has cancer) and evaluation that particular treatment is selected.Can data be presented to the doctor by any suitable method.For example, in some embodiment, analysis institution produces and can be doctor (for example, in the treatment place) report that print or that show for the doctor on graphoscope.
In some embodiment, at first remedially or in local analysis of mechanism information.Then raw data is delivered to center processing mechanism and changed into the information of using for doctor or patient with further analysis and/or with raw data.Center processing mechanism provides the favourable aspect of maintain secrecy (all data are kept at central authority with the safe and secret scheme of unifying), quick with consistent data analysis.Center processing mechanism can treat the destiny of back control data the experimenter then.For example, by using electrical communication system, central authority can offer data doctor, experimenter or researchist.
In some embodiment, the experimenter can directly obtain data by using electrical communication system.Can select further to disturb or suggestion based on described experimenter as a result.In some embodiment, described data are used for research and use.For example, described data can be used for comprising of further optimization mark or remove, and described mark is as the disconnected sign of particular condition or rank of disease.
E. in-vivo imaging
Use the in-vivo imaging technology also can detect gene fusion of the present invention, include but not limited to: radionuclide image; Positron emission tomography (PET); The axial x line of computer control tomoscan art, X-ray or MR imaging method, fluoroscopic examination and chemiluminescence detection.In some embodiment, the in-vivo imaging technology is used to observe the expression of cancer mark in the animal (for example, people or non-human mammal).For example, in some embodiment, use traget antibody mark cancer mark mRNA or the albumen of specificity at the cancer mark.Can be by using the antibody of in-vivo imaging method detection specificity combination and mark in individuality, described method includes but not limited to radionuclide imaging, positron emission tomography, computerize axle tomography, X ray or MR imaging method, fluoroscopic examination and chemiluminescence detection.The method that is used to produce at the antibody of cancer mark of the present invention is described below.
In-vivo imaging method of the present invention is used to diagnose the cancer (for example, prostate cancer) of expressing cancer mark of the present invention.In-vivo imaging is used to observe the existence of the mark that indicates cancer.Such technology allows not use biopsy beastly to diagnose.In-vivo imaging method of the present invention also is used to provide the prognosis to the cancer patients.For example, can detect the existence of the mark of representing that cancer may shift.In-vivo imaging method of the present invention can be further used for detecting the cancer that shifts in the other parts of health.
In some embodiment, the fluorescent mark specificity is at the reagent (for example, antibody) of cancer mark of the present invention.The antibody of mark is imported experimenter's (for example, per os or parenteral).Use any suitable method (for example, use to be described in United States Patent (USP) 6,198, the equipment in 107, this paper quotes as a reference) to detect fluorescently-labeled antibody.
In other embodiments, radiolabelled antibody.Purposes during antibody is diagnosed is in vivo known in this area.Sumerdon etc., (Nucl.Med.Biol17:247-254[1990]) have described the optimized antibody-sequestrant that is used to use the tumour radiotherapy immunoscintigraphy that indium-111 serves as a mark.Griffin etc., (J Clin Onc 9:631-640[1991]) have described this reagent is used to detect tumour in being doubted the patient who suffers from the recurrent colorectal carcinoma purposes.Have the purposes of similar reagent in nuclear magnetic resonance that paramagnetic ion serves as a mark and be known (Lauffer, Magnetic Resonance in Medicine 22:339-342[1991]) in this area.Employed mark depends on the selection of imaging form.Radio-labeling for example indium-111, technetium-99m or iodine-131 can be used for flat scanning or single photon emission computerized tomography(SPECT) (SPECT).Positron radiation mark for example fluoro-19 also can be used for positron emission tomography (PET).To MRI, can use paramagnetic ion for example gadolinium (III) or manganese (II).
Can obtain to be used to put together the radioactive metal with the transformation period that changes between 1 hour to 3.5 days of antibody, for example scandium-47 (3.5 days), gallium-67 (2.8 days), gallium-68 (68 minutes), technetium-99m (6 hours) and indium-111 (3.2 days), wherein gallium-67, technetium-99m and indium-111 is preferably used for the γZhao Xiangji imaging, and gallium-68 is preferably used for positron emission tomography.
With the process useful of these radioactive metal traget antibodies by bifunctional chelating agent for example diethyl pentetic acid (DTPA) carry out, for example described with indium-111 and technetium-99 m labeled method and the method described by Scheinberg etc. (Science 215:1511[1982]) by Khaw etc. (Science 209:295[1980]).Also can use other sequestrant, but the carboxyl carbon acid anhydrides of 1-(to the carboxyl methoxy-benzyl) EDTA and DTPA is favourable, does not influence the immunoreactivity of antibody basically because its application allows to put together.
Another is used for coupling DPTA and proteic method is to be undertaken by the cyclic anhydride that uses DTPA, as the method for being described by Hnatowich etc. (Int.J.Appl.Radiat.Isot.33:327[1982]) with indium-111 tagged albumin, but it can be used for traget antibody through change.The method of the suitable technetium-99 m labeled antibody of usefulness (not using DPTA to carry out chelating) is the pretinning method of (United States Patent (USP)s 4,323,546, this paper quotes as a reference) such as Crockford.
Preferred method with technetium-99 m labeled immunoglobulin (Ig) is (Int.J.Appl.Radiat.Isot. such as Wong, 29:251[1978]) method that is used for plasma proteins described and be used for the method for traget antibody recently by Wong etc. (J.Nucl.Med., 23:229[1981]).
Under the situation of the radioactive metal that is conjugated to specific antibody, introduce a high proportion of radio-labeling and do not destroy its immunologic opsonin and want equally to antibody as much as possible.Under the situation that specificity cancer mark of the present invention exists, can obtain further to improve, be protected to guarantee the antigen binding site on the antibody by radio-labeling.Behind mark, separate antigen.
In other embodiments, (Xenogen, Almeda CA) are used to carry out in-vivo imaging to the interior biophoton imaging of body.This real-time in-vivo imaging uses luciferase.Luciferase gene is integrated in cell, microorganism and the animal (for example, the fusion rotein that forms with cancer mark of the present invention).When being activated, it causes luminous reaction.Use CCD photographic camera and software are caught image and it are analyzed.
F. composition and test kit
The composition that is used for diagnostic method of the present invention includes but not limited to probe, amplification oligonucleotide and antibody.Particularly preferred composition only detects product when ARG and ETS family member gene fusion.These compositions comprise: the probe of independent mark, its comprise with from 5 of the transcriptional regulatory district of ARG ' part with hybridize the sequence of (that is, striding this gene fusion joint) from the joint of 3 of ETS family member gene ' part; A pair of amplification oligonucleotide, wherein first amplification oligonucleotide comprises the sequence with the hybridization of the transcriptional regulatory district of ARG, and second amplification oligonucleotide comprises the sequence with ETS family member gene recombination; The proteic antibody of ETS family member of the aminoterminal brachymemma that produces by the transcriptional regulatory district of ARG and ETS family member gene fusion; Perhaps, have from the aminoterminal part in the transcriptional regulatory district of ARG with from the antibody of the chimeric protein of the carboxyl terminal part of ETS family member gene.
But other useful composition comprises: the probe of a pair of mark, and wherein the probe of first mark comprises the sequence of hybridizing with the transcriptional regulatory district of ARG, and the probe of second mark comprises the sequence with ETS family member gene recombination.
Can provide any such composition with kit form, individually or with other combination of compositions of the present invention ground.For example, can provide the probe of described single marking and amplification oligonucleotide right being used for increasing and detecting the test kit of gene fusion of the present invention.Test kit can also comprise suitable contrast and/or detection reagent.
Probe of the present invention and antibody compositions also can provide with array format.
IV. prognosis purposes
At experiment confirm that exploitation is carried out in the process of the present invention the close association between the prognosis of gene fusion of the present invention and patients with prostate cancer (referring to for example, the following examples 5).Particularly, be derived from fusion under the situation of the genomic dna disappearance between TMPRSS2 and the ERG, have been found that cancer cells presents higher invasive phenotype.Thereby in some embodiment, use can detect the mensuration of the gene fusion (wherein having had the disappearance of inserting DNA) between TMPRSS2 and the ERG, provides prognosis and auxiliary doctor to determine suitable therapeutic strategy.For example, in some embodiment, more the concentrated area treatment has the tumour patient of this specific rearrangement, because their prognosis is significantly poor than the patient who lacks this rearrangement.
Can whether exist with the cell that rearrangement with the above-mentioned type (for example, above-mentioned those) is measured in any experiment.
Although the present invention most preferably is used to obtain the prognosis of patients with prostate cancer, also can check other epithelial cell tumour, and whether assay method as herein described and probe can be used to measure cancer cells from these tumours has possibility and makes them that the rearrangement of aggressive (that is, may be invasive and shift) be arranged especially.Use the example of the tumour that this method can characterize to comprise the tumour of breast, lung, colon, ovary, uterus, esophagus, stomach, liver, kidney, brain, skin and muscle.Described mensuration also is valuable for the researchist of the cancer in research clone and the animal model.
Other experiment confirm that carries out in exploitation process of the present invention has determined whether that by working sample one or more expression of gene disappearances are present in the disappearance zone, can detect chromosome deletion.For example, when the fusion that forms between TMPRSS2 and the ERG, delete the genomic dna of about 2.8 megabasses usually, when this takes place, can be lost at least 4 genes that this zone exists.They are ETS2 gene, WRB gene, PCP4 gene and MX1 gene.One or more minimizings in carcinous prostatic cell in them, hint person's prognosis mala.
Therefore, in some embodiment, the invention provides the method for measuring the relevant chromosomal DNA disappearance of resetting of indication cancer in the epithelial cell, it comprises, and uses at least the first kind and second kind of probe to carry out FISH and measures wherein said first kind of probe: length be at least 15 Nucleotide (for example, at least 15,20,35, etc.); Be combined on first kind of fluorescent mark; And under rigorous condition with the people's gene group in first kind of sequence hybridization, wherein said first kind of sequence comprises androgen Responsive Gene (for example, TMPRSS2 gene) or ETS family gene (for example, ERG gene, ETV1 gene, or ETV4 gene) at least a portion; And second kind of probe: length is at least 15 Nucleotide; Be combined in and be different from first kind of fluorescently-labeled second kind of fluorescent mark; And under rigorous condition with in the people's gene group, be different from second kind of sequence hybridization of first kind of sequence, and comprise androgen Responsive Gene (for example, TMPRSS2 gene) or ETS family gene (for example, ERG gene, ETV1 gene, or ETV4 gene) at least a portion.
In other embodiments, the invention provides the method for measuring the relevant genomic dna disappearance of resetting of indication cancer in the epithelial cell (for example prostatic cell), it comprises: obtain epithelial laboratory sample; Measure the epithelial cell sample, to determine to be selected from one or more expression of gene levels of the group that includes but not limited to ETS2, WRB, PCP4 and MX1; The expression level that will record in step b) is compared with the level in the control sample; If the expression of gene level is lower than the expression level of control sample in the laboratory sample that records, then draw the conclusion that has lacked.
V. drug screening purposes
In some embodiment, the invention provides drug screening assay method (for example, with the screening cancer therapy drug).The cancer mark (for example, including but not limited to the gene fusion of ERG, ETV1, ETV4 and FLI1 and TMPRSS2) that screening method utilization of the present invention uses the inventive method to identify).For example, in some embodiment, the invention provides the method that screening changes the compound of (for example, reducing) cancer marker gene expression.Described compound or reagent can disturb and transcribe, and this is by for example realizing with the interaction of promoter region.Compound or reagent can disturb and merge the mRNA (for example, disturbing antisense technology etc. by RNA) that produces.Compound or reagent can disturb in the biological activity upstream of merging or the approach in downstream.In some embodiment, candidate compound is antisense or the RNA interfering reagent (for example, oligonucleotide) that points to the cancer mark.In other embodiments, candidate compound is specificity in conjunction with cancer mark conditioning agent of the present invention or expression product and suppresses the antibody or the small molecules of its biological function.
In a screening method,, measure candidate compound then the ability that the influence of expressing to change the cancer marker expression with regard to candidate compound is assessed candidate compound by with compound and the cells contacting of expressing the cancer mark.In some embodiment, the level of the cancer mark mRNA by detecting cell expressing is measured the influence that candidate compound is expressed the cancer marker gene.Can detect mRNA by any suitable method expresses.In other embodiments, detect the influence of candidate compound by the level of measuring by the polypeptide of cancer label coding to the cancer marker gene.Can use any suitable method to measure the level of polypeptide expressed, include but not limited to method disclosed herein.
Especially, the invention provides the screening method that is used to identify conditioning agent, described conditioning agent promptly in conjunction with the candidate of cancer mark of the present invention or test-compound or reagent (for example, albumen, peptide, peptide mimics (peptidomimetic), class peptide (peptoid), small molecules or other medicines), described candidate or test-compound or reagent have for example cancer marker expression or the active inhibition of cancer mark (or stimulation) effect, or have expression or active stimulation or restraining effect to for example cancer labeled substrate.In treatment plan, (for example, the cancer marker gene) activity is destroyed the interactional compound of normal target gene with biological function or the evaluation that elaborates target gene product can be used to regulate target gene product directly or indirectly through compounds identified like this.The compound active or that express that suppresses the cancer mark is used for the treatment of propagation disorder, for example cancer, particularly prostate cancer.
In one embodiment, the invention provides the measuring method that is used to screen candidate or test-compound, described candidate or test-compound are the substrates of cancer labelled protein or polypeptide or its biologic activity part.In another embodiment, the invention provides and be used to screen in conjunction with cancer labelled protein or polypeptide or its biologic activity part or the assay method of regulating its active candidate or test-compound.
Test-compound of the present invention can obtain by using in the many approach in combinatorial library method known in the art any, and it comprises the biology library; (it is functional but have the library of molecule new, non-peptide main chain to have peptide, and described molecule has resistance to enzymatic degradation but keeps biological activity simultaneously for the class peptide library; Referring to, for example, Zuckennann etc., J.Med.Chem.37:2678-85[1994]); Accessibility on the space (addressable) parallel solid phase or liquid phase library; The synthetic library method that requirement is deconvoluted; Compound of ' microballon ' the library method; With the synthetic library method of using affinity chromatography to select.Biology library and class peptide library method are preferably used for peptide library, and other four kinds of methods can be used for the peptide of compound, non-peptide oligomer or small molecules library (Lam (1997) Anticancer Drug Des.12:145).
In the art, be used for the example of molecular library synthetic method, for example can in following document, find: DeWitt etc., Proc.Natl.Acad.Sci.U.S.A.90:6909[1993]; Erb etc., Proc.Nad.Acad.Sci.USA 91:11422[1994]; Zuckermann etc., J.Med.Chem.37:2678[1994]; Cho etc., Science261:1303[1993]; Carrell etc., Angew.Chem.Int.Ed.Engl.33.2059[1994]; Carell etc., Angew.Chem.Int.Ed.Engl.33:2061[1994]; With Gallop etc., J.Med.Chem.37:1233[1994].
Library of compounds (for example can exist in solution, Houghten, Bio technology 13:412-421[1992]), or be present in (Lam on the microballon, Nature 354:82-84[1991]), (U.S.Patent No.5 on (Fodor, Nature 364:555-556[1993]), bacterium or the spore on the chip, 223,409; This paper quotes as a reference), on the plasmid on (Cull etc., Proc.Nad.Acad.Sci.USA 89:18651869[1992]) or the phage (Scott and Smith, Science 249:386-390[1990]; Devlin Science 249:404-406[1990]; Cwirla etc., Proc.Natl.Acad.Sci.87:6378-6382[1990]; Felici, J.Mol.Biol.222:301[1991]).
In one embodiment, measure the mensuration that is based on cell, the cell that wherein will express cancer mark mRNA or albumen or its biologic activity part contacts with test-compound, and determines the active ability of described test-compound adjusting cancer mark.Variations by monitoring for example enzymic activity, destruction or mRNA etc. determine that test-compound regulates the active ability of cancer mark.
Also can assess test-compound and regulate for example bonded ability of cancer labeled substrate or adjusting control agent of cancer mark and compound.This can for example carry out on the substrate by for example being coupled to described compound with radio isotope or enzyme labelling, like this can be by detecting in the mixture through the compound of mark substrate compound the combining of substrate and cancer mark for example of determining described mark for example.
Perhaps, regulate cancer with radio isotope or enzyme labelling coupling cancer mark with the monitoring test-compound and be marked in the mixture ability in conjunction with the cancer labeled substrate.For example, available 125I, 35S, 14C or 3H is tagged compound (for example, substrate) directly or indirectly, and by direct radioactive emission counting or by scintillation counting detection of radioactive isotropic substance.Perhaps, available for example horseradish peroxidase, alkaline phosphatase or luciferase carry out enzyme labelling to compound, and by determining the be converted detection enzyme labelling of suitable substrate to product.
Can be at mark or do not assess compound (for example, cancer labeled substrate) and the interactional ability of cancer mark under the situation of any interactant of mark.For example, under the situation of not tagged compound or cancer mark, can use the interaction (Science 257:1906-1912[1992 such as McConnell]) of microphysiometer detection compound and cancer mark.As used herein, " microphysiometer " (for example, cell sensor (cytosensor)) is to use (light-addressable) potentiometer quantity sensor (LAPS) that can experience light to measure the analytical instrument of the speed of its environment of cell acidify.The change of this acidification rate can be used as interactional index between compound and the cancer mark.
In another embodiment, provide acellular assay method, wherein cancer labelled protein or its biologic activity part have been contacted with test-compound, and assessed the binding ability of described test-compound and cancer labelled protein, mRNA or its biologic activity part.The biologic activity that is used for the preferred cancer labelled protein of assay method of the present invention or mRNA partly comprises the fragment of participation and substrate or other protein-interacting, for example has the fragment of high surperficial probability score.
The cell-less measurement method is included in is enough to allow under two kinds of component interactions and the bonded condition and the reaction mixture of time interior preparation target gene protein and test-compound, thereby forms the mixture that can be removed and/or detect.
For example also can use fluorescence energy transfer (FRET) method (referring to, for example, Lakowicz etc., U.S. Patent number 5,631,169; Stavrianopoulos etc., U.S. Patent number 4,968,103; Each patent is incorporated herein by reference) two intermolecular interactions of detection.Select the fluorophore mark so that the emitted fluorescence energy of first donor molecule is absorbed by the fluorescent mark on second " acceptor " molecule, thereby it can produce fluorescence because of the energy that absorbs.
Perhaps, described ' donor ' protein molecular can utilize the natural fluoresence energy of tryptophan residue simply.Can select to launch the mark of the light of different wave length, described like this " acceptor " molecule marker can separate with the mark zone of " donor ".Because efficient and intermolecular distance dependent that the energy between the mark shifts, so can estimate spatial relation between the molecule.Taking place under the bonded situation between two molecules, the fluorescent emission of " acceptor " molecule marker should be maximum.Measure detection method (for example, using photofluorometer) by standard fluorescence well known in the art and can measure the FRET binding events easily.
In another embodiment, can by use real-time biomolecular interaction analysis method (BIA) (referring to, for example, Sjolander and Urbaniczky, Anal.Chem.63:2338-2345[1991] and Curr.Opin.Struct.Biol.5:699-705[1995 such as Szabo]) determine cancer labelled protein or mRNA and target molecule bonded ability.(for example, under situation BIAcore), " surface plasma (plasmon) resonance " or " BIA " detection of biological specificity in real time interact at any interaction material of mark not.The quality of mating surface changes the change (optical phenomena of surface plasma body resonant vibration (SPR)) that (sign of binding events) causes the near surface optical index, produces the detectable signal that can be used as the sign of real time reaction between biomolecules.
In one embodiment, target gene product or tried material and be anchored on the solid phase.When finishing, reaction can detect the target gene product/test-compound mixture that is anchored on the solid phase.Preferably, target gene product can be anchored at solid surface, and test-compound (not being anchored) can be directly or indirectly carries out mark with the detectable mark of this paper discussion.
It is desirable to, fixedly cancer mark, anticancer traget antibody or its target molecule are to help from one or both proteic non-composite form isolated complex form and the mensuration of automatization is provided.Test-compound combines with the cancer labelled protein, or the cancer labelled protein under candidate compound existence or non-existent situation and the interaction of target molecule, can finish in the container of the described reactant of any suitable splendid attire.The example of this container comprises microtiter plate, test tube and Eppendorf tube.In one embodiment, can provide the fusion rotein that has added structural domain, described structural domain allows one or both protein binding to matrix.For example, glutathione-S-transferase-cancer mark fusion rotein or glutathione-S-transferase/target fusion rotein can be adsorbed to glutathione S epharose microballon (Sigma Chemical, St.Louis, MO) or on the gsh deutero-microtiter plate, then with itself and test-compound, or the target protein of test-compound and non-absorption or the combination of cancer labelled protein, (for example, under the salt and pH at physiological condition) described mixture of incubation under the condition that helps mixture to form.Behind the incubation, it is any not in conjunction with component to remove to clean microballon or microtiter plate aperture, and matrix is fixed under the situation of microballon, determines mixture directly or indirectly, for example, as described above.
Perhaps, can use standard technique from matrix dissociate mixture and definite cancer mark in conjunction with or active level.Other is used for cancer labelled protein or target molecule the technology on the matrix of being fixed on comprised and uses puting together of vitamin H and streptavidin.Can be by (for example using technology known in the art, the biotinylation test kit, Pierce Chemicals, Rockford, EL) prepare biotinylated cancer labelled protein or target molecule and be fixed in bag from vitamin H-NHS (N-hydroxyl-succinimide) by in the aperture of 96 orifice plates of streptavidin (Pierce Chemical).
In order to carry out described mensuration, add revocable component to the surface component that contains grappling, the bag quilt.After reacting completely, under the condition that is maintained fixed on the solid surface, remove (for example, by cleaning) unreacted component at the mixture of any formation.Can finish in many ways being anchored on the detection of the mixture on the solid surface.When previous loose component during, detect and be fixed on lip-deep mark and then represent to have formed mixture by mark in advance.When previous loose component not in advance during mark, can use indirect labelling to detect and be anchored on lip-deep mixture; For example, use specificity at the antibody of the mark of fixed component (then, directly mark or with for example through anti-this antibody of IgG antibody indirect ground mark of mark).
Can utilize with the reaction of cancer labelled protein or target molecule but do not disturb described cancer labelled protein and its target molecule bonded antibody to carry out this mensuration.These antibody can be derived to the aperture of plate, thereby unconjugated target or cancer labelled protein are puted together by antibody and are trapped in the aperture.Except the above-mentioned method that is used for GST fixed mixture, the method that is used to detect these mixtures also comprises the immunodetection that uses with the mixture of the antibody of cancer labelled protein or target molecule reaction, and based on detecting and cancer labelled protein or the active enzyme connection of target molecule involved enzyme assay method.
Perhaps, can in liquid phase, carry out the cell-less measurement method.In this is measured, isolate reaction product by in many standard techniques any from unreacted component, described technology includes but not limited to: differential centrifugation (referring to, for example, Rivas and Minton, Trends BiochemSci 18:284-7[1993]); Chromatography (gel permeation chromatography, ion exchange chromatography); Electrophoresis (referring to, for example, Ausubel etc., eds.Current Protocols in MolecularBiology 1999, J.Wiley:New York.); And immunoprecipitation (referring to, for example, Ausubel etc., eds.Current Protocols in Molecular Biology 1999, J.Wiley:New York).These resins and chromatographic technique be for a person skilled in the art know (referring to, for example, Heegaard J.Mol.Recognit 11:141-8[1998]; Hageand Tweed J.Chromatogr.Biomed.Sci.Appl 699:499-525[1997]).In addition, as described herein, also can utilize the fluorescence energy transfer method easily further from solution, not detect combination under the situation of purifying mixture.
Mensuration can comprise cancer labelled protein or mRNA or its biologic activity part contact with known compound in conjunction with described cancer mark to form the mensuration mixture, described mensuration mixing is contacted with test-compound, and definite described test-compound and cancer labelled protein or the interactional ability of mRNA, determine wherein that described test-compound comprises with compound known with cancer labelled protein or the interactional ability of mRNA and compares, determine that test-compound is preferentially in conjunction with cancer mark or its biologic activity part or the active ability of regulating target molecule.
For determine the cancer mark in vivo can with one or more cells or the extracellular macromole degree that reaches of protein-interacting for example, this interactional inhibitor is very useful.Can use homogeneous determination to identify inhibitor.
For example, the prefabricated mixture of preparation target gene product and interactional cell or extracellular binding partners product so that target gene product or its binding partners be labeled, but since the formation of mixture cause the signal cancellation that described mark produces (referring to, U.S. Patent number 4,109,496, this paper quotes as a reference, and described patent uses this method to carry out immunoassay).Tried the signal that the adding of material will cause being higher than background and produced, described test-compound with from wherein a kind of material competition of ready-formed mixture and replace it.By this way, can identify the interactional material that tried of destruction target gene product-binding partners.Perhaps, the cancer labelled protein measure at double cross mensuration or triple-crossing (referring to for example, U.S. Patent number 5,283,317; Zervos etc., Cel172:223-232[1993]; Madura etc., J.Biol.Chem.268.12046-12054[1993]; Bartel etc., Bio technology 14:920-924[1993]; Iwabuchi etc., Oncogene 8:1693-1696[1993]; With Brent WO94/10300; Respectively be incorporated herein by reference) in can be used as " bait protein ", with identify other in conjunction with or conjugated protein with cancer mark interactional (" cancer mark " or " cancer mark-bp ") and participation cancer mark active albumen.This cancer mark-bp can be the activator or the inhibitor of the signal that produced by cancer labelled protein or target, and it is for example as the downstream components of the signal transduction path of cancer mark mediation.
