CN101333564B

CN101333564B - Method for extracting and purifying target nucleic acid and use thereof

Info

Publication number: CN101333564B
Application number: CN2008101114786A
Authority: CN
Inventors: 张常娥
Original assignee: SHANGHAI RENDU BIOTECHNOLOGY CO Ltd
Current assignee: Shanghai Rendu Biotechnology Co., Ltd
Priority date: 2007-06-27
Filing date: 2008-06-26
Publication date: 2011-02-23
Anticipated expiration: 2028-06-26
Also published as: CN101333564A

Abstract

The invention discloses a method for extracting and purifying target nucleic acid and an application thereof. The extraction method comprises a marker B and a specific conjugate A, wherein, capturing nucleic acid marked by the marker B and target nucleic acid in sample are combined to a solid phase carrier combined with the marker B and the specific conjugate A to form a compound of capturing nucleic acid- target nucleic acid of solid phase carrier-A-B; and the capturing nucleic acid at least comprises a 2`-oxygen-methylation oligoclonal nucleic acid which is specifically combined with the target nucleic acid RNA and is marked by the marker B. The invention also provides a kit for extracting the target nucleic acid, which at least comprises a 2`-oxygen-methylation oligoclonal nucleic acid which is specifically combined with the target nucleic acid RNA and is marked by the marker B, and the 2`- oxygen- methylation oligoclonal nucleic acid is used as the capturing nucleic acid. The method has the advantages of high specificity and purity, less pollution, constant temperature in the reaction process, high sensitivity, fast detecting speed, low requirements on instruments and low cost. Thus, the method is particularly applicable to blood screening.

Description

The method and the application thereof of extraction, purifying target nucleic acid

Technical field

The present invention relates to extraction and the purification process and the application thereof of the nucleic acid in the bioengineering field, particularly relate to by catching the target nucleic acid in the sample, to target nucleic acid extract, the method for purifying and the application in detection of nucleic acids thereof.

Background technology

In recent years, because the great demand in detection of nucleic acids market is all furtherd investigate both at home and abroad in this respect.Existing detection technique only directly detects or amplification detection at nucleic acid fragment specific in the sample mostly, and need purify to nucleic acid fragment.At present, the extracting method of nucleic acid is a lot, as SDS method, CTAB method, centrifugal post method and phenol-chloroform extraction process etc., because these methods are not that to catch purpose nucleic acid with specificity be purpose, so the product that extracts usually is total RNA or total DNA or both mixing in the sample, wherein, major part is non-purpose nucleic acid.The existence of these non-purpose nucleic acid tends to produce interference effect in follow-up detection of nucleic acids, as non-specific amplification etc. occurs in PCR, NASBA or TMA operation, therefore must increase the measure of purifying to extracting product, and the operation nature is more loaded down with trivial details.

In order to solve the above-mentioned problem that exists in detection of nucleic acids, the scientific research personnel has carried out the research that a series of specificitys are caught purpose nucleic acid.Invented the capture nucleic acid that a kind of utilization covalently bind on the PCR tube wall as people such as domestic Zhu Yongfang (CN152129A) purpose nucleic acid directly has been adsorbed onto method on the PCR tube wall.But, capture nucleic acid directly is attached to the chemical reaction step that needs complexity on the tube wall, and used PCR tube wall also must be through special processing.So this method cost height, complicated operation.On the other hand and since nucleic acid at the hybridization efficiency of solid phase surface well below solution hybridization efficient, even the target nucleic acid sample less to molecule, its capture rate is also very low.And when by the molecular weight of hybrid molecule bigger the time (as greater than 140bp), the capture rate of solid-phase hybridization is then lower.However, this invention proposes finishes in a PCR pipe from nucleic acid extraction to the method that detects whole process, still has advance.People (CN1940087A) such as people's (U.S. Patent number 6280945) such as external Lisen and domestic Zhou Kelong have proposed a kind of by utilizing Strepavidin (streptavidin) and Biotin (vitamin H) capture probe to be attached in advance the method for carrying out the specific nucleic acid extraction on the solid phase carrier, though this method operation is simple than solid phase carrier covalent attachment capture probe (CN1521269A), but what these two patents proposed all is to utilize the capture probe of the oligonucleotide of same type as reaction system, and the capture probe of not considering same type is to have very (Nucleic Acid Research (1998) Vol.26 (9) 2224-2229 of big-difference to the capture rate of dissimilar target nucleic acids; Nucleic Acid Research (2004) Vol.32 (9) e72).The method that they propose is used for extracting one type target nucleic acid (as only extracting DNA or RNA target from same sample, do not extract RNA and DNA simultaneously) be practicable, if but use it for when from same sample, extracting RNA and DNA target simultaneously, these methods are just unworkable.This is because in same reaction system, and forming RNA, DNA heteroduplex and the dynamic behavior that forms DNA, dna double chain is different (reference: Nucleic Acid Research (1998) Vol.26 (9) 2224-2229).So the capture rate of catching dissimilar nucleic acid (RNA and DNA) with the capture probe of single type in same system also is different.The result who optimizes buffering or reaction system also can only be or be favourable to capture dna, favourable to catching RNA, can't take into account simultaneously the synchronous high-efficiency rate of DNA and RNA target is extracted, thereby in some need be from same sample extracts the field of RNA and DNA target simultaneously with high sensitivity and extreme efficiency (as in the blood screening field, need be from same sample the synchronous high-efficiency rate extract RNA (HIV and HCV) and DNA (HBV)), these methods are the very serious defective of existence just.

Just because of this, up to now, the blood screening product none system of drugs approved by FDA can be extracted RNA and DNA target simultaneously.The blood screening product of the Luo Shi of FDA approval be utilize different methods catch RNA (HCV, HIV) and DNA (HBV) nucleic acid and separate detection.The blood screening product (Procleix) of the Gen-Probe company of another family of FDA approval is though can detect HCV and HIV simultaneously, and the two is RNA viruses, and dna virus (HBV) does not comprise wherein.Exactly because also same reason, the application of method in blood screening of catching RNA (HIV and HCV) and DNA (HBV) simultaneously with the DNA capture probe that people such as domestic Zhou Kelong (CN1940087A) propose is very difficult practicable, even if feasible reluctantly, its capture rate and detection sensitivity are also very low.In fact, the method that CN1940087A proposes only can be used for extracting DNA target (HBV), is very low to the extraction efficiency of RNA target (HIV and HCV).Therefore, above technology and invention require high in sensitivity, and it is all improper to need high-level efficiency to extract in the fields such as the blood screening of RNA and DNA target and food safety simultaneously, market press for a kind of can be from same sample simultaneously high-level efficiency extract the method for RNA and DNA target.

Summary of the invention

The purpose of this invention is to provide a kind of can be from same sample simultaneously with high-level efficiency extract, the method for purifying target nucleic acid (is target with RNA and/or DNA).

The extracting method of target nucleic acid provided by the present invention, comprise and utilize marker B specific junction mixture A and marker B, the process that will be attached to the capture nucleic acid-target nucleic acid mixture that forms solid phase carrier-A-B on the solid phase carrier that is combined with marker B specific junction mixture A with the capture nucleic acid and the target nucleic acid in the sample of marker B mark; Described capture nucleic acid comprise at least with RNA target nucleic acid specific combination 2 '-oxygen with marker B mark-few nucleic acid (2 '-OME-RNA) methylates.

In the extracting method of above-mentioned target nucleic acid, described capture nucleic acid also comprises the few nucleic acid of 2 '-deoxidation with marker B mark at least a and DNA target nucleic acid specific combination.

Described marker B is Biotin (vitamin H) or 10-40Oligo few nucleic acid such as (dA), described marker B specific junction mixture A be corresponding can with Strepavidin (streptavidin) or derivatives thereof or the 10-40Oligo few nucleic acid such as (dT) of marker B specific combination, in addition, the 10-40Oligo (dA) of the described thing B that serves as a mark can also replace with 10-40Oligo (dC), 10-40polyT or any other length is the few nucleic acid of 10-40 base pair; Corresponding, be covalently bonded in marker B specific junction mixture A on the solid phase carrier also should replace with 10-40Oligo (dC) complementary 10-40Oligo (dG), with 10-40polyT complementary 10-40polyA or with other length of capture nucleic acid marker B complementary be the few nucleic acid of 10-40 base pair.

When marker B is Biotin, when marker B specific junction mixture A was the Strepavidin or derivatives thereof, the extracting method of target nucleic acid provided by the present invention specifically can may further comprise the steps:

(1) capture nucleic acid that is specific to a kind of RNA target nucleic acid (called after R) of at least a Biotin of having mark of preparation;

(2) at least a capture nucleic acid R is added testing sample, obtain the capture nucleic acid-target nucleic acid mixture of Biotin mark, or the mixture of multiple mixture;

(3) solid phase carrier that will be fixed with the Strepavidin or derivatives thereof adds testing sample, form the capture nucleic acid-target nucleic acid RNA mixture of solid phase carrier-Strepavidin-Biotin mark, or be connected with the mixture of a plurality of described mixtures on same solid phase carrier, obtain containing the target compound of target nucleic acid.

If also contain DNA target nucleic acid to be measured in the testing sample, in the extracting method of above-mentioned target nucleic acid, also need prepare the capture nucleic acid of a kind of DNA target nucleic acid of being specific to of at least a Biotin of having mark in the described step (1); Also the capture nucleic acid that is specific to the DNA target nucleic acid of at least a Biotin of having mark need be added testing sample in the step (2); Contain in the target compound that contains target nucleic acid that obtains in the step (3) respectively and capture nucleic acid RNA and DNA target nucleic acid one to one.

((1a) is few nucleic acid (DNA) capture probe of 2 '-deoxidation of Biotin mark to the synoptic diagram of the method for the above-mentioned specificity acquisition target nucleic acid that utilizes Strepavidin or derivatives thereof and Biotin specific combination as shown in Figure 1; (1b) for 2 '-oxygen of Biotin mark-few trapping nucleic acids probe methylates; (2a) be the DNA target; (2b) be the RNA target.)。1) use one (or a plurality of) can with the special few nucleic acid that has the Biotin mark of target nucleic acid specific combination, wherein, utilize the few nucleic acid (DNA of 2 '-deoxidation, 1a) as the capture probe of capture dna target (2a), utilize the 2 '-oxygen-few nucleic acid (1b) that methylates as the capture probe of catching RNA target (2b); 2) use a kind of can with the Strepavidin (or derivatives thereof) on the solid phase carrier of being fixed on of Biotin mark specific combination on the few nucleic acid, thereby form capture probe (1a)-target nucleic acid (2a) mixture of solid phase carrier (4)-Strepavidin (3)-Biotin mark, or the capture probe (1b) of solid phase carrier (4)-Strepavidin (3)-Biotin mark-target nucleic acid (2b) mixture, or the capture probe (1a of solid phase carrier (4)-Strepavidin (3)-Biotin mark, 1b)-target nucleic acid (2a, 2b) mixture, or the mixture of above-mentioned three kinds of mixtures.

When marker B is 10-40Oligo (dA), when marker B specific junction mixture A was 10-40Oligo (dT), the extracting method of target nucleic acid provided by the present invention specifically can may further comprise the steps:

(1) at least a 3 ' end of preparation has the capture nucleic acid that is specific to a kind of RNA target nucleic acid (called after R ') of 10-40Oligo (dA) mark;

(2) at least a capture nucleic acid R ' is added testing sample, obtain capture nucleic acid-target nucleic acid mixture that 3 ' end has 10-40Oligo (dA), or the mixture of multiple mixture;

(3) solid phase carrier that will be fixed with the few nucleic acid of 10-40Oligo (dT) adds testing sample, form the capture nucleic acid-target nucleic acid mixture of solid phase carrier-dT-dA mark, or be connected with the mixture of a plurality of described mixtures on same solid phase carrier, obtain containing the target compound of target nucleic acid.

If also contain DNA target nucleic acid to be measured in the testing sample, in the extracting method of above-mentioned target nucleic acid, also need prepare the capture nucleic acid that is specific to a kind of DNA target nucleic acid that at least a 3 ' end has 10-40Oligo (dA) mark in the described step (1); Also the capture nucleic acid that is specific to the DNA target nucleic acid that at least a 3 ' end has 10-40Oligo (dA) mark need be added testing sample in the step (2); Contain in the target compound that contains target nucleic acid that obtains in the step (3) respectively and capture nucleic acid target nucleic acid RNA and DNA one to one.

At above-mentioned marker B is 10-40Oligo (dA), marker B specific junction mixture A is that the 10-40Oligo (dA) of the described thing B that serves as a mark can also replace with 10-40Oligo (dC), 10-40polyT or any other length is the few nucleic acid of 10-40 base pair in the extracting method of target nucleic acid of 10-40Oligo (dT); Corresponding, be covalently bonded in marker B specific junction mixture A on the solid phase carrier also should replace with 10-40Oligo (dC) complementary 10-40Oligo (dG), with 10-40polyT complementary 10-40polyA or with other length of capture nucleic acid marker B complementary be the few nucleic acid of 10-40 base pair.

The synoptic diagram of the above-mentioned specificity capture nucleic acid method of utilizing nucleic acid specificity hybridization as shown in Figures 2 and 3.(wherein, 2a, 2b (4) is identical with Fig. 1 (A), (5) for covalentlying bind in few nucleic acid (as polyT (10-40)) on the solid phase carrier, 1c is the few nucleic acid of 2 '-deoxidation, its 5 ' end have can with the few nucleic acid complementary sequence that covalently bind on the solid phase carrier.)。(1) one section trapping nucleic acid (such as polyT, Figure 1A (5)) is covalently bind on the solid phase carrier; (2) will be used for the few nucleic acid (1d of chimeric trapping that the RNA target is caught, its 3 ' end contains and the few nucleotide sequence of few nucleic acid complementary that covalently bind on the solid phase carrier, 5 ' end contains and RNA target complementary 2 '-oxygen-few nucleic acid methylates) and (3 ' end contains and contains and the few nucleic acid complementary 2`-deoxidation widow nucleotide sequence that covalently bind on the solid phase carrier to be used for the few nucleic acid (1c) of 2 '-deoxidation of DNA target trapping, 5 ' end contains and the few nucleic acid of DNA target nucleic acid complementary), mix by a certain percentage, combine with target nucleic acid then and form 1c-2a and/or 1d-2b-mixture; (3) with the mixture that forms in the above-mentioned steps (2) be combined in solid phase carrier on few nucleic acid combine, formation solid phase carrier (4)-few nucleic acid (5) traps few nucleic acid (1c)-target nucleic acid (2a) and/or solid phase carrier (4)-few nucleic acid (5) is traped few nucleic acid (1d)-target nucleic acid (2b) mixture.

