CN101322716A - Applications of anthocyanin and regulation for CHOP gene in preventing and treating atherosclerosis - Google Patents

Abstract

The invention discloses the use of anthocyanin in medicines for treating atherosclerosis and the application for preventing and treating atherosclerosis with regulation and control of CHOP gene, and relates to the improvement effect of anthocyanin monomer cyanidin-3, 5-diglucoside on macrophage injuries caused by oxidized low density lipoprotein, and discusses the mechanism of action thereof. In the invention, mouse macrophage cell line RAW264.7 is tested, and the effect of cyanidin-3, 5-diglucoside on activity of RAW264.7 macrophage processed by the oxidized low density lipoprotein is determined based on MTT method, the total RNA of cells is extracted, Affymetrix Mouse U4302.0 gene expression profile chip is applied to carry out marking hybridization experiments, differential gene analysis is carried out for the scanning results of Affyemtrix gene chip with the MTT method, and the differential genes are screened, and further real-time quantitative PRC method is utilized to further validate the expressed differential gene. The validation results verify that the cyanidin-3, 5-diglucoside can regulate CHOP gene expression down, and has obvious protective action on macrophages injured by oxidized low density lipoprotein.

Description

Anthocyanin reaches the application of regulation and control in preventing and treating atherosclerosis to the CHOP gene

Technical field

The present invention relates to medical technical field, be specifically related to a kind of anthocyanin monomer, cyanidin-3, the purposes of 5-diglucoside in preparation prevention or treatment atherosclerosis medicine and health food; Relate to the application of regulation and control in preventing and treating atherosclerosis simultaneously to CHOP (C/EBP homologous protein) gene.

Background technology

The atherosclerotic popular more and more fiery gesture that is over more than 100 year, worldwide, the death toll that atherosclerosis thrombosis causes accounts for 52% of whole death tolls, considerably beyond the tumor (24%) of second cause of the death, becomes genuine dead first killer.Atherosclerosis is a kind of systemic disease, can cause the whole body major organs, after one's own heart, dysfunction such as brain, kidney and even limbs and have a strong impact on patients ' life quality, returns family and social economy brings heavy burden.Therefore, seek efficient, low toxicity chemoprophylaxis and treatment atherosclerosis and seem very necessary.

Atherosclerotic pathogenesis is very complicated, and is not clear fully as yet so far.Studies confirm that more and more that in recent years er stress and atherosclerotic generation development are closely related.The independent risk factor of more known cardiovascular disease, can cause er stress as gathering of homotype cysteine, obesity and endocellular liberation cholesterol is equal, er stress then may be by increasing gathering of lipid within endothelial cells, activates inflammatory reaction path and cell death inducing and promote atherosclerotic the development.The activation of endoplasmic reticulum stress response path may be the common pathogenesis in the Atheromatosis reason process, and the key factor in the endoplasmic reticulum stress response path also may become the novel targets of treatment of atherosclerosis.

CHOP, promptly the C/EBP homologous protein is also referred to as growth retardation and DNA damage induced protein 153 (GADD153) or DNA damage inducible transcription 3 (DDIT3), is contact er stress and apoptotic important M signal molecule.Endoplasmic reticulum stress response is induced the CHOP expression of gene, can cause endothelial cell apoptosis and causes endothelial function damage, and the apoptosis that causes macrophage and vascular smooth muscle causes cell debris and is deposited on blood vessel, thereby promotes atherosclerotic the development.Simultaneously, experiment confirm, CHOP-/-macrophage is insensitive to the inductive apoptosis of cholesterol.These find that the apoptosis of all supporting er stress to cause strongly is one of atherosclerotic principal element.

At present, atherosclerosis still there are not a kind of effectively control medicine and method.The main direction that atherosclerosis is studied concentrates on by methods such as accent fat, antioxidation, antiplatelet aggregation, inhibition smooth muscle cell proliferation, protection endothelial functions and suppresses the speckle growth, by stabilize plaque such as antiinflammatory, inhibition cytokine-expressing, prevention substrate degradation, anti-apoptotics.Some medicine shows better effect on blood fat reducing and prevention plaque rupture, but its side effect also can't neglect.Atherosclerotic main preventive measure is a health diet, appropriate exercise.Therefore find a kind of both can prevention of arterial atherosisly, have the material of therapeutical effect again?