Also can identify the conditioning agent of cancer marker expression.For example, cell or acellular mixture are contacted with candidate compound, and with respect to cancer mark mRNA under the non-existent situation of described candidate compound or proteic expression level, assessment cancer mark mRNA or proteic expression.When the expression when described candidate compound exists was higher than it and does not exist as cancer mark mRNA or albumen, described candidate compound was accredited as the stimulant of cancer mark mRNA or protein expression.Perhaps, the expression when described candidate compound exists is lower than (, be markedly inferior on the statistics) when it did not exist, described candidate compound was accredited as the inhibitor of cancer mark mRNA or protein expression as cancer mark mRNA or albumen.Be used to detect the level that cancer mark mRNA or proteic method can be determined cancer mark mRNA or protein expression by described herein.
Can use based on assay method cell or acellular and identify conditioning agent, and can be in vivo for example determine in animal that described reagent regulates the active ability of cancer labelled protein, described animal for example is the animal model of disease, for example, suffers from the animal of the prostate cancer of prostate cancer or transfer; Or containing the animal of prostate cancer heterograft, described prostate cancer heterograft shifts the cell of the cancer that (for example being transferred to lymphoglandula, bone or liver) cause or the cell of prostate cancer cell line from animal (for example, people) or by prostate cancer.
The invention further relates to the novel agent identified by above-mentioned screening assay method (referring to for example, below to the description of cancer therapy method).Therefore, further in suitable animal model (model for example described herein), use the reagent of identifying by method described herein (for example, the cancer mark is regulated reagent, antisense cancer marker nucleic acid molecule, siRNA molecule, cancer mark specific antibody or cancer mark binding partners) to determine to use validity, toxicity, side effect or the mechanism of action of this reagent treatment.In addition, the novel agent of being identified by above-mentioned screening assay method can be used for treatment for example described herein.
VI. therepic use
In some embodiment, the invention provides the method for treatment cancer (for example prostate cancer).In some embodiment, the direct or indirect target cancer of therapeutics mark (for example, including but not limited to the gene fusion of ERG, ETV1 and ETV4 and TMPRSS2).
A.RNA disturbs and antisense therapy
In some embodiment, the expression of target cancer mark of the present invention.For example, in some embodiment, the present invention uses and to comprise the oligomerization antisense compounds particularly oligonucleotide is (for example, those that in the said medicine screening method, identify) composition, be used to regulate the function of the nucleic acid molecule of coding cancer mark of the present invention, thus final amount of regulating the cancer mark of expressing.
1.RNA disturb (RNAi)
In some embodiment, RNAi is used to suppress the fusion rotein function.The RNAi representative is used for comprising most of eukaryotes the cytophylaxis of the evolution conservative of people's control exogenous gene expression.RNAi causes and causes responding the sequence-specific mRNA degraded of the strand target RNAs homologue of dsRNA usually by double-stranded RNA (dsRNA).The mediation person of mRNA degraded is little interferential RNA duplex (siRNA), and it is cut by long dsRNA generation by enzyme in cell usually.SiRNA is about 21 Nucleotide (for example, length is 21-23 Nucleotide) usually on length, and have be characterised in that two Nucleotide 3 '-structure of the base pairing of overhang.With little RNA, or behind the RNAi transfered cell, it is believed that described sequence is delivered to the enzyme complex that is called RISC (the reticent mixture of RNA inductive).RISC discerns target and cuts it with endonuclease.It is to be noted that if bigger RNA sequence is delivered to cell then RNA enzyme III (Dicer) will longer dsRNA changes into the double-stranded siRNA fragment of 21-23nt.In some embodiment, the RNAi oligonucleotide is designed to the joining region of targent fused protein.
The siRNA of chemosynthesis has become and has been used for the strong reagent that carries out the mammalian genes functional analysis of genome range at the somatocyte of cultivating.Except it is used to confirm the value of gene function, siRNA also has the huge potential as the gene specific therapeutical agent (Tuschl and Borkhardt, Molecular Intervent.2002; 2 (3): 158-67, this paper quotes as a reference).
SiRNA is transfected into zooblast causes post-transcriptional silencing (Caplen etc., Proc Natl Acad Sci U.S.A.2001 effective, long lasting specific gene; 98:9742-7; Elbashir etc., Nature.2001; 411:494-8; Elbashir etc., Genes Dev.2001; 15:188-200; With Elbashir etc., EMBO J.2001; 20:6877-88 all is incorporated herein by reference).The method and composition that is used to use siRNA to carry out RNAi for example is described in United States Patent (USP) 6,506,559 (this paper quotes as a reference).
SiRNA is very effective on reducing by the amount of the RNA of target, and by extensin (extension protein), usually is reduced to undetectable level.The described sustainable several months of reticent effect, and have high specificity, because a Nucleotide mispairing between target RNA and the siRNA central zone is enough to stop reticent (Brummelkamp etc., Science2002 usually; 296:550-3; With Holen etc., Nucleic Acids Res.2002; 30:1757-66, both are incorporated herein by reference).An important factor when design siRNA is to have the accessible site of siRNA bonded.Bahoia etc., (J.Biol.Chem., 2003; 278:15991-15997; Incorporated by reference in this article) purposes in the accessible site of mRNA when having described a class DNA array that is called scanning array and being used for finding designing effective siRNA.These arrays comprise that size is the oligonucleotide of from monomer to particular maximum value (normally Comer), and it is synthetic that their use physical barriers (shade), and wherein progressively adds each base in the sequence.Thereby described array is being represented the complete oligonucleotide complement in target gene zone.The hybridization of said target mrna and these arrays can provide the complete accessibility that said target mrna should the zone to describe.Such data can be used to design antisense oligonucleotide (from 7 aggressiveness to 25 aggressiveness), wherein importantly reach trading off between oligonucleotide length and the binding affinity, to keep effect and target thing specificity (Sohail etc., Nucleic Acids Res., 2001; 29 (10): 2041-2045).Select other method of siRNA and the aspect of care for example to be described in WO05054270, WO05038054A1, WO03070966A2, J Mol Biol.2005 May13; 348 (4): 883-93, J Mol Biol.2005 May 13; 348 (4): 871-81 and Nucleic Acids Res.2003 Aug 1; 31 (15): 4417-24, they are whole in this article separately incorporated by reference.In addition, software (for example, the online siMAX siRNA of MWG design tool) can commercial or openly obtain, and is used for the selection of siRNA.
2. antisense
In other embodiments, use specifically the antisense compounds with the nucleic acid hybridization of one or more cancer marks of the present invention of encoding, the regulation and control expressing fusion protein.The specific hybrid of oligomeric compounds and its target nucleic acid has disturbed the normal function of described nucleic acid.This by specifically with the compound of target nucleic acid hybridization to the adjusting of the function of target nucleic acid so-called " antisense ".The function of disturbed DNA comprises duplicates and transcribes.The function of disturbed RNA comprises the function that all are great, for example, with the site that RNA transfers to protein translation, from RNA translation albumen, splices RNA to produce one or more mRNA and can be undertaken or promoted catalytic activity by RNA.The total effect of this interference target nucleic acid function is to regulate the expression of cancer mark of the present invention.In the context of the present invention, " adjusting " expression increases (stimulation) or reduces (inhibition) expression of gene.For example, can suppress to express to effectively prevent tumor proliferation.
Preferably, with special nucleic acid as target to carry out antisense.With antisense compounds " target " specific nucleic acid, be a rapid process of multistep in the context of the present invention.This process is the nucleotide sequence from identifying that its function will be conditioned usually.It can be the cytogene mRNA of described genetic transcription (or from) or from the nucleic acid molecule of infectious agent, described expression of gene is relevant with specific illness or morbid state for example.In the present invention, described target is the nucleic acid molecule of coding cancer mark of the present invention.Described target process also comprises the effect of site to obtain to want of determining that antisense interacts and takes place in this gene, and for example detects or regulate described proteic expression.In the context of the present invention, the site is the translation initiation of the open reading frame (ORF) that comprises described gene or the zone of terminator codon in the preferred gene.Because translation initiation codon normally 5 '-AUG is (in the mRNA molecule of transcribing; 5 '-ATG is in corresponding D NA molecule), so translation initiation codon is also referred to as " AUG codon ", " initiator codon " or " AUG initiator codon ".The minority gene have contain RNA sequence 5 '-translation initiation codon of GUG, 5 '-UUG or 5 '-CUG, and 5 '-AUA, 5 '-ACG and 5 '-CUG shown and brought into play function in vivo.Therefore, term " translation initiation codon " and " initiator codon " can comprise many codon sequences, although normally methionine(Met) (in eukaryote) or formylmethionine (in prokaryotic organism) of initial amino acid in each case.Eukaryote and prokaryotic gene can have two or more interchangeable initiator codons, wherein any can be preferentially in specific cell type or tissue or be used for translation initiation under given conditions.In the context of the present invention, " initiator codon " and " translation initiation codon " is meant the codon of the translation that is used to start the mRNA molecule in vivo, described mRNA molecule is transcribed the gene of own coding tumour antigen of the present invention, no matter and the sequence of described codon how.
Translation stop codon of gene (or " terminator codon ") can have three kinds of sequences (that is, 5 '-UAA, 5 '-UAG and 5 '-UGA; Corresponding DNA sequences is 5 respectively '-a kind of among TAA, 5 '-TAG and 5 '-TGA).Term " initiation codon subregion " and " translation initiation codon zone " are meant that beginning on either direction (that is, 5 ' or 3 ') from translation initiation codon comprises about 25 parts to the mRNA or the gene of about 50 continuous nucleotides.Similarly, term " termination codon subregion " and " translation termination codon region territory " are meant from translation stop codon beginning (that is, 5 ' or 3 ') on either direction and comprise about 25 parts to the mRNA or the gene of about 50 continuous nucleotides.
Open reading frame (ORF) or " coding region " in the zone between expression translation initiation codon and translation termination also are can be by the zone of efficient targeting.Other target region comprises 5 ' non-translational region (5 ' UTR) and 3 ' non-translational region (3 ' UTR), 5 ' non-translational region is meant the part that begins the mRNA on 5 ' direction from translation initiation codon, therefore comprise corresponding Nucleotide on 5 ' cap site of mRNA and Nucleotide between the translation initiation codon or the gene, 3 ' non-translational region is meant from the part of the mRNA of translation stop codon beginning on 3 ' direction, therefore comprises corresponding Nucleotide on translation stop codon of mRNA and Nucleotide between 3 ' end or the gene.5 ' cap of mRNA comprise by 5 '-5 ' triphosphoric acid bonding be connected to mRNA 5 ' residue on the methylated guanosine residue of N7-.5 ' cap zone of mRNA is believed to comprise 5 ' cap sequence self and preceding 50 Nucleotide adjacent with cap.The cap zone also can be preferred target region.
Although some eukaryote mRNA transcripts are directly translated, manyly comprise one or more zones of before transcript translation, from transcript, being excised, be called " intron ".(therefore being translated) zone of being left is called " exon ", and it is spliced and forms successive mRNA sequence together.The also preferred target region of mRNA splicing site (that is, intron-exon joint), and be particularly useful for disease and involve the situation that unusual splicing or disease involve the excessive generation of specific mRNA splicing product.Because resetting or lack the unusual fusion connection that causes also is preferred target.Also find intron also can be effectively from but preferred, by the target target region of the antisense compounds of DNA or premessenger RNA for example.
In some embodiment, use commercial software program (for example, Biognostik, Gottingen, the Germany that can buy; SysArris Software, Bangalore, India; Antisense Research Group, University of Liverpool, Liverpool, England; GeneTrove, Carlsbad, CA) target site of evaluation Antisense Suppression.In other embodiments, use reached site (accessiblesite) method that is described in United States Patent (USP) WO0198537A2 (this paper quotes as a reference) to identify the target site that is used for Antisense Suppression.
In case identified one or more target sites, just selected the effect of wanting with generation with the oligonucleotide of target fully complementary (that is, very hybridize well and have enough specificitys).For example, in the preferred embodiment of the invention, with the antisense oligonucleotide target to or near initiator codon.
In the context of the present invention, " hybridization ", for antisense composition and method, the hydrogen bond between expression complementary nucleosides or the nucleotide base, it can be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding.For example, adenine and thymine is the complementary nuclear of paired base by forming hydrogen bond.But the sequence that is appreciated that antisense compounds needn't 100% ground and the complementary just specific hybrid of its target nucleic acid sequence.When thereby antisense compounds causes the effect forfeiture with the normal function that disturbs described target DNA or RNA that combines of target DNA or RNA molecule, and exist enough complementary degree wanting under the specificity bonded condition (promptly avoiding, measuring or treat under the situation about handling in vivo is under physiological conditions and under the situation at external test, be to be under the condition of measuring) when described antisense compounds and non-target sequence form non-specific binding, but the antisense compounds specific hybrid.
Antisense compounds is usually as studying reagent and being used for diagnostics.For example, antisense oligonucleotide that can specific inhibition of gene expression can be used for illustrating the function of specific gene.Antisense compounds also is used for for example distinguishing each member's of biological pathway function.
The specificity of antisense and susceptibility also are used for the treatment of purposes.For example, antisense oligonucleotide has been used as the treatment part in the treatment of animal and human's morbid state.Safety and effectively antisense oligonucleotide is administered to the people and is just being carried out a large amount of clinical trials at present.Therefore determine that oligonucleotide is to be configured to the useful treatment pattern that particularly uses in people's the treatment plan treatment cell, tissue and animal.
Although antisense oligonucleotide is the form of preferred antisense compounds, the present invention also comprises other oligomerization antisense compounds, includes but not limited to oligonucleotide mimetic, the stand-in that for example describe below.According to the present invention, antisense compounds preferably comprises about 8 to about 30 nuclear bases (that is, about 8 bases to about 30 connections), although longer and shorter sequence all can be used for the present invention.Particularly preferred antisense compounds is an antisense oligonucleotide, more preferably comprises the oligonucleotide of about 12 to 25 nuclear bases.
The concrete example that is used for preferred antisense compounds of the present invention comprises the oligonucleotide that contains bonding between modified main chain or non-natural nucleosides.As defined in this specification sheets, the oligonucleotide with modified main chain is included in the oligonucleotide that keeps phosphorus atom on the main chain and do not have phosphorus atom on main chain.For the purpose of this specification sheets, the modified oligonucleotide that does not have phosphorus atom between its nucleosides in the main chain also can be considered to oligonucleoside.
Preferred modified oligonucleotide main chain comprises, for example, thiophosphatephosphorothioate, the chirality thiophosphatephosphorothioate, phosphorodithioate, phosphotriester, the aminoalkyl phosphotriester, methyl and other phosphonate ester comprise 3 '-alkylene phosphonic acids ester and chiral phosphonate, phosphinate, phosphoramidate comprises 3 '-amino phosphoramidate and aminoalkyl phosphoramidate, the thion phosphoramidate, the thion phosphonate ester, the thion alkyl phosphotriester with have normal 3 '-5 ' boron phosphoric acid ester (boranophosphate) of being connected, its 2 '-5 ' analogue of connecting and its analogue with reversed polarity (wherein, adjacent nucleosides unit to 3 '-5 ' to 5 '-3 ' or 2 '-5 ' to 5 '-2 ' connect).Also comprise various salt, mixing salt and free acid form.
The preferred modified oligonucleotide main chain that does not wherein comprise phosphorus atom has the main chain by bonding forms between bonding or one or more short chain heteroatoms or heterocycle nucleosides between bonding, blended heteroatoms and alkyl or cycloalkyl nucleosides between short-chain alkyl or cycloalkyl nucleosides.These comprise having the morpholino bonding (part is formed at the sugar moieties of nucleosides); Siloxane main chain; Sulfide, sulfoxide and sulfone main chain; Formacetyl and thioformacetyl main chain; Methyleneformacetyl and thioformacetyl main chain; The main chain that comprises alkene; Sulfamate backbone; Methylene radical imino-and methylene radical diazanyl main chain; Sulphonate and sulphonamide main chain; Amide backbone; Have blended N, O, S and CH with other 2The oligonucleotide main chain of component part.
In other preferred oligonucleotide mimetic, with bonding (that is main chain) between the sugar of new group substituted nucleotide unit and nucleosides.Keep base unit to be used for and the hybridization of suitable nucleic acid target compound.A kind of such oligomeric compounds has promptly shown the oligonucleotide mimetic with good hybridization characteristic, is known as peptide nucleic acid(PNA) (PNA).In the PNA compound, the main chain of the involved acid amides of sugar backbone of oligonucleotide particularly amino-ethyl glycine main chain replaces.Keep the nuclear base and combine with the aza nitrogen atom of the amide moieties of main chain directly or indirectly.The representational United States Patent (USP) of instruction PNA compound includes but not limited to U.S. Patent number 5,539,082,5,714,331 and 5,719,262, respectively be incorporated herein by reference.The instruction of other PNA compound can be at Nielsen etc., and Science 254:1497 finds in (1991).
The most preferred embodiment of the present invention is to have the oligonucleotide of thiophosphatephosphorothioate main chain and have heteroatomic main chain, U.S. Patent number 5,489,677 particularly above-mentioned-CH 2,--NH--O--CH 2--,--CH 2--N (CH 3)--O--CH 2--[being called methylene radical (methyl-imino) or MMI main chain],--CH 2--O--N (CH 3)--CH 2--,--CH 2--N (CH 3)--N (CH 3)--CH 2--and--O--N (CH 3)--CH 2--CH 2--[wherein natural phosphodiester backbone is expressed as--O--P--O--CH 2-] and the oligonucleoside of the amide backbone of above-mentioned U.S. Patent number 5,602,240.The oligonucleotide that equally preferably has the morpholino backbone structure of above-mentioned U.S. Patent number 5,034,506.
Modified oligonucleotide also can comprise one or more substituted sugar moieties.Preferred oligonucleotide comprises following groups a: OH in 2 ' position; F; O-, S-or N-alkyl; O-, S-or N-alkenyl; O-, S-or N-alkynyl; Or O-alkyl-O-alkyl, wherein alkyl, alkenyl and alkynyl can be C that replace or non-replacement 1To C 10Alkyl or C 2To C 10Alkenyl and alkynyl.Particularly preferably be O[(CH 2) nO] mCH 3, O (CH 2) nOCH 3, O (CH 2) nNH 2, O (CH 2) nCH 3, O (CH 2) nONH 2And O (CH 2) nON[(CH 2) nCH 3)] 2, wherein n and m are 1 to about 10.Other preferred oligonucleotide comprises following groups a: C in 2 ' site 1To C 10The low alkyl group of low alkyl group, replacement, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3, OCN, Cl, Br, CN, CF 3, OCF 3, SOCH 3, SO 2CH 3, ONO 2, NO 2, N 3, NH 2, silyl, RNA cutting group, reporter group, insertion (intercalator) of Heterocyclylalkyl, heterocycle alkaryl, aminoalkyl group amino, many alkylaminos, replacement, the group or be used to that is used to improve the pharmacokinetic characteristic of oligonucleotide improve the group of the pharmacodynamics feature of oligonucleotide.Preferred modify comprise 2 '-methoxy ethoxy (2 '-O--CH 2CH 2OCH 3, be also referred to as 2 '-O-(2-methoxy ethyl) or 2 '-and MOE) (Martin etc., Helv.Chim.Acta 78:486[1995]) promptly, the alkoxyl group alkoxy base.Other preferably modify comprise 2 '-dimethylamino oxygen base oxethyl (that is O (CH, 2) 2ON (CH 3) 2Group), be also referred to as 2 '-DMAOE and 2 '-dimethylamino ethoxy oxyethyl group (be also referred to as 2 in this area '-O-dimethylamino ethoxy ethyl or 2 '-DMAEOE), that is, 2 '-O--CH 2--O--CH 2--N (CH 2) 2
Other preferably modify comprise 2 '-methoxyl group (2 '-O--CH 3), 2 '-amino propoxy-(2 '-OCH 2CH 2CH 2NH 2) and 2 '-fluorine (2 '-F).Also can on other position of oligonucleotide, similarly modify, particularly on 3 ' terminal nucleotide or 3 ' position of the sugar in the oligonucleotide of 2 '-5 ' connection and 5 ' position of 5 ' terminal nucleotide.Oligonucleotide also can with sugared stand-in for example cyclobutyl moiety substitute five furyl glycosyls (pentofuranosyl) sugar.
Oligonucleotide can comprise that also nuclear base (being called " base " usually in this area simply) is modified or replacement.As used herein, " unmodified " or " natural " nuclear base comprises purine base adenine (A) and guanine (G) and pyrimidine bases thymus pyrimidine (T), cytosine(Cyt) (C) and uridylic (U).Modified nuclear base comprises other synthetic and natural nuclear base, 5-methylcytosine (5-me-C) for example, 5-hydroxymethyl cytosine, xanthine, xanthoglobulin, the 2-aminoadenine, the 6-methyl of VITAMIN B4 and guanine and other alkyl derivative, the 2-propyl group of VITAMIN B4 and guanine and other alkyl derivative, the 2-thiouracil, 2-sulphur thymus pyrimidine and 2-sulphur cytosine(Cyt), 5-halo uridylic and cytosine(Cyt), 5-proyl uridylic and cytosine(Cyt), 6-azo uridylic, cytosine(Cyt) and thymus pyrimidine, 5-uridylic (pseudouracil), the 4-thiouracil, the 8-halo, 8-amino, 8-sulphur, the 8-alkylthio, VITAMIN B4 and guanine that 8-hydroxyl and other 8-replace, the 5-halo is the 5-bromine particularly, uridylic and cytosine(Cyt) that 5-trifluoromethyl and other 5-replace, 7-methyl guanine and 7-methyladenine, guanozola and 8-azaadenine, 7-deazaguanine and 7-denitrogenation VITAMIN B4 and 3-deazaguanine and 3-denitrogenation VITAMIN B4.Other nuclear base comprises and is disclosed in U.S. Patent number 3,687, those in 808.In these nuclear bases some can be used for increasing the binding affinity of oligomeric compounds of the present invention especially.These nuclear bases comprise the pyrimidine that 5-replaces, and the purine that 6-aza-pyrimidine and N-2, N-6 and O-6 replace comprises 2-aminopropyl VITAMIN B4, the assorted uridylic of 5-and 5-proyl cytosine(Cyt).The 5-methylcytosine substituent has shown to be increased 0.6-1.2 ℃ of nucleic acid duplex stability and is at present preferred base substituent, when with 2 '-the sugar-modified thing of O-methoxy ethyl is more preferably when combining.
The another kind of oligonucleotide of the present invention is modified and is comprised by chemical process part or the conjugate that activity, cell distribution and the cell of one or more enhancing oligonucleotide absorbs is connected to oligonucleotide.These parts include but not limited to lipid part, and for example cholesterol moiety, cholic acid, thioether be (for example, hexyl-S-trityl mercaptan), sulphur cholesterol (thiocholesterol), aliphatic chain are (for example, dodecanediol or undecyl residue), phosphatide (for example, two-hexadecyl-rac-glycerine or 1,2-two-O-hexadecyl-rac-glyceryl-3-H-tricresyl phosphate ethyl ammonium), polyamines or polyglycol chain or or adamantane acetic acid, palmityl part, or octadecylamine or hexyl amino-carbonyl-oxygen base cholesterol moiety.
Related-art technology person knows how to produce the oligonucleotide that contains above-mentioned modification.The invention is not restricted to above-mentioned antisense oligonucleotide.Can use any suitable modification or replacement.
Needn't in given compound, carry out unified modification to all positions, surpass in fact that one above-mentioned modification can be integrated in the individualized compound or even the single nucleosides in oligonucleotide on.The present invention also comprises the antisense compounds as chimeric compound." chimeric " antisense compounds or " block polymer " are antisense compounds in the context of the present invention, oligonucleotide particularly, it comprises two or more chemically different zones, and each zone is made of at least one monomer unit (promptly being Nucleotide under the situation of oligonucleotide compound).These oligonucleotide comprise at least one such zone usually, and wherein said oligonucleotide is accepted to modify with the resistance to nuclease degradation that provides oligonucleotide to increase, the cell absorption of increase and/or the binding affinity to target nucleic acid that increases.Another zone of oligonucleotide can be used as the substrate of the enzyme that can cut RNA:DNA or RNA:RNA hybrid.As example, RNaseH is the cell exonuclease of the double-helical RNA chain of cutting RNA:DNA.Therefore the effect of RNaseH causes the cutting of RNA target, thereby has strengthened the validity of oligonucleotide inhibition of gene expression greatly.Therefore, and compare with the thiophosphatephosphorothioate deoxy-oligonucleotide of identical target region hybridization, when using chimeric oligonucleotide, available usually shorter oligonucleotide obtains suitable result.Can detect the cutting of RNA target thing by gel electrophoresis and (if desired) associated nucleic acid hybridization technology known in the art routinely.
Can two or more above-mentioned oligonucleotide, the composite structure of modified oligonucleotide, oligonucleoside and/or oligonucleotide mimetic forms chimeric antisense compounds of the present invention.
The present invention also comprises pharmaceutical composition and the preparation that comprises as the antisense compounds of describing below of the present invention.
B. gene therapy
The present invention relates to be used to regulate the purposes of any genetic manipulation of cancer marker expression of the present invention.The example of genetic manipulation includes but not limited to gene knockout (for example, use for example recombinate remove the cancer marker gene from karyomit(e)), has or does not have the expression etc. of the antisense constructs of inducible promoters.Can in external or body, nucleic acid construct be sent into cell by using any suitable method.Suitable method is with the nucleic acid construct transfered cell so that the method for (for example, antisence construct) takes place the incident of wanting.Gene therapy also can be used to send other disturbing molecule (for example, stimulating the back at inducible promoter (for example, male sex hormone-responsiveness promotor)) of siRNA or expression in vivo.
To carry by any realization in the whole bag of tricks in the molecule transfered cell of genetic information, described method includes but not limited to the exposed DNA construct of directed injection, with the gold grain bombardment that is loaded with described construct with use the transgenosis of the macromole mediation that for example liposome, biopolymer etc. carry out.Preferable methods is used the gene delivery vector that derives from virus, and described virus includes but not limited to adenovirus, retrovirus, vaccinia virus and adeno associated virus.Have higher efficient because compare with retrovirus, the carrier that derives from adenovirus is the gene delivery vector that preferably is used in vivo nucleic acid molecule being transferred in the host cell.Shown that the multiple solid tumor neutralization that adenovirus carrier changes gene over to animal model in vivo very effectively changes in human solid tumor's xenotransplantation body of immunodeficient mouse.The case description that is used for the adenovirus carrier of transgenosis and method is in the open WO00/12738 of PCT and WO00/09675, Application No. 6,033,908,6,019,978,6,001,557,5,994,132,5,994,128,5,994,106,5,981,225,5,885,808,5,872,154,5,830,730 and 5,824,544, each is incorporated herein by reference in full with it.
Can several different methods give the experimenter with vector administration.For example, in some embodiment of the present invention, use direct injection that vector administration is gone in tumour or the tissue relevant with tumour.In other embodiments, by blood or lymphokinesis use (referring to, for example, PCT discloses 99/02685, is incorporated herein by reference in full with it).The dosage level of exemplary adenovirus carrier preferably 10 8To 10 11The individual carrier granule that joins in the perfusate.
C. Antybody therapy
In some embodiment, the invention provides the antibody of the tumor of prostate of targeted expression cancer mark of the present invention (for example, the fusion of ERG, ETV1 or ETV4 and TMPRSS2).Any suitable antibody (for example, monoclonal antibody, polyclonal antibody or synthetic antibody) can be used in the methods of treatment disclosed herein.In preferred embodiments, the antibody that is used for cancer therapy is humanized antibody.The method that makes the antibody humanization be well-known in the art (referring to for example, U.S. Patent number 6,180,370,5,585,089,6,054,297 and 5,565,332; They are incorporated by reference in this article separately).
In some embodiment, therapeutic antibodies comprises the antibody that produces at cancer mark of the present invention (for example, the fusion of ERG, ETV1 or ETV4 and TMPRSS2), and wherein said antibody is conjugated to cytotoxic agent.In these embodiments, produce the not Normocellular tumour-specific therapeutical agent of target, thereby reduced the harmful side effect of many conventional chemotherapy methods.For some application, can look forward to these therapeutical agents is such pharmacological agents, be described pharmacological agents with acting on the useful reagent, particularly cytotoxic agent that are attached to antibody or other has the anti-cell reagent that kills endotheliocyte or suppress endothelial cell growth or fissional ability.The present invention relates to the purposes of any pharmacological agents that is conjugated to antibody and is sent with activity form.Exemplary anti-cell reagent comprises chemotherapeutics, radio isotope and cytotoxin.Therapeutic antibodies of the present invention can comprise various kinds of cell toxicity part, include but not limited to that radio isotope (for example, iodine-131, iodo-123, technetium (technicium)-99m, indium-111, rhenium-188, rhenium-186, gallium-67, copper-67, Yttrium-90, iodine-125 or astatine-211), hormone is steroid for example, metabolic antagonist is cytosine(Cyt) (for example, Arabinoside, Fluracil, methotrexate or aminopterin for example; Anthracycline; Ametycin), vinca alkaloids (for example, Omaine; Etoposide; Mithramycin) and antitumor alkanisation reagent for example Chlorambucil or melphalan.Other embodiment can comprise the reagent such as the lipid A part of setting accelerator, cytokine, somatomedin, bacterial endotoxin or bacterial endotoxin.For example, in some embodiment, the toxin that therapeutical agent comprises plant, fungi or bacterial origin is A streptomycin, ribosome inactivating protein, α-sarcina (sarcin), aspergillin, restrictocin, rnase, diphtheria toxin or Pseudomonas exotoxin for example, only lifts a small amount of example.In some preferred embodiments, use deglycosylated ricin A chain.