For improving purity, also comprise the step of washing of capture nucleic acid-target nucleic acid mixture in the extracting method of above-mentioned target nucleic acid, to obtain purified mixture to solid phase carrier-A-B.Described washing composition and washing methods can adopt the washing composition and the washing methods of biological technical field routine, as washing with the solution that contains dispersion agents such as NaCl, LiCl, pH 7.0Tris, dodecyl sodium sulfonate lithium, sanitas or Tween 20.

In the extracting method of above-mentioned target nucleic acid, marker B specific junction mixture A on the described solid phase carrier and marker B bonded condition and reaction system, capture nucleic acid and target nucleic acid in conjunction with condition and reaction system, and the condition and the reaction system of capture nucleic acid-target nucleic acid mixture of formation solid phase carrier-A-B are identical, reaction system is: 0.1-2% NP-40, pH 5.0-8.0 10-200mM Tris, 0.1-2% (V/V) Triton X-100,0.01-1% (W/V) SDS; Reaction conditions all can be: descended incubation 2-30 minute 55-90 ℃ (being preferably 60 ℃), at room temperature placed then 2-30 minute.

Described solid phase carrier all is preferably the super paramagnetic material magnetic bead of diameter 0.05-5 μ m.

Another object of the present invention provides a kind of target nucleic acid and extracts test kit.

When being used for the extraction of single RNA, test kit provided by the present invention, the capture nucleic acid that comprises marker B mark, and the solid phase carrier of the underlined thing B of covalent attachment specific junction mixture A, described capture nucleic acid comprise at least with RNA target nucleic acid specific combination 2 '-oxygen with marker B mark-few nucleic acid (2 '-OME-RNA) methylates.

When extracting when being used for RNA and DNA, the capture nucleic acid in the described test kit also can comprise the few nucleic acid of 2 '-deoxidation with marker B mark at least a and DNA target nucleic acid specific combination.

For improving purity, described test kit also can comprise the washing composition that capture nucleic acid-the target nucleic acid mixture washs that is used for solid phase carrier-A-B.Described washing composition can adopt the washing composition of biological technical field routine, as contains the washing composition of dispersion agents such as NaCl, LiCl, pH 7.0Tris, dodecyl sodium sulfonate lithium, sanitas or Tween 20.

Specifically, for catching HCV RNA, described nucleic acid extraction liquid be contain at HCV RNA design 2 '-oxygen-the few nucleic acid (solution of 2 '-OME-RNA) capture probe methylates, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Strepavidin parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 the capture probe of μ M Biotin mark, wherein the capture probe of Biotin mark has the nucleotide sequence of sequence 4 in the sequence table, and promptly (2 '-oxygen-HCV-RNA TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin 3 ' methylates few nucleic acid (2 '-OME-RNA).

For catching HIV RNA, described nucleic acid extraction liquid be contain at HIV RNA design 2 '-oxygen-the few nucleic acid (solution of 2 '-OME-RNA) capture probe methylates, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Strepavidin parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) TritonX-100,0.1% (V/V) SDS, 0.2 the capture probe of μ M Biotin mark, wherein the capture probe of Biotin mark has the nucleotide sequence of sequence 5 in the sequence table, and promptly (2 '-oxygen-HIV-RNA-TCO:5 '-GAUAACUUCUGCUUCUAUAU-Biotin-3 ' methylates few nucleic acid (2 '-OME-RNA).

For catching HCV RNA and HIV RNA simultaneously, described nucleic acid extraction liquid be contain at HCV RNA and HIV RNA design 2 '-oxygen-the few nucleic acid (solution of 2 '-OME-RNA) capture probe methylates, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mLStrepavidin parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 the capture probe of μ M Biotin mark, wherein catch the nucleotide sequence that the capture probe of the Biotin mark of HCV RNA has sequence 4 in the sequence table, be that (2 '-oxygen-HCV-RNA TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin 3 ' methylates few nucleic acid (2 '-OME-RNA), catch the nucleotide sequence that the capture probe of the Biotin mark of HIV RNA has sequence 5 in the sequence table, promptly (2 '-oxygen-HIV-RNA-TCO:5 '-GAUAACUUCUGCUUCUAUAU-Biotin-3 ' methylates few nucleic acid (2 '-OME-RNA).

For catching HCV RNA simultaneously, HIV RNA and HBV DNA, described nucleic acid extraction liquid be contain at HCV RNA and HIV RNA design 2 '-oxygen-few nucleic acid (2 '-OME-RNA) capture probe methylates, and at few nucleic acid (DNA) capture probe of 2 '-deoxidation of HCV RNA design, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Strepavidin parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 the capture probe of μ M Biotin mark, wherein catch the nucleotide sequence that the capture probe of the Biotin mark of HCV RNA has sequence 4 in the sequence table, be that (2 '-oxygen-HCV-RNA TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin 3 ' methylates few nucleic acid (2 '-OME-RNA), catch the nucleotide sequence that the capture probe of the Biotin mark of HIV RNA has sequence 5 in the sequence table, be that (2 '-oxygen-HIV-RNA-TCO:5 '-GAUAACUUCUGCUUCUAUAU-Biotin-3 ' methylates few nucleic acid (2 '-OME-RNA), catch the nucleotide sequence that the capture probe of the Biotin mark of HBV DNA has sequence 6 in the sequence table, i.e. HBV-DNA-TCO:5 '-CACGGGACCATGCAAGACCTGCACG-Biotin 3 '.

Capture nucleic acid-target nucleic acid mixture of the solid phase carrier-A-B that obtains in order to last method or test kit can be used as the sample that target nucleic acid is carried out qualitative and quantitative analysis, thereby also belongs to protection scope of the present invention.

Can adopt fluorescence detection that target nucleic acid of the present invention is carried out qualitative and quantitative analysis.Described fluorescence detection can be nucleic acid amplification detection method, comprise terminal point or real-time fluorescence PCR (real-time fluorescence PCR (detecting the DNA target), real-time fluorescence RT-PCR (detecting the RNA target)), terminal point or real-time fluorescence NASBA or TMA, terminal point or real-time fluorescence RCA, terminal point or real-time fluorescent fluorescence HDA etc.

The nucleic acid fragment that has been exaggerated used in described nucleic acid amplification detection can be the sequence identical with target nucleic acid, or with target nucleic acid complementary sequence.

Can use one or more fluorescent probes to detect the nucleic acid fragment that is exaggerated in described nucleic acid amplification detection, described fluorescent probe can be selected from the arbitrary combination of following one or more type probes according to existing technical knowledge and experiment condition: molecular beacon (Molecular Beacon), fluorescence resonance (IFret), scorpion probe (Scorpin probe), fluorescence amplify (Amplafluor) and molecule torch (Molecular torch).Described probe sequence can design according to target nucleic acid with according to ordinary method known in the art.

In addition, also can use a kind of constant temperature synchronous amplification detecting process for nucleic acid (Simultaneous Amplification and Testing, abbreviate SAT) that target nucleic acid is carried out detection by quantitative.This method can may further comprise the steps:

1) reactant that will contain following component mixes:

A. determined nucleic acid sample;

B. primer 1: 3 ' end of this primer can with 3 ' end of determined nucleic acid sample or near the hybridization of 3 ' end place, 5 ' end be promoter sequence;

C. primer 2: this primer can with 5 ' the end hybridization of negative (-) chain of determined nucleic acid sample;

D. one or more fluorescent probes;

E. the archaeal dna polymerase (being ThermoScript II) that at least a RNA relies on;

F. at least a RNA polymerase that can discern described promoter sequence;

2) reactant is mixed after, in encloses container, carries out constant temperature and amplify reaction, and with the variation of fluorescent signal in the detector synchronous detection reaction system, the time and intensity that changes according to fluorescent signal carries out quantitative or qualitative detection to nucleic acid samples.

In the constant temperature synchronous amplification detecting process of above-mentioned nucleic acid samples, the target nucleic acid (RNA (comprise mRNA, rRNA etc.) and/or DNA sample) of the determined nucleic acid sample in the step 1) for extracting with the inventive method.

Described promoter sequence is T7 promoter sequence, T3 promoter sequence, M13 promoter sequence or SP6 promoter sequence.

If the determined nucleic acid sample is RNA, (-) chain of described determined nucleic acid sample is by producing in the reaction; If the determined nucleic acid sample is a double-stranded DNA, (-) chain of described determined nucleic acid sample has been present in the determined nucleic acid sample, should also can produce by in reacting by (-) chain.

Described fluorescent probe can be selected from the arbitrary combination of following one or more type probes according to existing technical knowledge and experiment condition: molecular beacon (Molecular Beacon), fluorescence resonance (IFret), scorpion probe (Scorpin probe), fluorescence amplify (Amplafluor) and molecule torch (Molecular torch).Described probe sequence can design according to the determined nucleic acid sample with according to ordinary method known in the art.

Specifically the archaeal dna polymerase (being ThermoScript II) that described RNA relies on can be MMLV reversed transcriptive enzyme or AMV reversed transcriptive enzyme.

Described RNA polymerase is T7, T3, M13 or SP6 RNA polymerase.Used RNA polymerase is and the corresponding RNA polymerase of described promoter sequence.

Described reactant can be divided into fs reactant (all components except e and f reaction enzymes) and subordinate phase enzyme reaction thing (comprising e and f reaction enzymes), also can include Tris, KCl, MgCl in the described fs reactant ₂, NTPS, dNTPs, glycerine and DMSO, the component of described fs reactant specifically can be: 10-50mM Tris, 20-90mM KCl, 10-50mM MgCl ₂, 0.1-10mM NTPS, 0.1-10mM dNTPs, 5-40% (V/V) glycerine (Glycerol), 5-25% (V/V) DMSO, 0.1-2 μ M primer 1,0.1-2 μ M primer 2,0.1-2 μ M fluorescent probe; Also can include Tris, Triton X-100, KCl, EDTA, DTT and glycerine in the described subordinate phase enzyme reaction thing, the component of described subordinate phase enzyme reaction thing specifically can be: the archaeal dna polymerase (being ThermoScript II) that 100-9000U RNA relies on, the 100-5000U RNA polymerase, 20-100mM Tris, 0.1-1% (V/V) TritonX-100,30-300mM KCl, 0.01-0.5mM EDTA, 0.1-2mM DTT, 20-50% (V/V) glycerine.

Step 2) constant temperature in amplifies reaction conditions and can be: earlier will be except that the fs reactant thorough mixing e and the f reaction enzymes, after 55-90 ℃ of following incubation 2-30 minute, again at 42-55 ℃ of following incubation 2-30 minute, in this process, add subordinate phase enzyme reaction thing, begin thus to continue incubation 30-120 minute down at 42-55 ℃, with the variation of detector synchronous recording fluorescent signal, the time and intensity that produces according to fluorescent signal carries out quantitatively or qualitative detection testing sample; The volume ratio of described fs reactant and subordinate phase enzyme reaction thing can be 1-50: 1.

The described selection that is used to detect the detector of fluorescent signal is diversified, is preferably AB1 7000,7300,7500,7700,7900 series, Stratagen MPX3000 series and Barad iQ series etc.

The synchronous amplification detection of constant temperature (SAT) of specificity capture nucleic acid method of the present invention and nucleic acid combined, and the content of (wherein (1a), (1b), (1c), (1d), (2a), (2b), (3), (4), 5) expression is identical with Fig. 2 and Fig. 3 as shown in Figure 4 for the synoptic diagram that carries out detection of nucleic acids, (6) be a primer (second primer) that has promotor, (7) be a not primer of tape starting (first primer), (8) are the specific fluorescence probe).The detection principle of the constant temperature synchronous amplification detecting process of described nucleic acid is that 5 ' end of first primer contains rna polymerase promoter sequence with 3 ' end hybridization of first primer and determined nucleic acid; (utilize determined nucleic acid by first primer is template to the complementary strand of second primer and determined nucleic acid sample, produce through primer extension) hybridization, utilize this complementary strand to carry out new round primer extension for template, thereby produce a promoter sequence that has the double-stranded DNA order, as template, more and second primer (5) the complementary RNA product by rna polymerase transcribe, second primer (5) produces complementary cDNA chain with it again as template via second primer extension; Subsequently, first primer (6) is that the primer extension that template is carried out a new round forms the double chain DNA sequence that has promotor with this cDNA again; Then, be that template is carried out new round responsive transcription with the new double-stranded DNA that is produced again, produce more strand RNA.In reaction system, contain strand RNA complementary fluorescent probe (as molecular beacon etc.) therewith simultaneously; Along with the increase of strand RNA, the quantity of Za Jiao fluorescent probe also increases thereupon with it; At last, by the variation of amount of fluorescence detected, reach the purpose of real-time detection, all are reflected in the same system, carry out synchronously under the same temperature.

The qualitative and quantitative analysis of the extracting method bind nucleic acid of above-mentioned target nucleic acid can be used for (catching and detecting one or more pathogen nucleic acids) in the blood screening; thereby the application of the extracting method of above-mentioned target nucleic acid in blood screening also is that the present invention will protect.

The invention provides a kind of can be from same sample simultaneously with high-level efficiency and highly sensitive extract, the method for purifying target nucleic acid (is target with RNA and/or DNA), it is characterized in that: the characteristic of utilizing Strepavidin or derivatives thereof and Biotin specific combination, comprise the 2 '-oxygen-RNA that methylates that 1. utilizes the Biotin mark (2 '-OME-RNA) efficiently in conjunction with the characteristics of RNA (reference: Nucleic Acid Research (1998) Vol.26 (9) 2224-2229), the RNA target in the efficient capture sample; 2. utilize the 2 '-deoxidation DNA have the Biotin mark efficiently in conjunction with the characteristics (reference: the DNA target in efficient capture sample Nucleic Acid Research (1998) Vol.26 (9) 2224-2229) of DNA; 1. and 2. can mix simultaneously or separately use, consequently: as with 2-oxygen-methylate RNA capture probe and/or few nucleic acid (DNA) capture probe of 2 '-deoxidation is mixed simultaneously uses, present method can be expeditiously from same sample optionally special capture dna and/or RNA target simultaneously.In addition, also can utilize and with the specificity capture nucleic acid of target nucleic acid specific hybridization target nucleic acid to be extracted.Extracting method of the present invention has solved at some sensitivity requirement height, needs to extract simultaneously from same sample simultaneously the field of RNA and DNA target again, has solved the lower critical defect of extraction efficiency that prior art and product exist.Target nucleic acid extracting method of the present invention can combine with the qualitative and quantitative analysis of target nucleic acid, as special DNA target nucleic acid of catching of orientation and/or RNA target are further carried out the nucleic acid amplification detection, comprise existing terminal point or real-time fluorescence PCR, terminal point or real-time fluorescence NASBA or TMA, terminal point or real-time fluorescence RCA, terminal point and real-time fluorescent fluorescence HAD etc., especially be preferably the constant temperature synchronous amplification detecting process for nucleic acid (Simultaneous Amplification and Testing, abbreviate SAT) of the present inventor's invention.Target nucleic acid of the present invention extracts and detection method can be widely used in the detection of nucleic acids in fields such as Clinical Laboratory, blood screening, food safety inspection and environmental monitoring, wherein the advantage in blood screening is especially obvious, this is because in the process of blood screening detection of nucleic acids, and testing sample may only contain DNA target (HBV) or only contain RNA target (as HIV or HCV) or there be (HBV and HIV and/or HCV) simultaneously in DNA, RNA target.In this case, method for extracting nucleic acid disclosed by the invention just has extremely obvious superiority, promptly as long as 2-deoxidation DNA capture probe (at HBV) and two kinds of 2 '-oxygen-RNA capture probes that methylate is (a kind of at HIV, another kind of at HCV) mix simultaneously and use, just can from same reaction system, reach the purpose of efficient capture HBV, HCV and HIV target simultaneously.In sum, target nucleic acid extracting method of the present invention and test kit have specificity and purity height, pollute low advantage, amplify and detection method have the reaction process homo(io)thermism, highly sensitive, detection speed fast, and advantage that cost low low to the plant and instrument requirement, thereby have broad application prospects in the extraction of target nucleic acid and detection (qualitative, quantitative) thereof, blood screening fields such as (identifications of particular target gene).