After finding that the what is called " France antinomy " of low coronary heart disease death rate but appearred in French certain areas people's high fat diet in 1987, the main component anthocyanidin of batard-montrachet has caused people's great concern.Anthocyanidin is that a class extensively is present in the water colo(u)r in the plant, is the polyphenolic substance in the flavonoid.Free anthocyanidin is seldom seen under the natural conditions, and normal and monosaccharide forms glucosides, i.e. anthocyanin.Anthocyanin extensively is present in fruit, seed, flower and the crust of plant, also is present in some beverage (Folium Camelliae sinensis, medicated beer), vegetable, fruit and the grain.The anthocyanin of taking in reaches the highest haemoconcentration very soon after the harmonization of the stomach small intestinal absorbs.Retention time reaches 72 hours in about 7 hours of the plasma half-life, body, but its biology availability height is nontoxic substantially.

Studies show that in recent years, anthocyanin have multiple pharmacological effect such as antioxidation, mutation, antitumor, control cardiovascular and cerebrovascular disease, blood sugar lowering, antiinflammatory, antitumor, promotion vision.Particularly its effect in preventing and treating cardiovascular disease is exciting.Studies show that anthocyanin can effectively remove free radical, the endothelial function disturbance that protection blood vessel endothelium opposing peroxynitrite causes; Can improve the anti-degradation capability of elastic fiber, protect vascular endothelial cell, keep the normal function of blood vessel wall; Can stimulate the activity of nitric oxide synthetase in the vascular endothelial cell, improve nitric oxide level, vasodilator; In experiment in vitro, anthocyanin can obviously suppress the oxidation and the hematoblastic gathering of low density lipoprotein, LDL; Cholesterol reducing and low-density lipoprotein white level prevent the generation of cardiovascular and cerebrovascular disease effectively; Add the rabbit that cholesterol is fed with anthocyanin, quantity and atherosclerosis of aorta incidence rate that its blood plasma cholesterol level, macrophage picked-up oxidized low-density lipoprotein are transformed into foam cell later on all are lower than simple nursing cholesterol rabbit.Anthocyanin can also significantly be improved apolipoprotein E gene deficient mice blood lipid metabolism, suppresses the formation of atheromatous plaque and increases its stability.Discover that further anthocyanin can influence the gene expression of various inflammatory reactions and immunoreation regulatory factor by regulating NlmR nuclear factor κ B, comprises vascular cell adhesion molecule-1, intercellular adhesion molecule-1.But, also discover, feed heritability hyperlipemia rabbit with the anthocyanin in Ribes nigrum L. juice source, find that anthocyanin does not have influence to the blood lipid metabolism of hyperlipemia rabbit, can not the atherosclerotic formation of antagonism.

Are these Different Results of anthocyanin that what reason causes? because at present for the antiatherogenic research of anthocyanin, multiselect extracts mixture with the anthocyanin of different plant origins, the data that obtain from monomer component are very few, thereby determined the uncertainty of existing result of study now.Simultaneously, great majority research all is confined to exchange in the observation of fat curative effect, aorta atheromatous plaque thickness, area and some biochemical indicator, the less level that is deep into pair cell and expression of subcellular fraction active substance and mechanism.Because the nontoxic or low characteristic of the anthocyanin of natural origin, advanced research method that utilization is modern and new technical means are set forth the monomeric study of anti-atherogenic effect of anthocyanin and mechanism thereof and are proved, will promote its promotion and application worldwide undoubtedly.

Summary of the invention

The object of the present invention is to provide the purposes of a kind of anthocyanin in preparation treatment or the atherosis medicine of prevention of arterial; And the application of regulation and control CHOP expression of gene in preparation treatment or the atherosis medicine of prevention of arterial.Be specifically related to the monomer of a kind of anthocyanin, cyanidin-3,5-diglucoside improve the effect that OxLDL ELISA (ox-LDL) causes the damage of mice RAW264.7 macrophage system, and inquire into its mechanism of action.Therefore, cyanidin-3, the 5-diglucoside can be used in the medicine of preparation treatment or the atherosis generation development of prevention of arterial.

The present invention adopts mice RAW264.7 macrophage (mouse monokaryon macrophage leukaemia, derive from typical case's culture collection committee of Shanghai Chinese Academy of Sciences cell bank, catalog number (Cat.No.) TCM13) experimentizes, measure cyanidin-3 by tetrazolium bromide (MTT) method, 5-diglucoside (purchasing the Sigma company in the U.S., catalog number (Cat.No.) 74397) is to the influence of the RAW264.7 macrophage activity of ox-LDL processing.And extraction cell total rna, carry out the labelling hybrid experiment with Affymetrix Mouse U4302.0 chip gene expression profile (deriving from U.S. Affymetrix company), RMA (Robust multiarray analysis) method is carried out the differential gene analysis to the scanning result of Affyemtrix gene chip, filter out differential gene, adopt the real-time quantitative PCR method that the differential gene of expressing is further verified subsequently, concrete cyanidin-3, the mechanism of action of 5-diglucoside inquired into.Concrete summary of the invention is as follows:

A. cyanidin-3, the 5-diglucoside is anthocyanin monomer (buying the Sigma company in the U.S., catalog number (Cat.No.) 74397), but synthetic studies confirm that without any side effects.