Suggestion under any circumstance, if want, can by use known conjugation techniques (referring to, Ghose etc. for example, Methods Enzymol., 93:280[1983]) so that its on request on by the site of the tumour cell of target target, internalization, discharge or be provided to mode in the blood constitutent, with reagent for example these reagent successfully be conjugated on the antibody.
For example, in some embodiment, the invention provides by the immunotoxin of target cancer mark of the present invention (for example, ERG or ETV1 merge).Immunotoxin is selectively targeted dose the antibody or the fragment of tumour (normally at) and the cytotoxic agent conjugate of toxin moiety for example.Thereby described target agent makes toxin point to carry by the antigenic cell of target and optionally kills these cells.In some embodiment, treatment antibody uses linking agent that height body internal stability is provided (Thorpe etc., Cancer Res., 48:6396[1988]).
In other embodiments, particularly relate in the embodiment of treatment of solid tumors, design has the cytotoxic effect of antineoplastic vascular system (by suppressing vascular endothelial cell growth or cell fission) or the antibody of anti-cell effect.This attack is the blood vessel collapse of wanting to cause being confined to tumour, deprives the tumour cell particularly oxygen and the nutrition of the tumour cell of vascular system tip, finally causes necrocytosis and neoplasm necrosis.
In preferred embodiments, will be mixed with pharmaceutical composition as described below based on the therapeutical agent of antibody.In preferred embodiments, using antibody compositions of the present invention causes measurable cancer to reduce (for example, tumour reduces or eliminate).
D. pharmaceutical composition
The present invention further provides pharmaceutical composition (for example, it comprises expression or the active medicament of regulating and control gene fusion of the present invention).Can use pharmaceutical composition of the present invention in many ways, this depends on what want is part or systemic treatment and pending zone.Use can be local (comprise eye and to (comprise vagina and rectum send) of mucous membrane), lung (for example, by or the suction of powder or aerosol be blown into, comprise and pass through atomizer; In endotracheal, the nose, epidermis and through skin), per os or parenteral using.Parenteral administration comprises intravenously, intra-arterial, subcutaneous, intraperitoneal or intramuscularly or infusion; Or encephalic is for example used in the sheath or in the ventricle.
Be used for the pharmaceutical composition of topical application and preparation and can comprise patch, ointment, lotion, ointment, gel, drops, suppository, sprays, liquid and powder through skin.Conventional pharmaceutical carrier, water-based, powder or butyrous matrix, thickening materials etc. can be essential or want.
Be used for suspension or solution, capsule, wafer or tablet that Orally administered composition and preparation comprise powder or particle, water or non-aqueous media.Thickening material, seasonings, thinner, emulsifying agent, dispersing auxiliary or tackiness agent can be wanted.
Be used in the parenteral, sheath or the aqueous solution that the composition of using in the ventricle and preparation can comprise sterilization, it also can contain buffering matter, thinner and other suitable additive, such as but not limited to penetration enhancers, carrier compound and other medicines acceptable carrier or vehicle.
Pharmaceutical composition of the present invention includes but not limited to solution, emulsion and comprises the preparation of liposome.These compositions can produce from various ingredients, and described component includes but not limited to ready-formed liquid, self-emulsifying solid and self-emulsifying semisolid.
Pharmaceutical preparation of the present invention can exist with unit dosage form easily, and it can be prepared according to the routine techniques that pharmaceutical industries is known.These technology comprise makes activeconstituents and pharmaceutical carrier or vehicle bonded step.Usually the solid carrier by making activeconstituents and liquid vehicle or segmentation equably and closely or the two combine and prepare preparation, then, if desired, for product moulding.
Composition of the present invention can be mixed with any in many possible formulations, such as but not limited to tablet, capsule, liquid sugar sirup, soft gelatin capsule, suppository and enema.Composition of the present invention also can be mixed with the suspensoid in water, non-water or blending agent.Aqueous suspensoid can further comprise the material that increases suspensoid viscosity, and described material for example comprises, Xylo-Mucine, Sorbitol Powder and/or dextran.Suspensoid also can comprise stablizer.
In one embodiment of the invention, pharmaceutical composition can be mixed with the foam use.Pharmaceutical foam comprises these preparation, such as but not limited to emulsion, microemulsion, ointment, jelly and liposome.Although similar substantially in itself, these preparations change on the component of end product and denseness.
The reagent that strengthens the oligonucleotide absorption at cell levels also can join in medicine of the present invention and other composition.For example, cation lipid is lipofectin (U.S. Patent number 5,705,188), positively charged ion glycerol derivative and polycation molecule for example, and for example polylysine (WO97/30731) also increases the cell absorption of oligonucleotide.
Composition of the present invention can contain other extraly and be present in binder component in the pharmaceutical composition usually.Therefore, for example, composition can comprise extra, compatible, pharmaceutically active substance, for example antipruritic, astringent, local anesthetic or anti-inflammatory agent, the material that maybe can comprise the extra various formulations that are used for the physics preparation present composition, for example dyestuff, seasonings, sanitas, antioxidant, opalizer, thickening material and stablizer.Yet, these materials, fashionable when adding, should exceedingly not disturb the biologic activity of the component of the present composition.Preparation can be sterilized, if want, can with can not be nocuously mix with the auxiliary agent of the nucleic acid interaction of preparation, for example, lubricant, sanitas, stablizer, wetting agent, emulsifying agent, the salt that is used to influence osmotic pressure, buffer reagent, tinting material, seasonings and/or aromatoising substance etc.
Certain embodiments of the present invention provide pharmaceutical composition, and it comprises (a) one or more antisense compounds and (b) one or more other chemotherapeutics that work by non-antisense mechanism.The example of this based chemotherapy agent includes but not limited to cancer therapy drug for example zhengdingmeisu, dactinomycin, Dx, bleomycin, mitomycin, mustargen, Chlorambucil, melphalan, endoxan, Ismipur, 6-Tioguanine, cytosine arabinoside (CA), 5 FU 5 fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristin, vincaleucoblastine, etoposide, teniposide, cis-platinum and stilboestrol (DES).Anti-inflammatory drug includes but not limited to nonsteroid anti-inflammatory drugs and reflunomide, and antiviral, includes but not limited to ribavirin, vidarabine, acyclovir and ganciclovir, also can with combination of compositions of the present invention.Other non-antisense chemotherapeutics also within the scope of the invention.The compound of two or more combinations can use together or use in turn.
Administration depends on the seriousness and the responsiveness of the morbid state that will treat, and therapeutic process continues several days to some months, or weakening until healing or realization disease condition.The optimal dose dosage regimen can be calculated according to the observed value of patient's drug disposition accumulation.The dispenser doctor can easily determine optimal dose, dosed administration methodology and repetition rate.The relative efficiency of the visual independent oligonucleotide of optimal dose and changing, and usually can be based on finding effective EC in the animal model in vitro and in vivo 50Or estimate based on embodiment described herein.Usually, dosage is every kg body weight 0.01 μ g to 100g, but every day, weekly, every month or be administered once every year or repeatedly.The treatment doctor can be based on the residence time of medicine in body fluid or tissue and the repetition rate of concentration estimation dosed administration.After successful treatment, make the experimenter keep treatment and can want to prevent disease condition recurrence, wherein use described oligonucleotide with maintenance dose, consumption is every kg body weight 0.01 μ g to 100g, once a day or repeatedly, to per 20 years once.
VII. transgenic animal
The present invention relates to produce the transgenic animal that contain external source cancer marker gene of the present invention (for example, gene fusion) or its mutant and variant (for example, brachymemma or single nucleotide polymorphism).In preferred embodiments, transgenic animal show and compare altered phenotype (for example, marker increase or that reduce exists) with the wild-type animal.Be used to analyze these phenotypes existence or non-existent method and include but not limited to method described herein.In some preferred embodiments, transgenic animal further show tumor growth or cancer sign increase or that reduce.
Transgenic animal of the present invention are used for medicine (for example, cancer therapy) screening.In some embodiment, use and assess effect for transgenic animal and control animal test-compound (for example, suspecting) and control compound (for example, placebo) to the useful medicine of treatment cancer.
Can produce transgenic animal by several different methods.In some embodiment, the embryonic cell of each etap is used to import transgenosis to produce transgenic animal.Etap according to embryonic cell is used diverse ways.Zygote is the target of the best of microinjection.In mouse, it is about 20 microns size that male pronucleus reach diameter, and described diameter can allow duplicate injection 1-2 skin liter (p1) dna solution.Zygote had a main advantage as the target that carries out transgenosis, promptly in most of the cases the DNA of injection can be integrated in the host genome (Brinster etc., Proc.Natl.Acad.Sci.USA 82:4438-4442[1985]) in the past in the spilting of an egg first time.As a result, the cell of all transgenic nonhuman animals will carry the transgenosis of integration.This also is reflected in transgenosis usually and is delivered to effectively in the person's of foundation the filial generation, because 50% sexual cell will contain transgenosis.U.S. Patent number 4,873,191 have described the method that is used for the zygote microinjection; The disclosure of this patent is quoted at this in full with it.
In other embodiments, use retroviral infection that transgenosis is imported among the non-human animal.In some embodiment, by utilizing retroviral vector transfection ovocyte (U.S. Patent number 6,080,912 is incorporated herein by reference) in all cracks of the ovum that retroviral vector is injected into ovocyte.In other embodiments, can be in the developmental non-human embryo of vitro culture to the blastocyst stage.During this period, blastomere can be used as the target (Janenich, Proc.Natl.Acad.Sci.USA 73:1260[1976]) of retroviral infection.Handle by enzyme and to remove zona pellucida and infect (Hogan etc., Manipulating the Mouse Embryo, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, N.Y.[1986]) to obtain effective blastomere.Be used to import genetically modified virus carrier system and normally carry genetically modified replication defect type retrovirus (Jahner etc., Proc.Natl.Acad Sci.USA 82:6927[1985]).By on the cell of the generation virus of individual layer, cultivate blastomere obtain easily and effectively transfection (Stewart, etc., EMBO J., 6:383[1987]).Perhaps, can infect than latter stage.Virus or the injection cell that produces virus can be gone into segmentation cavity (Jahner etc., Nature 298:623[1982]).The great majority person of foundation is genetically modified mosaic, because integrate in the subgroup that only occurs in the cell that forms transgenic animal.In addition, the person of foundation can comprise genetically modified miscellaneous retroviruses inset by the different positions in genome, and it separates in filial generation usually.In addition, though efficient is lower, it also be possible (Jahner etc., the same [1982]) that the intrauterine retroviral infection of the embryo by second trimester of pregnancy will transgenosis imports in kind of the system.The method that other use retrovirus known in the art or retroviral vector form transgenic animal comprise retroviral particle or produce ovum week that the retroviral cell microinjection of handling through mitomycin C goes into zygote or body early embryo in the crack (PCT International Application No. WO 90/08832[1990]; with Haskell and Bowen; Mol.Reprod.Dev., 40:386[1995]).
In other embodiments, transgenosis is imported the stem cell formation embryo who also utilizes in the embryonic stem cell through transfection.By under appropriate condition the vitro culture pre-implantation embryos obtain the ES cell (Evans etc., Nature 292:154[1981]; Bradley etc., Nature 309:255[1984]; Gossler etc., Proc.Acad.Sci.USA 83:9065[1986]; With Robertson etc., Nature 322:445[1986]).Can effectively transgenosis be imported the ES cell by the DNA transfection of carrying out with several different methods known in the art, described method comprises the transfection of coprecipitation of calcium phosphate, protoplastis or spheroplast fusion, lipofection and the mediation of DEAE-dextran.Also can transgenosis be imported the ES cell by the transduction of retrovirus-mediated method or by microinjection.With these after the ES of transfection cell imports in the segmentation cavity of blastocyst stage embryo, it can form the embryo and to the kind system of the chimeric animal of gained make contributions (for this summary, can be referring to Jaenisch, Science 240:1468[1988]).Will before the ES of transfection cell imports segmentation cavity, having integrated genetically modified ES cell with enrichment, suppose that described transgenosis provides the method for carrying out this selection with accepting various selection schemes through the ES of transfection cell.Perhaps, can use the polymerase chain reaction screening to integrate genetically modified ES cell.This technology has been avoided allowing before being transferred to segmentation cavity and has been grown under suitable selection condition through the ES of transfection cell.
In other embodiments, utilize homologous recombination to knock out gene function or formation deletion mutant (for example, the mutant of brachymemma).The method that is used for homologous recombination is described in U.S. Patent number 5,614,396, and this paper quotes as a reference.
Experiment
Provide the following example with proof with further illustrate some embodiment preferred of the present invention and aspect, and should not be interpreted as limiting the scope of the invention.
Embodiment 1ERG and ETV1 gene fusion
A. material and method
The cancer outlier is analyzed (COPA)
In the Oncomine 3.0 that comprises 10,486 microarray experiments, on 132 gene expression data collection, carry out COPA and analyze.In addition, in analyzing, COPA comprises data from the laser capture micro-dissections prostata tissue sample of 99 amplifications.COPA has 3 steps.At first, with the alignment of the meta of genetic expression value, the meta expression values of each gene is set at 0.Secondly, calculate meta absolute deviation (MAD), and, be amplified to 1 by with the MAD of each genetic expression value divided by it.Meta and MAD are used for the conversion with respect to mean value and standard deviation, make the unconventionality expression value suitably interference profile estimate, thereby keep postnormalization.The 3rd the step, list for each gene conversion expression values 75%, 90% and 95%, the fractions according to them sorts gene then, and the precedence table of outlier is provided.
Sample
The tissue that uses is from the radical prostatectomy series of Michigan State University, with from quick necrotomy scheme (Shah etc., Cancer Res 64,9209 (Dec 15,2004)), they the two all be the part of the special scheme of the outstanding research of Michigan State University's prostate cancer (S.P.O.R.E.) tissue core.
Organize that also (Ulm, radical prostatectomy series Germany) obtains from the Ulm of university hospital.Collect all samples from the patient who agrees, obtain the approval of evaluation committee of mechanism under system separately in advance.According to manufacturer's specification sheets, separate total RNA from all samples with Trizol (Invitrogen).Also from RWPE, PC3, PC3+AR (Dai etc., Steroids 61,531 (1996)), LNCaP, VCaP separates total RNA with DuCaP clone.By sex change formaldehyde gel electrophoresis or Agilent Bioanalyzer 2100, checking RNA integrity.Also can use commercial available benign prostate total tissue RNA group (CPP, Clontech).
Quantitative PCR (QPCR)
Basically as (Chinnaiyan etc., Cancer Res 65,3328 (2005); Rubin etc., Cancer Res 64,3814 (2004)) described, use SYBR Green dyestuff, on Applied Biosystems 7300 real-time PCR systems, carry out quantitative PCR (QPCR).In brief, having in the presence of random primer or random primer and the oligo dT primer, using SuperScript III (Invitrogen), the total RNA reverse transcription of 1-5 μ g is being become cDNA.The thermal cycle conditions of using the manufacturer to recommend is used SYBR Green master's mixture (AppliedBiosystems) and each 25ng forward and reverse primer to carry out institute and is responded.To respond and carry out curve analysis, by the electrophoresis on 1.5% sepharose, differentiate product from selected experiment.For each experiment, use sequential detection software 1.2.2 version (AppliedBiosystems), in the exponential phase setting threshold level of QPCR reaction.Use compare threshold cycle (Ct) method (Applied Biosystems User Bulletin#2), measure in each sample each target gene with respect to the amount of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), wherein the cDNA sample is as the calibration factor of described each experiment of legend.By Integrated DNA Technologies, synthetic all Oligonucleolide primers.
(Vandesompele etc., Genome Biol 3, RESEARCH0034 (2002)) described GAPDH primer primer, and table 4 has been listed all other primers.Use the serial dilutions of prostate cancer cDNA or plasmid template, confirmed the efficient that roughly is equal to of primer, so that use relatively Ct method.
The rapid amplifying (RLM-RACE) of the cDNA end of RNA ligase enzyme mediation
According to manufacturer's specification sheets, use GeneRacer RLM-RACE test kit (Invitrogen), carry out the rapid amplifying of the cDNA end of RNA ligase enzyme mediation.At first, based on the expression of ERG or ETV1, select sample by QPCR.Handle the total RNA of 5 micrograms with the Roll Phosphoric acid esterase, remove 5 ' phosphoric acid salt from the mRNA and the non--mRNA of brachymemma, and raise one's hat with nicotinic acid (tobacco acid) Pyrophosphate phosphohydrolase.The few thing of GeneRace RNA is connected on the total length transcript, and uses SuperScript III reverse transcription.In order to obtain 5 ' end, use GeneRacer 5 ' primer and the ETV1 exon 4-5_r of ETV1 or ERG exon 4a_r or the ERG exon 4b_r of GeneRacer 5 ' primer and ERG, with Platinum Taq HighFidelity (Invitrogen) the amplification first chain cDNA.Table S2 has provided primer sequence.By 1.5% agarose gel electrophoresis, differentiate product, cut off band, purifying, and TOPO TA cloned into pCR 4-TOPO.By Michigan State University's dna sequencing core, on ABI Model3730 automatic sequencer, use M13 reverse and M13 forward (20) primer or T3 and T7 primer, two-way order-checking is from the plasmid DNA purification of at least 4 bacterium colonies.The cDNA of RLM-RACE is not used in other mensuration.
The reverse transcription PCR that TMPRSS2:ERG merges
After using aforesaid QPCR to identify TMPRSS2:ERG male case, with Platinum Taq High Fidelity and TPRSS2:ERG primer, the cDNA sample that pcr amplification is identical.Electrophoresis is differentiated product as mentioned above, and the clone advances pCR 4-TOPO, and order-checking.
External male sex hormone is replied
With contrast of 1% ethanol or 1nM synthetic androgen R1881, handle RWPE, LNCaP, VCap DuCaP, PC3 and PC3 cell (3) 24h of personnel selection androgen receptor (PC3+AR) stable transfection.Separate total RNA, and with ERG exon 5-6_f and _ the r primer carries out reverse transcription and QPCR as mentioned above.The ERG/GAPDH relative quantity of each sample is proofreaied and correct the control sample to RWPE.
Fluorescence in situ hybridization (FISH)
To be used for interkinesis fluorescence in situ hybridization (FISH) analysis from (FFPE) tissue slice of the paraffin-embedding of the formalin fixedization of normal peripheral lymphocyte and metastatic prostate cancer sample MET-26 and MET-28.In addition, contain from 13 clinically the tissue Microarray of the FFPE section core of limitation prostate cancer and 16 metastatic prostate cancer samples list, carry out interkinesis FISH.Use fusion double-colored, that the dual signal scheme is estimated TMPRSS2 and ETV1, its middle probe is striden the major part of each locus.Vitamin H-14-dCTP BAC clone RP11-124L22 is used for the ETV1 locus, and the BAC clone RPP11-35CD of digoxin-dUTP mark is used for the TMPRSS2 locus.In order to analyze the gene rearrangement that comprises ERG, use division-signal probe strategy, wherein 2 probes are striden ERG locus (the BAC clone RP11-95I21 of the BAC clone RP11-476D17 of vitamin H-14-dCTP mark and digoxin-dUTP mark).All BAC clones obtain from children's hospital of Auckland institute (CHORI).Before fabric analysis,, verify the integrity and the purity of all probes by hybridizing with lymphocytic diffusion metaphase of normal periphery.As (Rubin etc., Cancer Res 64,3814 (2004); Garraway etc., Nature 436,117 (2005)) described hybridization, washing and the color detection organized.
B. result
The cancer outlier is analyzed
In recent years, describe genetic expression with dna microarray and become the general method that the research cancer is transcribed group (transcriptome).Microarray research provides about deeply the seeing clearly of the molecule heterogeneity of cancer, and often identifies the recruit's hypotype (Valk etc., N Engl J Med 350,1617 (2004)) with tumor histology, patient result and the corresponding disease of treatment response.But, generally speaking, transcribe group (transcriptome) analysis and caused the discovery of new origin cause of formation oncogene.Suppose that causing the remarkable rearrangement of cross expressing of oncogene and high-level copy number to change is obvious in transcribing group (transcriptome) data, but be not the traditional analysis scheme inevitable.
In most of cancer types, observed the heterogeneous collection of illustrative plates of oncogene activation, thereby the collaborating genes activated traditional analysis method (for example, t-check or signal to noise ratio) of searching in the class cancer sample can not be found such oncogene expression collection of illustrative plates.On the contrary, needs are searched the remarkable method of expressing of crossing in the case subclass.The experiment of carrying out in exploitation process of the present invention causes the cancer outlier to analyze the exploitation of (COPA).COPA attempts to be converted and to emphasize and discern outlier (Ross etc., Blood102,2951 (2003)) by using simple digital based on the meta of gene expression atlas and meta absolute deviation.Fig. 5 A has explained this scheme.COPA is applied to Oncomine database (Bittner etc., Nature 406,536 (2000)), and it comprises 132 gene expression data collection representing 10,486 microarray experiments.COPA has correctly discerned several outliers that the gene in recurrence rearrangement or the high-level particular cancers type that increases takes place in wherein known meeting.Analysis concentrates on the outlier of known cause of disease oncogene, and as cancer gene generaI investigation defined (Vasselli etc., Proc Natl Acad Sci USA 100,6958 (2003)), it is arranged in preceding 10 outliers (table 1 and table 3) in the Oncomine data centralization.For example, in acute myelogenous leukemias such as Valk (AML) data centralization, RUNX1T1 (ETO) has 95% intense anomaly value, this with the AML subclass in the known transposition and the consistent (Davis etc. of carcinogenic activity of this gene, Proc Natl Acad Sci USA 100,6051 (2003)) (table 1).This outlier and t (8 with proof; 21) case of transposition is accurately relevant, described t (8; 21) RUNX1 (AML1) and RUNX1T1 (ETO) (Fig. 5 B) are merged in transposition.Similarly, in acute lymphoblastic leukemias such as Ross (ALL) data centralization, PBX1 shows 90% intense anomaly value, this and the known consistent (Segal etc. of E2A-PBX1 transposition that occur in the ALL subclass, J ClinOncol 21,1775 (2003)) (table 1).In addition, the t (1 that characterizes among this unconventionality expression value and this group ALL; 19) E2A-PBX1 transposition be associated fully (figure S1C).
The identification of the outlier of ETS family member ERG and ETV1 in the prostate cancer
Then checked new COPA prediction, concentrate at several independent datas, COPA identifies the intense anomaly value of ERG and ETV1 in the prostate cancer, described ERG and ETV1 are the transcription factor (Lapointe etc. of ETS family of the carcinogenic transposition in 2 known participation Ewing sarcomas and the myelocytic leukemia, Proc Natl Acad Sci USA 101,811 (2004); Tian etc., N Engl J Med 349,2483 (2003)).At (Keats etc. such as Dhanasekaran, Blood 105,4060 (2005)) in, (Dhanasekaran etc. such as Welsh, Faseb J 19,243 (2005)) and (Wang etc. such as Lapointe, Lancet 365,671 (2005)) the prostate cancer gene expression data is concentrated, ERG has 75% higher assessment branch outlier (table 1), and at Lapointe etc. and (Welsh etc., Cancer Res 61 such as Tomlins, 5974 (2001)) data centralization, ETV1 has 90% higher assessment branch outlier (table 1).In a word, at 7 independently in the prostate cancer research, COPA is arranged in ERG or ETV1 in preceding ten aberrant genes 9 times.ERG and ETV1 participate in the carcinogenic transposition in the Ewing sarcoma.5 ' activation domain of EWS gene combines the fusion in territory with 3 ' DNA of ETS family member's high conservative, for example (t (21 for ERG; 22) (q22; Q12)) or ETV1 (t (7; 22) (p21; Q12)), be Ewing sarcoma feature (Lapoint etc., the same; Zhan etc., Blood 99,1745 (2002); Fonseca etc., Cancer Res 64,1546 (2004)).Because it is unnecessary on the function relating to ETS family member's transposition, in each Ewing sarcoma case, only observe a class transposition usually in oncogenic transformation.
Predict, if ERG and ETV1 participate in the development of prostate cancer similarly, their outlier should be to repel mutually, that is to say, each case should be crossed only one that expresses in 2 genes.Sudden change on the function in the unnecessary gene or the gene in the identical carcinogenic approach can not be selected in tumour progression jointly.Checked the associative expression collection of illustrative plates of ERG and ETV1 in several prostate cancer data centralizations, found that they show the outlier of mutual repulsion.Differentiated from 2 ERG that transcribe group (transcriptome) research on a large scale and ETV1 expression map (Wang etc., the same; Cheok etc., Nat Genet 34,85 (2003)), they use different microarray platforms to describe the prostata tissue that rough lumber is cut (Figure 1A, left figure and middle figure).Benign prostate tissue, limitation prostate cancer and metastatic prostate cancer have clinically been described in the research of Lapointe etc., wherein ERG and ETV1 unconventionality expression are limited to prostate cancer and metastatic prostate cancer, and limitation prostate cancer sample has clinically only been described in the research of Glinsky etc.In 2 researchs, prostate cancer is exclusively expressed ERG or ETV1 (Figure 1A, right figure).In the collection of illustrative plates research of 99 prostata tissue samples that obtain by laser capture micro-dissections (LCM), found similar result (Welsh etc., the same).(Figure 1B except the exclusive unconventionality expression of ERG or ETV1, right figure), result from LCM research confirms, ETV1 and ERG only cross in from the epithelial cell of prostate cancer or metastatic prostate cancer and express, and do not express but do not cross in inferring precursor pathology prostatic intraepithelial neoplasm formation (PIN) or contiguous optimum epithelium.Whether with wherein activated gene can be consistent with other transposition that multiple companion is merged, multiple myeloma data sets such as Zhan (Dhanasekaran etc., Nature 412,822 (2001)) have been checked in order directly to determine observed exclusive unusual collection of illustrative plates.The recurrence of heavy chain immunoglobulin promotor and CCND1 or FGFR3 is merged, and is respectively t (11,14) or t (4,14), has characterized the particular subset (Wigle etc., Cancer Res 62,3005 (2002)) of multiple myeloma.These transpositions be reflected in outlier analyze in (Fig. 1 C), CCND1 is 75% higher assessment branch outlier, FGFR3 is 95% the 3rd higher assessment branch outlier (table 1).Except 2 cases, the myelomatosis sample shows exclusive mistake of CCND1 or FGFR3 and expresses (Fig. 1 C, right figure).In a word, the ERG and the ETV1 outlier of striding a plurality of prostate cancer data sets suddenlyd change consistent with other origin cause of formation in the various human malignant tumour.In each prostate cancer sample ERG or ETV1 exclusive cross to express consistent with other tumour, in described other tumour, activated gene can merge biological unnecessary chaperone, for example in multiple myeloma.
The discovery of the recurrence gene fusion of TMPRSS2 and ERG or ETV1 in the prostate cancer.
Measured then that ERG and ETV1 cross the mechanism of expression in each prostate cancer sample.By carrying out quantitative PCR (QPCR), differentiated and crossed the prostate cancer cell line and the clinical sample (Fig. 2 A) of expressing ERG or ETV1.By passing through QPCR, LNCaP prostate cancer cell line and the remarkable expression ETV1 (Fig. 2 A) of mistake of 2 samples (MET-26RP (the remaining primary carcinoma a kind of prostate gland), and MET-26LN (nodus lymphoideus transferring rate)) that obtains from the patient of the metastatic prostate cancer of dying from the hormone resistance.Also by the dna microarray analysis, discovery is also crossed expression ETV1 (Welsh etc. from localized 5 the independent metastasis of different anatomic and from the residual cancer in this patient's the prostate gland, the same), show that the ETV1 activation was occurring in the primary tumo(u)r before generally shifting.Express the prostate cancer cell line VCaP of ERG and the DuCaP from second patient of the metastatic prostate cancer of dying from the hormone resistance and 2 mistakes and also to identify nodus lymphoideus transferring rate (MET-28LN) (Fig. 2 A).These clones separate independently from vertebra metastasis (VCaP) and from the endocranium metastasis (DuCaP) of the patients with prostate cancer of the 3rd hormone resistance (Golub etc., Science 286,531 (1999); Rosenwald etc., Cancer Cell 3,185 (2003)).The common mistake of ERG expressed in these 2 clones, shows that once more the ERG activation occurs in before the generally transfer.In a word, these results show that in the tumor of prostate generating process, specific genetic event can activate ERG or the ETV1 in the single sample.