Below in conjunction with specific embodiment the present invention is described in further details.

Fig. 1 is the synoptic diagram that utilizes the specificity capture nucleic acid method of Strepavidin and Biotin specific combination

Fig. 2 and Fig. 3 are the synoptic diagram that utilizes the specificity capture nucleic acid method of nucleic acid specificity hybridization

Fig. 4 carries out the synoptic diagram of detection of nucleic acids for the synchronous amplification detection of constant temperature (SAT) of specificity capture nucleic acid method of the present invention and nucleic acid combines

Agents useful for same and method are conventional reagent and ordinary method if no special instructions among the following embodiment.All primers, molecular beacon and fluorescent probe sequence are synthetic by U.S. ValueGene company and U.S. Bioneer company.

Embodiment

Embodiment 1, capture probe and 2 '-(2 '-OME-RNA) capture probe is caught the comparison of HCV RNA target efficient to the oxygen-few nucleic acid that methylates to utilize the few nucleic acid (DNA) of 2 '-deoxidation

With HCV RNA (sequence 2 in the sequence table) is example, utilizing Biotin (vitamin H) is marker B, Strepavidin (streptavidin) is marker B specific junction mixture A, detect the capture rate of the few trapping nucleic acids probe of the few trapping nucleic acids probe of 2 '-deoxidation and 2 '-oxygen-methylate to the RNA target nucleic acids, concrete grammar may further comprise the steps:

One, reagent preparation

1. the lysate (A) that has few nucleic acid (DNA) capture probe of 2 '-deoxidation: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL streptavidins parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) TritonX-100,0.1% (V/V) SDS, 0.2 μ M biotinylation capture probe, wherein capture probe is: HCV-DNA TCO:5 '-AGACAGTAGTTCCTCACAGGGG-Biotin 3 ' (sequence 4 in the sequence table, few nucleic acid (DNA) capture probe of 2 '-deoxidation).

2. have the 2 '-oxygen-few nucleic acid that the methylates (lysate of 2 '-OME-RNA) capture probe (B): the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL streptavidins parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 μ M biotinylation capture probe, wherein capture probe is: (2 '-oxygen-HCV-RNA TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin 3 ' (sequence 4 in the sequence table) methylates few nucleic acid (2 '-OME-RNA).

3. washings: 150mM NaCl solution.

4.HCV the preparation of RNA sample: S1 is for containing the positive blood plasma of 100000 copy/mL HCV approximately; S2 is that S1 comes with ten times of dilutions of negative blood plasma, and S3 is that S2 comes with ten times of dilutions of negative blood plasma; S4 is that S3 comes with ten times of dilutions of negative blood plasma; S5 is that S4 comes with ten times of dilutions of negative blood plasma.The negative blood plasma of S6.S1 and negative blood plasma are provided by Changzhou hepatopathy institute.

5. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: 50mM Tris, 35mM KCl, 20mM MgCl ₂, 4mM NTPS, 1mM dNTPs, 10% (V/V) glycerine, 0.5 μ m primer 1 and primer 2,0.5 μ m molecular beacon, wherein, the sequence of the primer and probe is:

Primer 1 (HCV-SAT-P1): 5 '- AATTTAATACGACTCACTATAGGGAGATTTTGGAAGT GTGCTCATGA TGCACGGTCT-3 ' (band underscore base is the T7 promoter sequence);

Primer 2 (HCV-SAT-P2): 5 '-TTTCTTGGATTAACCCCGCTCAATG-3 ';

Molecular beacon (HCV-SAT-Probe): 5 ' Fam-CCGAG GAGAU UUGGG CGUGC CCCCG CUCGG-Dabcyl-3 ', the fluorescent mark group of 5 ' end is that (6-carboxyfluorescein, 6-FAM) quenching group of 3 ' end mark is Dabcyl (i.e. 4 (4-methylamino phenyl azo)-phenylformic acid (non-fluorophor) to the 6-Fluoresceincarboxylic acid.

6. the component of the subordinate phase enzyme reaction thing of the constant temperature synchronous amplification detecting process of nucleic acid: MMLV ThermoScript II (U.S. RD BioSciences company), 2000U T7 RNA polymerase (U.S. RD BioSciences company), 20mM Tris, 0.5% (V/V) Triton X-100,30mM KCl, 0.1mM EDTA, 0.3mM DTT, 25% (V/V) glycerine.

Two, operating process

Using few trapping nucleic acids probe of 2 '-deoxidation and the 2 '-oxygen-few nucleic acid that methylates respectively is capture probe, with method of the present invention target nucleic acids (HCV RNA) is caught, and to detect both capture rates to RNA, concrete grammar may further comprise the steps:

1, gets 12 1.5mL centrifuge tubes, be numbered A1, A2, A3, A4, A5, A6, B1, B2, B3, B4, B5, B6;

2,, get 100 μ l lysate A and add respectively in A1 to the A6 mark pipe with behind the abundant mixing of lysate; Getting 100 μ l lysate B adds respectively in B1 to the B6 mark pipe;

3, use clean Tip head to draw respectively that (S1 joins A1 and B1, and S2 joins A2 and B2, by that analogy), closes the centrifuge tube lid, vibrates 30 seconds in the 1.5mL centrifuge tube that 400 μ l S1, S2, S3, S4, S5, S6 add correspondence markings;

4, above-mentioned sample processing tube is placed on the thermostat, be incubated 5 minutes down at 60 ℃;

5, more above-mentioned sample processing tube is placed room temperature to place 10 minutes;

6, sample processing tube is placed left standstill on the magnetic bead tripping device 5 minutes;

7, treat that magnetic bead is adsorbed in tube wall after, keep sample processing tube on the magnetic bead tripping device, exhaustion liquid keeps magnetic bead;

8, in sample processing tube, add the 1mL washings, take off the sample processing tube vibration and be placed on the magnetic bead tripping device in 30 seconds, left standstill 5 minutes;

9, treat that magnetic bead is adsorbed in tube wall after, keep sample processing tube on the magnetic bead tripping device, exhaustion liquid keeps magnetic bead;

10, repeat 8 and 9 and (obtain purified mixture, A1～A5 is magnetic bead-Strepavidin-Biotin mark (2 '-OME-RNA)-target nucleic acid RNA mixture, B1～B5 are the few nucleic acid of 2 '-deoxidation of magnetic bead-Strepavidin-Biotin mark-target nucleic acid RNA mixture);

11,40 μ l augmentation detection liquid (fs reactant) are added respectively in above-mentioned each sample processing tube, get 30 μ l augmentation detection liquid to clean micro-reaction pipe behind the vibration mixing;

12, the micro-reaction pipe that will fill augmentation detection liquid is put 60 ℃ of insulations 10 minutes;

13, take out the micro-reaction pipe and put 42 ℃ of insulations 5 minutes again;

14, add 10 μ l subordinate phase enzyme reaction things in 13 processes in the micro-reaction pipe, mixing continues reaction 60 minutes down at 42 ℃;

15,14 simultaneously, the micro-reaction pipe is gone to the changing conditions of the grand stone real-time fluorescence quantitative PCR in Shanghai (Slan) instrument synchronous detection fluorescent signal, set every 1 minute and detect first order fluorescence (FAM) signal, detect the variable quantity of record fluorescent signal altogether 60 times.

The detected result of fluorescent signal is: A1, A2 are positive, and A3, A4, A5, A6 are negative; And B1, B2, B3, B4, B5 are positive, B6 is negative, and the HCV RNA that adds different concns produces the fluorescent signal that is higher than background at different time, extent of dilution high more (concentration is low more), it is long more then to produce the required reaction times of fluorescent signal (Ct) be higher than background, the concentration and the Ct (generation is higher than the required reaction times of fluorescent signal of background) that are sample to be tested are inversely proportional to, sample (the B6 that does not add HCV RNA, negative control) when reaction finishes (Ct＞60 minute) have only the background fluorescence signal.Above-mentioned detected result shows, method of the present invention can be used for the extraction and the purifying of target nucleic acid, and few nucleic acid (DNA) capture probe of the 2 '-deoxidation capture rate that is used for the RNA target is far below with 2 '-oxygen-(2 '-OME-RNA) capture probe is caught the efficient of RNA target to the few nucleic acid that methylates.

This experimental result shows, for the sample that contains the RNA target nucleic acid, with method of the present invention extract, during the purifying RNA target nucleic acid, comprise in the capture probe with RNA target nucleic acid specific combination 2 '-oxygen with marker B mark-(2 '-OME-RNA) has tangible capture effect to the few nucleic acid that methylates.

Embodiment 2, (few nucleic acid (DNA) capture probe of 2 '-OME-RNA) capture probe and 2 '-deoxidation is caught the comparison of HBV DNA target efficient to utilize the 2 '-oxygen-few nucleic acid that methylates

With HBV DNA (sequence 1 in the sequence table) is example, utilizing Biotin (vitamin H) is marker B, Strepavidin (streptavidin) is marker B specific junction mixture A, detect few trapping nucleic acids probe of 2 '-oxygen-methylate and the few trapping nucleic acids probe of the 2 '-deoxidation capture rate to the DNA target nucleic acids, concrete grammar may further comprise the steps:

One, reagent preparation

1. the lysate (A) that has few nucleic acid (DNA) capture probe of 2 '-deoxidation: identical with embodiment 1, wherein, capture probe is: HBV-DNA TCO:5 '-CACGGGACCATGCAAGACCTGCACG-Biotin-3 ' (sequence 6 in the sequence table, few nucleic acid (DNA) capture probe of 2 '-deoxidation).

2. have the 2 '-oxygen-few nucleic acid that methylates (lysate of 2 '-OME-RNA) capture probe (B): identical with embodiment 1, wherein, capture probe is: (2 '-oxygen-HBV-RNA TCO:5 '-CACGGGACCAUGCAAGACCUGCACG-Biotin-3 ' methylates few nucleic acid (2 '-OME-RNA).

3. washings: 150mM NaCl solution.

4.HBV the preparation of DNA sample: S1 is for containing the positive blood plasma of 100000 copy/mL HBV approximately; S2 is that S1 comes with ten times of dilutions of negative blood plasma, and S3 is that S2 comes with ten times of dilutions of negative blood plasma; S4 is that S3 comes with ten times of dilutions of negative blood plasma; S5 is that S4 comes with ten times of dilutions of negative blood plasma.The negative blood plasma of S6.S1 and negative blood plasma are provided by Changzhou hepatopathy institute.

5. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1, wherein, the sequence of the primer and probe is:

Primer 1 (HBV-SAT-P1): 5 '- AATTTAATACGACTCACTATAGGGAGTGGATGTGTCTGCGGCGTTTTATC-3 ' (band underscore base is the T7 promoter sequence);

Primer 2 (HBV-SAT-P2): 5 '-GGACAAACGGGCAACATACCTTGGTAGT-3 ';

Molecular beacon (HBV-SAT-Probe): 5 ' Fam-CCGAGAGAAGAACCAACAAGAAGACUCGG-Dabcyl-3 ', the fluorescent mark group of 5 ' end is that (6-carboxyfluorescein, 6-FAM) quenching group of 3 ' end mark is Dabcyl (i.e. 4 (4-methylamino phenyl azo)-phenylformic acid (non-fluorophor) to the 6-Fluoresceincarboxylic acid.

6. the component of the subordinate phase enzyme reaction thing of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1.

Two, operating process

Using few trapping nucleic acids probe of 2 '-deoxidation and the 2 '-oxygen-few nucleic acid that methylates respectively is capture probe, with method of the present invention target nucleic acids (HBV DNA) is caught, and to detect both capture rates to DNA, concrete grammar is identical with embodiment 1.

The detected result of fluorescent signal is: A1, A2, A3, A4, A5 are all positive, and A6 is negative; And B1, B2 are positive, B3, B4, B5, B6 are negative, and the HBV DNA that adds different concns produces the fluorescent signal that is higher than background at different time, extent of dilution high more (concentration is low more), it is long more then to produce the required reaction times of fluorescent signal (Ct) be higher than background, the concentration and the Ct (generation is higher than the required reaction times of fluorescent signal of background) that are sample to be tested are inversely proportional to, sample (the A6 that does not add HBV DNA, negative control) when reaction finishes (Ct＞60 minute) have only the background fluorescence signal.Above-mentioned detected result shows, method of the present invention can be used for the extraction and the purifying of target nucleic acid, and few nucleic acid (DNA) capture probe of the 2 '-deoxidation capture rate that is used for the DNA target is far above with the 2 '-oxygen-few nucleic acid that methylates (efficient of 2 '-OME-RNA) capture probe capture dna target.

Above-mentioned experimental result explanation, for the sample that contains the DNA target nucleic acid, capture probe of the present invention also need comprise the few nucleic acid (DNA) of 2 '-deoxidation with marker B mark at least a and DNA target nucleic acid specific combination.

Embodiment 3, be used for the 2 '-oxygen-few nucleic acid that methylates that HCV RNA catches (2 '-OME-RNA) capture probe uses simultaneously, in conjunction with SAT the sample among embodiment 1 and the embodiment 2 is detected being used for few nucleic acid (DNA) capture probe of 2 '-deoxidation that HBV DNA catches and embodiment 1 among the embodiment 2.

Detection method may further comprise the steps:

One, reagent preparation

1. have few nucleic acid (DNA) capture probe and 2 ' of the 2 '-deoxidation-oxygen-few nucleic acid that methylates (lysate of 2 '-OME-RNA) capture probe: identical with embodiment 1, wherein, capture probe is: HBV-DNA-TCO:5 '-CACGGGACCATGCAAGACCTGCACG-Biotin 3 ', HCV-RNA-TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin-3 '.

2. washings: 150mM NaCl solution.