B. cyanidin-3, the 5-diglucoside is to the effect of mice RAW264.7 macrophage: the mice RAW264.7 macrophage of cultivating (is derived from typical case's culture collection committee of Shanghai Chinese Academy of Sciences cell bank, catalog number (Cat.No.) TCM13) is inoculated in 96 orifice plates, after treating that cell grows up to 80～90% monolayers that merge, be divided into 6 groups at random, it is the blank group, 30,60,90,120,150 μ mol/L anthocyanin group, every group is repeated 8 holes, respectively in addition 0,30,60,90,120,150 μ mol/L cyanidin-3, the 5-diglucoside is handled, and places 37 ℃, 5%CO ₂Cultivate in the incubator after 24 hours, with 3-(4,5-dimethylthiazole-2)-2, (tetrazolium bromide, MTT) method detects the survival rate of cell, the form of inverted phase contrast microscope observation of cell to 5-diphenyl tetrazole bromine salt.

C. cyanidin-3, the 5-diglucoside causes the improvement effect of mice RAW264.7 macrophage system damage to OxLDL ELISA (ox-LDL): the mice RAW264.7 macrophage of cultivating is inoculated in 96 orifice plates, after treating that cell grows up to 80～90% monolayers that merge, be divided into 6 groups at random, it is the blank group, 0,30,60,90,120 μ mol/L anthocyanin group, every group is repeated 8 holes, elder generation is with 0 in the experiment, 30,60,90, the cyanidin-3 of 120 μ mol/L concentration, 5-diglucoside pretreatment cell 1 hour, add ox-LDL (final concentration 40mg/L) then, the blank group replaces ox-LDL and anthocyanin with the conventional RPMI1640 culture medium of serum-free, places 37 ℃, 5%CO ₂After hatching 24 hours jointly in the incubator, with the form of inverted phase contrast microscope observation of cell, mtt assay detects the survival rate of cell.

D. cyanidin-3, the 5-diglucoside is handled the effect of mice RAW264.7 macrophage system gene expression profile to ox-LDL: the mice RAW264.7 macrophage of cultivating is inoculated in the 60ml culture bottle, after treating that cell grows up to 80～90% monolayers that merge, be divided into 3 groups at random, i.e. 1. matched group: the conventional cultured cell of RPMI1640 culture medium; 2. ox-LDL organizes: the ox-LDL final concentration is 40mg/L; 3. anthocyanin+ox-LDL group: with the anthocyanin cultured cell of 60 μ mol/L 1 hour, add the ox-LDL that final concentration is 40mg/L then earlier.Every group is repeated 3 times, each is organized cell and continues to cultivate harvesting after 24 hours, extract purification respectively and respectively organize cell total rna, utilize Affymetrix Mouse U4302.0 chip gene expression profile (deriving from U.S. Affymetrix company) to carry out the labelling hybrid experiment, RMA (Robust multiarray analysis) method is carried out the differential gene analysis to the scanning result of Affyemtrix gene chip, filters out differential gene.

E. cyanidin-3, the 5-diglucoside is handled the effect of mice RAW264.7 macrophage system CHOP (C/EBP homologous protein) gene expression to ox-LDL: the mice RAW264.7 macrophage of cultivating is inoculated in the 60ml culture bottle, after treating that cell grows up to 80～90% monolayers that merge, be divided into 3 groups at random, i.e. 1. matched group: the conventional cultured cell of RPMI1640 culture medium; 2. ox-LDL organizes: the ox-LDL final concentration is 40mg/L; 3. anthocyanin+ox-LDL group: with the anthocyanin cultured cell of 60 μ mol/L 1 hour, add the ox-LDL that final concentration is 40mg/L then earlier.Every group is repeated 3 times, and each is organized cell and continues to cultivate harvesting after 24 hours, extracts purification respectively and respectively organizes cell total rna, and the expression of the differential gene CHOP that gene chip is filtered out with the real-time quantitative PCR method detects.

The present invention compared with prior art has the following advantages and effect:

1, cyanidin-3, the 5-diglucoside is the monomer of a kind of anthocyanin, chemical constitution is clear, but synthetic studies confirm that without any side effects.

2, the present invention shows, when cyanidin-3, when 5-diglucoside concentration is 30,60,90,120 μ mol/L, mice RAW264.7 macrophage ovalize, cell growth state is good, and MTT showed cell vigor and normal control group does not as a result have significant difference.Cyanidin-3 is described, 5-diglucoside concentration is safe concentration in 30～120 μ mol/L scopes.