In the effort that characterizes these genetic events, tested and had sample that high ERG or ETV1 express chromosome amplification (7p21.2 and 21q22.3) in their each positions.By the QPCR of genomic dna, there is not to find to have the amplification (Sotiriou etc., Proc Natl Acad Sci USA 100,10393 (2003)) that each transcript is crossed ERG in the sample of expression or ETV1.Then, measured the generation that DNA resets.Because be used for 5 ' end that the primer of above-mentioned QPCR is positioned at the known breaking point of Ewing sarcoma ERG and ETV1, identical transposition can not occur in the prostate cancer.Therefore, that differentiates in the above demonstrates in the sample that ETV1 crosses expression, has measured the expression level of ETV1 exon by exon walking QPCR.It is right that 5 primers of ETV1 exon 2-7 are striden in use, and the LNCaP cell shows the uniform basically of ETV1 exon of all measurements and cross to express, and the ETV1 exon 2 of 2 MET26 samples and 3 expression ratio exon 4-7 have reduced and surpass 90% (Fig. 2 B).This result's possible explanation comprises alternative splicing, a kind of isotype of new cancer specific or a kind of not rearrangement of report.
In order to characterize total length ETV1 transcript, on LNCaP cell and MET26-LN, carry out the terminal rapid amplifying (RLM-RACE) of cDNA of 5 ' RNA ligase enzyme mediation.In addition, carry out the total length transcript that RLM-RACE obtains ERG among the MET28-LN.For from RLM-RACEcDNA pcr amplification ETV1, to be connected to 5 ' end of complete transcriptional thing with RNA-oligonucleotide complementary forward primer, use exon 4 (in LNCaP cell and MET26-LN, cross express 5 '-the least significant end exon) reverse primer.Use strategy similar to the above, the exon 4 that records ERG is crossed expression in MET28-LN.The reverse primer of this exon is used for the pcr amplification of RLM-RACEcDNA.The order-checking of clone's product, disclosed prostate specific gene TMPRSS2 (28) (21q22.2) with MET26-LN in ETV1 and with MET28-LN in the fusion (Fig. 2 C) of ERG.In MET26-LN, identify 2 kinds of RLM-RACE PCR products.First kind of product TMPRSS2:ETV1a causes the fusion (Fig. 2 C) of exon 4 section starts of the complete exons 1 of TMPRSS2 and ETV1.Second kind of product TMPRSS2:ETV1b causes the exons 1 and 2 and the fusion (Fig. 6) of exon 4 section starts of ETV1 of TMPRSS2.Two kinds of products all are consistent with above-mentioned exon walking QPCR, and wherein MET26-LN shows and crosses the disappearance of expressing in exon 2 and 3.In MET28-LN, identify single RLM-RACE PCR product, order-checking has disclosed the fusion (TMPRSS2:ERGa) (Fig. 2 C) of exon 4 section starts of the complete exons 1 of TMPRSS2 and ERG.
The checking of TMPRSS2:ERG and TMPRSS2:ETV1 gene fusion in the prostate cancer
Based on these results, with the forward primer among the TMPRSS2 and the reverse primer of the exon 4 among ERG and the ETV1, design QPCR primer is right.Use strides that 2 primers of one group of sample of limitation prostate cancer and metastatic prostate cancer case are right clinically from 42, carries out SYBRGreen QPCR, and (Fig. 2, D and E) described representative result.These results confirm that the sample that only has high-caliber ETV1 or ERG is expressed each fusion product that contains TMPRSS2.Although QPCR can produce measurable product after 35 circulations of some negative sample, curve analysis has disclosed the different products in positive and the negative sample, the gel electrophoresis of 40 QPCR analysis cycle after products has only disclosed the primer dimer (Fig. 2, D and E) in the negative fusion sample.Because high GC content (80.3%) causes being difficult to design the primer in the exons 1 of TMPRSS2 fully, can partly explain the formation of primer dimer.But, use Taqman QPCR to confirm TMPRSS2:ERGa, TMPRSS2:ETV1a and the expression of TMPRSS2:ETV1b fused specificity, wherein forward primer is striden each fusion, and in each case, only under the situation identical, detected product (Sotiriou etc., the same) with SYBRGreen QPCR.To be used for the primer of SYBR Green QPCR and the specificity of amplicon in order further confirming, to use the primer identical, at the reverse transcription PCR of the enterprising column criterion of sample sets of Expression of TM PRSS2:ERGa with SYBRGreen QPCR.Obtained the product of similar size, the order-checking of clone's product has confirmed the existence of TMPRSS2:ERGa.Differentiated 2 case PCA16 and PCA17, they express high-caliber ETV1 or ERG respectively, but do not show the evidence (Fig. 2, D and E) of transposition by QPCR.RLM-RACE has supported these results, uses the order-checking of the product of the ETV1 primer generation among the PCA16, discloses the evidence that merges transcript, does not obtain product with the ERG primer among the PCA17.Obtained similar result with the LNCaP cell, RLMRACE or QPCR do not obtain the evidence that merges, and this is consistent with above-mentioned exon walking QPCR.
The summing-up of TMPRSS2 and ETS family member's fusion transcript in the prostate cancer sample
In table 2, summed up the result who merges 3 kinds of different assay methods of transcript from TMPRSS2:ERG and TMPRSS2:ETV1, comprise the order-checking of RLM-RACE product, the order-checking of QPCR and RT-PCR product.Except the QPCR that in all samples, carries out the TMPRSS2 fusion, use several technology on the sample of selecting, to confirm the existence of these fusions.For example, in PCA1 (prostate cancer sample 1), use the order-checking of order-checking, QPCR and the RT-PCR product of RLM-RACE product, identify TMPRSS2:ERGa.By the gel electrophoresis of QPCR curve analysis and QPCR product, PCA4 has produced the amplicon bigger than expection.Subsequently RLM-RACE analyze the complete exons 1 that confirmed TMPRSS2 and ERG the exon 2 section start fusion (TMPRSS2:ERGb) (Fig. 6).The Taqman QPCR that the forward primer of TMPRSS2:ERGb joint is striden in use has confirmed that TMPRSS2:ERGb only exists in PCA4, use the Taqman QPCR of the forward primer stride the TMPRSS2:ERGa joint not produce product (27) in this sample.Only expressing under the situation of ERG or ETV1 excessively respectively, finding the evidence that TMPRSS2:ERG and TMPRSS2:ETV1 merge by QPCR or dna microarray.These results are consistent with observed exclusive expression in outlier is analyzed.
Fluorescence in situ hybridization (FISH) confirms that TMPRSS2:ETV1 transposition and ERG reset
After confirming that TMPRSS2:ETV1 and TMPRSS2:ERG merge the existence of transcript, use the interkinesis fluorescence in situ hybridization (FISH) on paraffin-embedded (FFPE) of formalin fixed sample, obtain evidence in these rearrangements of karyomit(e) level.Use 2 kinds of different probe strategies: the double-colored division-signaling plan of the rearrangement of the double-colored fusion-signaling plan of detection TMPRSS2:ETV1 transposition and detection ERG locus.Be used for having verified these probe strategies (Fig. 3) on 2 cases of RLM-RACE, MET26 and MET28 at first.Use the probe of TMPRSS2 and ETV1, normal peripheral lymphocyte (NPL) shows a pair of redness and pair of green signal (Fig. 3 A).MET26 shows the fusion of a pair of signal, and it is indicating probe overlapping (Fig. 3 B, yellow arrows), and this is consistent with the expression of TMPRSS2:ETV1 transcript in this sample.In addition, identify the low-level amplification of the unanimity of ETV1 locus, as 2 residual signals of ETV1 indicated (Fig. 3 B, red arrow).Similarly, use and to stride 5 of ERG locus ' and the probe in 3 ' zone, observe a pair of yellow signal (Fig. 3 C) among the NPL.In MET28, a pair of probe splits into green and danger signal separately, is indicating the rearrangement (Fig. 3 D, green and red arrow) at ERG locus place.This result is consistent with the expression of TMPRSS2:ERG transcript in this case.Based on these results, list in the serial tissue Microarray that contains from the core of 13 routine limitation prostate cancers and 16 routine metastatic prostate cancers, carry out above-mentioned each fish analysis (Fig. 3 E).Shown in matrix, 23/29 case (79.3%) shows the evidence that TMPRSS2:ETV1 merges (7 example) or ERG rearrangement (16 example).In addition, 12/29 case (41.4%) shows the evidence in the low-level amplification in ETV1 locus place.Report has in the past identified ETV1, and the genome of 7p location is as one of the most common amplification region (Slamon etc., Science 235,177 (1987)) in limitation and the metastatic prostate cancer.But, as if the 7p amplification can not drive ETV1 and express, because occurring in 6, ETV1 amplification has in the case that ERG resets, our transcript data acknowledgement, and none has that high ERG expresses and TMPRSS2:ERG merges and also has high ETV1 expression in 19 samples.In addition, when FISH presents ETV1 amplification and TMPRSS2:ETV1 fusion, the single ETV1 signal that only increases, the signal of amplification fusion.However, the result from this fish analysis confirms that TMPRSS2:ETV1 and ERG are rearranged in the existence of genomic level, and be consistent with above-mentioned transcript data.
TMPRSS2 is the gene of male sex hormone-adjusting, causes the male sex hormone of ERG to be regulated with the fusion of ERG.TMPRSS2 is identified as the Prostato-specific gene at first, and its expression in the LNCaP cell is strengthened by male sex hormone, in its promotor, also contain male sex hormone response element (ARE) (Huang etc., Lancet 361,1590 (2003); Schwartz etc., Cancer Res62,4722 (2002)).The high expression level that research subsequently is verified in normal and tumour prostata tissue, and confirm TMPRSS2 in the prostate cell line of male sex hormone-sensitivity be the male sex hormone adjusting (Schwartz etc., Cancer Res 62,4722 (2002); Ferrando etc., Cancer Cell1,75 (2002); Chen etc., Mol Biol Cell14,3208 (2003); LaTulippe etc., Cancer Res 62,4499 (2002)).In addition, although male sex hormone can not increase the expression of TMPRSS2 among the prostate cancer cell line PC3 of androgen insensitivity, the stably express of androgen receptor in the PC3 cell can cause TMPRSS2 become the male sex hormone responsiveness (Schwartz etc., the same; Ferrando etc., the same; Chen etc., the same; LaTulippe etc., the same).On the contrary, the microarray research of the LNCaP prostate cell line of handling with male sex hormone does not identify ERG or ETV1 is male sex hormone-responsiveness (Jain etc., Cancer Res 64,3907 (2004)), the inspection of their promoter sequence does not disclose total ARE (Sotiriou etc., the same).Predict, merge (table 2), can cause the male sex hormone of ERG to be regulated by 3 in each clone independent DuCaP and the TMPRSS2:ERGa in the VCaP clone that confirm of measuring.Using QPCR to measure ERG expresses, although having confirmed ERG expresses at VCaP and DuCaP cell camber, synthetic male sex hormone R1881 processing can make the untreated contrast of the expression ratio of ERG in the DuCaP cell increase by 2.57 times, and the expression in the VCaP cell increases by 5.02 times (Fig. 4).R1881 compares with untreated contrast after handling, and the expression of ERG is minimum in the PC3 cell (0.73fold) of RWPE (1.37fold), LnCaP (0.86fold), PC3 (1.28fold) and expression androgen receptor, and constant basically.
The microarray analysis of same sample confirms that the ERG in DuCaP and the VCaP cell is the adjusted (Sotiriou etc., the same) in response to male sex hormone only.The invention is not restricted to specific mechanism.In fact, the understanding to mechanism is not that enforcement is essential to the invention.Even so, predict, these results are hinting when having each fusion that contains TMPRSS2, the possible mechanism that the entanglement of ERG or ETV1 is expressed in the prostate cancer.
Table 1. cancer outlier is analyzed (COPA).The gene of known experience origin cause of formation sudden change in cancer has the intense anomaly value.The document evidence of the symptom transposition that " X " expression obtains." XX " specific transposition of expression and the document evidence that in particular studies, characterizes the sample of this transposition." Y " expression is consistent with known amplification.ERG and ETV1 outlier in " * * " expression prostate cancer.
Table 1
Figure A20068004182600791
Figure A20068004182600801
Table 2 has shown the summary of the fusion of TMPRSS2 and ETS family member state in prostate cancer sample and the clone.For all mensuration, positive findings uses " " to indicate with "+" indication, negative findings.Blank cell shows, this sample is not carried out particular assay.Indicate crossing of ERG or ETV1 to express by quantitative PCR (QPCR), indicating this sample also to pass judgment on, and confirmed to express with the cDNA microarray with the sample of asterisk mark.In order to detect TMPRSS2:ERG or TMPRSS2:ETV1 gene fusion, the sample of selecting carried out the ETS family member's that expresses RLM-RACE, the indication of order-checking back contains the sample that TMPRSS2 merges.By QPCR, the TMPRSS2:ETV1 and the TMPRSS2:ERG that measure all samples express.Also use the TMPRSS2 identical to merge primer with QPCR, by the reverse transcription PCR (RT-PCR) of standard, the situation of amplification selection, and amplicon checked order.In the end in the row, shown the sample of evidence with TMPRSS2:ETV1 or TMPRSS2:ERG fusion.
Table 2
Figure A20068004182600811
Figure A20068004182600821
Table 3. cancer outlier is analyzed (COPA).The gene that has shown the known experience origin cause of formation sudden change in cancer that in preceding 10 of Oncomine research, has outlier.The document evidence of the symptom transposition that " X " expression obtains." XX " specific transposition of expression and the document evidence that in particular studies, characterizes the sample of this transposition." Y " expression is consistent with known amplification.ERG and ETV1 outlier in " * * " expression prostate cancer.
Table 3
Figure A20068004182600831
Figure A20068004182600841
The Oligonucleolide primers that table 4. uses in this research.For all primers, gene, base and exon (, using UCSC Genome Browser) have been listed according to the comparison of the described reference sequences of people's gene group meeting in May, 2004 text.Forward primer uses " r " to represent with " f " expression, reverse primer.
Table 4
Figure A20068004182600851
Embodiment 2ETV4 gene fusion
A. material and method
The ETS family that draws in studying expresses
In order to study the expression of ETS family member in the prostate cancer, used 2 prostate cancers to draw and studied.(Lapointe etc., Proc Natl Acad Sci USA 2004; 101:811-6 and Tomlins etc., Science 2005; 310:644-8) be presented in the Oncomine database (Rhodes etc., Neoplasia 2004; 6:1-6).By Interpro strainer ' Ets ' (Interpro ID:IPR000418), identify gene with ETS territory.Use ' intermediate value-center of each gene (median-center per gene) ' option, in Oncomine, set up the Heatmap diagram, colour contrast is set for emphasized that ERG and ETV1 are differentially expressed.
Sample
Prostate cancer tissue (PCA1-5) is from the radical prostatectomy series of Michigan State University, and it is the part of the special scheme of the outstanding research of Michigan State University's prostate cancer (S.P.O.R.E.) tissue core.Collect all samples from the patient who agrees, obtain the approval of evaluation committee of mechanism in advance.According to manufacturer's specification sheets, separate total RNA with Trizol (Invitrogen).Also use commercial available benign prostate total tissue RNA group (CPP, Clontech, Mountain View, CA).
Quantitative PCR (QPCR)
Of (Tomlins etc., the same), use SYBR Green dyestuff, (Applied Biosystems, Foster City carry out QPCR on CA) at AppliedBiosystems 7300 real-time PCR systems.Measure in each sample each target gene with respect to the amount of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).The relative quantity correction of target gene is the relative quantity from benign prostate organizational groups (CPP).(Coralville IA), synthesizes all Oligonucleolide primers by Integrated DNATechnologies.The GAPDH primer is as (Vandesompele etc., Genome Biol 2002; 3:RESEARCH0034) described.The primer of the exon of ETV4 following (from 5 ' to 3 '): ETV4_ exon 2-f:CCGGATGGAGCGGAGGATGA (SEQ ID NO:21), ETV4_ exon 2-r:CGGGCGATTTGCTGCTGAAG (SEQ ID NO:22), ETV4_ exon 3-f:GCCGCCCCTCGACTCTGAA (SEQ ID NO:23), ETV4_ exon-r:GAGCCACGTCTCCTGGAAGTGACT (SEQ ID NO:24), ETV4_ exons 1 1-f:CTGGCCGGTTCTTCTGGATGC (SEQ ID NO:25), ETV4_ exons 1 2-r:CGGGCCGGGGAATGGAGT (SEQ ID NO:26), ETV4_3 ' UTR-f:CCTGGAGGGTACCGGTTTGTCA (SEQ ID NO:27), ETV4_3 ' UTR-r:CCGCCTGCCTCTGGGAACAC (SEQ ID NO:28).Use UCSC Genome Browser, freezing in May, 2004 by RefSeq (NM_001986.1) and the people's gene group of comparison ETV4, the numbering exon.For confirming TMPRSS2:ETV4, QPCR merges transcript, use TMPRSS2:ETV4a-f (AAATAAGTTTGTAAGAGGAGCCTCAGCATC (SEQ ID NO:29)) and TMPRSS2:ETV4b-f (ATCGTAAAGAGCTTTTCTCCCCGC (SEQ ID NO:30)) with ETV4_ exon 4-r, it detects TMPRSS2:ETV4a and TMPRSS2; The ETV4b transcript.
The rapid amplifying (RLM-RACE) of the cDNA end of RNA ligase enzyme mediation
Of (Tomlins etc., the same), according to manufacturer's specification sheets, use GeneRacerRLM-RACE test kit (Invitrogen) to carry out RLM-RACE.In order to obtain 5 ' end of ETV4, use GeneRacer 5 ' primer and ETV4_ exon 4-r or ETV4_ exon 7-r (GAAAGGGCTGTAGGGGCGACTGT (SEQ ID NO:31)), clone the first chain cDNA from PCA5.Clone's product is as (Tomlins etc., the same) described order-checking.From 2 primers to obtaining the equivalence 5 ' end of TMPRSS2:ETV4 transcript.
Fluorescence in situ hybridization (FISH)
(FFPE) tissue slice of formalin-fixed paraffin-embedding is used for interkinesis FISH.Handle the 10min that organizes of deparaffnize with 0.2M HCl, handle 10min at 80 ℃, with proteolytic ferment K (Invitrogen) digestion 10min with 2x SSC.To organize and the BAC probe at 94 ℃ of common sex change 5min, spend the night 37 ℃ of hybridization.Carry out post-hybridization washing 5min with the 2x SSC that contains 0.1% tween 20, use is conjugated to anti--digoxigenin (the Roche Applied Science on the fluorescein, Indianapolis IN) carries out fluoroscopic examination with the streptavidin (Invitrogen) that is conjugated on the Alexa Fluor 594.With the slide glass counterstaining, fixing in containing the ProLong Gold Antifade reagent (Invitrogen) of DAPI.(Leica, Deerfield IL) check slide glass, and (AppliedImaging, Santa Clara CA), take pictures with the CCD camera to use Cyto Vision software system to use Leica DMRA fluorescent microscope.
(Oakland CA) obtains all BAC, by hybridizing checking probe location with lymphocytic diffusion metaphase of normal periphery from BACPAC Resource Center.Merge in order to detect TMPRSS2:ETV4, use RP11-35C4 (at 5 of TMPRSS2 '), a plurality of BAC with 3 ' be positioned ETV4 (away from ETV4 to approaching: RP11-266I24, RP11-242D8, and RP11-100E5).Reset in order to detect ETV4, use RP11-436J4 (at 5 of ETV4 '), a plurality of BAC with 3 ' be positioned ETV4.For each hybridization, differentiate the cancer cells zone by the pathologist, 100 cells of each sample counting.The cell count that the TMPRSS2:ETV4 of report merges is used RP11-242D8, obtains similar result with all 3 ' ETV4BAC.In order to get rid of other rearrangement among the PCA5, merge probe (RP11-35C4 and RP11-124L22) with 2 probes (RP11-266I24 and RP11-242D8) ERG heading signal probes (RP11-95I21 and RP11-476D17) and TMPRSS2:ETV1 and carry out FISH at 3 of ETV4 '.Use QIAFilter MaxiPrep test kit (Qiagen, Valencia CA) separate BAC DNA, the use digoxigenin-or vitamin H-nick translation mixture (Roche Applied Science) synthesising probing needle.
B. result
Preliminary COPA screening causes having the sign (embodiment 1) that the TMPRSS2 of ERG or ETV1 merges.Further predict, the prostate cancer of these gene fusion feminine genders is carried the rearrangement that comprises other ETS family member.By the expression (Rhodes etc. of research from all ETS family members of supervision in the prostate cancer drawing research of Oncomine database, the same), in from each the single cases for prostate cancer in 2 research, tissue (the Lapointe etc. that rough lumber is cut are described in remarkable-one of the expression excessively that identifies ETS family member ETV4, the same) (Fig. 7 A), another describes (LCM) tissue 1 (Fig. 7 B) of laser capture micro-dissections.Because these cases did not have expression ERG or ETV1, and did not have the benign prostate organization table to reveal expression, predict the fusion that contains TMPRSS2 and be responsible for expression ETV4 in these cases.Although ELF3 also crosses in a part of cases for prostate cancer and expresses, in 2 researchs, normal prostata tissue sample also shows significant ELF3 and crosses expression, shows that gene fusion unlikely drives the expression in optimum and cancerous tissue.Thereby, further analyze ETV4 and crossed expression case (called after PCA5 here).
Use confirms the expression of crossing of ETV4 from PCA5 and exon-isolating total RNA of walking quantitative PCR (QPCR).QPCR confirms, compare with blended benign prostate tissue (CPP), the exon 3 of ETV4 ' cross expression (about 900 times) to exon 2 is remarkable in this case, but the prostate cancer of expression ETV4 is TMPRSS2:ERG male (PCA1-2) or negative (PCA3-4) (Fig. 8 A).But, observe the rapid reduction (＞99%) of the expression of the exon 2 of comparing ETV4 with the distal region among the PCA5, this is indicating and may the merging of TMPRSS2, as in TMPRSS2:ERG and TMPRSS2:ETV1 male case viewed (Tomlins etc., the same) in the past.
In order to discern 5 ' end of ETV4 transcript among the PCA5, use the reverse primer in the exon 7, carry out the terminal rapid amplifying (RLM-RACE) of cDNA of RNA-ligase enzyme mediation.RLM-RACE has disclosed 2 kinds of transcripts, every kind contain with 5 ' end (Fig. 8 B) of the sequence composition at about 8kb place, upstream of the TMPRSS2 that merges from the sequence of ETV4.Particularly, 5 ' end of TMPRSS2:ETV4a has 47 base pairs in this zone of the upstream of coming comfortable TMPRSS2, and 5 ' end of TMPRSS2:ETV4b has identical end 13 base pairs.2 kinds of transcripts these 5 ' terminal merge to identical continuous section by the reverse primers in the exon 7 of ETV4, this continuous section by 5 of the exon 3 of adjacent ETV4 ' 9 base pairs of intron and the canonical sequence of the exon 3 of report form.
Use QPCR to confirm 2 kinds of transcript existence in PCA5 and their disappearances in CPP and PCA1-4.In order further to get rid of the existence that comprises from the fusion transcript of the known exon of TMPRSS2, forward primer and ETV4 exon 4 reverse primers in the exons 1 of use TMPRSS2, carry out QPCR,, in CPP or PCA1-5, do not detect product as expection.
Do not know whether other prostate cancer with ETV4 imbalance may contain the TMPRSS2:ETV4 fusion transcript that more is similar to TMPRSS2:ERG and TMPRSS2:ETV1 transcript (it comprises the known exon from TMPRSS2) on the structure.Here the TMPRSS2:ETV4 of report merges the ARE that does not contain the adjacent TMPRSS2 upstream of determining sign.But, evidence suggests, male sex hormone responsiveness enhanser be arranged in the TMPRSS2 sequence that TMPRSS2:ETV4 transcript described herein exists the upstream (Rabbitts, Nature 1994; 372:143-9).However, only participate in the remarkable expression strong hint of crossing of the ETV4 exon of fusion transcript, this gene fusion is responsible for the imbalance of ETV4.In a word, TMPRSS2:ETV4 merge transcript structural support following conclusion, promptly drive ETS family member's imbalance at the regulatory element (rather than the TMPRSS2 sequence of transcribing) of TMPRSS2 upstream.
In order to confirm to have used interkinesis fluorescence in situ hybridization (FISH) by the fusion at TMPRSS2 (21q22) and ETV4 (17q21) genomic gene seat on every side of RLM-RACE and QPCR performance.Use is at 5 of TMPRSS2 ' with at the probe of 3 of ETV4 ', observes the fusion (Fig. 8 D) of TMPRSS2 and ETV4 locus in 65% cancer cells from PCA5.As the further confirmation that ETV4 resets, use probe at 5 of ETV4 ' and 3 ', 64% cancer cells from PCA5 shows heading signal.Also use 2 probes (ERG heading signal probe and TMPRSS2:ETV1 merge probe) on PCA5, to carry out FISH, to get rid of other rearrangement, for each hybridization obtains negative findings at 3 of ETV4 '.
In a word, the result has given prominence to the application of scrutiny outlier in the oncogene expression data, does not show consistent collection of illustrative plates of lacking of proper care (Eisen etc., Proc Natl Acad Sci USA 1998 because most of analytical procedure can be underestimated; 95:14863-8; Golub etc., Science1999; 286:531-7; Tusher etc., Proc Natl Acad Sci USA2001; 98:5116-21), thereby can not identify ETV4 rare in the prostate cancer (98 case in 2).Combined with the identification that TMPRSS2:ERG and TMPRSS2:ETV1 merge, the result shown in shows here, by the following commentaries on classics of ARE or in the ETS family member's of the enhanser mediation of TMPRSS2 upstream imbalance, is the sign that tumor of prostate takes place.
The detection of embodiment 3 gene fusion RNA
This embodiment has described that the target thing is caught, the qualitative detection of amplification and RNA (IVT), described RNA contains the sequence of 4 gene fusion in 4 qualitative test that separate: contain TMPRSS2:ETV1a, TMPRSS2:ETV1b, TMPRSS2:ERGa and the TMPRSS2:ERGb of APTIMA reagent preparation, carry out each HPA with the specific oligonucleotide of suitable target thing, primer and probe and detect.Table 5 has shown the sequence of the oligonucleotide that uses in this mensuration.
Table 5
Figure A20068004182600901
A. material and method
RNA target thing is caught
Lysis buffer contains 15mM biphosphate sodium-hydrate, 15mM anhydrous phosphoric acid hydrogen sodium, 1.0mM EDTA disodium dihydrate, 1.0mM EGTA free acid and 110mM lauryl sulfate lithium, pH6.7.
Target thing capture agent contains 250mM HEPES, the 310mM lithium hydroxide, 1.88M lithium chloride, 100mM EDTA free acid, (the Seradyn that pH6.4 and 1 micron magnetic-particle SERA-MAG of 250 μ g/ml MG-CM carboxylate salt are modified, Inc., Indianapolis, Indiana), it has dT covalently bound with it) 14Oligomer.
Washing soln contains 10mM HEPES, 6.5mM sodium hydroxide, 1mM EDTA, 0.3% (v/v) ethanol, 0.02% (w/v) methyl p-hydroxybenzoate, 0.01% (w/v) propylparaben, 150mM sodium-chlor, 0.1% (w/v) Sodium Lauryl Sulphate BP/USP (SDS), pH 7.5.
RNA amplification and detection
Amplifing reagent is the lyophilized form that contains the 3.6mL solution of 26.7mM rATP, 5.0mM rCTP, 33.3mM rGTP and 5.0mM rUTP, 125mM HEPES, 8% (w/v) trehalose dihydrate compound, 1.33mM dATP, 1.33mM dCTP, 1.33mM dGTP and 1.33mM dTTP, pH 7.5.Reprovision amplifing reagent in 9.7mL amplifing reagent reprovision solution (face as follows).Before the use, add every kind of primer oligomer of 15pmol.
Amplifing reagent reprovision solution contains 0.4% (v/v) ethanol, 0.10% (w/v) methyl p-hydroxybenzoate, 0.02% (w/v) propylparaben, 33mM KCl, 30.6mM MgCl 2, 0.003% phenolsulfonphthalein.
Enzyme reagent is the lyophilized form that contains the 1.45mL solution of 20mM HEPES, 125mM N-acetyl-L-cysteine, 0.1mMEDTA disodium dihydrate, 0.2% (v/v) TRITON7X-100 stain remover, 0.2M trehalose dihydrate compound, 0.90RTU/mL Moloney murine leukemia virus (MMLV) ThermoScript II and 0.20U/mL t7 rna polymerase, pH7.0.For the MMLV ThermoScript II, the activity of 1 unit (RTU) is defined as, at 37 ℃ of synthetic and release 5.75fmol cDNA in 15 minutes, for t7 rna polymerase, the activity of 1 unit (U) is defined as, in 20 minutes, produces 5.0fmol rna transcription thing at 37 ℃.Reprovision enzyme reagent in 3.6mL enzyme reagent reprovision solution (face as follows).
Enzyme reagent reprovision solution contains 50mM HEPES, 1mM EDTA, 10% (v/v) TRITON7X-100,120mM Repone K, 20% (v/v) anhydrous glycerol, pH7.0.
Hybridizing reagent contains 100mM succsinic acid free acid, 2% (w/v) lauryl sulfate lithium, 100mM lithium hydroxide, 15mM aldrithiol-2,1.2M lithium chloride, 20mM EDTA free acid, 3.0% (v/v) ethanol, pH4.7.
Selective reagents contains 600mM boric acid, 182.5mM sodium hydroxide, 1% (v/v) TRITON7X-100, pH8.5.
Detection reagent comprises detection reagent I (it contains 1mM nitric acid and 32mM hydrogen peroxide) and tight detection reagent II (it contains 1.5M sodium hydroxide).
B. measuring method
The target thing is caught
1. be 400 μ L samples in each reaction tube, by the diluent of preparation IVT stock solution in the STM that specifies the copy level, preparation sample.
2. use and repeat transfer pipet, the TCR that 100 μ L is contained TCO adds the appropriate reaction test tube.
3. the use micropipet adds every kind of sample of 400 μ L in the test tube of suitable mark.
4. cover sealed card to test tube, with the moving shelf of have gentle hands jog.Do not want vortex.The incubation shelf is 30 ± 5 minutes in 62 ± 1 ℃ of water-baths.
5. from water-bath, take out shelf, on absorbent material, blot the test tube bottom.
6. guarantee that sealed card is closely fixing.If desired, replace new sealed card, and tight seal.
7. do not take off sealed card, on room temperature incubation shelf 30 ± 5 minutes.
8. shelf was placed on the TCS magnet base 5-10 minute.
9. by dispensing branch pumping APTIMA washing soln, cause to distribute and leave standstill the pump line.By the enough liquid of this system's pumping, making does not have air filled cavity in the line, and all 10 nozzles are carried stable liquid flow.
10. open vacuum pump, first junctor between suction arm and trap bottle disconnects the suction arm.Guarantee that the vacuumometer reading is greater than 25in.Hg.Reach this reading and need 15 seconds.Reconnect arm, guarantee vacuumometer 7 and 12in.Hg between.Stay vacuum pump and catch step to finishing all target things.
Be connected to first group of tip securely 11. will aspirate arm.By tip being reduced into first TTU, the suction all liquid briefly contacts with the test tube bottom up to tip.Do not make tip keep in touch the test tube bottom.
12. after finishing suction, pointed nose is injected their original tip box.For remaining TTU repeat aspiration step, for each sample uses special-purpose tip.
13. dispensing branch is placed on each TTU, and uses distribution to leave standstill pump, the 1.0mLAPTIMA washing soln is delivered into the TTU of each test tube.
14. cover sealed card to test tube, take off shelf from TCS.Vortex once on many test tubes vortex mixed instrument.
15. shelf was placed on the TCS magnet base 5-10 minute.
16. as described in step 13 and 14, the suction all liquid.
17. after the suction, take off shelf from the TCS pedestal the last time, the visual control test tube is to guarantee to aspirate all liquid.If see any liquid, shelf was put back to the TCS pedestal 2 minutes, using the front is the used identical tip of each sample, is this TTU repeat aspiration.
Primer annealing and amplification
1. use and repeat transfer pipet, add the amplifing reagent of 75 μ L reprovisions in each reaction tube, the latter is contained the specific primer of analyte.All reaction mixtures in the shelf should be red now.