3.HCV the preparation of RNA sample and HBV DNA sample: S1 is for containing the positive blood plasma of 100000 copy/mL HCV approximately, S2 is that S1 comes with ten times of dilutions of negative blood plasma, S3 is that S2 comes with ten times of dilutions of negative blood plasma, S4 is that S3 comes with ten times of dilutions of negative blood plasma, and S5 is that S4 comes with ten times of dilutions of negative blood plasma; The negative blood plasma of S6; S1 and negative blood plasma are provided by Changzhou hepatopathy institute.The preparation of HBV DNA sample: S1 ' is for containing the positive blood plasma of 100000 copy/mL HBV approximately, S2 ' is that S1 ' comes with ten times of dilutions of negative blood plasma, S3 ' is that S2 ' comes with ten times of dilutions of negative blood plasma, S4 ' is that S3 ' comes with ten times of dilutions of negative blood plasma, and S5 ' is that S4 ' comes with ten times of dilutions of yin and yang attribute blood plasma; The negative blood plasma of S6 '; S1 ' and negative blood plasma are provided by Changzhou hepatopathy institute.

4. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1, wherein, the primer of used HCV and HBV is identical with embodiment 2 with embodiment 1 with probe.

5. the component of the subordinate phase enzyme reaction thing of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1.

Two, operating process

With few trapping nucleic acids probe of 2 '-deoxidation and the 2 '-oxygen-few nucleic acid that methylates is capture probe, with method of the present invention target nucleic acids (HBV DNA and HCV RNA) is caught, to detect both capture rates to DNA and RNA, concrete grammar may further comprise the steps:

2,, get 100 μ l lysates and add respectively in A1 to A6 and B1 to the B6 mark pipe with behind the abundant mixing of lysate;

3, use clean Tip head to draw respectively that (S1 joins A1 in the 1.5mL centrifuge tube that 400 μ l S1, S2, S3, S4, S5, S6 and S1 ', S2 ', S3 ', S4 ', S5 ', S6 ' add correspondence markings, S1 ' joins B1, by that analogy), close the centrifuge tube lid, vibrated 30 seconds;

10, repeat 8 and 9 and (obtain purified mixture, A1～A5 is mainly magnetic bead-Strepavidin-Biotin mark (2 '-OME-RNA)-target nucleic acid RNA mixture, and B1～B5 is mainly the few nucleic acid of 2 '-deoxidation-target nucleic acid DNA mixture of magnetic bead-Strepavidin-Biotin mark);

11-15, identical with embodiment 1.

The detected result of fluorescent signal is: A1, A2, A3, A4, A5, B1, B2, B3, B4 and B5 are all positive, A6, B6 is negative, and the HBV DNA and the HCV RNA that add different concns produce the fluorescent signal that is higher than background at different time, extent of dilution high more (concentration is low more), it is long more then to produce the required reaction times of fluorescent signal (Ct) be higher than background, the concentration and the Ct (generation is higher than the required reaction times of fluorescent signal of background) that are sample to be tested are inversely proportional to, the sample (A6 and the B6 that do not add HBV DNA and HCV RNA, negative control) when reaction finishes (Ct＞60 minute) have only the background fluorescence signal.

Above-mentioned detected result shows, method of the present invention can be used for the extraction and the purifying of target nucleic acid, and (few nucleic acid (DNA) capture probe and 2 ' of 2 '-deoxidation-oxygen-few nucleic acid (2 '-OME-RNA)) that methylates uses simultaneously, and in the sample is that RNA or DNA can be caught expeditiously and detect with two kinds of capture probes.

Embodiment 4, resulting DNA among the embodiment 3 or RNA target are carried out wash-out, sample is detected in conjunction with Real-time RT-PCR

Utilizing Biotin (vitamin H) is marker B, Strepavidin (streptavidin) is marker B specific junction mixture A, with few nucleic acid (DNA) capture probe of the 2 '-deoxidation that is used for catching HBV DNA among the embodiment 2 and embodiment 1 be used to catch HCV RNA 2 '-oxygen-(2 '-OME-RNA) capture probe uses the few nucleic acid that methylates simultaneously, in conjunction with Real-time RT-PCR the sample among embodiment 1 and the embodiment 2 is detected, testing process may further comprise the steps:

One, reagent preparation

1. have few nucleic acid (DNA) capture probe and 2 ' of the 2 '-deoxidation-oxygen-few nucleic acid that methylates (lysate of 2 '-OME-RNA) capture probe: identical with embodiment 3.

2. washings: 150mM NaCl solution.

3. elutriant: the 10mM Tris damping fluid of the purified water preparation of handling with DEPC is added with 0.1% (V/V) Tween 20,1mM EDTA, 0.001-1% NaN ₃

4.HCV the preparation of RNA sample and HBV DNA sample: identical with embodiment 3.

5. the reaction solution during the Real-time RT-PCR of nucleic acid detects: the PCR reaction solution contains 1.8mM dNTPs, 3.6mM DTT, 3.5mM MgCl ₂, primer is to HBV-PCR-P1﹠amp; HBV-PCR-P2 and HCV-PCR-P1﹠amp; Each 0.4 μ M of HCV-PCR-P2, primer sequence is as follows:

HBV-PCR-P1：5’-CGTGCTGGTAGTTGATGTTCC-3’

HBV-PCR-P2：5’-CATCCTGCTGCTATGCCTCAT-3’；

HCV-PCR-P1：5’-TGGAGATTTGGGCGTG-3’

HCV-PCR-P2：5’-TCGCAAGCACCCTATC-3’。

6. the component of the enzyme reaction thing during the Real-time RT-PCR of nucleic acid detects: 200U MMLV reversed transcriptive enzyme, 0.6U warm start Taq archaeal dna polymerase.

7. each 0.5 μ M of probe liquid: HBV-PCR-probe and HCV-PCR-probe, 10mM Tris, 1mM EDTA, probe sequence is as follows: HBV-PCR-probe:

5’-FAM-CCGAGAGAAGAACCAACAAGAAGATGAGGCTCGG-Dabcyl-3’

HCV-PCR-probe：5’-FAM-CGCGAGACTGCTAGCCGAGTAGTGTTCGCG-Dabcyl-3’。

According to Real-time RT-PCR reaction solution: enzyme mixture: the ratio of probe liquid=8: 6: 1 is mixed with 15ul reaction detection liquid, adds nucleic acid-templated 15ul and promptly is available on the machine to increase and detects in real time.

Two, operating process

1-10, identically with embodiment 3 (obtain purified mixture, A1～A5 is mainly magnetic bead-Strepavidin-Biotin mark (2 '-OME-RNA)-target nucleic acid RNA mixture, B1～B5 are mainly the few nucleic acid of the 2 '-deoxidation-target nucleic acid DNA mixture of magnetic bead-Strepavidin-Biotin mark).

11,30 μ l elutriants are added in above-mentioned each sample processing tube the vibration mixing respectively.Take off the sample processing tube vibration and be placed on the magnetic bead tripping device in 30 seconds, left standstill 5 minutes.

12. after treating that magnetic bead is adsorbed in tube wall, keep sample processing tube on the magnetic bead tripping device, inhale district's 15 μ l augmentation detection liquid to clean micro-reaction pipe, add 15ul augmentation detection liquid then;

13, the micro-reaction pipe that will fill augmentation detection liquid goes to AB1 7500 and is the changing conditions of real-time fluorescence quantitative PCR instrument synchronous detection fluorescent signal, and the amplification parameter setting of instrument sees Table 1.

The Real-time RT-PCR detected result of fluorescent signal is: A1, A2, A3, A4, A5, B1, B2, B3, B4, B5 is all positive, A6, B6 is all negative, and the HBV DNA that adds different concns produces the fluorescent signal that is higher than background with HCV RNA in different cycle indexes, extent of dilution high more (concentration is low more), it is long more then to produce the required cycle index of fluorescent signal that is higher than background, the concentration and the Ct (generation is higher than the required cycle index of fluorescent signal of background) that are sample to be tested are inversely proportional to, the sample (A6 and the B6 that do not add HBV DNA and HCV RNA, negative control) when reaction finishes (Ct＞60 minute) have only the background fluorescence signal.

Table 1 RT-PCR loop parameter

Figure DEST_PATH_RE-GSB00000286134200171

Embodiment 5, the few nucleic acid of 2 '-deoxidation that utilizes 3 ' end to have 10-40Oligo (dA) are that capture probe is caught HBV DNA target

To catch HBV DNA is example, utilizing 10-40Oligo (dA) is marker B, 10-40Oligo (dT) is marker B specific junction mixture A, detect the capture rate of the few trapping nucleic acids probe of the few trapping nucleic acids probe of 2 '-deoxidation and 2 '-oxygen-methylate to the DNA target nucleic acids, concrete grammar may further comprise the steps:

One, reagent preparation

1. the lysate (A) that has few nucleic acid (DNA) capture probe of 2 '-deoxidation: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Oligo dT-25 parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 μ M capture probe, wherein, capture probe is: HBV-DNA TCO:

5-CACGGGACCATGCAAGACCTGCACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAA-3 ' (few nucleic acid (DNA) capture probe of 2 '-deoxidation).

2. have the 2 '-oxygen-few nucleic acid that the methylates (lysate of 2 '-OME-RNA) capture probe (B): the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Oligo dT-25 parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 μ M capture probe, wherein, capture probe is: HBV-RNA TCO:

(2 '-oxygen-5 '-CACGGGACCAUGCAAGACCUGCACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAA-3 ' methylates few nucleic acid friendly (2 '-OME-RNA).

3. washings: 150mM NaCl solution.

4.HBV the preparation of DNA sample: identical with embodiment 2.

5. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 2.

6. the component of the subordinate phase enzyme reaction thing of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 2.

Two, operating process

Using few trapping nucleic acids probe of 2 '-deoxidation and the 2 '-oxygen-few nucleic acid that methylates respectively is capture probe, with method of the present invention target nucleic acids (HBV DNA) is caught, and to detect both capture rates to DNA, concrete grammar may further comprise the steps:

4, above-mentioned sample processing tube is placed on the thermostat, be incubated 30 minutes down at 60 ℃;

5, more above-mentioned sample processing tube is placed room temperature to place 20 minutes;

10, (obtain purified mixture, A1～A5 is the few nucleic acid of 2 '-deoxidation of magnetic bead-dT-dA mark-target nucleic acid RNA mixture, and B1～B5 is (2 '-OME-RNA)-target nucleic acid DNA mixture) of magnetic bead-dT-dA mark to repeat 8 and 9;

11-15, identical with embodiment 1.

Embodiment 6, capture probe and 2 '-(2 '-OME-RNA) capture probe is caught the comparison of HCV RNA target efficient to the oxygen-few nucleic acid that methylates to utilize 3 ' end to have the few nucleic acid (DNA) of 2 '-deoxidation of 10-40Oligo (dA)

With HCV RNA is example, utilizing 10-40Oligo (dA) is marker B, 10-40Oligo (dT) is marker B specific junction mixture A, detect the capture rate of the few trapping nucleic acids probe of the few trapping nucleic acids probe of 2 '-deoxidation and 2 '-oxygen-methylate to the RNA target nucleic acids, concrete grammar may further comprise the steps:

One, reagent preparation

1. the lysate (A) that has few nucleic acid (DNA) capture probe of 2 '-deoxidation: identical with embodiment 5, wherein, capture probe is: HCV-DNA TCO:5 '-AGACAGTAGTTCCTCACAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3 ' (few nucleic acid (DNA) capture probe of 2 '-deoxidation).

2. have the 2 '-oxygen-few nucleic acid that methylates (lysate of 2 '-OME-RNA) capture probe (B): identical with embodiment 5, wherein, capture probe is: (2 '-oxygen-HCV-RNA TCO:5 '-AGACAGUAGUUCCUCACAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3 ' methylates few nucleic acid (2 '-OME-RNA).

3. washings: 150mM NaCl solution.

4.HCV the preparation of RNA sample: identical with embodiment 1.

5. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1.

Two, operating process

Using few trapping nucleic acids probe of 2 '-deoxidation and the 2 '-oxygen-few nucleic acid that methylates respectively is capture probe, with method of the present invention target nucleic acids (HCV RNA) is caught, and to detect both capture rates to RNA, concrete grammar is identical with embodiment 5.

This experimental result shows, with method of the present invention extract, during the purifying RNA target nucleic acid, comprise in the capture probe with RNA target nucleic acid specific combination 2 '-oxygen with marker B mark-(2 '-OME-RNA) has obvious capture effect to the few nucleic acid that methylates.

Embodiment 7, be used for the 2 '-oxygen-few nucleic acid that methylates that HCV RNA catches (2 '-OME-RNA) capture probe uses simultaneously, in conjunction with SAT the sample among embodiment 5 and the embodiment 6 is detected being used for few nucleic acid (DNA) capture probe of 2 '-deoxidation that HBV DNA catches and embodiment 6 among the embodiment 5.

Concrete grammar may further comprise the steps:

One, reagent preparation

1. have few nucleic acid (DNA) capture probe and 2 ' of the 2 '-deoxidation-oxygen-few nucleic acid that methylates (lysate of 2 '-OME-RNA) capture probe: 250 μ g/mL Oligo dT-25, the super paramagnetic material magnetic bead of the diameter 1 μ m of parcel, 50mM Tris, pH 7.0,0.1% (V/V) NP-40,1% (V/V) Triton X-100,0.1% (V/V) SDS, 0.2 μ M capture probe, wherein, capture probe is: HBV-DNA-TCO:5 '-CACGGGACCA TGCAAGACCTGCACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3 ', HCV-RNA-TCO:5 '-AGACAGUAGUUCCUCACAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3 '.

2. washings: 150mM NaCl solution.

3.HCV the preparation of RNA sample and HBV DNA sample: identical with embodiment 3.

4. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 3.

5. the component of the subordinate phase enzyme reaction thing of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 3.

Two, operating process

11-15, identical with embodiment 1.