3, the present invention shows, cyanidin-3, and 5-diglucoside concentration all can be improved ox-LDL to the effect of RAW264.7 cells injury in 30～120 μ mol/L scopes, and its improvement effect does not have dose dependent.

4, the present invention shows, cyanidin-3,5-diglucoside have mainly been protected the destruction of ox-LDL to the lipid inner membrance, has strengthened the formation ability again of ability of cell proliferation and organizational structure.

5, the present invention shows, cyanidin-3, the 5-diglucoside can reduce the high expressed of crucial CHOP protein gene in the coding er stress that ox-LDL causes, and alleviates the endoplasmic reticulum stress response in the atherosclerosis generation evolution, thereby brings into play its study of anti-atherogenic effect.

Description of drawings

Fig. 1. the variable concentrations anthocyanin acts on the cell viability comparison after 24 hours of RAW264.7 macrophage.

* compare P＜0.05 with matched group.

Fig. 2. the variable concentrations anthocyanin is to the influence of the RAW264.7 macrophage vigor of OxLDL ELISA (ox-LDL) processing.* compare P＜0.05 with matched group; # and ox-LDL group compare P＜0.05.

Fig. 3. microscopically is observed 120 μ mol/L anthocyanin are handled the RAW264.7 macrophage to OxLDL ELISA (ox-LDL) form (* 200).

Fig. 4. Ct value in the quantitative PCR (Cycle threshold, cycle threshold) is set sketch map.

Fig. 5. quantitative PCR method detects the CHOP expression of gene level in the cell of respectively organizing.

The specific embodiment

With cyanidin-3, the 5-diglucoside carries out inquiring into about the experimentation of the mice RAW264.7 macrophage system protective effect that OxLDL ELISA (ox-LDL) is handled and mechanism, and its new purposes at pharmaceutical field is described below.

Embodiment 1: cyanidin-3, the 5-diglucoside is to the effect of mice RAW264.7 macrophage

1 experiment material

1.1 experiment medicine

Cyanidin-3, the 5-diglucoside: be a kind of monomer of anthocyanin, purchase Sigma company in the U.S., catalog number (Cat.No.) 74397, English name Cyanin chloride is also referred to as Cyanidin-3,5-di-O-glucoside, molecular formula C ₂₇H ₃₁ClO ₁₆, molecular weight 646.98, chemical constitution is as follows.

1.2 experimental subject

Mice RAW264.7 macrophage: i.e. mouse monokaryon macrophage leukaemia derives from typical case's culture collection committee of Shanghai Chinese Academy of Sciences cell bank, catalog number (Cat.No.) TCM13.

1.3 reagent

3-(4,5-dimethylthiazole-2)-2, (tetrazolium bromide is MTT) available from U.S. Fluka company for 5-diphenyl tetrazole bromine salt; Dimethyl sulfoxide (DMSO) is available from U.S. Sigma company; RPMI-1640 culture medium and hyclone are available from U.S. Gibco company; Trypsin is available from Wuhan life sciences technology company.

1.4 instrument

CO2 gas incubator is available from U.S. SHEL-LAB company; Superclean bench (YJ-1450 type) is available from Suzhou cleaning equipment company; Inverted phase contrast microscope is available from German LEICA company; Fluorescence microplate reader is available from Switzerland TECAN company.

2 experimental techniques:

2.1RAW264.7 the cultivation of cell

The RAW264.7 cell culture of normal growth is in the RPMI-1640 culture medium that contains 10% hyclone, 20%mmol/L 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES) and 125mg/L glutamate, Glu, and condition of culture is 37 ℃, 5%CO ₂, inoculum density is 1 * 10 ⁷Individual/L, the doubling time is 48～72h.

2.2 grouping and medication

Adopt the RPMI-1640 culture medium that does not contain serum to dilute cyanidin-3 successively, the 5-diglucoside.The conventional RAW264.7 cell of cultivating, adjusting cell density is 1 * 10 ⁷Individual/L, evenly be inoculated in aseptic 96 well culture plates 37 ℃, 5%CO then ₂Cultivated 24 hours, and made cell grow into good monolayer.Made cell synchronization in 24 hours with the static cultivation of equal-volume serum-free medium before the experiment beginning, be divided at random subsequently: 1. blank group: the serum-free medium cultivation; 2. anthocyanin is organized: cyanidin-3,5-diglucoside final concentration is respectively 30,60,90,120,150 μ mol/L.Every group is repeated 8 holes, places 37 ℃, 5%CO ₂Cultivate after 24 hours in the incubator and detect.