2. use and repeat transfer pipet, add 200 μ L oil reagent.
3. cover sealed card, vortex on many test tubes vortex mixed instrument to test tube.
4. incubation shelf 10 ± 5 minutes in 62 ± 1 ℃ of water-baths.
5. shelf is changed in 42 ± 1 ℃ of water-baths over to 5 ± 2 minutes.
6. make shelf in water-bath, take off sealed card carefully, use and repeat transfer pipet adds 25 μ L reprovisions in every kind of reaction mixture enzyme reagent.All reactants should be orange now.
7. cover test tube with fresh sealed card immediately, from water-bath, take out, by moving shelf, mixed reactant with the have gentle hands jog.
8. on 42 ± 1 ℃ of incubation shelfs 60 ± 15 minutes.
Hybridization
1. take out shelf from the preceding water-bath of increasing, be transferred to the amplification rear region.Use and repeat transfer pipet, add the probe reagent of 100 μ L reprovisions, the latter is contained the specific probe of analyte.All reaction mixtures should be yellow now.
2. cover sealed card to test tube, vortex is 10 seconds on many test tubes vortex mixed instrument.
3. incubation shelf 20 ± 5 minutes in 62 ± 1 ℃ of water-baths.
4. from water-bath, take out shelf, room temperature incubation 5 ± 1 minutes.
Select
1. use and repeat transfer pipet, in each test tube, add 250 μ L selective reagentss.All reactants should be red now.
2. cover sealed card to test tube, vortex 10 seconds or up to color even, the incubation shelf is 10 ± 1 minutes in 62 ± 1 ℃ of water-baths.
3. from water-bath, take out shelf.On room temperature incubation shelf 15 ± 3 minutes.
Read TTU
1. guarantee to exist the automatic detection reagent I and the II of enough volumes, to finish experiment.
2. by an empty TTU is placed box location number 1, carry out the WASH operation, preparation LEADER luminometer.
3. TTU is loaded into photometer, operation HC+Rev B method.
C. result
Shown the result of 4 mensuration in table 6-9, each TMPRSS2:ERG and TMPRSS2:ETV1 gene fusion IVT analyze in TCR.
Table 6
TMPRSS2:ETV1a (copy
The IVT/ reaction) RLU
0 0 4,945 4,599
10 10 10 2,185,959 2,268,090 2,284,908
100 100 100 2,270,369 2,302,023 2,272,735
1,000 1,000 2,279,627 2,285,742
Table 7
TMPRSS2:ETV1b (copy IVT/ reaction) RLU
0 0 0 0 0 7,743 6,622 7,370 6,181 7,409
10 10 10 10 10 7,712 7,178 7,302 8,430 8,331
100 100 100 100 100 774,792 285,712 3,361,878 1,349,368 2,757,334
1,000 1,000 1,000 1,000 1,000 3,647,502 3,790,087 3,813,812 3,753,743 3,667,242
Table 8
TMPRSS2:ERGa (copy IVT/ reaction) RLU
0 0 7,938 7,505
10 10 10 2,043,379 387,408 978,457
100 100 100 2,332,764 2,445,544 2,530,239
Table 9
TMPRSS2:ERGb (copy IVT/ reaction) RLU
0 0 5,978 6,284
10 10 2,700,069 2,768,541
100 100 2,883,091 2,779,233
1,000 1,000 2,857,247 2,957,914
The FISH of embodiment 4 gene fusion measures
This embodiment has described the application of fluorescence in situ hybridization (FISH), to confirm 23 rearrangements of carrying among ERG or the ETV1 in 29 prostate cancer samples.The clone experiment shows that crossing of ETS family member expressed in the male sex hormone responsiveness promoter element mediation prostate cancer of TMPRSS2.These results relate to the development of cancer and the molecular diagnosis and the treatment of prostate cancer.
Listed the concrete BAC probe that in FISH measures, uses below.
Measure by the distored clinical FISH among the FISH test ETS family member
● stride the probe of ETV1 and probe test ETV1-TMPRSS2 that one is striden the TMPRSS2 locus merges with one
● the BAC:RP11-692L4 of ETV1
● the BAC:RP11-121A5 of TMPRSS2, (RP11-120C17, PR11-814F13, RR11-535H11)
● the ERG transposition is tested in the probe set with the c-ERG:t-ERG fracture:
The BAC:RP11-24A11 of c-ERG
The BAC:RP11-372017 of t-ERG, RP11-137J13
● with probe set test ETV1 disappearance/amplification, stride the ETV1 locus for one, one with reference to probe on karyomit(e) 7:
The BAC:RP11-692L4 of ETV1
At the BAC on the karyomit(e) 7: the commercial probe on chromosomal kinetochore with reference to probe
● with probe set test ERG disappearance/amplification, stride the ERG locus for one, one with reference to probe on karyomit(e) 21:
The BAC:RP11-476D17 of ERG
BAC:* on karyomit(e) 21 with reference to probe
● with probe set test TMPRSS2 disappearance/amplification, stride the TMPRSS2 locus for one, one with reference to probe on karyomit(e) 21:
The BAC:RP11-121A5 of TMPRSS2, (RP11-120C17, PR11-814F13, RR11-535H11)
BAC:* on karyomit(e) 21 with reference to probe
* the BAC:PR11-32L6 on karyomit(e) 21 with reference to probe, RP11-752M23, RP11-1107H21, RP11-639A7, (RP11-1077M21)
Embodiment 5TMPRSS2:ERG merges relevant disappearance
This embodiment has described and has merged relevant to the existence of common disappearance on karyomit(e) 21q22.2-3 between ERG and the TMPRSS2 with TMPRSS2:ERG.Use people PCA sample, 6 clones and 13 heterograft of wide region, check the association between progression of disease and the clinical effectiveness.
A. material and method
Clinical sample
Under the scheme of IRB approval, collect the prostate gland sample that is used for this research.Characterize all limitation PCA samples clinically by a pathologist, and distribute the Gleason scoring, to eliminate the difference in the pathology report between the observer.With limitation PCA sample collection clinically is a part in the ongoing research approach of Ulm university.Take the sample of hormone resistance from the quick necrotomy scheme of Michigan State University.
Carry out the FISH experiment on 2 PCA result array, they are made up of 897 tissue core (histospots) from 214 patients.Be displayed in Table 10 the summary of patient demographics.All patients 1989 between calendar year 2001 in Ulm university (Ulm, Germany) experience radical prostatectomy and pelvic lymphadenectomy.Preoperative PSA scope is 1-314ng/ml (average 36ng/ml).It is respectively 3.4 and 8.4 years that average and maximum is followed up a case by regular visits to.
Clone and heterograft
Male sex hormone independently (LNCaP) PCA clone of (PC-3, DU-145, HPV10 and 22Rv1) and male sex hormone sensitivity (Manassas VA), and maintains in their defined medium available from U.S. typical case's culture center.HPV10 is derived from cell from senior PCA (Gleason mark 4+4=8), and they have carried out transforming (18) by the HPV18DNA transfection.22Rv1 is the people PCA epithelial cell line that is derived from heterograft, and described heterograft degenerates and the breeding continuously in mouse of recurrence back at the castrating inductive of parent's male sex hormone-dependent CWR22 heterograft.VCAP clone is from vertebra transitivity pathology, and the latter is as the part of the quick necrotomy scheme of Michigan State University.
LuCaP 23.1,35, and 73,77,81,86.2,92.1 and 105 are derived from the disease PCA patient of the hormone resistance of male sex hormone independence.LuCaP 49 and 115 is from androgen-dependent PCA patient.LuCaP 58 is from the untreated patient with metastatic disease in late period clinically, and LuCaP 96 is derived from the prostate gland deutero-tumour of growing in the PCA patient of hormone resistance.LuCaP 49 (being derived from the nethike embrane quality) and LuCaP 93 are hormone-insensitive (androgen receptor [AR]-feminine gender) minicell PCA.These 2 kinds of heterograft show the neuroendocrine phenotype.LuCaP 23.1 is maintained in the SCID mouse,, keep other heterograft by tumour being implanted in the male BALB/c nu/nu mouse.
Use interkinesis FISH to measure TMPRSS2:ERG and merge state
The fish analysis of the transposition of TMPRSS2:ERG such as top and former (Tomlins, etc., Science 310:644-8 (2005)) are described.This fracture is measured and is presented in Figure 11 and 14.For the ERG that analyzes on the karyomit(e) 21q22.2 resets, use the fracture probe system, it is made up of the BAC clone RP11-24A11 (finally puting together to produce danger signal) of vitamin H-14-dCTP mark and the BAC clone RP11-137J13 (finally puting together to produce green) of digoxigenin-dUTP mark, and the two strides the zone, contiguous kinetochore and the zone, terminal kinetochore of ERG locus respectively.All BAC clones obtain from the children's hospital of Auckland institute (CHORI) that is positioned at Canadian Auckland.
Use this fracture probe system, the nucleus that does not have ERG to reset shows 2 pairs of redness arranged side by side and green.Redness-green arranged side by side forms the yellow signal that merges.Having nucleus that ERG resets has shown and the fracture of a pair of redness-green arranged side by side has caused producing the allelic single redness of transposition and the allelic combination yellow signal of green and non-transposition in each hole.Before fabric analysis,, verify the integrity and the purity of all probes by hybridizing with the diffusion in mid-term of normal peripheral lymphocytic cell division.As in the past (Garraway, etc., Nature 436:117-22 (2005); Rubin, etc., Cancer Res.64:3814-22 (2004)) described, organize hybridization, washing and fluoroscopic examination.In 59%PCA case, can estimate at least one TMA core from 2 TMA.Use the technical difficulty of this mensuration to comprise, the diagnostic materials and the superpose cell that lack the faint probe signals of assessment have stoped accurate diagnosis.Remaining analysis concentrates on the PCA of limitation clinically that 118 examples can estimate.15 examples have the corresponding prohormone that also can estimate lymphnode metastatic sample just.
Use and be equipped with suitable colour filter, CCD (electric charge coupling devices) pick up camera and Cyto VisionFISH imaging and catch software (Applied Imaging, San Jose, OlympusBX-51 fluorescent microscope CA), analytic sample under the 100x oil-immersion objective.By 2 pathologists evaluation that experimentizes independently, the two all has the experience of analyzing interkinesis FISH experiment.For every kind of situation, attempt at least 100 nucleus of each case scoring.If find significant difference between 2 pathologists' result, this case is judged by the 3rd pathologist.
Oligonucleotide SNP array analysis
Although the SNP array has a mind to be used for gene type allelotrope, the SNP array data can provide that (Lieberfarb is etc., Cancer Res 63:4781-5 (2003) about heterozygosity forfeiture; Lin is etc., Bioinformatics 20:1233-40 (2004)) and the information of the detection that changes of copy number (Zhao, etc., Cancer Cell 3:483-95 (2003)).Use the SNP array analysis, can differentiate and verify the gene (MITF) that in comprising melanomatous various cancers, increases (Garraway, etc., Nature 436:117-22 (2005)) and PCA (TPD52) (Rubin, Deng, Cancer Res.64:3814-22 (2004)).
SNP on the 100K array detects the minimizing of representing from genome.Digest the 250ng genomic dna of 2 equal portions respectively with XbaIHindIII.The fragment of digestion is connected on the oligonucleotide connector independently.Under the segmental condition of amplification 200-2000bp PCR, the product that uses single PCR primer amplification to obtain.These fragments are represented genomic sub level branch.The SNP that spreads out on array is by preliminary election, because they are positioned at these XbaI and HindIII fragment, and have been verified as on array and detect strongly.The DNA of the amplification of labeled derivative set then further separates, and hybridization, to separate HindIII and XbaI oligonucleotide SNP array.
With GeneChip Scanner 3000 scanning arrays.Obtaining gene type with GeneChip operating system 1.1.1 and Affymetrix gene type instrument 2.0 softwares calls with signal quantitative.Only further analyze array with the rate of calling above 90% gene type.The pre-treatment raw data file, and in dChipSNP (Lin, etc., Bioinformatics 20:1233-40 (2004)), observe.More specifically, pre-treatment comprises, use one group of constant probe, array data is standardized into the baseline array, use (PM/MM) method (Li subsequently based on model, Deng, Proc.Nat ' l Acad.Sci.USA 98:31-6 (2001)) handle, to obtain the single intensity level of each SNP in each sample.
TMPRSS2:ERG and TMPRSS2:ETV1 merge the quantitative PCR of transcript
On DNA engine Opticon 2 machines, use SYBRGreen dyestuff (Qiagen) to carry out QPCR from MJ Research.Having in the presence of the random hexamer, using TAQMAN reverse transcription reagent (Applied Biosystems), total RNA reverse transcription is being become cDNA.Carry out all QPCR reactions with SYBRGreen master's mixture (Qiagen).Design all Oligonucleolide primers at Integrated DNATechnologies.Use Tomlin etc. (Science310:644-8 (2005)) described and to merging specific primer:
TMPRSS2:ERG_f：TAGGCGCGAGCTAAGCAGGAG(SEQ ID NO：55)，
TMPRSS2:ERG_r：GTAGGCACACTCAAACAACGACTGG(SEQ ID NO：56)，
TMPRSS2:ETV1_f CGCGAGCTAAGCAGGAGGC，(SEQ ID NO：57)
TMPRSS2:ETV-1_r：CAGGCCATGAAAAGCCAAACTT(SEQ ID NO：58)。
The GAPDH primer as before (Vandesompele, etc., Genome Biol 3:RESEARCH0034 (2002)) described.Use forward and the reverse primer of 10 μ Mol, operate according to the thermal cycle conditions that the manufacturer recommends.Use Opticon Monitor analysis software 2.02 editions, in the exponential phase setting threshold level of QPCR reaction.Use compare threshold cycle (Ct) method (Applied Biosystems User Bulletin#2), measure in each sample each target gene with respect to the amount of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).To respond and carry out curve analysis, by the electrophoresis on 2% sepharose, differentiate product from selected experiment.
Statistics
Study clinical and the pathology parameter, be associated with the existence of rearrangement state and disappearance.Suitably use chi square test and Fisher rigorous examination.Use Kaplan-Meier to analyze and set up the survivorship curve and the genome change parameter of pathological no Prostato-specific antigens recurrence.Use the Log-permutation tests to estimate related statistical significance.Get rid of and have the patient that new in advance auxiliary hormone is eliminated therapy.(SPSS Inc., Chicago IL) carry out all statistics to SPSS 13.0 under the use Windows, and significance level is 0.05.
B. conclusion
Detect the disappearance on the karyomit(e) 21 relevant with TMPRSS2:ERG gene rearrangement
In order to characterize the frequency that TMPRSS2:ERG resets among the PCA, use from the improved FISH of (Science 310:644-8 (2005)) described mensuration such as Tomlins and measure.Initial FISH measure use be positioned at kinetochore 3 ' and the ERG of 5 ' end, terminal kinetochore on 2 probes.Newly be determined at terminal kinetochore direction and move 5 ' probe (Figure 14).Use PCA screening micro-array tissue (TMA), observe about 70% the PCA (Figure 11 A and 11B) that TMPRSS2:ERG resets of showing and also show disappearance (Figure 11 C and 11D) with the corresponding green of telomeric 5 ' ERG probe, this shows this chromosomal region of disappearance.Use 100K oligonucleotide SNP array to characterize the scope of these disappearances.By studying 30 PCA samples, comprise at the beginning of clone, heterograft and the prohormone and the transitivity PCA sample of hormone resistance, identify the genome (Figure 12 A-C) between last ERG of karyomit(e) 21q23 and the TMPRSS2.
By FISH and/or qPCR, measure the rearrangement state (Figure 12 A, grey and light blue vitta) of TMPRSS2:ERG and TMPRSS2.ETV1 among these 30 PCA.At LuCaP 49, LuCaP 93, ULM LN 13, and MET6-9, MET18-2, MET24-28, and observe discrete genomic deletion in the TMPRSS2:ERG rearrangement male sample that comprises zone between TMPRSS2 and the ERG locus of MET28-27.The degree of these discrete disappearances is heterogeneous.At LuCaP 35, LuCaP 86.2, among LuCaP 92.1 and the MET3-81, observe on the karyomit(e) 21 that comprises the zone between TMPRSS2 and the ERG locus genomic deletion widely.VCaP clone and heterograft LuCap 23.1 do not show the disappearance in this zone.Sample subclass for 45% (5/11), disappearance occurs near the ERG introne 3.For the sample of great majority 64% (7/11), near the disappearance end the SNP is positioned at TMPRSS2 (the next SNP of kinetochore direction is that about 100Kbp is far away endways).VCaP clone has shown along the copy number of whole karyomit(e) 21 to be increased.
Reset the male tumour for TMPRSS2:ERG, the PCA of 71% (5/7) hormone resistance shows the disappearance between TMPRSS2 and the ERG locus, only just identifies disappearance in the transitivity PCA sample (ULM LN 13) in 25% (1/4) prohormone.There is significant homogeneity in the disappearance border of 2 different subclasses, and this starting point by disappearance is distinguished---at 38.765Mb or 38.911Mb.The PCA clone of these standards (PC-3, LNCaP, DU-145, or CWR22 (22Rv1)) does not all show TMPRSS2:ERG or TMPRSS2:ETV1 and merges.Several LuCap heterograft show the TMPRSS2:ERG with disappearance merges, and comprises LuCaP 49 (setting up from nethike embrane matter) and LuCaP 93, and the two all is hormone-insensitive (androgen receptor [AR]-feminine gender) minicell PCA.
In the case smaller subset that has and do not have TMPRSS2:ERG to reset, the copy number of observing ERG increases.The VCaP clone that is derived from the PCA of hormone resistance shows significant copy number increase (Figure 12 A-C) on the karyomit(e) 21, and this confirms by FISH.
TMPRSS2:ERG in prostate cancer sample and the prohormone nodus lymphoideus transferring rate just originally resets
For frequency and the potential clinical significance that characterizes these observationss, 118 limitation PCA cases have clinically been checked by FISH.Be displayed in Table 10 clinical and the pathology demography.Confirm that as PSA level before high tumour rank (Gleason grade), pathologic state and the treatment this group patient is in palindromia high-risk.Use is from the section of the normal structure of this group, big zone that wherein can microscopy PCA, and it is homogeneity that the TMPRSS2:ERG that observes given tumour resets.The TMA experiment confirm these observationss.In the PCA case, wherein take 3-6 core from the different zones of tumour, observe TMPRSS2:ERG and reset state 100% consistence of (promptly existing or disappearance).Also observe, in the case that the TMPRSS2:ERG that contains disappearance resets, in 97.9% (94/96) case, in all TMA cores, observe disappearance from same patient.
Table 10: by Radial Protatectomy treatment 118 the clinical and pathology demography * of limitation patients with prostate cancer clinically
Figure A20068004182601031
* be not that all 118 cases can both obtain all data
Former PCA sample 49.2% and 41.2% prohormone just in the transitivity LN sample, identify TMPRSS2:ERG and reset (Figure 13 A).Former PCA sample 60.3% (35/58) and 42.9% (3/7) have prohormone that TMPRSS2:ERG resets just in the lymphoglandula tumour, observe the disappearance (green) (Fig. 1 C-D) of terminal centromeric probe.
Exist former of coupling and prohormone just in the case of lymphoglandula tumour at 15,100% consistence that exists TMPRSS2:ERG to reset state, 47% (7/15) to showing rearrangement.Centering 42.9% (3/7) is as one man observed the disappearance of terminal kinetochore (green) probe.
TMPRSS2:ERG resets state and prostate cancer progress
Observe the association (Figure 13) between rearrangement state and clinical and the pathology parameter.In the late tumor stage of higher per-cent (pT) PCA case (p=0.03), to observe TMPRSS2:ERG and reset (Figure 13 B) with disappearance, metastatic disease is present in (pN in the local lymphonodi pelvini oTo pN 1-2) (p=0.02).The clinical effectiveness (wherein can obtain follow up data) of also having estimated the association between the TMPRSS2:ERG rearrangement that has and do not have to lack and having failed and record by 70 patients' prostate specific antigen (PSA) biological chemistry.Gleason grade, tumour stage, nuclear level and lymphoglandula state are the good predict factors (all p-value＜0.0005) of PSA biological chemistry failure.Observe trend in the single argument level, the survival advantage of no PSA recurrence in the PCA case that the TMPRSS2:ERG that showing does not have disappearance resets is measured as measuring by FISH.
Embodiment 6 and the Cancer-Related TMPRSS2:ERG gene fusion of lethal prostate gland
In the former research, 5 of TMPRSS2 (21q22.3) '-non-translational region and ETS transcription factor family member ERG (21q22.2), ETV1 (7p21.2) (Tomlins, Deng, Science310:644-8 (2005)) or ETV4 (Tomlins, Deng, Cancer Res.66 (7): 3396-400 (2006)) gene fusion can provide the mechanism that the mistake of ETS gene is expressed in most of prostate cancers.In addition, the fusion of male sex hormone regulatory gene TMPRSS2 and oncogene shows that progression of disease can change based on these molecular isoforms.The most common mechanism of gene fusion is the genomic dna (Figure 17 A and B) of about 2.8 megabasses between disappearance TMPRSS2 and the ERG.This embodiment has described based on the transfer of the existence of general T MPRSS2:ERG gene fusion or the danger of prostatic cancer specific death.
A. method
The study population is included in 1977 to 1991 in Sweden
Figure A20068004182601041
University hospital diagnoses out early prostate cancer (Tla-b, Nx, M0) people, they because Symptomatic benign prostatic hyperplasia and as transurethral resection of the prostate (TURP) or excise adenoma as described in (J.Urol.175 (4): 1337-40 (2006)) such as Andr é n through bladder.Baseline evaluation during diagnosis comprises physical examination, chest radiography, bone scanning and bone X line photography (if desired).Do not tie by stages.Because this evaluation does not provide the evidence of distant metastasis, the regular follow-up patient accepted clinical examination, laboratory test and bone scanning every 6 months during after the diagnosis preceding 2 years, subsequently with 12 months interval.Determine that by bone scanning the patient of taking place to shift treats with the androgen-deprivation therapy after showing symptom.
By the researchist comment on medical record determine the group in the cause of death.Compare with the Sweden record of deaths, show greater than 90% consistence, systematically cross the low report or any cause of death of too high report (Johansson, etc., Lancet1 (8642): 799-803 (1989)) about the checking research of the cause of death.The mortality ratio of following up a case by regular visits to of this group is 100%, does not miss the patient who follows up a case by regular visits to before in October, 2005.The research terminal point is defined as the development (meta is followed up a case by regular visits to 9.1 years time, maximum 27 years) of distant metastasis or prostatic cancer specific death.
All TURP samples are commented on by a pathologist, to confirm the diagnosis of prostate cancer, determine Gleason scoring and nuclear level, and as estimation tumor load as described in (J.Urol.175 (4): 1337-40 (2006)) in the past.Make by hand array instrument assembling micro-array tissue (Rubin, etc., Cancer Epidemiol.Biomarkers Prev.14 (6): 1424-32 (2005)).Use is measured from the improved fluorescence in situ hybridization of being described by (Science 310:644-8 (2005)) such as Tomlins at first of mensuration (FISH), passes judgment on the frequency that TMPRSS2:ERG resets in the prostate cancer.Newly be determined at terminal kinetochore direction and move the about 600kb of 5 ' probe.In 92 cases for prostate cancer, can estimate at least one TMA core.
B. result
Go out in man's group of localized cancer in this diagnosis based on colony, the frequency that TMPRSS2:ERG merges is 15.2% (14/92) (Figure 17 A and B).TMPRSS2:ERG merges male tumour most probable and has higher Gleason scoring (2 side P=.014) (table 11).In order to pass judgment on the relation of fusion state and lethal prostate cancer, use the accumulation incidence to return.Observe the existence of TMPRSS2:ERG gene fusion and the remarkable association (Figure 17 C) between transfer or the disease specific death, accumulation incidence (CIR) is 3.6 (P=.004,95% fiducial intervals [CI]=1.5-8.9).When regulating the Gleason scoring, CIR is 2.4 (P=.07 and 95%CI=0.9-6.1).The invention is not restricted to specific mechanism.In fact, the understanding to mechanism is not that enforcement is essential to the invention.Even so, predict, based on the homogeneity of the TMPRSS2:ERG gene fusion in the specific tumors cell and it existing in the aggressive prostate cancer (forming) only with respect to prostatic intraepithelial neoplasm, predict, this is early stage incident, and this may partly facilitate Gleason collection of illustrative plates phenotype biology behind.
Table 11: the prognosis factor of passing through the stratified localized prostate cancer of TMPRSS2:ERG gene fusion state in man's group of pre-period management
Figure A20068004182601061
* use the t check or the chi square test of continuous variable and absolute variable respectively, contrasted clinical parameter with experimenter that TMPRSS2:ERG merges and the clinical parameter that does not have the experimenter of TMPRSS2:ERG fusion.
* obtains the Gleason scoring by summing up main and less important Gleason collection of illustrative plates.
* * is for a case, and level is not examined in assessment.
* * * will be survived 12 years and do not form the individual segregation growth stage survivor who shifts or die from prostate cancer at least before in October, 2005.
Survival is become the short-term survivor less than 12 years and the individual segregation that form to shift.
The TMPRSS2:ETS that embodiment 7 detects in the patients with prostate cancer urine merges
A. material and method
Urine is collected, and RNA separates and amplification
Before needle biopsy or radical prostatectomy, obtain urine samples from the patient who experiences digital examination per rectum.Homaluria is advanced to contain in the urine collection cups of DNA/RNA sanitas (SierraDiagnostics).For isolation of RNA, 4 ℃, at the centrifugal minimum 30ml urine of 400rpm 15min.RNAlater (Ambion) is added in the urine settling, before RNA separates, be deposited in-20 ℃.According to manufacturer's specification sheets, use Qiagen RNeasyMicro test kit, separate total RNA.According to manufacturer's specification sheets, use OmniPlex to transcribe group (Whole transcriptome) amplification (WTA) test kit (RubiconGenomics) entirely, total RNA that increases (Tomlins etc., Neoplasia 8:153[2006]).The total RNA of 25 nanograms is used for the WTA library and analyzes, and the WTA pcr amplification is carried out taking turns in the cDNA library.Use QIAquick PCR purification kit (Qiagen), the product of purifying amplification.About the clone evidence of notion experiment, the VCaP or the LNCaP cell branch that specify number are gone in the 1ml sterile urine, as described in about excretory urine, handle sample.
Quantitative PCR
Basically as (Tomlins etc., Neoplasia 8:153[2006], Tomlins etc., Science 310:644[2005], top embodiment 1) described, quantitative PCR (QPCR) is used to detect ERG, ETV1 and TMPRSS2:ERG transcript from the cDNA of WTA amplification.About each QPCR reaction, the cDNA that 10ng WTA is increased is used as template.The reactant of ERG, ETV1, PSA and GAPDH uses 2x Power SYBR Green master's mixture (AppliedBiosystems) and 25ng forward and reverse primer.The reactant of TMPRSS2:ERGa uses 2xTaqman universal PC R master's mixture and final concentration forward and reverse primer and the 250nM probe as 900nM.Measure about Taqman, think that the Ct value does not show amplification greater than 38 round-robin samples.For all samples, the amount of ERG and ETV1 is standardized into the amount of GAPDH.Get rid of the sample of insufficient amplification from further analysis, indicating the relatively poor recovery of prostatic cell in the urine with PSA.ERG (exon 5_6 forward) and ETV1 (exon 6_7) have been described 2, GAPDH 3, and PSA 4Primer.As follows to specific Taqman primer of TMPRSS2:ERGa and probe (the MGB mark):
TM-ERGa2_MGB-f；CGCGGCAGGAAGCCTTA(SEQ ID NO：70)
TM-ERGa2_MGB-r；TCCGTAGGCACACTCAAACAAC(SEQ ID NO：71)，
The TM-ERGa2_MGB-probe; 5 '-MGB-CAGTTGTGAGTGAGGACC-NFQ-3 ' (SEQID NO:72)
Fluorescence in situ hybridization (FISH)
(FFPE) section from the paraffin-embedding of the thick formalin fixed of the 4 μ m of needle biopsy of coupling is used for interkinesis fluorescence in situ hybridization (FISH), processing, and hybridize, as in the past (embodiment 2 and Tomlins etc., Cancer Res 66:3396[2006]) described.As in the past (Tomlins etc., Cancer Res 66:3396[2006]; Tomlins etc., Science 310:644[2005]; Top embodiment 1 and 2) described, preparation detects the BAC probe that ERG resets, RP11-95I21 (at 5 of ERG ') and RP11-476D17 (at 3 of ERG ').
B. result
This embodiment has described in digital examination per rectum thick, merges existence in the prostate cancer cell of transcript in the urine into of coming off by TMPRSS2:ETS, detects the noninvasive method of prostate cancer.In Figure 33, shown the result.As the evidence of notion, use sterile urine, it is studied with the prostate cancer cell line of expressing high-caliber ERG and TMPRSS2:ERG (VCaP) or high-caliber ETV1 (LNCaP).Shown in Figure 33 A, by quantitative PCR (QPCR), can detect ERG among the VcaP (1,600 cell) exclusive cross express and LNCaP (16,000 cell) in ETV1 exclusive cross expression.
VCaP and LNCaP cell and GAPDHC by association study t(threshold cycle) value is observed in some cases, and the urine that the patient after digital examination per rectum obtains contains enough reliable detection ERG or ETV1 crosses the cell count of expression.Thereby, before QPCR analyzes, use OmniPlex to transcribe group (Whole transcriptome) amplification entirely, total RNA that amplification is collected from the urine of suffering from the patient of prostate cancer under a cloud.Use this strategy, pass judgment on one group of 16 patient, wherein before needle biopsy, after digital examination per rectum, obtain urine, to detect prostate cancer.The assessment subsequently of needle biopsy confirms that this group contains 4 benign prostate patients, and 1 has senior prostatic intraepithelial neoplasm and forms (HGPIN) and 11 and have prostate cancer.In addition, pass judgment on one group of 3 patients with prostate cancer, wherein before radical prostatectomy, after digital examination per rectum, collect urine.
Be displayed in Table 12 stack features.Each urine sample is from the patient of uniqueness, and assigned I D.Indicate the source (examination of living tissue in advance or radical prostatectomy (RP)) of sample.Indicate diagnosis after the needle biopsy (comprise that optimum, senior prostatic intraepithelial neoplasm forms (HGPIN), and prostate cancer (PCa)).For after needle biopsy, being diagnosed as patient, indicate main Gleason, less important Gleason and Gleason overall score with prostate cancer.For all patients,, report examination of living tissue PSA (ng/ml) and age in advance if can obtain.
Table 12
Sample source Diagnosis Examination of living tissue Gleason Major Examination of living tissue Gleason Minor Examination of living tissue Gleason scoring PSA (ng/ml) before the examination of living tissue
Before the examination of living tissue Optimum 4.7
Before the examination of living tissue Optimum 8.3
Before the examination of living tissue Optimum 6.7
Before the examination of living tissue Optimum 4
Before the examination of living tissue HGPIN 9.7
Before the examination of living tissue Pca 3 4 7 3.3
Before the examination of living tissue Pca 3 3 6 5.99
Before the examination of living tissue Pca 3 3 6 2.8
Before the examination of living tissue Pca 3 3 6 5.9
Before the examination of living tissue Pca 4 4 8 10.6
Before the examination of living tissue Pca
Before the examination of living tissue Pca 4 5 9 11.8
Before the examination of living tissue Pca 3 4 7 5.5
Before the examination of living tissue Pca 3 3 6 3.8
Before the examination of living tissue Pca 4 5 9 19.3
Before the examination of living tissue The Pca-treatment 3 3 6
Pre-RP Pca
Pre-RP Pca
Pre-RP Pca