Embodiment 8, the application example of target nucleic acid extracting method of the present invention in blood screening

Target nucleic acid of the present invention extracts and detection method can be widely used in the detection of nucleic acids in fields such as Clinical Laboratory, blood screening, food safety inspection and environmental monitoring, wherein the advantage in blood screening is especially obvious: in the process of blood screening detection of nucleic acids, testing sample may only contain DNA target (HBV) or only contain RNA target (as HIV or HCV etc.) or there are (HBV and HIV and/or HCV etc.) simultaneously in DNA, RNA target.In this case, method for extracting nucleic acid disclosed by the invention just has extremely obvious superiority, promptly as long as 2-deoxidation DNA capture probe (at HBV) and two kinds of 2 '-oxygen-RNA capture probes that methylate is (a kind of at HIV, another kind of at HCV) mix simultaneously and use, just can reach the purpose of efficient capture HBV DNA, HCV RNA and HIV RNA (sequence 3 in the sequence table) target from same reaction system simultaneously, concrete examination may further comprise the steps:

One, reagent preparation

1. have the lysate that mixes capture probe: identical with embodiment 1, wherein contain at 2 ' of HBV-deoxidation DNA capture probe and two kinds of 2 '-oxygen-RNA capture probes that methylate (a kind of at HIV, another kind of) at HCV, sequence is as follows:

HBV-DNA TCO:5 '-CACGGGACCATGCAAGACCTGCACG-Biotin-3 ' (sequence 6 in the sequence table) (few nucleic acid (DNA) capture probe of 2 '-deoxidation),

HCV-RNA-TCO:5 '-AGACAGUAGUUCCUCACAGGGG-Biotin-3 ' (sequence 4 in the sequence table) (2 '-oxygen-the RNA capture probe methylates),

HIV-RNA-TCO:5 '-GAUAACUUCUGCUUCUAUAU-Biotin-3 ' (sequence 5 in the sequence table) (2 '-oxygen-the RNA capture probe methylates).

3. washings: 150mM NaCl solution.

4. the preparation of sample:

HBV DNA sample is identical with embodiment 3 with the preparation of HCV RNA sample, the preparation method of HIV RNA sample is: H1 is for containing the positive blood plasma of 100000 copy/mL HIV approximately, H2 is that H1 comes with ten times of dilutions of positive blood plasma, H3 is that H2 comes with ten times of dilutions of positive blood plasma, H4 is that H3 comes with ten times of dilutions of positive blood plasma, and H5 is that H4 comes with ten times of dilutions of positive blood plasma; The negative blood plasma of H6; H1 and negative blood plasma are provided by Changzhou hepatopathy institute.

5. the component of the fs reactant of the constant temperature synchronous amplification detecting process of nucleic acid: identical with embodiment 1, wherein, it is identical with embodiment 3 with probe with the primer that HCV detects to be used for HBV, and the primer and the probe that are used for the HIV detection are as follows:

Primer 1 (HIV-SAT-P1): 5 '- AATTTAATACGACTCACTATAGGGAG TTGTATGTCT GTTGCTATTA TGTCTA-3 ' (band underscore base is the T7 promoter sequence);

Primer 2 (HIV-SAT-P2): 5 '-GGTTTA TTACAGGGAC AGCAGAGACC-3 ';

Molecular beacon (HIV-SAT-Probe): 5 ' Fam-CCGAG AGAAU UACAAAAACA AAU UACAAAA CUCGG-Dabcyl-3 ', the fluorescent mark group of 5 ' end is 6-Fluoresceincarboxylic acid (6-carboxyfluorescein, 6-FAM), the quenching group of 3 ' end mark is Dabcyl (i.e. 4 (4-methylamino phenyl azo)-phenylformic acid (non-fluorophor).

Two, operating process

1, gets 18 1.5mL centrifuge tubes, be numbered A1, A2, A3, A4, A5, A6, B1, B2, B3, B4, B5, B6, H1 ', H2 ', H3 ', H4 ', H5 ', H6 ';

2,, get 100 μ l lysates and add respectively in A1 to A6, B1 to B6 and H1 to the H6 mark pipe with behind the abundant mixing of lysate;

3, use clean Tip head to draw 400 μ l S1, S2, S3, S4, S5, S6 respectively, S1 ', S2 ', S3 ', S4 ', S5 ', S6 ', and H1, H2, H3, H4, H5, H6 add, and (S1 joins A1 in the 1.5mL centrifuge tube of correspondence markings, S1 ' joins B1, H1 joins H1 ' by that analogy), close the centrifuge tube lid, vibrated 30 seconds;

All the other operating processes are identical with embodiment 3 with experimental technique.

The detected result of fluorescent signal is: A1, A2, A3, A4, A5, B1, B2, B3, B4, B5, H1, H2, H3, H4, H5 are all positive, and A6, B6, H6 are negative.

Above-mentioned detected result also shows, in the sample preparation process, if only there is a kind of target nucleic acid in the sample, has the capture rate that does not influence this target nucleic acid in the time of other capture probe.Same, in the amplification detection process,, also little to the amplification detection influence of this target at the existence of the primer of other target and probe if having only a kind of target nucleic acid in the sample.

In the blood screening operation of reality, if adopt the pattern in the foregoing description 8 to carry out examination, because this pattern can detect three kinds of viruses simultaneously, so, no matter be that one or both or three kinds of viral samples that exist can both be detected.This pattern is easy to operate, detects the flux height, requires also lower to instrument.Promptly only need the monochromatic fluorescence detector of constant temperature to get final product (as Fluro Scan).But, owing to may have only HBV DNA or HCV RNA or HIV RNA or two kinds even three kinds of existence simultaneously in the actual clinical blood sample, can not determine that from the positive findings of this pattern in esse in the sample is any or which kind viral nucleic acid.But this is not any shortcoming in blood screening.Because the real purpose of blood screening is examination and goes out contaminated blood sample, no matter be that the existence of a kind of virus or several viruses all is regarded as contaminated blood.

Know that as need physical presence which kind of or which is planted viral nucleic acid in the contaminated blood, only need the pattern of embodiment 8 is just changed a little and can reach: promptly utilize the different fluorescence different viral detection probes of mark usually.Such as with FAM mark HBV probe, with HEX mark HCV probe, with TAMRA mark HIV probe.Other fluorescein that can select for use also has VIC, NEO, TET, Cy3, Cy5 etc.But such examination pattern must be used multicolor fluorescence detector (as ABI 7500, this is 5 look fluorescent PCR instrument), so just can judge that physical presence which kind of or which is planted viral nucleic acid the blood from the kind and the number of the fluorescent signal that produces.