2.3MTT method

After being incubated at cell processing in 96 orifice plates and finishing, the residual liquid in the sucking-off cell hole is with the PBS solution rinsing 2 times that is preheated to 37 ℃; Every then hole adds the RPM-I1640 culture medium that does not contain serum of MTT (5mg/ml is dissolved in phosphate buffer) solution and the 180 μ l of 20 μ l, continues to cultivate 4 hours in 37 ℃; Every subsequently hole adds 100 μ l DMSO, slowly vibrates 10 minutes on horizontal shaking table, with the purple crystal thing in the dissolved cell; The 570nm place measures its absorbance value on microplate reader at last.

2.4 the index of observation

(1) inverted phase contrast microscope observation of cell form changes

(2) mtt assay detects cell viability

2.5 date processing

Data are represented with x ± s, organize mean more and carry out homogeneity test of variance and one factor analysis of variance, the relatively employing Tukey method between each group.

3 experimental results

Inverted phase contrast microscope is observed and is shown, normal RAW264.7 cell ovalize or polygon, adherent growth.When cyanidin-3, when 5-diglucoside concentration was 30,60,90,120 μ mol/L, cell is ovalize still, and cell growth state is good.When cyanidin-3, when 5-diglucoside concentration reaches 150 μ mol/L, part cell detachment, floating appears.

MTT experimental result (Fig. 1) demonstration, when cyanidin-3, when 5-diglucoside concentration is 30,60,90,120 μ mol/L, cell viability and normal control group no significant difference.When cyanidin-3, when 5-diglucoside concentration reached 150 μ mol/L, cell viability was compared obvious decline with the normal control group.

Above experimental result shows, cyanidin-3, and 5-diglucoside concentration is safe concentration in 30～120 μ mol/L scopes.

Embodiment 2: cyanidin-3,5-diglucoside cause the improvement effect of mice RAW264.7 macrophage system damage to ox-LDL

1 experiment material

1.1 experiment medicine

Cyanidin-3,5-diglucoside: with specific embodiment 1.

1.2 experimental subject

Mice RAW264.7 macrophage: with specific embodiment 1.

1.3 reagent

Ox-LDL is available from the biochemical chamber of coordinating, Beijing; MTT is available from U.S. Fluka company; DMSO is available from U.S. Sigma company; RPMI-1640 culture medium and hyclone are available from U.S. Gibco company; Trypsin is available from Wuhan life sciences technology company.

1.4 instrument

With specific embodiment 1.

2 experimental techniques:

2.1RAW264.7 the cultivation of cell

With specific embodiment 1.

2.2 grouping and medication

Adopt the RPMI-1640 culture medium that does not contain serum to dilute cyanidin-3 successively, the 5-diglucoside.The conventional RAW264.7 cell of cultivating, adjusting cell density is 1 * 10 ⁷Individual/L, evenly be inoculated in aseptic 96 well culture plates 37 ℃, 5%CO then ₂Cultivated 24 hours, and made cell grow into good monolayer.With 24 hours synchronizing them of the static cultivation of equal-volume serum-free medium, be divided at random subsequently before the experiment beginning: 1. blank group: the conventional cultivation of serum-free medium; 2. ox-LDL organizes: the ox-LDL final concentration is 40mg/L.3. anthocyanin+ox-LDL organizes: with safe concentration respectively the cyanidin-3 of 30,60,90,120 μ mol/L, and 5-diglucoside cultured cell 1 hour, adding final concentration then is the ox-LDL continuation cultivation of 40mg/L.Every group is repeated 8 holes, places 37 ℃, 5%CO ₂Cultivate after 24 hours in the incubator and detect.

2.3MTT method

With specific embodiment 1.

2.4 the index of observation

(1) inverted phase contrast microscope observation of cell form changes.

(2) mtt assay detects cell viability

2.5 date processing

Data are represented with x ± s, organize mean more and carry out homogeneity test of variance and one factor analysis of variance, the relatively employing Tukey method between each group.

3 experimental results

MTT experimental result (Fig. 2) shows, the ox-LDL of 40mg/L can obviously reduce cell viability, and the cyanidin of different safe concentrations-3,5-diglucoside (30,60,90,120 μ mol/L) all can obviously improve the damage of ox-LDL pair cell, improves cell viability.

What Fig. 3 showed is the normal control of observing under the inverted phase contrast microscope, ox-LDL and the cyanidin-3 of 40mg/L, and 5-diglucoside concentration is that 120 μ mol/L are upgrowth situation figure of cell.

Above experimental result shows, cyanidin-3,5-diglucoside can improve ox-LDL to the RAW264.7 cells injury, and concentration does not have dose dependent.

Embodiment 3: cyanidin-3,5-diglucoside are handled the effect of mice RAW264.7 macrophage system gene expression profile to ox-LDL

1 experiment material

1.1 experiment medicine

Cyanidin-3,5-diglucoside: with specific embodiment 1.