In the needle biopsy group, 5 patients are differentiated to be the remarkable expression ERG that crosses, and wherein one is diagnosed as by needle biopsy has HGPIN, and other 4 be diagnosed as and have prostate cancer.In the radical prostatectomy group, differentiated to having high ERG expression (Figure 33 B) for one in 3 patients with prostate cancer.In from any patient of any group, do not detect ETV1 and cross expression.In order to confirm the expression of TMPRSS2:ERG in crossing the sample of expressing ERG, be used for TaqMan primer/probe assay of specific amplification TMPRSS2:ERGa.This measures the strong amplified production of VCaP cell from Expression of TM PRSS2:ERGa (Tomlins etc., Science 310:644[2005]).In addition, from 5 in 6 urine samples crossing the patients with prostate cancer express ERG, also Expression of TM PRSS2:ERGa (Ct value 29.8-38.9), and do not have Expression of TM PRSS2:ERGa from 10 samples of the patient who did not have expression ERG.Express ERG and the sample of non-Expression of TM PRSS2:ERGa as crossing, this sample may be expressed other isotype that merges transcript, for example TMPRSS2:ERGb or the fusion transcript that identifies recently (Soller etc., Genes Chromosomes Cancer 45:717[2006]; Yoshimoto etc., Neoplasia 8:465:2006).In order to confirm that existence that TMPRSS2:ERG merges transcript can indicate the existence of TMPRSS2:ERG male cancerous tissue, the probe that is used for detecting the ERG rearrangement on the tissue slice from the coupling of representative case carries out fluorescence in situ hybridization (FISH).From urine, having detectable TMPRSS2:ERG transcript and 3 patients that diagnose out cancer, the tissue that obtains mating, a patient has detectable TMPRSS2:ERG transcript and diagnoses out PIN in urine, 2 patients do not have detectable TMPRSS2:ERG transcript and diagnose out cancer.Shown in Figure 33 B, record by FISH, diagnose out cancer, still in their urine, do not have the patient of detectable TMPRSS2:ERG transcript in cancerous tissue, not have the ERG rearrangement for 2.Record by FISH, the ERG that all 3 patients that diagnose out cancer and have a detectable TMPRSS2:ERG transcript in their urine also show in the cancerous tissue resets.At last, the ERG that do not show in the senior PIN tissue of the patient who diagnoses out PIN and have a detectable TMPRSS2:ERG in their urine resets.This shows that this patient may have the cancer of not diagnosing out in other place beyond prostate gland, causes the existence of detectable TMPRSS2:ERG transcript in their urine.
TMPRSS2 in embodiment 8 prostate cancers and ETS family gene merge
This research has been described 111 operative treatments American analysis-by-synthesis of resetting frequency based on TMPRSS2 and ETS family gene in the group of screening of limitation prostate cancer clinically.
A. material and method
Research colony, clinical data and prostate gland sample collection:
As the source of limitation prostate cancer clinically, accept radical prostatectomy contains the core of representing cancer and benign tissue as man's structure of initial stage monotherapy (that is, not having assistant agent or newly auxiliary hormone or radiation-therapy) micro-array tissue (TMA) from 111 in Michigan State University.Radical prostatectomy series is the part of the good research ad hoc program of Michigan State University's prostate cancer (SPORE) tissue core.Represent tissue block to get 3 cores (diameter is 0.6mm) from each, make up TMA.The TMA construction process be described in (Kononen etc., Nat.Med.4:844[1998]; Rubin etc., Am J surg Pathol 26:312[2002]).Detailed clinical pathology and TMA data maintain in the security relationship database, as mentioned previously (Manley etc., Am J.Pathol.159:837[2001]).
Use interkinesis fluorescence in situ hybridization evaluation of measuring TMPRSS2-ETS gene fusion
The micro-array tissue section that 4 μ m are thick is used for interkinesis fluorescence in situ hybridization (FISH), processing, and hybridize, as mentioned previously (Tomlins etc., Science 310:644[2005]; Tomlins etc., Cancer Res 66:3396[2006]).Use Axioplan ImagingZl microscope (Carl Zeiss) to check slide glass, (Germany) the middle ISIS software system of using are taken pictures with the CCD photographic camera for MetaSystems, Altlussheim in Metafer imaging analysis system.By the pathologist complete form with non-overlapping nucleus in manual scoring FISH signal (100x oil immersion), and write down minimum 30 cells or available maximum cancer cells number in 3 cores from a case.To there be the case of 30 valuable cells to be reported as not enough hybridization.All (Oakland CA), by hybridizing with lymphocytic diffusion metaphase of normal periphery, verifies probe location to all BAC from center, BACPAC source.Reset in order to detect TMPRSS2, ERG and ETV4, we use following probe: RP11-35C4 (at 5 of TMPRSS2 ') and RP11-120C17 (at 3 of TMPRSS2 '), RP11-95I21 (at 5 of ERG ') and RP11-476D17 (at 3 of ERG '), and RP11-100E5 (at 5 of ETV4 ') and RP11-436J4 (at 3 of ETV4 ').Merge in order to detect TMPSS2-ETV1, RP11-35C4 (at 5 of TMPRSS2 ') is used with RP11-124L22 (at 3 of ETV1 ').Use QIAFilter Maxi Prep test kit (Qiagen, Valencia CA) separate BACDNA, the use digoxigenin-or vitamin H-nick translation mixture (RocheApplied Science, Indianapolis, IN) synthesising probing needle.Streptavidin (the Invitrogen that uses anti--digoxigenin antibody (Roche Applied Science) that fluorescein puts together and Alexa594 to put together respectively, Carlsbad, CA), detect digoxigenin and biotin labeled probe.
Use fracture (TMPRSS2, ERG, ETV4) or merge the rearrangement that (TMPRSS2-ETV1) probe strategy detects the karyomit(e) level.With 2 pairs of chromatic greens and danger signal, the normal signal collection of illustrative plates of TMPRSS2, ERG and ETV4 in the painted nucleus of indication DAPI.About these probes,, confirm to reset by the fracture of one of 2 colour signals.Merge about TMPRSS2-ETV1,2 pairs of redness of separating and green are recorded as normally, and a pair of chromatic signal record that separate and a pair of is rearrangement.
B. result and discussion
This embodiment has described the operative treatment analysis-by-synthesis of the American mark of resetting based on TMPRSS2 in the group of big screening and ETS transcription factor gene of limitation prostate cancer clinically.TMPRSS2 division probe FISH mensuration scheme is used for detecting the sum frequency of the prostate cancer gene rearrangement with the known ETS companion ERG of family, ETV1, ETV4 and other unknown companion, as shown in figure 34.Suppose that the negative prostate cancer of 3 known EIS companions (ERG, ETV1 and ETV4) may be carried the rearrangement that comprises other ETS family member.The result has confirmed the complicated molecule mark (Figure 35 A and B) that TMPRSS and ETS family gene reset in the limitation prostate cancer clinically.In 65% the case estimated, total TMPRSS2 resets, and ERG, ETV1 and ETV4 reset (Figure 35 A) in 55%, 2% and 2% the case estimated.In 40.5% case with TMPRSS2 rearrangement, observe the disappearance of 3 ' probe, this is consistent with TMPRSS2 and the chromosome deletion between the ERG as gene fusion mechanism.These results have confirmed that TMPRSS2:ETS merges the high frequency in prostate cancer, and have confirmed to show that TMPRSS2:ERG is former research (Tomlins etc., the Science310:644 of common type; Perner etc., Cancer Res 66:3396[2006]; Yoshimoto etc., Neoplasia 8:4665[2006]; Soller etc., Genes Chromosomes Cancer45:717[2006]; Wang etc., Cancer Res 66:8347[2006] and the foregoing description).
When this group is limited to all valuable those cases of all 4 probes, observe similar result (Figure 35 A and B).This analyzes confirmation, and it is to repel mutually that TMPRSS2:ETS resets, because there is not patient chart to reveal a plurality of ETS family members' rearrangement.This is analyzed also and confirms, single TMPRSS2 measures and can detect nearly all ETS effectively and reset, and detects 24 23 of having in the case that ERG, ETV1 or ETV4 reset because measure by TMPRSS2.Lack therein in all 9 cases of 5 ' ERG probe, identify the disappearance of 3 ' TMPRSS2 probe.
In addition, identify 2 cases with the fracture of TMPRSS2 probe, this indicates a rearrangement, does not have the rearrangement (case 32 and 36) of ERG, ETV1 or ETV4 and has the case that TMPRSS2 resets, do not have ERG to reset, and wherein can not estimate ETV1 and/or ETV4.These case hints, TMPRSS2 can be with new ETS family member or incoherent oncogene in prostate cancer.
In a word, these result's hints, single TMPRSS2 is provided by the diagnosis and the prognosis information that can provide in the prostate cancer.
Embodiment 9PSA gene fusion
The FISH of the probe by being positioned at 5 of PSA ' and 3 ' uses FISH to test Identification Lists to reveal the case of heading signal.Be used to detect PSA splitted 5 ' and 3 ' BAC be respectively RP11-510I16 and RP11-26P14.Do not identify the companion of PSA gene fusion as yet.These identical probes are also provoked the division among the ETS family member SPIB, because its position is very near PSA.
Embodiment 10FLI1 crosses expression
In not carrying the different cell samples of FLI1 gene fusion, measure FLI1 and express.From having the case that high FLI1 expresses, the expression of measuring 5 of FLI1 ' and 3 ' exon.The result as shown in figure 18.Do not detect 5 ' and the difference of 3 ' transcript abundance.RACE does not indicate yet and merges transcript.Compare with control sample, FLI1 crosses in prostate cancer and expresses.The primer and the TaqMan probe that in Figure 37, have shown the FII1 amplification.
FISH also is used to discern the sample of the heading signal (this is indicating and is resetting) with FLI1, but records by FISH, and these cases do not have TMPRSS2:FLI1 and merge.The BAC probe is as shown in table 13.These cases also have high FLI1 and express.
Embodiment 11 micro-array tissues
Micro-array tissue is used to measure the existence of gene fusion.The TMA that uses comprises the prostate cancer array and the single cases for prostate cancer of prostate cancer progress array, prostate cancer result array, hot postmortem array, prostate cancer screening array, Erg feminine gender.List use following gene probe: TMPRSS2-ETV1 in tissue Microarray and merge probe, Erg divides probe, and TMPRSS2 divides probe, and ETV1 divides probe, ETV4 division probe and FL1 division probe.
In addition, on result array, use Erg division probe.The result is as follows: negative case: 30, and positive case: 29, edge case: 1.There is weak cognation (＞=7) between Erg positive case and the higher Gleason scoring.
The nucleus interaction factor that protein arrays and mass spectrum is used to differentiate ERG2.The result as shown in figure 21.
The male sex hormone that embodiment 12Erg expresses is regulated
This embodiment has described the male sex hormone adjusting that Erg expresses.Use LNCap (TMPRSS2-ERG-) and VCaP (TMPRSS2-ERG+) clone.Make different R188148 hours of measuring of cells contacting.Measure the expression of Erg, PSA (+contrast) and 'beta '-tubulin (contrast).The result as shown in figure 19.Find that it is androgen-dependent that ERG is expressed among the VCaP, but quite different in the LNCap cell.
Embodiment 13 peptide antibodies and Aqua probe produce
Figure 22-25 has shown the sequence (indicating underscore) of ERG1, the ETV1, FLI-1 and the ETV4 that are used for peptide antibody preparation and preparation aqua probe.For all ETS family members, by Applied Biosystems design primer.Monitor the expression in the cases for prostate cancer, high expression level is the indicator of possible gene fusion and the indicator of FISH.
ETV1 in the embodiment 14LnCaP cell
This embodiment has described among VCaP and the LNCaP androgenic analysis of transcribing response.Except detecting many transcripts differentially expressed in 2 kinds of clones (for example PSA), also differentiated the transcript of many unique imbalances in VCaP or LNCaP cell.This analysis identifies, and ETV1 exclusively responds male sex hormone in the LNCaP cell.Express combinedly with the mistake of ETV1 in the LNCaP cell, FISH is used for studying the ETV1 locus of LNCaP cell.
A. material and method
Clone
In this research, use prostate cancer cell line LNCaP (original source shifts from the lymphoglandula prostate cancer) and VCaP (Korenchuk, S. etc., In vivo 15,163-8 (2001)) (original source shifts from the vertebra prostate cancer).Study for microarray, make VCaP and LNCaP cell be grown in the substratum that contains serum that charcoal adsorbed 24 hours, then with 0.1% ethanol or be dissolved in 1nM synthetic androgen 17-hydroxyl-17-methyl-female-4 in the ethanol, 9,11-triolefin-3-ketone (R1881, NEN Life Science product, Boston MA) handled 48 hours.Study for quantitative PCR (QPCR), make cell be grown in the substratum that contains serum that charcoal adsorbed 24 hours, with 0.1% ethanol, be dissolved in the Casodex (10uM in the acetone, bicalutamide, AstraZeneca Pharmaceuticals, Wilmington, DE) or be dissolved in flutamide (10uM in the ethanol, Sigma, St.Louis, MO) preincubation.After 2 hours, add the R1881 of 0.1% ethanol or 0.5nM, harvested cell after 48 hours.According to manufacturer's specification sheets, (Invitrogen, Carlsbad CA) separate total RNA from all samples to use Trizol.By sex change formaldehyde gel electrophoresis or Agilent Bioanalyzer 2100 (AgilentTechnologies, Palo Alto, CA), checking RNA integrity.
Microarray analysis
Basically make up the cDNA microarray that is used for this research as previously mentioned, exception is that this array contains 32,448 features.Method in the printing and the aftertreatment that can obtain array on the Internet.Basically carry out the cDNA microarray analysis as previously mentioned.In brief, reverse transcription is from contrast and the VCaP that handled of R1881 and total RNA of LNCaP clone, and uses the cy5 fluorochrome label.Reverse transcription is used the cy3 fluorochrome label from total RNA of the merging of contrast VCaP or LNCaP sample, is used for all hybridization of each clone.The product of mixed mark then is with the cDNA hybridization array.Marking image uses Genepix software package (Axon InstrumentsInc., Union City, CA) stdn.By array meta align data, only the gene of expressing at least 80% sample is used for analyzing.
Quantitative PCR (QPCR)
As (Tomlins etc., Cancer Res 66,3396-400 (2006); Tomlins etc., Science 310,644-8 (2005)) described, Applied Biosystems 7300 real-time PCR systems (Applied Biosystems, Foster City, CA) on, use the SYBRGreen dyestuff to carry out QPCR.Report that each target gene is with respect to the amount of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in each sample.The relative quantity of target gene in each clone and/or the experiment is proofreaied and correct to contrasting.(Coralville IA), synthesizes all Oligonucleolide primers by Integrated DNA Technologies.GAPDH (Vandesompele etc. have been described, GenomeBiol 3, RESEARCH0034 (2002)), PSA (Specht etc., Am J Pathol 158,419-29 (2001)), ERG (exon 5-6_f and exon 5-6_r) and ETV1 (exon 6-7_f and exon 6-7_r) primer (Tomlins etc., Science 310,644-8 (2005)).
Fluorescence in situ hybridization (FISH)
Use standard technique, scatter metaphase from normal peripheral lymphocyte (NPLs) and LNCaP cell preparation.Handle slide glass 2min with 2x SSC,,, add probe then with 100% Ethanol Treatment 2min with 70% Ethanol Treatment 2min.Give the slide glass covered,, spend the night 37 ℃ of hybridization at 75 ℃ of incubation 2min.Post-hybridization washing is, to wash 3 times in PBST then at 42 ℃ of 5min with 2x SSC.Use is conjugated to anti--digoxigenin (the Roche Applied Science on the fluorescein, Indianapolis, IN) and be conjugated to streptavidin on the Alexa Fluor 594 (Invitrogen, Carlsbad CA) carry out fluoroscopic examination.With the slide glass counterstaining, fixing in containing the ProLong GoldAntifade reagent (Invitrogen) of DAPI.(Zeiss, Thornwood NY) check slide glass, and (Metasystems, Altlussheim Germany), take pictures with the CCD camera to use ISIS software to use Zeiss Axio Imager Zl fluorescent microscope.
(Oakland CA) obtains all BAC, by hybridizing checking probe location with lymphocytic diffusion metaphase of normal periphery from BACPAC Resource Center.In order to hybridize the ETV1 zone on the karyomit(e) 7p, 4 kinds of BAC (terminal kinetochore is to the kinetochore) have been used: RP11-124L22, RP11-313C20, RP11-703A4 and RP11-1149J13.About to the location of karyomit(e) 14q, FISH has described BAC RP11-483K13, and we also use NPL to confirm that it and 14q hybridize.Use QIAFilter Maxi Prep test kit (Qiagen, Valencia CA) separate BAC DNA, and the use digoxigenin-or vitamin H-nick translation mixture (Roche Applied Science) synthesising probing needle.
B. result
The result is shown in Figure 26-28.Figure 26 has shown that crossing of ETV1 expressed and the male sex hormone adjusting in the LNCaP prostate cancer cell line.Figure 26 A has shown the expression of gene mark that male sex hormone is regulated in VCaP and the LNCaP prostate cancer cell line.The Heatmap of gene shown with vehicle treated (grey) and compared, and 1nM synthetic androgen R1881 (green) induces or suppresses any clone (3,499 features, p＜0.05 and change multiple than＞=1.5).Every row is represented a gene; Every row are flirtatious a sample.According to colourity, yellow and blue cell was indicated respectively and was expressed or expressed deficiency.The indication of ash cytochrome lacks data.The value of each clone is aligned on the corresponding control sample.Indicate PSA, ERG and the ETV1 position on heatmap, in insertion figure, shown their expression.Figure 26 B has shown by quantitative PCR (QPCR), male sex hormone inducing PSA in confirmation VCaP and the LNCaP cell.By QPCR, measure the relative expression's (being standardized into GAPDH) of PSA in LNCaP (redness) and VCaP (blueness) clone.Being with or without in the presence of specified resisting-male sex hormone Casodex or the flutamide, handled cell 48 hours with carrier or 1nM R1881.It is the amount of each clone in the control sample that the relative quantity of PSA in each sample is proofreaied and correct.Figure 26 C has shown that androgenic ETV1 induces in the LNCaP cell.Use the sample identical, measure the relative quantity of ETV1 by QPCR with B.Figure 26 D shows that ETV1 remarkable mistake in the LNCaP cell expressed.By QPCR, in 48 hours control samples, measure the relative expression of PSA, ETV1 and ERG from each clone.The relative quantity of target gene in each sample proofreaied and correct be mean vol from the PSA of 2 clones.ERG and ETV1 expression difference multiple between LNCaP and the VCaP have been indicated.
Figure 27 has shown the rearrangement of ETV1 in the LNCaP cell.Figure 27 A has shown the synoptic diagram as the BAC of the probe of fluorescence in situ hybridization (FISH).Use UCSC Genome Browser, in May, 2004 refrigerated people's gene group, be determined at the location and the coordinate at 7p21 (comprising ETV1 locus and BAC on every side) and 14q32 place.The BAC that uses in this research is designated as the rectangle of numbering.With the arrow of indication transcriptional orientation, show the position of ETV1 and DGKB.Figure 27 B shows that RP11-124L22 and RP11-1149J13 co are on the karyomit(e) 7 of normal peripheral lymphocyte (NPL).By the FISH among the NPL, measure RP11-124L22 (BAC#1) and RP11-1149J13 (BAC#4) location on diffusion metaphase (last figure) or interkinesis cell (figure below).For all of image,, use the arrow of corresponding probe color simultaneously, the signal on the indication karyomit(e) 14 with the signal on the arrow indication karyomit(e) 7 metaphase.The high power that has shown the information area of diffusion metaphase in frame is amplified.Figure 27 C has shown BAC#1 and the location (last figure) of BAC#4 on distributing metaphase, and is measuring interkinesis cell (figure below) near in the tetraploid LNCaP clone.Observe on the karyomit(e) 72 signal for locatings altogether, 2 danger signals on the karyomit(e) 7 and 2 greens on the coloured differently body.Figure 27 D shows, is positioned karyomit(e) 14 from the signal of RP11-124L22 in the LNCaP cell.The same with C, exception is, RP11-124L22 (BAC#1) and RP11-483K13 (BAC#5, FISH map to karyomit(e) 14q) spread cohybridization metaphase at LNCaP together.4 danger signals from RP11-483K13 are positioned at karyomit(e) 14q; 2 greens are positioned at karyomit(e) 7p, and 2 greens are positioned at karyomit(e) 14q.
Figure 28 shows that whole ETV1 locus is inserted in the karyomit(e) 14 of LNCaP cell.Figure 28 A has shown the synoptic diagram of the BAC that uses in this experiment.Figure 28 B has shown RP11-124L22 (BAC#1) and the location (last figure) of RP11-313C20 (BAC#2) on distributing metaphase, and has measured interkinesis cell (figure below) by FISH in LNCaP clone.In diffusion metaphase, on karyomit(e) 7 (yellow arrows) and karyomit(e) 14 (yellow arrows), observe 2 pairs of localized signals altogether.
These results confirm, whole ETV1 locus from karyomit(e) 7 transpositions to karyomit(e) 14.Although do not know the genome sequence of the inset upstream on karyomit(e) 14, ARE may be contained in this zone, and it drives the only high level of observed ETV1 and androgen response in the LNCaP cell.These result's hints, the LNCaP cell can be as the external model of observed ETS gene fusion in human prostata cancer.
ETS family member's inhibition among the embodiment 15PCA
This embodiment has described ETS family member's inhibition in the prostate cancer.SiRNA is used for suppressing the expression of LnCaP and VCAP ETV1 and ERG.Quantitative PCR is used to confirm this inhibition.The result is shown in Figure 29 and 30.Described inhibition does not influence propagation.Be the stable slow virus that suppresses to set up expression shRNA.
On the full genome array of Agilent 44K, carry out microarray, to determine which gene is differentially expressed when suppressing the ERG expression in VCaP cell (it has TMPRSS2:ERG and merges).For this experiment, 3 kinds of conditions have been used: use Dharmacon siRNA (ERGsi) to suppress ERG, suppress (untransfected) VCaP cell of luciferase (contrast) and untransfected.Carry out 3 kinds of ERG/ untransfected hybridization and 2 kinds of contrast/untransfected hybridization.Described gene is called and is present in all 5 experiments, have standard deviation (mean values of 2 kinds of conditions), and demonstrate less than 0.5＜0.75 or＞difference multiple between 1.5 ERG and the contrast.ERGdiffield indicates the difference multiple between ERG and the contrast inhibition experiment, so mean this gene expression in ERG suppresses not enough (ERG originally is arranged in the 81st in this analysis) less than 1 value.
Embodiment 16 transgenic mices
Set up and crossed the transgenic mice of expressing gene fusion of the present invention and ETS and androgen Responsive Gene.Figure 31 has shown that the virus that is used to set up mouse crosses expression system.Figure 32 has shown the synoptic diagram that genome inserts in the transgenic mice.Such mouse can be used for research (for example, Mechanism Study) and drug screening purposes.
The identification of embodiment 17TMPRSS2:ERGa
As described in top (embodiment 1), observe the fusion of TMPRSS2 and ERG.In order to measure the albumen of TMPRSS2:ERGa gene fusion expression, use ERG part (NM_004449) that PCR increases at the fusion breaking point that exon 4 begins to locate to infer terminator codon to the exons 11, insert adjacent from the VCaP prostate cancer cell line at the 3x of terminator codon upstream Flag mark.Product TA is cloned into PCR8/GW/TOPO TA (Invitrogen), and two-way order-checking.Order-checking shows 2 different isotypes of existence, is called ERG1 in this article and (comprises exon 6 (NM_182918, GGGGTGCAGCTTTTATTTTCCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGA ATTACAACTAGGCCAG from ERG isotype 1; SEQ IDNO:73) and ERG2 (not comprising this exon).Product Gateway is cloned into pLenti6/V5-DEST destination carrier.This plasmid direct transfection is advanced the PHINX cell, be used for the ERG protein production.
A. method
Transfection is measured: according to manufacturer's specification sheets, use Fugene transfection reagent (Roche), with ERG2 or empty carrier transfection Phinx cell.For each construct uses totally 10 150mm diameter flat boards.48 hours harvested cells are used for immune precipitation determination hereinafter described after transfection.
Protein cleavage and immunoprecipitation: washed cell in containing the ice-cooled PBS of proteinase inhibitor, by in containing the TBS of 1%NP40, homogenizing cracking.According to manufacturer's specification sheets, (Biorad Laboratories, Hercules CA), estimate to contain the protein content of proteic supernatant liquor to use the Bradfords protein determination.To be used for immunoprecipitation research from the equal protein (about 30mg is in the 15ml damping fluid) of all samples.(Sigma, St Louis MO) add each sample to 50% slip of about 200 microlitre EZVIEWRed ANTI-FLAG M2 affinity gels, are incubated overnight at 4 ℃.With immunoprecipitate washing 3 times, the each use contained the TBS of 0.1%NP40 and independent TBS.According to manufacturer's specification sheets, and use FLAG peptide (Sigma, St Louis, MO), the albumen of elution of bound.Wash-out carries out 3 times.(Sigma, St Louis MO), precipitate the albumen in the elutriant to use 50%TCA.Precipitate 3 times with ice-cooled washing with acetone, be suspended in again in the Laemmeli damping fluid, (Invitrogen Corporation, Carlbad CA) go up electrophoresis at the 4-20%BIS-TRIS gel.(Carsbad is CA) to gel-colored for Silver Quest, Invitrogen Corporation with the silver-colored dyestuff that is fit to mass spectroscopy.Band and the corresponding zone in the carrier swimming lane that will be corresponding with ERG2 be cut into 6, every 1cm.High molecular zone from gel is downward, with each gel film indicia band 1-6.Thereby, the zone of containing high-molecular-weight protein with 1 correspondence, and be with 6 correspondences the lower molecular weight zone.Based on the natural molecule amount (about 55KDa) of ERG2, it can be moved to and be with in 4 and 5.Repeat the ERG2 sequence and differentiate 3 times, merge data from all experiments.
Albumen is differentiated
Collect gel band, (Invitrogen Corporation, Carsbad CA), use the de-inking solution decolouring that provides in silver-colored dye reagent box according to manufacturer's specification sheets.In gel, the pig trypsin of use in 1M bicarbonate of ammonia, pH9 1: 50, PromegaCorporation, Madison WI) digests.At 37 ℃ of digestion 16h.When 24h finishes, use 3% formic acid to stop tryptic activity.Use 50% acetonitrile to extract peptide.Dry peptide is suspended in 2% acetonitrile that contains 0.1% formic acid again, uses the 0.075mm * 150mm C18 post (Michrome Bio Resources Inc.) that connects Paradigm HPLC pump, separates by reverse-phase chromatography.Use the 45-min gradient of 5-95%B (0.1% formic acid/95% acetonitrile), the wash-out peptide, wherein solvent orange 2 A is 0.1% formic acid/2% acetonitrile.Use Finnigan LTQ mass spectrograph (Thermo Electron Corp.) to obtain collection of illustrative plates, the instrument that relies on mode operation with data is realized dynamically getting rid of.On 3 kinds of peptide ions the abundantest of full MS scanning, obtain the MS/MS collection of illustrative plates.Use is searched for this collection of illustrative plates at compound, non-entirely with the MASCOT research tool of NCBI genseng according to sequence library.Use the PeptideProphet program, verify that these database searchs result's peptide distributes accuracy.This is a mixture model; Promptly specify (comprising the number that the typical case is terminal) the maximum evaluation of expection of the probability of correct peptide identification based on Search Results scoring and different peptide features.Use second program ProteinProphet to come, and make up their probability, with the probability of specifying correct albumen to distribute according to albumen grouping peptide.Separating capacity with follow-up single peptide probability (as they the NSP value or belong to the number of peptide together) reappraise and increase, its constitutes peptide grouping information and possible multi-hit proteic state albumen.
The result:
Table 14
Coverage diagram (ERG2)
Annotate: E*BAND*-* represents the ERG2 peptide in the ERG1 experiment
Figure A20068004182601211
Figure A20068004182601221
Figure A20068004182601231
This table has shown the coverage diagram of the ERG2 that obtains in 3 different experiments.The aminoacid sequence correspondence that indicates underscore from the sequence of the machine translation of the ER31 of VCAP cell clone.Aminoacid sequence GGAAFI FPNTSVYPEATQRITTRP (SEQ ID NO:196) corresponding to the specific exon of ERG1, and in ERG2, lack.Remaining aminoacid sequence correspondence the ERG2 sequence that identifies in each experiment.In all experiments, in band 1-5, identify ERG2.Explained the peptide sequence of the ERG2 that in each such band, obtains.In 3 experiments, observe the proteic very high covering of ERG2.Coverage diagram shows, rarely observes the covering with the peptide of preceding 50 proteic N-stub areas of the corresponding clone of amino-acid residue in the mass spectroscopy coverage diagram.But, find from the peptide VPQQDWLSQP (SEQ IDNO:197) that the amino acid Xie Ansuan begins it is highly abundant, thereby in all experiments, differentiate.Evaluation more closely shows, is methionine(Met) in the framework at the 47th amino acid.In a plurality of experiments, the disappearance of any upstream peptide (N-terminal) of the 47th methionine(Met) confirms that it is the-terminal amino acid of ERG2.In addition, arginine residues makes it become potential trypsinase cleavage site the 50th existence.At this position tryptic digestion, can produce shorter N-terminal peptide MSPR (it for the identification of ion trap mass spectrometer and Yan Taixiao) and longer C-terminal peptide VPQQDWLSQP (SEQ IDNO:198) (it is all identified) in all experiments.Also in single experiment, identify peptide sequence MIQTVPDPAAHI (SEQ ID NO:199) with low-down probability score.This maps to the N-end of the ERG that reports in NCBI.This sequence is not to cross the part of the construct of expression from the dystopy of VCAP cell clone.This can obtain by ERG in the body of expressing the PHINX cell, thereby can represent the part of the ERG relevant with benign cell.
Thereby in a word, the result shows that the 3rd methionine(Met) is the translation starting point of TMPRSS2:ERG fusion product.MASTIKEALS VVSEDQSLFE CAYGTPHLAK TEMTA YGQTSKMSPRVPQQDWLSQP(SEQ ID NO：200)
First methionine(Met) is the translation starting point of endogenous ERG.MIQTVPDPAA HI(SEQ IDNO：201)
Figure 20 has shown endogenous and synoptic diagram fusion polypeptide.
Fish analysis on embodiment 18 urine samples
In order to separate from urine and the preparation prostatic cell, after careful digital examination per rectum, collect about 30ml urine.Add 15ml PreservCyt immediately, in the 50ml test tube, in room temperature, at the centrifugal sample 10min of 4000rpm.Abandon supernatant liquor, will precipitate in room temperature and be suspended in 15min among the 15m10.75M KCl again, in the 50ml test tube, in room temperature, at the centrifugal 10min of 4000rpm.Abandon supernatant liquor, will precipitate the methyl alcohol that is suspended in 3: 1 ratios of 10ml again: in the Glacial acetic acid.Then at the centrifugal 8min of 4000rpm.Abandon supernatant liquor, keep 200 μ l, precipitation again suspends.The precipitation that will suspend again drips on the glass slide then, and is air-dry.Hybridization and probe preparation use ERG 5 '/3 ' and TMPRSS 5 '/3 ' probe right as described in the top embodiment 2.
All publications, patent, patent application and the registration number of mentioning in the specification sheets in the above is whole in this article incorporated by reference.Although the present invention has used particular to be described, be to be understood that the present invention should exceedingly not be defined in these specific embodiments.In fact, the different improvement and the variant of described composition and the inventive method are conspicuous for those of ordinary skills, and within the scope of following claim.