Sequence table

<160>6

<210>1

<211>3215

<212>DNA

<213>HBV?C265-15

<400>1

ctccaccact?ttccaccaaa?ctcttcagga?tcccagagtc?agggccctgt?actttcctgc 60

tggtggctcc?agttcagaaa?cagtgagccc?tgctcagaat?actgtctctg?ccatatcgtc 120

aatcttatcg?aagactgggg?accctgtacc?gaacatggag?agcatcgcat?caggactcct 180

aggacccctg?ctcgtgttac?aggcggggtt?tttcttgttg?acaaaaatcc?tcacaatacc 240

acagagtcta?gactcgtggt?ggacttctct?cagttttcta?gggggaacac?ccgtgtgtct 300

tggccaaaat?tcgcagtccc?aaatctccag?tcactcacca?acctgttgtc?ctccaatttg 360

tcctggttat?cgctggatgt?ttctgcggcg?ttttatcatc?ttcctctgca?tcctgctgct 420

atgcctcatc?ttcttgttgg?ttcttctgga?ctatcaaggt?atgttgcccg?tttgtcctct 480

aattccagga?tcatcaacaa?ccagcaccgg?accatgcaaa?acctgcacga?ctcctgctca 540

aggaacctct?atgtttccct?catgttgctg?tacaaaacct?acggacggaa?actgcacctg 600

tattcccatc?ccatcatctt?gggctttcgc?aaaataccta?tgggagtggg?cctcagtccg 660

tttctcttgg?ctcagtttac?tagtgccatt?tgttcagtga?ttcgtagggc?tttcccccac 720

tgtctggctt?ttagttatat?ggatgatgtg?gttttggggg?ccaaatctgt?acaacatctt 780

gagtcccttt?atgccgctgt?taccaatttt?cttttgtctt?tgggtataca?tttaaaccct 840

cacaaaacaa?aaagatgggg?atattccctt?aacttcatgg?gatatgtaat?tgggagttgg 900

ggcacattgc?cacaggaaca?tattgtacaa?aaaatcaaaa?tgtgttttag?gaaacttcct 960

gtaaacaggc?ctattgattg?gaaagtatgt?caacgaattg?cgggtctttt?ggggttcgcc 1020

gcccctttca?cgcaatgtgg?ctatcccgct?ttaatgcctt?tatatgcatg?tatacaagca 1080

aaacaggctt?ttactttctc?gccaacttac?aaggcctttc?taagtaaaca?gtatctgaac 1140

cttacccccg?ttgctcggca?acggcctggt?ctgtgccaag?tgtttgctga?cgcaaccccc 1200

actggttggg?gcttggccat?aggccatcag?cgcatgcgtg?gaacctttgt?gtctcctctg 1260

ccgatccata?ctgcggaact?cctagccgct?tgttttgctc?gcagcaggtc?tggggcaaaa 1320

ctcatcggga?ctgacaattc?tgtcgtgctc?tcccgcaagt?atacatcatt?tccatggctg 1380

ctaggctgtg?ctgccaactg?gatcctgcgc?gggacgtcct?ttgtttacgt?cccgtcggcg 1440

ctgaatcccg?cggacgaccc?ctctcggggc?cgcttggggc?tctaccgccc?gcttctccgc 1500

ctgttgtgcc?gaccgaccac?ggggcgcacc?tctctttacg?cggactcccc?gtctgtgcct 1560

tctcatctgc?cggaccgtgt?gcacttcgct?tcacctctgc?acgtcgcatg?gagaccaccg 1620

tgaacgccca?cgggaacctg?cccaaggtct?tgcataagag?aactcttgga?ctttcatcca 1680

tgtcaacgac?cgaccttgag?gcatacttca?aagactgtgt?gtttactgag?tgggaggagt 1740

tgggggtgga?ggttaggtta?aaggtctttg?tactaggagg?ctgtaggcat?aaattggtgc 1800

gttcaccagc?accatgcaac?tttttcacct?ctgcctaatc?atctcatgtt?catgtcctac 1860

tattcaagcc?tccaagctgt?gccttgggtg?gctttagggc?atggacatcg?acccgtataa 1920

agaatttgga?gcttctgtgg?agttactctc?ttttttgcct?tctgactcct?ttccttctat 1980

tcgagatctc?ctcgacaccg?cctctgctct?gtatcgggag?gccttagagt?ctccggaaca 2040

ttgttcacct?caccatacgg?caatcaggca?agctattctg?tgttggggtg?agttgatgaa 2100

tctagccacc?tgggtgggaa?gtaatttgga?acatccagca?tccagggaat?tagtagtcag 2160

ctatgtcaac?gttaatatgg?gcttaaaatt?cagacaacta?ttgtggtttc?acatttcctg 2220

tcttactttt?ggaagagaaa?ctgttcttga?atatttggtg?tcttttggag?tgtggattcg 2280

cactcctcct?gcatatagac?cacaaaatgc?ccctatctta?tcaacacttc?cggaaactac 2340

tgttgttaga?ccaagaggca?ggtcccttag?aagaagaact?ccctcgcctc?gcagacgaag 2400

gtctcaatcg?ccgcgtcgca?gaagatctca?atctcgggaa?ccccaatgtt?agtattcctt 2460

ggacacataa?ggtgggaaac?tttactgggc?tttattcttc?tacggtacct?tgctttaatc 2520

ctaactggca?aactccttct?tttcctgaca?ttcatttgca?ggaggacatt?gttgatagat 2580

gtaagcaatt?tgtgggaccc?cttacagtca?atgaaaacag?gagactaaaa?ttaattatgc 2640

ctgctgggtt?ttatcccaat?ggtactaaat?attttccctt?agataaaggg?atcaaaccgc 2700

attatccaga?gtatgtagtt?aatcattact?tccagacgcg?acattattta?cacactcttt 2760

ggaaggcggg?gatcttatat?aaaagagaat?ccacacgtag?cgcctcattt?tgcgggtcac 2820

catattcttg?ggaacaagat?ctacagcatg?ggaggttggt?cttccaaacc?tcgaaaaggc 2880

atggggacaa?atctttctgt?ccccaatccc?ctgggattct?tccccgatca?tcagttggac 2940

cctgcattca?aagccaactc?agaaaatcca?gattgggacc?tcaacccgca?caaggacaac 3000

tggccggacg?ccaacaaggt?gggagcggga?gcattcgggc?caggggtcac?tcctccccat 3060

gggggactgt?tggggtggag?ccctcaggct?cagggcctac?tcacaactgt?gccagcagct 3120

cctcctcctg?cctccaccaa?tcggcagtca?ggagggcagc?ctactccctt?atctccacct 3180

ctaagggaca?ctcatcctca?ggccatgcag?tggaa 3215

<210>2

<211>9420

<212>RNA

<213>HCV?GZ52557

<400>2

gccagccccu?aauggggcga?cacuccacca?ugaucacucc?ccugugagga?acuacugucu 60

ucacgcagaa?agcgucuagc?cauggcguua?guaugagugu?cgugcagccu?ccaggacccc 120

cccucccggg?agagccauag?uggucugcgg?aaccggugag?uacaccggaa?uugccaggau 180

gaccgggucc?uuucuuggaa?caaccccgcu?caaugccugg?agauuugggc?gugcccccgc 240

gagacugcua?gccgaguagu?guugggucgc?gaaaggccuu?gugguacugc?cugauagggu 300

gcuugcgagu?gccccgggag?gucucguaga?ccgugcauca?ugagcacacu?uccuaaaccu 360

caaagaauaa?ccaaaagaaa?caccaaccgu?cgcccacagg?acguuaaguu?cccgggcggc 420

ggccagaucg?uugguggagu?uuacuuguug?ccgcgcaggg?gcccuagauu?gggugugcgc 480

gcgacgagaa?aagcuucgga?acggucccag?cccagaggca?ggcgucagcc?uauccccaag 540

gcgcgccaug?ccgcgggccg?uaccuggggg?caacccgggu?acccuuggcc?ccucuacggg 600

aaugagggcu?gugggugggc?aggguggcuc?cuguccccuc?gcggcucccg?cccgacgugg 660

ggccccaacg?acccccggcg?uagaucccgc?aauuugggua?aagucaucga?uaccuuuacu 720

ugcggucucg?ccgaucucau?gggguacguc?ccugucuugg?gcggucccuu?agggggcguc 780

gccgcagcuc?uggcacacgg?uguucgggcu?guggaagacg?ggaucaauua?cgcaacaggg 840

aaucuacccg?guugcucuuu?cucuaucuuu?cuccuggccc?uccucucaug?ccuuacugug 900

cccaccucug?cucuuaauua?ugccaacaag?agcggcauau?accaucuuac?caaugacugc 960

cccaacagca?gcauuguuua?ugaggcagag?acagccauac?uucacuuacc?agggugcgug 1020

ccguguguca?aaguggccaa?uagguccaaa?ugcugggucc?cugcgacgcc?cacguuggcu 1080

guccaggacg?agucaacacc?agcuauuggg?uuccguggcc?acguggaugu?cauggcaggc 1140

gccgcaacua?ucuguucugc?ucuguacgug?ggggacuugu?gcggcggcgc?uuucuuggug 1200

ggccaacucu?ucaccuuccg?cccucgccuc?caccauaccg?ugcaggacug?uaauugcucc 1260

aucuacccug?gccacgucac?cggccacaga?auggcguggg?acaugaugau?gaauuggucu 1320

ccuaccacua?cuuuuauacu?auccagcauc?cugagaaucc?cgcaggugcu?caucgagguu 1380

uuuaccggug?gucacugggg?ugucauuggu?gcuguggugu?auuucucuau?gguaggcagu 1440

uggguaaaag?uucuccucgu?ccugcuccuc?uucgcuggcg?uggaugcaua?ucacaccucc 1500

gugggauacg?cggcaggcca?uacggcgucc?agcuuugucg?gccucuucac?cccgggagcu 1560

ucucagcacc?uccagcuuau?caacaccaac?ggcagcuggc?acaucaaucg?uacagcucuc 1620

aauuguaaug?auagucugaa?gacuggguuc?aucgcaggcc?uauuuuaugu?ccgcaaguuu 1680

aauuccaccg?gaugcccgca?acgauugucc?ucuuguaagc?cacucacaca?uuuccaucaa 1740

ggguggggcu?ccaucucuua?ugccaaccua?uccggcccau?cugaugacaa?gccuuacugc 1800

uggcacuacc?ccccccgccc?gugugaagug?guaccggcug?agacagugug?uggcccaguc 1860

uauugcuuua?cacccagucc?ggucgugguc?ggcaccacug?accagagggg?ccuccccaca 1920

uacaccuggg?gagcuaacaa?gacugauguc?uuccuguuau?ccagccagag?accuccauca 1980

ggcggguggu?acggaugcac?cuggaugaac?gcgacggggu?ucguuaagac?cugcggugcu 2040

ccgccgugua?acaucagacc?cgugccgaau?gccucugacc?cagcggaguu?gagguguccc 2100

accgacugcu?ucaggaaaca?ucccgaggca?acguacgcuc?gguguggcuc?agggcccugg 2160

cuaaccccca?gguguuuggu?ggacuauccc?uacaggcuau?ggcacuaucc?augcacaguc 2220

aauuacacca?uccacaccgu?ccgcauguuu?guggcugguc?uagagcauag?guugaaagug 2280

gcgugcaacu?ggacccgcgg?cgagcgcugu?gaguuggacg?accgggacag?gaucgagaug 2340

cacccccucc?uguuuuccac?cacagagcuc?gcgguccugc?caugcuccuu?uagcaccaug 2400

ccugcacugu?cauccggacu?gauccaccuc?caucagaaug?uuguggacgu?gcaauaccua 2460

uauggaguau?ccacgagcac?caccagcugg?gugauuaaau?gggaguacau?cguucuccug 2520

uuucucuacc?uggcugaugc?ccgucucugc?accuguuugu?ggcugauguu?cuuagugggu 2580

aaggccgagg?cagcuuugga?aaaccucauc?agucugaaug?cugccgcggc?ugcggguacc 2640

cacagguggg?uguggggucu?agccuucauc?ugccuugcuu?ggcaugucag?agguagacuu 2700

ggccccgugg?ucgccuaugg?agccuugcag?cuauggcccc?uucuuuugcu?uguccucgca 2760

cugccaccgc?gggcguaugc?cuacgacggg?gagcaggcag?caucucuagg?ugcagcgguc 2820

auugucaucc?ugacccucgu?cacucucacu?ccacauuaua?aggcucugcu?cacugggugc 2880

cucuggugga?uccaguauuu?cauagcacgg?cuagaagcug?agcugcauau?gugggcuccg 2940

acccugacag?uccggggggg?ccgugaugcu?gugauacuac?ucaccugccu?auuucauccc 3000

acuuuggggu?uugaggucac?caagauacuu?cuugccuuaa?uuggcccguu?guacuugcuc 3060

caagaagguc?ugcugcgggu?gccguacuac?gugcgggcac?augcgcuuuu?gcgcgugugc 3120

uugcucgugc?gucggauagc?agcggguaag?uacaugcaga?ugcuccuucu?uaaagucggc 3180

gcggcgacug?gcaccuacau?cuaugaccau?cuaucgccuc?ucgccgacug?ggcuagcgac 3240

gguuugcgcg?accucgcugu?cgcgguugaa?ccggucguuu?uuucaccgau?ggagaagagg 3300

gucauuguuu?ggggcgcuga?cacuauugcc?uguggugaua?uauuaucugg?ccuuccuguc 3360

ucagccaggc?gaggaaaucu?cguuuuccug?ggcccggcug?augacgugaa?ggggaagggc 3420

uggucccucc?uagcucccau?cacggcuuau?gcucagcaaa?cacggggccu?acugggcacc 3480

aucgucacaa?gccucacugg?cagggacagg?aaccaagugg?aaggggagau?ccaggugcug 3540

uccaccgcca?cccagacuuu?ccugggcaca?accaucaaug?gcgugcugug?gacuguuuac 3600

cacggagccg?ggucgaagac?ccuggccggu?ccaaagaagc?cuuugugcca?aauguacacc 3660

aauguggacc?aagaccuggu?aggauggccc?gcccccccgg?gugcuaaguc?guacacggcc 3720

ugcacuugcg?gagcaaguga?cacauaucua?gucacaagaa?auggugaugu?cauaccugcc 3780

aggcgaaagg?gggauagucg?cgcagcacuc?cuaagcccac?gaccuauuag?cacucuaaaa 3840

gguucgucgg?gcgggcccgu?ccucugcccg?ucagggcaug?uggugggcau?uuuccgcgcg 3900

gcuaucugcg?cuaggggcgu?ugcuaaggcc?auugacuuug?ugccggugga?gaacauggaa 3960

accaccaugc?gcuccccuag?uuucucugac?aauuccacuc?cgcccgcugu?accacagagu 4020

uaucaggugg?gcuaccucca?cgcuccgacu?ggaagcggga?agagcacuaa?ggucccugcg 4080

gcuuacgcca?gccagggaua?uaaggugcua?guguugaacc?caucuguugc?ugccacucuc 4140

agcuuuggua?gcuucaugag?ccgggcuuau?ggcaucgacc?ccaauauaag?aaccgggguc 4200

aggacaauca?cgacaggcgc?ccccauuacu?uacucaaccu?acggcaaauu?ccuugccgac 4260

ggcgggugua?gugggggcgc?guaugacaua?aucauuugug?augagugcca?cuccacggac 4320

ccuaccaccg?uccuggguau?aggcacaguc?uuggaccaag?cggaaacugc?agacgcccgg 4380

cucaccgucc?uggccacugc?aacaccgccu?ggcuccguaa?cugucccaca?cccgaacaua 4440

caagaaguug?cuuugcccac?gacaggggag?guccccuucu?acggcaaggc?uauaccccua 4500

gagcacauca?agggggguag?gcaucucauc?uuuugucauu?caaagaagaa?gugugacgag 4560

cuugcuggcc?aauugaggca?guuagggcug?aacgcuguag?ccuucuacag?agguaucgac 4620

guuucaguca?ucccuaccuc?cggcgauguc?gucguuugcg?cuacggacgc?ccuuaugacu 4680

gguuauacgg?gcgauuucga?uagcguaauc?gacuguaacg?ucacugucac?gcaggucguc 4740

gacuucaguc?uggacccuac?uuuuuccaua?gagacaacca?cuguccccca?agacgccgug 4800

ucucgcaguc?aacggcgcgg?ccguacgggg?cgggggaaac?cgggggugua?uagguacgua 4860

ucgcagggag?agcgcccauc?agggacguuc?gacaccguca?uccucugcga?ggccuaugac 4920

accggauguu?cgugguauga?gcugacaccu?ucagaaacca?ccguccgguu?acgggcauac 4980

cuuaacacgc?cugggcuccc?cguaugccag?gaucaucuug?aguucuggga?ggcaguguuc 5040

acugggcuca?cccacauuga?ugcccauuuu?cucucucaga?caaagcaggc?gggggaaaac 5100

uuugcguauc?ugguggcuua?ccaagccacc?gucugcucac?gagcgaaagc?uccccccccg 5160

uccugggacc?aaauguggaa?augucucauc?agacucaagc?cuacucucac?ggggccuacg 5220

cccuuguugu?acaggcuugg?agcggugcag?aaugacauca?caacaacaca?cccaaucacc 5280

aaguacauca?uggcuugcau?gucggcagau?uuagagguca?ucaccagcac?augggugcua 5340

gccggcggga?uccuugccgc?cuuggcugcc?uauugccuca?cgaugggcag?cguugucauc 5400

ugcggcagga?ucauaaccag?uggcaagccc?gccgucaugc?ccgaccgaga?gaucauguac 5460

cagcaguaug?augagaugga?agagugcacu?agucgcauuc?cauaucucgu?cgaggggcag 5520

cagauagccg?aacaguucag?acaaaaggug?cugggccuga?ugcagaccac?ggccaagcag 5580

gcggaagacu?ugaagccagc?cgucacuucu?gccuggccga?agauugagca?auucuggcac 5640

aagcacaugu?ggaacuucau?cagcggaaua?caguaucugg?cgggguuauc?cacuuuaccc 5700

ggcaauccgg?cuguagcugc?ccucaugucu?uucucggccu?cauugacgag?cccacuaccc 5760

acaucuacaa?cccuccuccu?gaauguucug?gggggcuggg?uggcuucaca?acugggaccc 5820

gccccagccg?ccacagcuuu?uguggcgagc?ggccuagcag?gcgcggccau?aggcggcgur 5880

ggccugggca?aggucaucgu?agacaucuua?gccggcuaug?gagcaggcgu?auccggggcu 5940

cucgurgcwu?uyaagaucau?gagcggcgag?acucccgcag?uugaggacau?ggucaacuua 6000

cuaccagccc?uguugagucc?cggcgcucuc?gucgugggcg?ucgugugcgc?ugccauccuc 6060

cggcgacaug?ugggccccuc?ugaaggagcc?gcccaaugga?ugaaccgguu?gauagccuuc 6120

gcaucucggg?guaaccaugu?cucucccacg?cauuauguuc?cagagaccga?ugcaucacgg 6180

gcugugacua?acauacucag?uucccucacc?auuacuaguc?uucuccgcaa?gcuucaucag 6240

uggauccaug?aagacuaugc?cucaccuugc?ucaacgucuu?gguugaggga?uaucugggac 6300

ugggugugua?cuguacucuc?ugacuucaag?acauggcuca?aagcaaaacu?cuucccagcc 6360

cucccaggga?uccccuucua?cucgugccaa?cgggguuaua?gggggauaug?gaggggcgac 6420

ggagucagcc?acacuacgug?cccaugcggc?gcggaaauag?cgggccacgu?aaagaacggg 6480

ucuaugaaga?ucgugggccc?ccggaccugc?agcaacgugu?gguuuggcac?cuuucccauc 6540

aaugcgacca?cgacuggucc?aagugugcca?gcccccucgc?cuaacuacac?cagggccuug 6600

uggagagugg?ccgcggagga?guauguugag?auucuaaggg?uuggggacag?ucacuacgug 6660

gugggcguca?ccgcugacaa?cgugaaaugc?cccugccaag?uccccgcucc?ggaguucuuc 6720

acugagauag?auggcgugag?gauacaccgc?uaugcaccaa?agugcaagcc?acuucucagg 6780

gaugaggucu?ccuuuagugu?ggggcucaac?acauacguag?uggggucuca?gcugcccugc 6840

gaccccgagc?cagaugucuu?cgugguaaca?ucaaugcuga?cagacccaga?ucacaucaca 6900

gcagaggcgg?cuaggcggcg?ccucgcuaga?ggcucuccuc?caucacucgc?uaguuccucu 6960

gccagccagu?ugucugccgc?uucguuaaaa?gccacaugcu?ccaccaacug?uguccauccc 7020

gacgcugaac?ucaucagcgc?caaucuccug?uggaggcagg?agaugggugg?aaccaucacc 7080

aggguggagu?cagagaacaa?aauuguggug?cucgauuccu?ucgagccguu?gaaagaugaa 7140

uaugaugaca?gggaaauauc?aacagcggcg?gagugccaua?ggccccgacg?gccugcguuu 7200

ccggccgcuc?uuccugugug?ggcccguccg?gacuacaacc?ccccacucuu?ggagccaugg 7260

aaggcaccug?acuacaagcc?ucccacggua?uccggaugug?cccuaccacc?uacaccauca 7320

ccuccugucc?cucccccaag?gaggaagaag?cugauacggc?ucgaugaguc?aagaguggcg 7380

caagcuuugg?cagagcuggc?aucccgggcg?uucucaacac?cuccagagca?gcccgacaac 7440

aauucugauc?caggacuagg?accuggcgcg?ggggagcccg?cggaccauga?cgcagaggga 7500

gaaacaucag?auguggacuc?guauagcucc?augccacccc?uugaggguga?gccaggagac 7560

ccugaccuaa?gcucaggauc?gugguccaca?gucagugaug?aggaaaccag?cguaugcugu 7620

uccaugucuu?acucauggac?aggcgcuccc?aucaccccuu?gcgcagcuga?ggaggaaaag 7680

uugccaauaa?guccccugag?caacggccua?uuacggcacc?acaaccuggu?guacuccacc 7740

accucccgca?gcgccccuuu?gcgccagaaa?aaaguaaccu?ucgaccgguu?gcagguccua 7800

gauuccuauu?acuaugacac?agucaaggag?auaaaaaccc?uggcaucagg?agugaaggcc 7860

agacuccucu?ccguagagga?ggcuugcgac?cucacccccc?cacgaucagc?ccgguccaag 7920

uuuggauacg?gggcgaagga?ugucagggcc?cacacuagca?aggccguaga?ccacaucagc 7980

uccguguggg?aggacuugcu?ggaagacaac?ucaacaccua?uuccuaccac?uguaauggcc 8040

aaaaacgaag?uguucugugu?ggacagcucg?aaagggggcc?gaaagcccgc?ccgacuuauc 8100

guauacccgg?accuuucagu?ucgggugugc?gaaaagagag?cucucuacga?cauuacgcag 8160

aaguugcccg?uggccauuau?gggagccgcu?uacgguuucc?aguacucacc?uaaucagaga 8220

guggaauauc?uccucaaggu?guggcgcucc?aagaaaacuc?cuaugggguu?cuccuaugac 8280

acccgguguu?uugacucaac?agucaccgag?cgcgacaucc?guacagagga?gucuaucuac 8340

caaugcugcc?agcuagaccc?gcaggcucgc?aaagcuauaa?caucccugac?ugaacggcuc 8400

uaugucggug?guccuaugua?caacucaaag?ggccaauguu?guggauaccg?ucgaugcagg 8460

gccagcgggg?uccuuccaac?cagccuaggc?aacaccauga?cauguuacau?caaagcuaug 8520

gcagccugca?aggcggccaa?gcuaaaagac?uuugacaugc?uggucugcgg?ugacgauuua 8580

gucgugauuu?cugagagcga?cggcguccag?gaggacauaa?gugcccugcg?agccuucacg 8640

gaggccauga?ccagguacuc?ugcgcccccu?ggcgacgaac?cucacccaga?guacgaccug 8700

gagcggauaa?caucuugcuc?cgcaaacguc?uccguagccc?augaccaaaa?uggacguagg 8760

uacuacuacc?ucacacgaga?cccaguuaca?ccuuuagccc?gggcugcuug?ggaaacagcu 8820

cggcacacuc?caguaaacuc?gugguugggg?aacauuauua?uguacgcccc?ugccaucugg 8880

guccgcaugg?uucucaugac?acauuucuuc?ggaaugcucc?agucccaaga?aacacuccau 8940

caagcacucg?acuucgaucu?cuauggaguc?acauauucca?ucacuccgcu?ugaucuaccu 9000

cagaucauac?agcgccuaca?uggcauggcu?gcuuuuucac?uccaugguua?cucucccggc 9060

gaacucaauc?ggguggcuuc?gugucucagg?aagcuuggga?ugcccccguu?gagagcuugg 9120

agacaucggg?caagagcagu?cagagcuagg?cuuaucgccc?agggggggaa?ggccgcuaua 9180

ugcggcaagu?accucuuuaa?cugggccguu?aaaaccaagc?ucaaacucac?uccauuggcc 9240

ggcgcggcua?cucucgacuu?gucggggugg?uuuacgucag?gcuacagcgg?gggggacauu 9300

uuucacagcg?uguccuaugc?ccgaccccgc?guauuacucc?ugugccuacu?ccugcucacc 9360

guagggguag?gcaucuuccu?gcuuccugcu?cgguaagcag?gaggccuuaa?gcaacacucc 9420

<210>3

<211>9720

<212>RNA

<213>HIV064

<400>3

uggaugggcu?aauuuacucc?aagaaaagac?aagagauccc?ugauuugugg?gucuauaaua 60

cucaaggcuu?cuucccugau?uggcaaaacu?acacaccagg?gccagggacc?agauucccac 120

uguguuuugg?auggugcuuc?aagcuaguac?caguugaucc?aagagaggua?gaggaagaaa 180

acaaagggga?aaacaacugc?cuguuacacc?ccaugagcca?gcauggaaua?gaugacaacg 240

aaagagaagu?gcugaugugg?aaguuugaca?gcucccuagc?acgaaaacac?auagcccgag 300

aacugcgucc?agaguacuac?aaagacugcu?gacaaagaag?uuucuaacua?ggacuuccgc 360

uggggacuuu?ccaggggagg?uguggccggg?gaggaguugg?ggaguggcua?acccucagau 420

gcugcauaaa?agcagccgcu?uuucgcuugu?acugggucuc?ucuugguaga?ccaggucgag 480

cccgggagcu?cucuggcuag?caagggaacc?cacugcuuaa?agccucaaua?aagcuugccu 540

uaagugcuua?aaguagugug?ugcccgucug?uguuaggacu?cuaguaacua?gagaucccuc 600

agaccacucu?agacuaagua?aaaaucucua?gcaguggcgc?ccgaacaggg?acuugaaagc 660

gaaaguuaau?agggacucga?aagcgaaagu?uccagagaag?uucucucgac?gcuggacucg 720

gcuugcugag?guacacacag?caagaggcga?gagcggcgaa?cugguaagua?cgccaauuuu 780

ugacuagcag?aagcuagaag?gagagagaug?ggugcgagag?cgucaguauu?aaguggggga 840

aaauuagaug?caugggaaaa?aauucgguua?cggccaggag?gaaagaaaaa?auauaggaua 900

aaacauuuag?uaugggcaag?cagagaguua?gaaagauucg?cgcuuaaccc?uggccucuua 960

gaaacagcag?aaggauguca?acagauaaua?gaacaguuac?agucaacucu?caagacagga 1020

ucagaagaac?uuaaaucauu?auuuaauuua?guaguaaccc?ucuggugcgu?acaccaaagg 1080

auagauguaa?aagacaccaa?ggaagcuuca?gauaaauuag?aggaaguaca?aaagaagagc 1140

cagcaaaaaa?cacagcaggc?agcagcuggc?acaggaagca?gcagcaaagu?cagccaaaau 1200

uacccuauag?ugcaaaauac?acaagggcaa?augguacauc?agccuuuauc?accuagaacu 1260

cugaaugcau?gggugaaagu?aguagaggaa?aaagguuuua?acccagaagu?aauacccaug 1320

uucucagcau?uaucagaggg?agccacccca?caagauuuaa?auaugaugcu?aaauauagug 1380

gggggacacc?aggcagcaau?gcagauguua?aaagaaacca?ucaaugagga?agcugcagaa 1440

ugggauaggu?uacacccagu?acaugcagga?ccuauuccac?caggccagau?gaagcggcaa 1500

ccaaggggaa?gugacauagc?aggaacuacu?aguacccuuc?aagaacaaau?aggauggaug 1560

acaaauaauc?caccuauccc?agugggagac?aucuauaaaa?gguggauaau?ccugggauug 1620

aauaaaauag?uaagaaugua?uagcccuguu?ggcauuuugg?acauaaaaca?agggccaaaa 1680

gagcccuuca?gagacuaugu?agacagguuu?uauaaaacuc?ucagagcgga?acaagcuaca 1740

caggagguaa?aaaacuggau?gacagaaacc?uuguuagucc?aaaaugcgaa?uccagacugu 1800

aaguccauuu?uaaaagcauu?aggaacagga?gcuacauuag?aagaaaugau?gacagcaugc 1860

cagggagugg?gaggaccuag?ccauaaggca?aggguuuugg?cugaggcaau?gagccauguu 1920

caaaauacaa?auauaaugau?gcagagaggc?aauuuuaagg?uccagaaaag?aauuaagugc 1980

uucaacugug?gcaaagaagg?acaccuagcc?agaaauugca?gggccccuag?aaagaagggu 2040

uguuggaaau?gugggcaaga?aggacaucaa?augaaagacu?gcacugggag?acaggcuaau 2100

uuuuuaggca?aaauuuggcc?uuccaacaag?ggaaggccag?ggaauuuucc?ucagagcaga 2160

acagagccaa?cagccccacc?agcagaaaau?ugggggaugg?gggaagagau?aaccuccuuc 2220

cugaagcagg?agcagaaaga?caaggagcau?ccugcuccuu?caguuucccu?caaaucacuc 2280

uuuggcaacg?accccuuguu?acaguaaaaa?uaggaggaca?guuaaaagaa?gcucuauuag 2340

auacaggagc?agaugauaca?guauuagaag?auauaaauuu?gccaggaaaa?uggaaaccaa 2400

aaaugauagg?gggaauugga?gguuuuauca?agguaaggca?auaugaucag?auacuuguag 2460

aaauuugugg?aaaaaaggcu?auagguacag?uguuaguagg?accuacaccu?gucaauauaa 2520

uuggacgaaa?uauguugacu?cagauugguu?guacuuuaaa?uuucccaguu?aguccuauug 2580

acacuguacc?aguaaaauua?aagccaggaa?uggauggacc?aaaaguuaaa?caguggccau 2640

ugacagaaga?aaaaauaaaa?gcauuaacag?aaauuuguaa?agagauggaa?gaggaaggaa 2700

aaauuucaag?aauugggccu?gaggauccau?acaauacucc?aauauuugcu?auaaagaaaa 2760

aggacagcac?caaauggaga?aaauuaguag?auuucagaga?gcucaauaaa?agaacucagg 2820

acuuuuggga?aguucaauua?ggaauaccgc?auccagcagg?uuuaaaaaag?aaaaaaucag 2880

uaacaguacu?agauguggga?gaugcauauu?uuucaguucc?uuuagaugag?gacuuuagaa 2940

aguauacugc?auucaccaua?ccuaguauaa?acaaugagac?accaggaauc?agauaucagu 3000

acaaugugcu?accucaggga?uggaaaggau?caccagcaau?auuccagagu?agcaugacaa 3060

aaaucuuaga?gcccuauaga?auaaaaaauc?cagaaaugga?uaucuaucaa?uacauggaug 3120

auuuguuggu?aggaucugac?uuagaaauag?gacagcacag?agcaaaaaua?gaggagcuaa 3180

gagcucaucu?auugagcugg?ggauuuacua?caccagacaa?aaagcaucaa?aaggaaccuc 3240

cauuccuuug?gaugggauau?gaacuccauc?cugacagaug?gacaguccag?ccuauagaac 3300

ugccagaaaa?agacagcugg?acugucaaug?auauacagaa?auuaguggga?aaacuaaauu 3360

gggcaaguca?aauuuaugca?gggauuaagg?uaaagcaacu?guguaaacuc?cucaggggag 3420

cuaaaacacu?aacagacgua?guaccacuga?cugaagaagc?agaacuagaa?uuggcagaga 3480

acagggagau?ucuaaaaacc?ccugugcaug?gaguauauua?ugacccauca?aaagacuuag 3540

uggcagaagu?acagaaacaa?gggcaggacc?aauggacaua?ucaaauuuau?caagagccau 3600

uuaaaaaucu?aaaaacagga?aaauaugcca?gaaaaagguc?ugcucacacu?aaugauguaa 3660

gacaacuaac?agaaguggug?caaaaaauag?ccacagaagg?cauaguaaua?uggggaaaga 3720

uuccuaaauu?uagacuaccc?auacaaaaag?aaacauggga?aacauggugg?auggaauauu 3780

ggcaggcuac?cuggauuccu?gaaugggagu?uuguuaauac?cccuccucua?guaaaauuau 3840

gguaccaauu?agaaaaagac?ccuauaauag?gagcagagac?uuucuaugua?gauggggcau 3900

gcaguaggga?aacuaagcua?ggaaaagcag?gguaugucac?cgacagagga?agacaaaagg 3960

uaguuucccu?aacugagaca?acaaaucaaa?agacugaauu?acaugcaauc?cauuuagccu 4020

ugcaggauuc?aggaucagaa?gugaacauag?uaacagacuc?acaauaugca?uuaggaauca 4080

uucaugcaca?accagacagg?agugaaucag?aaguagucaa?ccaaauaaua?gaggagcuaa 4140

uaaaaaagga?aaaagucuac?cugucauggg?ugccagcaca?caaggggauu?ggaggaaaug 4200

aacaaguaga?uaaauugguc?aguucaggaa?ucaggaaggu?gcuguucuua?gaugggauag 4260

auaaggcuca?agaagaacau?gaaagauauc?acagcaauug?gagaacaaug?gcuagugauu 4320

uuaauuugcc?accuauagua?gcaaaggaaa?uaguagccaa?cugugauaaa?ugucaacuaa 4380

aaggggaagc?aaugcaugga?caaguaggcu?guaguccagg?aauauggcaa?uuagauugca 4440

cacaucuaga?aggaaaaguc?auccugguag?caguccacgu?ggccagugga?uauauagaag 4500

cagaaguuau?cccagcagaa?acaggacagg?aaacagcaua?cuuucugcua?aaauuagcag 4560

gaagauggcc?aguaaaagua?auacacacag?acaaugguag?caauuucacc?agcaaugcag 4620

uuaaagcagc?uuguuggugg?gccaaugucc?gacaggaauu?ugggaucccc?uacaauccuc 4680

aaagucaagg?aguaguagaa?ucuaugaaua?aggaauuaaa?gaaaaucaua?gggcagauaa 4740

gagaacaagc?ugaacaccuu?aagacagcug?uacaaauggc?aguauucauu?cacaauuuua 4800

aaagaaaagg?ggggauuggg?ggguacagug?caggggaaag?aauaauagac?auaauagcaa 4860

cagacauaca?aacuaaagaa?uuacaaaaac?aaauuacaaa?aauucaaaau?uuucggguuu 4920

auuacaggga?cagcagagac?ccaauuugga?aaggaucagc?aaaacuacuc?uggaaaggug 4980

aaggggcagu?aguaauacaa?gacaauagug?aaauaaaagu?aguaccaaga?agaaaagcaa 5040

agaucauuag?ggauuaugga?aaacagaugg?caggugauga?uuguguggca?gguagacagg 5100

augaggauua?gaacauggaa?uaguuuagua?aaacaucaua?uguaugucuc?aaagaaagcu 5160

aguaaguggu?uuuauagaca?ucauuaugaa?agccagcauc?caaagguaag?uucagaggua 5220

cacaucucac?uaggagaggc?uauauuagua?auaagaacau?auuggggucu?gcagacagga 5280

gaaaaggacu?ggcaauuggg?ucauggaguc?uccauagaau?ggaggcagaa?aaacuauaga 5340

acacaaauag?auccugaccu?agcagacaaa?cugauucauu?uauacuauuu?ugacuguuuu 5400

ucagacucug?ccauaaggaa?agccauauua?ggacaaguag?uuagacguag?gugugaauac 5460

ccaucaggac?auaaccaggu?aggauccuua?caauauuugg?cacugaaagc?auuaacaaca 5520

ccaaaaaaga?ucaggccacc?ucugccuagu?guuaaaaaau?uaacagaaga?cagauggaac 5580

aagccccaga?agaucauggg?ccacagagag?aacccuacaa?uuuauggaca?uuagagcugu 5640

uagaggagcu?uaaaaaugaa?gcuguuagac?auuuuccuag?gaccuggcuc?cauggcuuag 5700

gacaguacau?cuauaacacu?uauggggaua?cuugggaagg?gguugaagcc?auaauaagaa 5760

cuuugcaaca?gcuacuguuu?guucauuuca?gaauugggug?ucaacauagc?agaauaggca 5820

uuuugccagg?gagaagaggc?aggaauggag?ccgguagauc?cuaaccuaga?gcccuggaau 5880

cauccgggaa?gucagccuac?aacugauugu?agcaagugcu?auuguaaaaa?auguugcugg 5940

cauugccaaa?ucugcuuucu?gaaaaaaggc?uuaggcaucu?ccuauggcag?gaagaagcgg 6000

aaguaccgac?gaggaacuuc?ucagagcagu?gaggaucauc?aaaauccuau?accaaagcag 6060

ugaguauaaa?aauauauaug?uaaugacacc?cuuggaaauu?agugcaauag?uaggacugau 6120

aguagcgcua?aucuuagcaa?uaguagugug?gacuauagua?gcuauagaag?cuaggaaaau 6180

auuaaggcaa?aagaaaauag?acaagauagu?uaagagaaua?agagaaagag?cagaagacag 6240

uggaaaugag?agugaggggg?auacagagga?auuggccaaa?cuuguggaaa?ugggggauuu 6300

ugaucauugg?guuggugaua?acuuguagug?ccucaaacaa?cuuguggguu?acaguuuauu 6360

augggguucc?uguguggaga?gaugcagaua?ccacccuauu?uugugcauca?gaugccaaag 6420

cacaugagac?cgaagugcac?aaugucuggg?ccacacaugc?cuguguaccc?acagacccca 6480

acccacaaga?aauaccccug?gacaauguaa?cagaaaauuu?uaacaugugg?aaaaauaaca 6540

ugguagagca?gaugcaagag?gauguaauca?guuuauggga?ucaaagucua?aagccaugua 6600

uaaaguuaac?uccucuuugu?guuacuuuaa?auuguaccaa?uacuauuuug?accaauacua 6660

cuuugaccaa?uagcacaacc?aauggcaaca?guagcauagg?aaauguaaca?gaugaaguaa 6720

aaaacuguac?uuuuaacaug?accacagaga?uaagagauaa?gcagcagaag?guccgugcau 6780

uuuuuuauaa?gcuugauaua?gaacccaugg?gggggaauga?uaguagugaa?uauagguuaa 6840

uaaguuguaa?uacuucaguc?auuaagcagg?cuuguccaaa?gauauccuuu?gauccaauuc 6900

cuauacauua?uuguacucca?gcugguuaug?cgauuuuaaa?guguaaugau?aagaaguuca 6960

augggacagg?gccauguaaa?aaugucagca?caguacaaug?uacacaugga?auuaaaccag 7020

uaguaucaac?ucaauugcug?uuaaauggca?gucuagcaga?agaagaaaua?auaaucagcu 7080

cugagaaucu?cacaaacaau?gccaaaaaca?uaauagugca?ccuuaauaaa?ucuguaauaa 7140

ucaauuguac?cagacccucc?accaauacaa?gaaaaaguac?aagaauagga?ccaggucaag 7200

uguucuauag?aacaggagac?auaacaggag?auauaaggaa?aacauauugu?gagauuaaug 7260

gaacaguaug?gaaugaaacu?uuaaagcagg?uagcuaaaaa?auuaaaagag?cacuuuaaua 7320

agacaauagu?cuuucaacca?cccucaggag?gagauccaga?aacuacaaug?caucauuuua 7380

auuguagagg?ggaauuuuuc?uauugcaaua?caacaaaauu?guuuaauggu?acagagaaug 7440

gaaccaugga?ggggcuuaau?accacuauca?uacuuccaug?caggauaaag?caaauuguaa 7500

ggauguggca?ggaaguagga?caagcaaugu?auaauccucc?caucagugga?aacauuacuu 7560

guauaucaag?uauuacagga?auacuauuaa?caagagaugg?ugguaauaau?gcaacuaaug 7620

aaaccuucag?accaggagga?ggaaauauaa?aggacaauug?gagaagugaa?uuauauaaau 7680

auaaaguagu?acaaauugaa?ccacuaggaa?uagcacccac?cagggcaaaa?agaagagugg 7740

uggauagaga?aaaaagagca?gugggacuag?gagcuaugau?cuuuggguuc?uuaggagcag 7800

caggaggcac?uaugggcgca?gcgucaauaa?cgcugacggu?acaggccaga?caauuauugu 7860

cugguauagu?gcaacagcaa?aacgauuugc?ugagagcuau?agaggcgcaa?cagcauaugu 7920

ugcaacucac?agucuggggc?auuaaacagc?gccaggcaag?aguccuggcu?guggaaagau 7980

accuaaagga?ucaaagguuc?cuaggacuuu?ggggcugcuc?uggaaaaacc?aucugcacca 8040

cuaaugugcc?cuggaacucc?acuuggagua?acaaaucuua?ugaugagauu?uggaacaaca 8100

ugacaugggu?agagugggag?aaagaaauua?gcaauuacac?aaacaaaauc?uaugaccuac 8160

uuacagaauc?gcagaaccag?caggaaaaaa?augaaaagga?uuuguuagag?uuggacaaau 8220

gggcaagucu?guggaauugg?uuugacauau?caaauuggcu?gugguauaua?aaaauauuua 8280

uaaugauagu?aggaggguua?auagguuuaa?gaauaauuuu?ugcugugcuu?ucuauaguaa 8340

auagaguuag?gcagggauac?ucaccuuugu?cuuuccagac?cccuuuccau?caucagaggg 8400

aacccgacag?acccgaagga?aucgaagaag?aagguggcga?gcaaggcaga?gacagauccg 8460

ugcgauuagu?gagcggauuc?uuagcucuug?caugggacga?ucugaggaac?cugugccucu 8520

ucagcuacca?ccgcuugaga?gacuucaucu?ugauugcaac?gaggacugug?gaacuucugg 8580

gcaagggacu?gagacggggg?ugggaaggcc?ucaaauaucu?ggggagucuu?cuguuauauu 8640

gggggcagga?acugaaaacu?agugcuaucu?cuuugcuuga?ugcuauagca?auaacaacag 8700

cgggguggac?agauaggguu?auagaaguua?cacaaagagc?uuggagagcu?cuucuccaca 8760

uaccuagaag?aaucagacag?ggcuuugaaa?gggcuuugcu?auaaauggga?ggcaaguggu 8820

cgaagaguag?caaaguagga?uggccucagg?ucagggaaag?aauaaagcaa?acuccuccuu 8880

cagcaacaga?aggaguagga?gcaguaucuc?aagaucuaga?uaaacaugga?gcaauaacaa 8940

guaguaauau?gaauaaugcu?gauaaugccu?ggcugagagc?acaagaagaa?gagggggaag 9000

gagggguagg?cuuuccaguc?aggccgcagg?uaccucuaag?accaaugacu?uuuaagggag 9060

cuuuugaucu?uagcuucuuu?uuaaaagaaa?aggggggacu?ggaugggcua?auuuacucca 9120

agaaaagaca?agagauccuu?gauuuauggg?ucuauaauac?ucaaggcuuc?uucccugauu 9180

ggcaaaacua?cacaccaggg?ccagggacca?gauucccacu?guguuuugga?uggugcuuca 9240

agcuaguacc?aguugaucua?agagagguag?aggaagaaaa?caaaggggaa?aacaacuguc 9300

uguuacaccc?caugagccag?cauggaauag?augacgacga?aagagaagug?cugaugugga 9360

aguuugacag?cucccuagca?cgaaaacaca?uagcccgaga?acugcgucca?gaguacuaca 9420

aagacugcug?acaaagaagu?uucuaacuag?gacuuccgcu?ggggacuuuc?caggggaggu 9480

guggccgggg?aggaguuggg?gaguggcuaa?cccucagaug?cugcauaaaa?gcagccgccu 9540

uucgcuugua?cugggucucu?cuugguagac?caggucgagc?ccgggagcuc?ucuggcuagc 9600

aagggaaccc?acugcuuaaa?gccucaauaa?agcuugccuu?gagugcuuaa?aguggugugu 9660

gcccgucugu?guuaggacuc?uggcaacuag?agaucccuca?gaccacucua?gacugaguaa 9720

<210>4

<211>22

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>4

agacaguagu?uccucacagg?gg 22

<210>5

<211>20

<212>RNA

＜213〉artificial sequence

<220>

<223>

<400>5

gauaacuucu?gcuucuauau 20

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

cacgggacca?tgcaagacct?gcacg 25

Claims

1. the extracting method of a target nucleic acid, comprise and utilize marker B specific junction mixture A and marker B, the process that will be attached to the capture nucleic acid-target nucleic acid mixture that forms solid phase carrier-A-B on the solid phase carrier that is combined with marker B specific junction mixture A with the capture nucleic acid and the target nucleic acid in the sample of marker B mark; Described capture nucleic acid comprises 2 '-oxygen with the marker B mark-few nucleic acid that methylates with RNA target nucleic acid specific combination at least, also comprises the few nucleic acid of 2 '-deoxidation with marker B mark at least a and DNA target nucleic acid specific combination.

2. method according to claim 1 is characterized in that: described marker B is Biotin, and described marker B specific junction mixture A is Strepavidin.

3. method according to claim 2 is characterized in that: the extracting method of described target nucleic acid may further comprise the steps:

(1) the capture nucleic acid R that is specific to a kind of RNA target nucleic acid of at least a Biotin of having mark of preparation;

(3) solid phase carrier that will be fixed with Strepavidin adds testing sample, form the capture nucleic acid-target nucleic acid RNA mixture of solid phase carrier-Strepavidin-Biotin mark, or be connected with the mixture of a plurality of described mixtures on same solid phase carrier, obtain containing the target compound of target nucleic acid.

4. method according to claim 3 is characterized in that: the capture nucleic acid that also need prepare a kind of DNA target nucleic acid of being specific to of at least a Biotin of having mark in the described step (1); Also the capture nucleic acid that is specific to the DNA target nucleic acid of at least a Biotin of having mark need be added testing sample in the step (2); Contain in the target compound that contains target nucleic acid that obtains in the step (3) respectively and capture nucleic acid RNA and DNA target nucleic acid one to one.

5. method according to claim 1 is characterized in that: described marker B is 10-40Oligo-dA, and described marker B specific junction mixture A is 10-40Oligo-dT.

6. method according to claim 5 is characterized in that: the extracting method of described target nucleic acid may further comprise the steps:

(1) at least a 3 ' end of preparation has the capture nucleic acid R ' of a kind of RNA target nucleic acid of being specific to of 10-40Oligo-dA mark;

(2) at least a capture nucleic acid R ' is added testing sample, obtain capture nucleic acid-target nucleic acid mixture that 3 ' end has 10-40Oligo-dA, or the mixture of multiple mixture;

(3) solid phase carrier that will be fixed with the few nucleic acid of 10-40Oligo-dT adds testing sample, form the capture nucleic acid-target nucleic acid mixture of solid phase carrier-dT-dA mark, or be connected with the mixture of a plurality of described mixtures on same solid phase carrier, obtain containing the target compound of target nucleic acid.

7. method according to claim 6 is characterized in that: also need prepare the capture nucleic acid that at least a 3 ' end has a kind of DNA target nucleic acid of being specific to of 10-40Oligo-dA mark in the described step (1); Also the capture nucleic acid that is specific to the DNA target nucleic acid that at least a 3 ' end has the 10-40Oligo-dA mark need be added testing sample in the step (2); Contain in the target compound that contains target nucleic acid that obtains in the step (3) respectively and capture nucleic acid target nucleic acid RNA and DNA one to one.

8. method according to claim 7 is characterized in that: the 10-40Oligo-dA of capture nucleic acid 3 ' end is replaced with 10-40Oligo-dC, 10-40polyA or other length is the few nucleic acid of 10-40 base pair; Be covalently bonded in few nucleic acid on the solid phase carrier replace with accordingly with 10-40Oligo-dC complementary 10-40Oligo-dG, with 10-40polyA complementary 10-40polyT or with capture nucleic acid 3 ' other length of terminal sequence complementary be the few nucleic acid of 10-40 base pair.

9. according to the arbitrary described method of claim 1-8, it is characterized in that: also comprise the step that capture nucleic acid-the target nucleic acid mixture washs the target product solid phase carrier-A-B that obtains.

10. according to each described method of claim 1-8, it is characterized in that: the marker B specific junction mixture A on the described solid phase carrier and marker B bonded condition and reaction system, capture nucleic acid and target nucleic acid in conjunction with condition and reaction system, and the condition and the reaction system of capture nucleic acid-target nucleic acid mixture of formation solid phase carrier-A-B are identical, reaction system is: 0.1-2% NP-40, pH 5.0-8.0 10-200mM Tris, 0.1-2% TritonX-100,0.01-1% SDS; Reaction conditions is: at 55-90 ℃ of following incubation 2-30 minute, at room temperature placed then 2-30 minute.

11. according to each described method of claim 1-8, it is characterized in that: described solid phase carrier is the super paramagnetic material magnetic bead of diameter 0.05-5 μ m.

12. the target compound that contains target nucleic acid that obtains with each described method of claim 1-11.

13. each described method application in blood screening of claim 1-11.

14. a target nucleic acid extracts test kit, comprise: 2 '-oxygen with the marker B mark-few nucleic acid that methylates of at least a and RNA target nucleic acid specific combination is as capture nucleic acid, the few nucleic acid of 2 '-deoxidation with marker B mark of at least a and DNA target nucleic acid specific combination is as capture nucleic acid, and the solid phase carrier of the underlined thing B of covalent attachment specific junction mixture A.

15. extraction test kit according to claim 14 is characterized in that: described test kit also comprises washing composition.

16. extraction test kit according to claim 14, it is characterized in that: described nucleic acid extraction liquid is the solution that contains at the 2 '-oxygen-few trapping nucleic acids probe that methylates of HCV RNA design, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mLStrepavidin parcel, 50mM Tris, pH 7.0,0.1% NP-40,1% Triton X-100,0.1% SDS, 0.2 the capture probe of μ M Biotin mark, wherein the capture probe of Biotin mark has the nucleotide sequence of sequence 4 in the sequence table.

17. extraction test kit according to claim 14, it is characterized in that: described nucleic acid extraction liquid is the solution that contains at the 2 '-oxygen-few trapping nucleic acids probe that methylates of HIV RNA design, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mLStrepavidin parcel, 50mM Tris, pH 7.0,0.1% NP-40,1% Triton X-100,0.1% SDS, 0.2 the capture probe of μ M Biotin mark, wherein the capture probe of Biotin mark has the nucleotide sequence of sequence 5 in the sequence table.

18. extraction test kit according to claim 14, it is characterized in that: described nucleic acid extraction liquid is the solution that contains at the 2 '-oxygen-few trapping nucleic acids probe that methylates of HCV RNA and HIV RNA design, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Strepavidin parcel, 50mM Tri s, pH 7.0,0.1%NP-40,1% Triton X-100,0.1% SDS, 0.2 the capture probe of μ M Biotin mark, wherein catch the nucleotide sequence that the capture probe of the Biotin mark of HCV RNA has sequence 4 in the sequence table, catch the nucleotide sequence that the capture probe of the Biotin mark of HIV RNA has sequence 5 in the sequence table.

19. extraction test kit according to claim 14, it is characterized in that: described nucleic acid extraction liquid be contain at HCV RNA and HIV RNA design 2 '-oxygen-few trapping nucleic acids probe methylates, and at the few trapping nucleic acids probe of 2 '-deoxidation of HBV DNA design, its prescription: the super paramagnetic material magnetic bead of the diameter 1 μ m of 250 μ g/mL Strepavidin parcel, 50mM Tri s, pH 7.0,0.1% NP-40,1% Triton X-100,0.1% SDS, 0.2 the capture probe of μ M Biotin mark, wherein catch the nucleotide sequence that the capture probe of the Biotin mark of HCV RNA has sequence 4 in the sequence table, catch the nucleotide sequence that the capture probe of the Biotin mark of HIV RNA has sequence 5 in the sequence table, catch the nucleotide sequence that the capture probe of the Biotin mark of HBV DNA has sequence 6 in the sequence table.