1.2 experimental subject

Mice RAW264.7 macrophage: with specific embodiment 1.

1.3 reagent

Ox-LDL is available from the biochemical chamber of coordinating, Beijing; MTT is available from U.S. Fluka company; DMSO is available from U.S. Sigma company; RPMI-1640 culture medium and hyclone are available from U.S. Gibco company; Trypsin is available from Wuhan life sciences technology company; TRIZOL reagent is available from Shanghai bio-engineering corporation product; RNA purification kit (RNeasy Total RNA Isolation kit) derives from U.S. QIAGEN company; AffymetrixMouse U430 2.0 chip gene expression profiles derive from U.S. Affymetrix company; The reverse transcription test kit is available from U.S. Promega company; Ethanol, isopropyl alcohol, normal heptane, normal hexane, acetonitrile are chromatographic grade, available from Shanghai traditional Chinese medicines group; Trichloroacetic acid, sodium hydroxide, potassium hydroxide, chloroform are chemical pure, available from Shanghai traditional Chinese medicines group.

1.4 instrument

CO2 gas incubator is available from U.S. SHEL-LAB company; Superclean bench (YJ-1450 type) is available from Suzhou cleaning equipment company; Inverted phase contrast microscope is available from German LEICA company.

2 experimental techniques:

2.1RAW264.7 the cultivation of cell

With specific embodiment 1.

2.2 grouping and medication

The conventional RAW264.7 cell of cultivating, adjusting cell density is 1 * 10 ⁷Individual/L, evenly be inoculated in the aseptic 60ml culture bottle 37 ℃, 5%CO then ₂Cultivated 24 hours, and made cell grow into good monolayer.With 24 hours synchronizing them of the static cultivation of equal-volume serum-free medium, be divided at random subsequently before the experiment beginning: 1. blank group: the conventional cultivation of serum-free medium; 2. ox-LDL organizes: the ox-LDL final concentration is 40mg/L.3. anthocyanin+ox-LDL organizes: first cyanidin-3 with 60 μ mol/L, and 5-diglucoside cultured cell 1 hour, adding final concentration then is the ox-LDL continuation cultivation of 40mg/L.Every group is repeated 3 times, places 37 ℃, 5%CO ₂Continue to cultivate harvesting confession detection after 24 hours in the incubator.

2.3RNA extraction and detection

2.3.1 the extraction (TRIZOL method) of total RNA

1) homogenizes: get 2 * 10 ⁶Cell adds 1ml TRIZOL, blows and beats repeatedly with the 1ml pipettor.

2) sample that homogenizes was placed 5 minutes at 15～30 ℃, the chloroform that adds 0.2 times of volume then, the violent jolting in the tight back of lid lid made mixing in 15 seconds, placed 2～3 minutes at 15～30 ℃, 4 ℃, centrifugal 15 minutes of 7000rpm, centrifugal back forms the phenol chloroform phase of lower floor's redness, the colourless water in intermediate phase and upper strata.

3) with upper water phase transfer to a new centrifuge tube (when the volume of water is approximately and homogenizes 60% of used TRIZOL1 volume), add the isopropyl alcohol of 0.8 times of volume, violent jolting makes mixing, and 4 ℃, centrifugal 15 minutes of 7000rpm abandons supernatant.

4) add 70% (ml/ml) ethanol, put upside down centrifuge tube and precipitate contained salinity with flush away for several times.Earlier precipitation is broken up as the bigger available pipettor head of precipitation.4 ℃ then, centrifugal 10 minutes of 7000rpm abandons supernatant.

5) repeat above step 1 time.

6) 15～30 ℃ are dried, and add the water dissolution of an amount of no RNA enzyme then.

7) analyze RNA concentration with spectrophotometer, at the 260nm wavelength, 1OD approximates the RNA of 40 μ g/ml.

8) 1% (mg/ml) sepharose electrophoresis.

2.3.2RNA purification (QIAGEN RNeasy Total RNA Isolation kit)

Concrete grammar carries out with the workbook that test kit provides by QIAGEN company.

2.4 gene chip and analytical method

Gene chip is made and is finished by Shanghai Biochip Co., Ltd.Use Affymetrix Mouse U4302.0 chip gene expression profile, this chip contains 45000 probe sets, 34000 known function genes

2.4.1 sample type and gene chip numbering

Table 1: sample packet and meaning

2.4.2 gene chip data pretreatment

Application RMA (Robust multiarray analysis) carries out the data pretreatment to the cel formatted file of Affyemtrix gene chip, has comprised the green strength of each probe sets in this document.RMA based on the PM probe signals value of gene, in the process of signal calculated value, carries out five steps fully:

1. pass through the weighted average of probe adjacent domain background to each probe background correction;

2. the gene of removing the signal response value and be P accounts for the gene number ratio and is lower than 50% sample;

3. to the PM after proofreading and correct to number conversion;

4. estimate the average after PM is to number conversion, then average is carried out indexation;

5. after the average after the indexation being removed the minimax value, carry out standardization.

2.4.3 differential gene significance analysis

After the data pretreatment, analysis anthocyanin+ox-LDL group, normal control, ox-LDL organize the difference expression gene between three groups.The method of seeking the group difference gene is based on the variance analysis method of Tobin's mean variance model at random.Because the sample size in every group is less, can't judgment sample distribute whether meet normal distribution, therefore, can not use the variance analysis of carrying out packet samples based on normal distribution simply.At this, use the conjugation prior distribution of Bayesian statistical theory infer gene markization afterwards signal value (being called for short signal value afterwards) in sample average and the distribution in the variance.If will guarantee that both meet normal distribution, then the two associating conjugation prior distribution then should distribute for anti-gamma.Therefore, whether problem will be traced to the source to definite prior distribution is that anti-gamma distributes, then in definite its super parameter.At this, the inventor uses maximum likelihood method to determine prior distribution.

Because the Tobin's mean variance model analysis is inferred prior distribution according to real data at random, thereby infers theoretical distribution, therefore, when using bayes method processing statistical problem, not only utilize limited sample information fully, also utilized prior distribution, thereby derive actual posteriority distribution situation.Therefore, increased utilization ratio greatly, thereby more effectively improved the accuracy that difference expression gene is differentiated limited information.

2.4.4 analytic target

Anthocyanin+ox-LDL group, normal control, ox-LDL organize all gene test values of three groups.

2.4.5 statistical method

At this, between between any two groupings, not there are differences as null hypothesis, then check null hypothesis whether to set up, thereby find the significant difference gene between grouping.At this, the t value is:

${\mathrm{SS}}_T=\underset{i=1}{\overset{G}{\mathrm{\Σ}}}\underset{j=1}{\overset{n_i}{\mathrm{\Σ}}}{(x_{\mathrm{ij}}-\stackrel{\‾}{x})}^2$

3 experimental results

The gene chip result is presented in 34000 known function genes, 309 of variant genes.Wherein, ox-LDL group and matched group are relatively: 24 of up-regulated genes, 87 of down-regulated genes; Anthocyanin+ox-LDL group and ox-LDL group compare: 16 of up-regulated genes, 22 of down-regulated genes.Behind the significance analysis of co-expression gene, filter out two gene groups and make up gene function similarity network, the computing network central point, draw in anthocyanin+ox-LDL group and ox-LDL organize relatively, CHOP (C/EBP homologous protein) gene is a cyanidin-3, the main controlling gene of 5-diglucoside downward modulation.Cyanidin-3,5-diglucoside have mainly been protected the destruction of ox-LDL to the lipid inner membrance, have strengthened the formation ability again of ability of cell proliferation and organizational structure.

Embodiment 4: cyanidin-3,5-diglucoside are handled the effect of mice RAW264.7 macrophage system CHOP (C/EBP homologous protein) gene expression to ox-LDL

1 experiment material

1.1 experiment medicine

Cyanidin-3,5-diglucoside: with specific embodiment 1.

1.2 experimental subject

Mice RAW264.7 macrophage: with specific embodiment 1.

1.3 reagent

Ox-LDL is available from the biochemical chamber of coordinating, Beijing; MTT is available from U.S. Fluka company; DMSO is available from U.S. Sigma company; RPMI-1640 culture medium and hyclone are available from U.S. Gibco company; Trypsin is available from Wuhan life sciences technology company; TRIZOL reagent is available from Shanghai bio-engineering corporation product; RNA purification kit (RNeasy Total RNA Isolation kit) derives from U.S. QIAGEN company; Reverse transcription reagent is purchased the company in American I nvitrogen; Quantitative PCR reagent (Power SYBR Green PCR MasterMix) is purchased the company in American AB I; Primer is synthetic by Shanghai Ying Jun Bioisystech Co., Ltd; Ethanol, isopropyl alcohol, normal heptane, normal hexane, acetonitrile are chromatographic grade, available from Shanghai traditional Chinese medicines group; Trichloroacetic acid, sodium hydroxide, potassium hydroxide, chloroform are chemical pure, available from Shanghai traditional Chinese medicines group.

1.4 instrument

CO2 gas incubator is available from U.S. SHEL-LAB company; Superclean bench (YJ-1450 type) is available from Suzhou cleaning equipment company; Inverted phase contrast microscope is available from German LEICA company; Quantitative PCR instrument (7300Sequence Detection System) is purchased the company in American AB I.

2 experimental techniques:

2.1RAW264.7 the cultivation of cell

With specific embodiment 1.

2.2 grouping and medication

The conventional RAW264.7 cell of cultivating, adjusting cell density is 1 * 10 ⁷Individual/L, evenly be inoculated in the aseptic 60ml culture bottle 37 ℃, 5%CO then ₂Cultivated 24 hours, and made cell grow into good monolayer.With 24 hours synchronizing them of the static cultivation of equal-volume serum-free medium, be divided at random subsequently before the experiment beginning: 1. blank group: the conventional cultivation of serum-free medium; 2. ox-LDL organizes: the ox-LDL final concentration is 40mg/L.3. anthocyanin+ox-LDL organizes: first cyanidin-3 with 60 μ mol/L, and 5-diglucoside cultured cell 1 hour, adding final concentration then is the ox-LDL continuation cultivation of 40mg/L.Every group is repeated 3 times, places 37 ℃, 5%CO ₂Continue to cultivate harvesting confession detection after 24 hours in the incubator.

2.3RNA extraction and detection

2.3.1 the extraction (TRIZOL method) of total RNA

With specific embodiment 3.

2.3.2RNA purification (QIAGEN RNeasy Total RNA Isolation kit)

With specific embodiment 3.

2.4RT-PCR reaction

2.4.1cDNA first chain is synthetic

(1) from-80 ℃ of refrigerators, takes out RNA, under 20～25 ℃, thaw, in 0.2ml PCR pipe, prepare reaction solution then.

Total RNA 3 μ g

Oligo-dT(15)(1μg/μl) 0.5μl

dNTP?mix(10mM) 1μl

ddH2O(DEPC) Xμl

Cumulative volume 12 μ l

(2) reaction tube is placed the PCR instrument, 65 ℃ of pre-degeneration 5 minutes.

(3) reaction of degeneration finishes back preparation cDNA first chain synthesis reaction system in the PCR pipe

5X?first-strand?buffer 4.0μl

0.1M?DTT 2.0μl

RNA?inhibitor 1.0μl

Superscript?II(200U/μl) 1.0μl

ddH2O(DEPC) Xμl

Cumulative volume 20 μ l

(4) place the PCR instrument to react on the PCR pipe, 42 ℃ of insulations are after 50 minutes, 70 ℃ of degeneration 15 minutes, 4 ℃ of preservations.

2.4.2SYBR?Green?RT-PCR

Reaction system

2x?SYBR?Green?PCR?buffer 12.5ul

primer(5pmol) 1μl

Template(10ng)+ddH2O 11.5μl

Cumulative volume 25 μ l

Hatched 2 minutes for 50 ℃, 95 ℃ then, 10 minutes; Then carry out 40 circulations: 95 ℃, 15 seconds; 60 ℃, 1 minute.Instrument uses Prism 7300 systems of ABI company.

2.4.3CHOP gene primer design

Design of primers is as follows:

Forward?Primer：CTGAGGAGAGGACTGAGGGTAGAC

Reverse?Primer：CTGGACATGGACAGTAATAAACAATGT

2.5 statistics, drawing method

(1), obtains different samples with respect to heterogeneic Ct value by a series of parameter setting analysis.

The Ct value, C represents Cycle (circulation), and t represents threshold (threshold value), and the implication of Ct value is: the period (as shown in Figure 4) that the fluorescence signal in each reaction tube is experienced when arriving the thresholding of setting.

Studies show that (2) there is linear relationship in the logarithm of the Ct value of each template and the initial copy number of this template, initial copy number is many more, and the Ct value is more little.

Because what compare is the difference of transcriptional level, so by detecting the house-keeping gene of each sample, with genes of interest normalization.

The growth form of PCR product is 2 ⁿIf it is all idealized that all ingredients and outside institute add condition, N is exactly a period.So obtain Δ Ct=Ct testing gene-Ct house-keeping gene earlier, be converted to primary template concentration=2 again ^{-Δ Ct}

2.6 repeatability check

3 parallel samples of each sample calculate the coefficient of variation of 3 parallel sample Ct values of same sample, the variation within batch coefficient of analytic sample target gene quantitative result.

3 experimental results

The real-time quantitative RT-PCR result as shown in Figure 5, it has further verified the gene chip result, confirms that cyanidin-3,5-diglucoside can reduce the high expressed of CHOP gene in the mice RAW264.7 macrophage that ox-LDL causes.

Claims (3)

1, the application of anthocyanin in the medicine that preparation is treated or prevention of arterial is atherosis.

2, the application of regulation and control CHOP expression of gene in preparation treatment or the atherosis medicine of prevention of arterial.

3, application according to claim 1 is characterized in that described anthocyanin is a cyanidin-3, the 5-diglucoside.

Images