Claims (41)

1. diagnose the method for prostate cancer among the patient, it comprises:
(a) provide sample from the patient; With
(b) whether exist in the test sample and have from 5 of the transcriptional regulatory district of male sex hormone regulatory gene ' part with from the gene fusion of 3 of ETS family member gene ' part,
The existence of wherein said gene fusion in sample is the index of prostate cancer among the patient.
2. the process of claim 1 wherein that described male sex hormone regulatory gene is selected from TMPRSS2 and PSA.
3. the method for claim 2, wherein the transcriptional regulatory district of male sex hormone regulatory gene comprises the promoter region of male sex hormone regulatory gene.
4. the method for claim 3, wherein the promoter region of male sex hormone regulatory gene comprises the androgen response element (ARE) of male sex hormone regulatory gene.
5. the process of claim 1 wherein that described ETS family member gene is selected from down group: ERG, ETV1 (ER81), FLI1, ETS1, ETS2, ELK1, ETV6 (TEL1), ETV7 (TEL2), GABP α, ELF1, ETV4 (E1AF; PEA3), ETV5 (ERM), ERF, PEA3/E1AF, PU.1, ESE1/ESX, SAP1 (ELK4), ETV3 (METS), EWS/FLI1, ESE1, ESE2 (ELF5), ESE3, PDEF, NET (ELK3; SAP2), NERF (ELF2) and FEV.
6. the process of claim 1 wherein that step (b) comprises detecting to have from the 5 ' part in the transcriptional regulatory district of male sex hormone regulatory gene with from the chromosome rearrangement of the genomic dna of 3 of ETS family member gene ' part.
7. the method for claim 6, wherein step (b) comprises the chromosome rearrangement of using nucleic acid sequencing technology for detection genomic dna.
8. the method for claim 6, wherein step (b) comprises the chromosome rearrangement of using nucleic acid hybridization technique to detect genomic dna.
9. the method for claim 8, wherein step (b) comprises the chromosome rearrangement of using the nucleic acid hybridization technique that is selected from situ hybridization (ISH), microarray and southern blotting technique to detect genomic dna.
10. the method for claim 6, wherein step (b) comprises the use nucleic acid amplification method, detects the chromosome rearrangement of genomic dna.
11. the method for claim 10, wherein step (b) comprises and uses the amplification (TMA) be selected from polymerase chain reaction (PCR), inverse transcription polymerase chain reaction (RT-PCR), transcriptive intermediate, ligase chain reaction (LCR), strand displacement amplification (SDA) and based on the nucleic acid amplification method of the amplification (NASBA) of nucleotide sequence, detect the chromosome rearrangement of genomic dna.
12. comprising detecting, the step of the process of claim 1 wherein (b) has from the 5 ' part in the transcriptional regulatory district of male sex hormone regulatory gene with from the chimeric mRNA transcript of 3 of ETS family member gene ' part.
13. the method for claim 12, wherein step (b) comprises use nucleic acid sequencing technology, detects chimeric mRNA transcript.
14. the method for claim 12, wherein step (b) comprises the use nucleic acid hybridization technique, detects chimeric mRNA transcript.
15. the method for claim 14, wherein step (b) comprises and uses the nucleic acid hybridization technique be selected from situ hybridization (ISH), microarray and RNA trace to detect chimeric mRNA transcript.
16. the method for claim 15, wherein said in situ hybridization are to use the fluorescence in situ hybridization (FISH) that is selected from following probe: RP11-372017; RP11-137J13; RP11-692L4; RP11-476D17; PR11-32L6; RP11-752M23; RP11-1107H21; RP11-639A7; RP11-1077M21; RP11-121A5; RP11-120C17; PR11-814F13 and RR11-535H11.
17. the method for claim 12, wherein step (b) comprises the use nucleic acid amplification method, detects chimeric mRNA transcript.
18. the method for claim 17, wherein step (b) comprises and uses the amplification (TMA) be selected from polymerase chain reaction (PCR), inverse transcription polymerase chain reaction (RT-PCR), transcriptive intermediate, ligase chain reaction (LCR), strand displacement amplification (SDA) and based on the nucleic acid amplification method of the amplification (NASBA) of nucleotide sequence, detect chimeric mRNA transcript.
19. the step of the process of claim 1 wherein (b) comprises the ETS family member albumen of the aminoterminal brachymemma that detection is produced by the transcriptional regulatory district of male sex hormone regulatory gene and ETS family member gene fusion.
20. comprising detecting, the step of the process of claim 1 wherein (b) has from the aminoterminal part in the transcriptional regulatory district of male sex hormone regulatory gene with from the chimeric protein of the carboxyl terminal part of ETS family member gene.
21. the method for claim 19 or 20, wherein step (b) comprises the protein sequencing technology of using, and detects albumen.
22. the method for claim 19 or 20, wherein step (b) comprises that the use immunoassay detect albumen.
23. the method for claim 22, wherein step (b) comprises that use is selected from following immunoassay and detects albumen: immunoprecipitation; Western blot; ELISA; Immunohistochemistry; Immunocytochemistry; Flow cytometry and immunity-PCR.
24. the process of claim 1 wherein that described sample is selected from: tissue, blood, urine, seminal fluid, prostatic secretion and prostatic cell.
25. based on the existence of genomic deletion in the gene fusion whether to the process of claim 1 wherein that described gene fusion is the fusion of TMPRSS2 and ERG, wherein this method also comprises,, characterize the step of prostatic cell.
26. the method for claim 25, wherein said gene rearrangement are the disappearances of the genomic dna between TMPRSS2 and the ERG gene on the karyomit(e) 21.
27. the method for claim 26, wherein said disappearance comprises the disappearance of the exons 1 of ERG gene.
28. the method for claim 26, wherein said disappearance comprises the disappearance of the exon 3 of TMPRSS2 gene.
29. the method for claim 26 wherein lacks the genomic dna between 2.8 and 2.85 megabasses.
30. the method for claim 29 is wherein used FISH to measure and detected described disappearance, described FISH measures and uses at least a fluorescently-labeled probe that is selected from BAC clone RP11-137J13 and BAC clone RP11-24A11.
31. the method for claim 28 wherein uses polymerase chain reaction (PCR) to detect described disappearance.
32. the method for claim 31 wherein uses the primer that is selected from SEQ ID NO:55-SEQ IDNO:58 to carry out described PCR.
33. the method for claim 26, wherein Que Shi existence is the index of patient's metastatic prostate cancer.
34. be used to diagnose the composition of patient's prostate cancer, it comprises following at least a:
(a) probe of a mark, its comprise can and from 5 of the transcriptional regulatory district of the male sex hormone regulatory gene ' part and the sequence of hybridizing from the fusion joint between 3 of ETS family member gene ' part;
(b) comprise can with the probe of first mark of the sequence of the transcriptional regulatory district of male sex hormone regulatory gene hybridization and comprise can with the probe of second mark of the sequence of ETS family member gene recombination;
(c) comprise can with first amplification oligonucleotide of the sequence of the transcriptional regulatory district of male sex hormone regulatory gene hybridization and comprise can with second amplification oligonucleotide of the sequence of ETS family member gene recombination;
(d) the proteic antibody of ETS family member of the aminoterminal brachymemma that produces by the transcriptional regulatory district of male sex hormone regulatory gene and ETS family member gene fusion; With
(e) have from the aminoterminal part in the transcriptional regulatory district of male sex hormone regulatory gene with from the antibody of the chimeric protein of the carboxyl terminal part of ETS family member gene.
35. the method for the relevant genomic dna disappearance of resetting of indication cancer in the mensuration prostatic cell, it comprises:
A) obtain the laboratory sample of prostatic cell;
B) measure described prostatic cell sample, to determine to be selected from one or more expression of gene levels of ETS2, WRB, PCP4 and MX1;
C) expression level that will record in step b) is compared with the level in the control sample; With
D), then determine to lack if expression of gene level described in the described laboratory sample that records is lower than the expression level of control sample.
36. the method for treatment patient's prostate cancer, it comprises:
Use a kind of reagent to the patient, described reagent can suppress to have from 5 of the transcriptional regulatory district of male sex hormone regulatory gene ' part with from least a biological activity of the gene fusion of 3 of ETS family member gene ' part.
37. the method for claim 36, wherein said male sex hormone regulatory gene is selected from TMPRSS2 and PSA.
38. the method for claim 37, the transcriptional regulatory district of wherein said male sex hormone regulatory gene comprises the promoter region of male sex hormone regulatory gene.
39. the method for claim 38, the promoter region of wherein said male sex hormone regulatory gene comprise the androgen response element of male sex hormone regulatory gene.
40. the method for claim 36, wherein said ETS family member gene is selected from down group: ERG, ETV1 (ER81), FLI1, ETS1, ETS2, ELK1, ETV6 (TEL1), ETV7 (TEL2), GABP α, ELF1, ETV4 (E1AF; PEA3), ETV5 (ERM), ERF, PEA3/E1AF, PU.1, ESE1/ESX, SAP1 (ELK4), ETV3 (METS), EWS/FLI1, ESE1, ESE2 (ELF5), ESE3, PDEF, NET (ELK3; SAP2), NERF (ELF2) and FEV.
41. the method for claim 36, wherein said reagent is selected from down group: small molecules, siRNA, antisense nucleic acid and antibody.
CN200680041826.6A 2005-09-12 2006-09-12 Recurrent gene fusions in prostate cancer Active CN101341256B (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US71643605P 2005-09-12 2005-09-12
US60/716,436 2005-09-12
US73035805P 2005-10-27 2005-10-27
US60/730,358 2005-10-27
US77904106P 2006-03-03 2006-03-03
US60/779,041 2006-03-03
US79559006P 2006-04-28 2006-04-28
US60/795,590 2006-04-28
PCT/US2006/035507 WO2007033187A2 (en) 2005-09-12 2006-09-12 Recurrent gene fusions in prostate cancer

Publications (2)

Publication Number Publication Date
CN101341256A true CN101341256A (en) 2009-01-07
CN101341256B CN101341256B (en) 2013-01-23

Family

ID=40214787

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200680041826.6A Active CN101341256B (en) 2005-09-12 2006-09-12 Recurrent gene fusions in prostate cancer

Country Status (2)

Country Link
CN (1) CN101341256B (en)
ZA (1) ZA200803021B (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102892934A (en) * 2010-03-15 2013-01-23 金斯顿女王大学 Methods, probe sets, and kits for detection of deletion of tumor suppressor genes by fluorescence in situ hybridization
CN103003294A (en) * 2010-02-19 2013-03-27 密执安大学评议会 Gene fusion targeted therapy
CN104592386A (en) * 2014-12-31 2015-05-06 广州市第一人民医院 ETS structural domain transcription factor FEV protein monoclonal antibody and application thereof
CN104611430A (en) * 2015-01-26 2015-05-13 钱学庆 Detection method and primers for TMPRSS2-ERG gene in human urine
CN104846070A (en) * 2011-09-16 2015-08-19 上海长海医院 Biomarkers for treating prostatic cancer, therapeutic target and application thereof
CN108165627A (en) * 2015-08-31 2018-06-15 北京泱深生物信息技术有限公司 A kind of molecular marker of diagnosis and treatment pelvic prolapse
CN108359719A (en) * 2009-05-26 2018-08-03 奎斯特诊断投资公司 The detection method of gene imbalance

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHANDAN KUMAR-SINHA ET AL: "Recurrent gene fusions in prostate cancer", 《NATURE REVIEWS》 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108359719A (en) * 2009-05-26 2018-08-03 奎斯特诊断投资公司 The detection method of gene imbalance
CN103003294A (en) * 2010-02-19 2013-03-27 密执安大学评议会 Gene fusion targeted therapy
CN102892934A (en) * 2010-03-15 2013-01-23 金斯顿女王大学 Methods, probe sets, and kits for detection of deletion of tumor suppressor genes by fluorescence in situ hybridization
CN102892934B (en) * 2010-03-15 2016-07-20 金斯顿女王大学 For the method lacked through fluorescence in situ hybridization detection tumor suppressor gene, probe groups and test kit
CN104845992B (en) * 2011-09-16 2018-09-14 上海长海医院 The biological markers of prostate cancer, therapy target and application thereof
CN104846070A (en) * 2011-09-16 2015-08-19 上海长海医院 Biomarkers for treating prostatic cancer, therapeutic target and application thereof
CN104845992A (en) * 2011-09-16 2015-08-19 上海长海医院 Biomarkers for treating prostatic cancer, therapeutic target and application thereof
CN104846070B (en) * 2011-09-16 2018-02-09 上海长海医院 The biological markers of prostate cancer, therapy target and application thereof
CN104592386B (en) * 2014-12-31 2018-07-13 广州市第一人民医院 Ets domain transcription factor FEV protein monoclonal antibodies and its application
CN104592386A (en) * 2014-12-31 2015-05-06 广州市第一人民医院 ETS structural domain transcription factor FEV protein monoclonal antibody and application thereof
CN104611430A (en) * 2015-01-26 2015-05-13 钱学庆 Detection method and primers for TMPRSS2-ERG gene in human urine
CN108165627A (en) * 2015-08-31 2018-06-15 北京泱深生物信息技术有限公司 A kind of molecular marker of diagnosis and treatment pelvic prolapse
CN108165627B (en) * 2015-08-31 2020-04-07 北京泱深生物信息技术有限公司 Molecular marker for diagnosing and treating pelvic cavity prolapse

Also Published As

Publication number Publication date
ZA200803021B (en) 2010-09-29
CN101341256B (en) 2013-01-23

Similar Documents

Publication Publication Date Title
US10190173B2 (en) Recurrent gene fusions in prostate cancer
JP6404378B2 (en) Recurrent gene fusion in prostate cancer
CN102812130A (en) Recurrent Gene Fusions In Prostate Cancer
CN102639709A (en) Recurrent gene fusions in cancer
CN101341256B (en) Recurrent gene fusions in prostate cancer

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant