CN101315370A - Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid - Google Patents
Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid Download PDFInfo
- Publication number
- CN101315370A CN101315370A CNA2008100220311A CN200810022031A CN101315370A CN 101315370 A CN101315370 A CN 101315370A CN A2008100220311 A CNA2008100220311 A CN A2008100220311A CN 200810022031 A CN200810022031 A CN 200810022031A CN 101315370 A CN101315370 A CN 101315370A
- Authority
- CN
- China
- Prior art keywords
- solution
- methyl
- quinaldic acid
- preparation
- particle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an immunofluorescence PCR detection method for 3-methyl-quinoline-2-carboxylic acid and belongs to the chemical technology field of immune analysis. The method comprises the steps of preparing an envelope antigen, an immune antigen and an antibody, fixing the envelope antigen, modifying magnetic nano-particles, coupling the magnetic nano-particles with the envelope antigen, preparing gold nano-particles with two particle diameters, preparing two types of gold nano-probes, performing immune reaction in a flow injection system, conducting the fluorescence quantitative PCR detection on a real-time basis, and the test of samples to be tested. The method has the advantages that the sensitivity of the detection of the metabolin, namely the 3-methyl-quinoline-2-carboxylic acid of quinoline feed supplement is greatly enhanced, the operation is simpler, the purpose of the high flux is achieved, and as solid phase carriers, the magnetic particles has the advantages of convenient cleaning and separation, and simple operation; the gold nano-particles modified by DNA are used as probes, which replace the traditional HRP for the immune reaction, so that the reaction condition is simplified, the sensitivity of the detection is enhanced, and the international leading level is achieved.
Description
Technical field
A kind of 3-methyl-quinaldic acid's Immunofluorescence PCR detecting method belongs to the immunoassay technical field of chemistry.
Background technology
3-methyl-quinaldic acid, English name: 3-methyl-quinoxaline-2-carboxylic acid (MQCA) is a quinolines feed addictive metabolic product in animal body, serves as main representative with quinolone and olaquindox.Behind edible this type of feed addictive such as chicken, pig, fish, meeting mainly is that metabolism generates 3-methyl-quinaldic acid in muscle, enteron aisle, kidney in vivo, and this metabolin is very big to human toxicity.Because domestic a large amount of abuses to the quinolines adjuvant, caused adjuvant content severe overweight in animal body, domestic detection technique still rests on the detection to former medicine, along with the raising of international standard, the internationalization of China's trade, this detection technique can not meet the demands.In recent years, begin to have strengthened gradually research and detection abroad to metabolin 3-methyl-quinaldic acid.For in line with international standards, reduce meat product unnecessary loss when outlet of China, China is necessary to strengthen the research dynamics to metabolin, because less to its research, detectability is still higher, in order to remedy this blank, be necessary to study a kind of highly sensitive, detectability is low, and is simple to operate, at 3-methyl-quinaldic acid's detection method.
Though the method for HPLC and LC-MS/MS is sensitive, required instrument costs an arm and a leg, to having relatively high expectations of operating personnel, and difficult the popularization.Advantages such as the immunoassay chemical method has fast, and is highly sensitive, simple to operate, and selectivity is good.Compare with traditional ELISA method, the present invention utilizes magnetic nanoparticle as solid phase carrier, in the flow injection system, carry out immune response, with the golden nanometer particle of dna modification as probe, after the immune response, collect DNA, and utilize the real-time fluorescence PCR technology to detect, thereby reach the purpose that detects 3-methyl-quinaldic acid, the inventive method has improved the sensitivity that detects greatly, and operation is easier, has reached high-throughout purpose, and with magnetic particle as solid phase carrier, have and clean and convenient separation, advantage simple to operate is carried out immune response with the golden nanometer particle of dna modification as the traditional HRP of probe replacement, simplify the condition of reaction, improved the sensitivity that detects.
Summary of the invention
The purpose of this invention is to provide a kind of 3-methyl-quinaldic acid's Immunofluorescence PCR detecting method, highly sensitive, easy to operate, the range of linearity is wide.
Technical scheme of the present invention: a kind of 3-methyl-quinaldic acid's Immunofluorescence PCR detecting method, comprise the preparation of coating antigen, immunogene and antibody, fixing of coating antigen, the modification of magnetic nano-particle, the coupling of magnetic nano-particle and coating antigen, the golden nanometer particle preparation of two kinds of particle diameters, the preparation of two kinds of gold nano-probes, immune response in the flow injection system, the detection of real-time fluorescence quantitative PCR detection and testing sample;
Processing step is:
(1) preparation of coating antigen: 3-methyl-quinaldic acid is linked to each other with gavaculine, again with ovalbumin mutually coupling obtain coating antigen;
(2) immunogenic preparation: with 3-methyl-quinaldic acid and bovine serum albumin mutually coupling obtain immunogene;
(3) preparation of antibody: the immunogen immune rabbit that obtains with step (2) obtains specific polyclonal antibody;
(4) coating antigen is fixing: coating antigen and magnetic particle coupling that step (1) is obtained, and be fixed in the glass microchannel;
(5) modification of magnetic nano-particle: with the Fe of preparation
3O
4Seed is modified with the 3-aminopropyl triethoxysilane;
(6) coupling of magnetic nano-particle and coating antigen:
The golden nanometer particle preparation of (7) two kinds of particle diameters;
The preparation of (8) two kinds of gold nano-probes;
(9) immune response in the flow injection system:
(10) real-time fluorescence quantitative PCR detects: 3-methyl-quinaldic acid and polyclonal antibody are passed through in the glass microchannel, competition in conjunction with after polyclonal antibody with through the common gold nano-probe reaction of modifying of goat anti-rabbit antibody and double-stranded DNA, sex change obtains single stranded DNA and with its collection, the single stranded DNA that collection obtains carries out real-time fluorescence quantitative PCR and detects, and obtains the typical curve about 3-methyl-quinaldic acid's concentration and Ct value;
(11) detection of testing sample: the Ct value that testing sample records is compared with the typical curve that obtains, and obtains the content of 3-methyl-quinaldic acid in the testing sample.
The preparation of coating antigen: get 3-methyl-quinaldic acid 102mg, be dissolved in 6mL N, among the N-dihydroxy formamide DMF, add 120 μ L tri-n-butylamines, reacted 0.5 hour, add 75 μ L isobutyl chlorocarbonates again, reacted 1 hour, mix with the pH9.6 sodium carbonate buffer solution 6mL solution that contains the 100mg gavaculine again,, have precipitation to produce in the process 4 ℃ of following stirring reactions 2 hours, centrifugal, taking precipitate, drying obtains 3-methyl-quinaldic acid's haptens; Get 3-methyl-quinaldic acid's haptens 9.9mg, N-hydroxy-succinamide NHS 11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg, join 3mLN, among the N-dihydroxy formamide DMF, the stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 60mg ovalbumin OVA again, and is centrifugal, and supernatant was with ultrapure water dialysis 3 days, freeze-drying ,-20 ℃ of preservations are standby.
Immunogenic preparation: get 3-methyl-quinaldic acid 102mg, N-hydroxy-succinamide NHS11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg, join 3mLN, among the N-dihydroxy formamide DMF, the stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 130mg ovalbumin OVA again, and is centrifugal, and supernatant was with ultrapure water dialysis 3 days, freeze-drying ,-20 ℃ of preservations are standby.
The modification of magnetic nano-particle: prepare FeSO respectively with redistilled water
47H
2O and FeCl
36H
2The solution of O and NaOH solution are with join two kinds of iron salt solutions mixing, Fe in the mixed solution of molysite
2+The concentration of ion is 0.12mol/L, Fe
3+Concentration be 0.2mol/L; The concentration of NaOH solution is 2.5mol/L; NaOH solution with certain volume under vigorous stirring slowly is added drop-wise in the mixed molysite solution, gained is deposited in 60 ℃ of ageings 2 hours, with redistilled water with sediment undergoes washing for several times, again 60 ℃ of dryings 24 hours, grinding the back products therefrom in agate mortar is Fe after the filtration
3O
4Seed.With Fe
3O
4Seed 0.125g 100mL ethanol and the aqueous dispersion of 1mL second distillation, ultrasonic 30min drips 0.4mL 3-aminopropyl triethoxysilane APTES, and stirring at room 7 hours is with the centrifugal 30min of 8000r/min, with the Fe of APTES modification
3O
4Nano particle separates from reaction medium, and with ethanolic solution it is cleaned 5 times, and is again 60 ℃ of dryings 24 hours, standby after the filtration.
The coupling of magnetic nano-particle and coating antigen: get the Fe that gained APTES modifies
3O
4Nano particle 10mg, N-hydroxy-succinamide NHS 11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg joins 3mLN, among the N-dihydroxy formamide DMF, stirring at room reaction is spent the night, the centrifugal precipitation of going, and supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 60mg ovalbumin OVA again, centrifugal, supernatant carries out magnetic resolution with ultrapure water dialysis 3 days to solution in the bag filter, abandons supernatant, add the pH9.6 sodium carbonate buffer solution sealing that contains 2% gelatin, add the PBST cleansing solution again, washing back magnetic separates, and removes supernatant, add the Tris damping fluid of 1mL 0.02mol/L pH7.6 in the centrifuge tube that last magnetropism was separated, 4 ℃ of preservations are standby.
The preparation of golden nanometer particle: all glass apparatus all strong acid soak, and distilled water cleans, and dries standby; During preparation, adding 100mL mass concentration is 0.01% gold chloride in the Erlenmeyer flask of cleaning, heating, boil, and then add 1% citric acid three sodium solution 3.5mL or 1mL, heat while stirring, solution colour is from the faint yellow redness that becomes, reaction continues 6-8 minute trisodium citrate makes the complete sedimentation of golden nanometer particle, the gained gold nanometer particle grain size is respectively 13nm or 30nm, and last, solution is cooled to room temperature respectively, be diluted to 100mL, 4 ℃ of preservations.
The preparation of gold nano-probe: comprise the preparation of 30nm golden nanometer particle and the preparation of 13nm gold nano-probe
The preparation of 30nm golden nanometer particle: goat-anti rabbit stirring reaction in the alkaline aqueous solution of pH9.1 of 30nm golden nanometer particle and 1.5 μ g, and then, oligonucleotides 5 '-TACGAGTTGAGACCGTTAAGACGAGGCAATCATGCAATCCTGAATGCGt (the 10)-SH-3 ' that in solution, adds sulfydryl modification, room temperature reaction 20 hours, again with containing 0.1MNaCl, the phosphate buffered solution of 10mM is regulated pH to 7.0, salt after old 40 hours in centrifugal 30 minutes of-4 ℃ of following 2000r.p.m, abandon supernatant, red precipitate is with containing 0.1M NaCl, the phosphate buffered solution dissolving of 10mM, the oligonucleotides 5 '-CGCATTCAGGATTGCATGAATGCCTCGTCTTAACGGTCTCAACTCGTA-3 ' that adds 1.5 μ M was hybridized 4 hours for 37 ℃, the centrifugal once more supernatant that goes, crossover process repeats 4 times, precipitation is dissolved at last and contains 0.3MNaCl, the phosphate buffered solution of 10mM, obtain the common 30nm gold nano-probe of modifying of goat anti-rabbit antibody and double-stranded DNA, as 4 ℃ of preservations of storing solution;
The preparation of 13nm gold nano-probe: directly in gold nano solution, add sulfydryl oligonucleotides 5 '-GGCAATCATGCAATCCTGAATGCGa (10)-SH-3 ', room temperature reaction 20 hours, regulate pH value to 7.0 with the phosphate buffered solution that contains 0.1M NaCl, 10mM again, salt after old 40 hours in centrifugal 30 minutes of-4 ℃ of following 2000r.p.m, abandon supernatant, red precipitate dissolves with the phosphate buffered solution that contains 0.1M NaCl, 10mM, 4 ℃ of preservations.
Immune response in the flow injection system: clean microtubule and immune response pond with the washing lotion that contains 0.1M NaCl, pH7.0,0.01M PBS earlier, the super paramagnetic nano particle solution of then 40 μ L antigens being modified of 0.5mg/mL sucks in the solenoid, inject in the immune response pond with the speed of 5 μ L/s again, the electromagnet energising, the absorption magnetic bead is fixed in the reaction tank; 50 μ L antibody and 50 μ L 3-methyl-quinaldic acid's mixed solution of preincubate are sucked in the solenoid, and wherein, 3-methyl-quinaldic acid is dissolved in pH7.4, contains among the 0.01M PBST of 0.05%Tween-20, and concentration is from 1pg/mL to 100pg/mL; Then, mixed solution was injected immune response pond room temperature reaction 10 minutes, inject 400 μ L pH7.0, contain the washing lotion of the 0.01MPBS of 0.1M NaCl with the speed of 20 μ L/s again, afterwards, the goat anti-rabbit antibody of 100 μ L and the solution of the common 30nm gold nano-probe of modifying of double-stranded DNA are injected reaction tank with the speed of 1 μ L/s, reacted flushing 6 minutes; Inject the distilled water of 100 μ L with the speed of 2 μ L/s, 60 ℃ of reactions 6 minutes, the distilled water of the 100 μ L that reinject is at last collected required single stranded DNA, removes magnetic field, and the washing pillar is in order to using again.
Real-time fluorescence quantitative PCR detects: design
Sense primer F is: 5 '-CGCATTCAGGATTGCATGA-3 ',
Antisense primer R is: 5 '-CGAGTTGAGACCGTTAAGACGA-3 ';
The preparation cumulative volume is the reaction solution of 20 μ L, each component is respectively: TOYOBO SYBR GreenReal-time PCR Master Mix 10.0 μ L, ultrapure water 6.8 μ L, sense primer F 0.6 μ L, the single stranded DNA 2.0 μ L of antisense primer R0.6 μ L and collection; This mixed solution is put into the real-time fluorescence PCR instrument, carry out following operation: the pre-sex change of 95 ℃/30s; Increase, 95 ℃/5s, 60 ℃/5s, 72 ℃/10s, totally 45 circulations; Carry out the melting point curve analysis: 95 ℃/0s, 45 ℃/15s, 95 ℃/0s, 0.1 ℃/s, collect fluorescence continuously, 1 circulation; Finally obtain typical curve about 3-methyl-quinaldic acid's concentration and Ct value.
The detection of testing sample: the Ct value that testing sample records is compared with the typical curve that obtains, and obtains the content of 3-methyl-quinaldic acid in the testing sample.
Beneficial effect of the present invention: the present invention improves the sensitivity that quinoxaline feed addictive metabolin 3-methyl-quinaldic acid detects greatly, and operate easier, reached high-throughout purpose, and with magnetic particle as solid phase carrier, have and clean and convenient separation advantage simple to operate, golden nanometer particle with dna modification replaces traditional HRP to carry out immune response as probe, simplified the condition of reaction, improved the sensitivity that detects, reached the international leading level.
Description of drawings
Figure 13-methyl-quinaldic acid's Immunofluorescence PCR testing result.
Embodiment
Embodiment 1
(1) preparation of coating antigen:
Get 3-methyl-quinaldic acid 102mg, be dissolved in 6mLN, N-dihydroxy formamide (DMF), add 120 μ L tri-n-butylamines, reacted 0.5 hour, add 75 μ L isobutyl chlorocarbonates again, reacted 1 hour, mix with the sodium carbonate buffer solution (pH9.6) that contains the 100mg gavaculine again,, have precipitation to produce in the process 4 ℃ of following stirring reactions 2 hours, centrifugal, taking precipitate, drying obtains haptens;
Get haptens 9.9mg, N-hydroxy-succinamide (NHS) 11.5mg, N, N-dicyclohexyl diimine (DCC) 20.63mg, join 3mL N, N-dihydroxy formamide (DMF), the stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant again with 3mL ovalbumin (OVA) (60mg) solution spend the night at 4 ℃ of following stirring reactions, centrifugal, supernatant was with ultrapure water dialysis 3 days, freeze-drying ,-20 ℃ of preservations are standby;
(2) preparation of immunogenic:
Get 3-methyl-quinaldic acid 102mg, N-hydroxy-succinamide (NHS) 11.5mg, N, N-dicyclohexyl diimine (DCC) 20.63mg, join 3mL N, N-dihydroxy formamide (DMF), the stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant again with 3mL ovalbumin (OVA) (130mg) solution spend the night at 4 ℃ of following stirring reactions, centrifugal, supernatant was with ultrapure water dialysis 3 days, freeze-drying ,-20 ℃ of preservations are standby;
(3) immune animal:
Adopt the animal of new zealand white rabbit as the quilt immunity, Freund's complete adjuvant with immunogenic and equivalent during first immunisation is mixed and made into emulsifying agent, at the subcutaneous multi-point injection in White Rabbit back, immunizing dose is 1mg/, 2-4 added the equivalent incomplete Freund with the same dose immunogenic and is mixed and made into emulsifying agent, booster immunization after week at interval, monitoring antibody titer and specificity between duration of immunity, last immunity does not add adjuvant.Last immunity is after 7 days, and the heart bloodletting obtains the MQCA polyclonal antibody of purifying through ammonium sulfate precipitation.
(4) mensuration of antibody titer:
The monitoring that the antibody of different times is tired after adopting indirect ELISA method to immunity is judged as the positive when reaching 1.0 left and right sides with the OD value, tiring of final antibody is 3.2 * 10 as a result
5
(5) modification of magnetic nano-particle:
Prepare FeSO respectively with redistilled water
47H
2O and FeCl
36H
2The solution of O and NaOH solution are with join two kinds of iron salt solutions mixing.Fe in the mixed solution of molysite
2+The concentration of ion is 0.12mol/L, Fe
3+Concentration be 0.2mol/L; The concentration of NaOH solution is 2.5mol/L.NaOH solution with certain volume under vigorous stirring slowly is added drop-wise in the mixed molysite solution, gained is deposited in 60 ℃ of ageings 2 hours, with redistilled water with sediment undergoes washing for several times, again 60 ℃ of dryings 24 hours, grinding the back products therefrom in agate mortar is Fe after the filtration
3O
4Seed.
To go up step product 0.125g with 100mL ethanol with 1mL is water-soluble separates, ultrasonic 30min drips 0.4mL 3-aminopropyl triethoxysilane (APTES), and stirring at room 7 hours is with the centrifugal 30min of 8000r/min, with the Fe of APTES modification
3O
4Nano particle separates from reaction medium, and with ethanolic solution it is cleaned 5 times, and is again 60 ℃ of dryings 24 hours, standby after the filtration.
(6) coupling of magnetic nano-particle and coating antigen:
Get step (5) gained final product 10mg, N-hydroxy-succinamide (NHS) 11.5mg, N, N-dicyclohexyl diimine (DCC) 20.63mg, join 3mL N, N-dihydroxy formamide (DMF), stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant again with 3mL ovalbumin (OVA) (60mg) solution spend the night at 4 ℃ of following stirring reactions, centrifugal, supernatant carries out magnetic resolution with ultrapure water dialysis 3 days to solution in the bag filter, abandons supernatant, add the confining liquid sealing that contains 2% gelatin, add the PBST cleansing solution again, washing back magnetic separates, and removes supernatant, add the Tris damping fluid of 1mL 0.02mol/L pH7.6 in the centrifuge tube that last magnetropism was separated, 4 ℃ of preservations are standby.
(7) preparation of golden nanometer particle:
All glass apparatus all strong acid soak, and distilled water cleans, and dries standby.During preparation, adding 100mL concentration is 0.01% gold chloride in the Erlenmeyer flask of cleaning, heating, boil, and then add 1% citric acid three sodium solution (the 30nm particle needs 1mL), heat while stirring, solution colour is from the faint yellow redness that becomes, and reaction continues 6-8 minute so that the complete sedimentation of trisodium citrate.At last, solution is cooled to room temperature respectively, is diluted to 100mL, 4 ℃ of preservations.
(8) preparation of gold nano-probe:
At first, the goat-anti rabbit of 30nm golden nanometer particle and 1.5 μ g is stirring reaction (pH9.1) in alkaline aqueous solution, and then, the oligonucleotides (5 '-tacgagttgagaccgttaagacgaggcaatcatgcaatcctgaatgcgt (10)-SH-3 ') that in solution, adds sulfydryl modification, room temperature reaction 20 hours, use the phosphate buffered solution (0.1M NaCl) of 10mM to regulate pH value to 7.0 again, salt in centrifugal 30 minutes of-4 ℃ of following 2000r.p.m, is abandoned supernatant after old 40 hours.Red precipitate dissolves with the phosphate buffered solution (0.1MNaCl) of 10mM, the 37 ℃ of hybridization of target-probe (5 '-cgcattcaggattgcatgaatgcctcgtcttaacggtctcaactcgta-3 ') 4 hours that add 1.5 μ M, the centrifugal once more supernatant that goes, crossover process repeats 4 times, precipitation is dissolved in the phosphate buffered solution (0.3MNaCl) of 10mM at last, as 4 ℃ of preservations of storing solution.
(9) immune response in the flow injection system:
Earlier with 0.01M PBS (pH7.0,0.1M washing lotion NaCl) is cleaned microtubule and immune response pond, the super paramagnetic nano particle solution (0.5mg/ml) that 40 μ L antigens are modified sucks in the solenoid then, inject in the immune response pond with the speed of 5 μ L/s again, the electromagnet energising, the absorption magnetic bead is fixed in the reaction tank.Mixed solution (50 μ L antibody with preincubate; 50 μ LMQCA) suck in the solenoid, wherein, MQCA be dissolved in 0.01MPBST (pH7.4,0.05%Tween-20) in, concentration is from from 1pg/mL to 100pg/mL.Then, mixed solution is injected immune response pond room temperature reaction 10 minutes, inject the washing lotion of 400 μ L 0.01MPBS (pH7.0,0.1M NaCl) again with the speed of 20 μ L/s.Afterwards, the solution of the 30nm Au probe of 100 μ L (containing two anti-and DNA) is injected reaction tank with the speed of 1 μ L/s, react 6 minutes, wash.Inject the distilled water of 100 μ L with the speed of 2 μ L/s, 60 ℃ of reactions 6 minutes, the distilled water of the 100 μ L that reinject is at last collected required single stranded DNA, removes magnetic field, and the washing pillar is in order to using again.
(10) real-time fluorescence quantitative PCR detects:
Designing sense primer (F) is 5 '-cgcattcaggattgcatga-3 ', and antisense primer (R) is 5 '-cgagttgagaccgttaagacga-3 '.Secondly, the preparation cumulative volume is the reaction solution of 20 μ L, and each component is respectively: TOYOBO SYBR Green Real-time PCR Master Mix10.0 μ L; Ultrapure water 6.8 μ L; Sense primer (F) 0.6 μ L; Antisense primer (F) 0.6 μ L; The single stranded DNA 2.0 μ L that step (9) is collected.This mixed solution is put into the real-time fluorescence PCR instrument, carry out following operation: the pre-sex change of 95 ℃/30s; Increase, 95 ℃/5s, 60 ℃/5s, 72 ℃/10s (collection fluorescence), totally 45 circulations; Carry out the melting point curve analysis: 95 ℃/0s, 45 ℃/15s, 95 ℃/0s (0.1 ℃/s is collected fluorescence continuously), 1 circulation.Finally obtain typical curve, reached the purpose that detects about 3-methyl-quinaldic acid.
Claims (10)
1. a 3-methyl-quinaldic acid Immunofluorescence PCR detecting method, it is characterized in that the preparation of coating antigen, immunogene and antibody, fixing of coating antigen, the modification of magnetic nano-particle, the coupling of magnetic nano-particle and coating antigen, the golden nanometer particle preparation of two kinds of particle diameters, the preparation of two kinds of gold nano-probes, immune response in the flow injection system, the detection of real-time fluorescence quantitative PCR detection and testing sample; Processing step is:
(1) preparation of coating antigen: 3-methyl-quinaldic acid is linked to each other with gavaculine, again with ovalbumin mutually coupling obtain coating antigen;
(2) immunogenic preparation: with 3-methyl-quinaldic acid and bovine serum albumin mutually coupling obtain immunogene;
(3) preparation of antibody: the immunogen immune rabbit that obtains with step (2) obtains specific polyclonal antibody;
(4) coating antigen is fixing: coating antigen and magnetic particle coupling that step (1) is obtained, and be fixed in the glass microchannel;
(5) modification of magnetic nano-particle: with the Fe of preparation
3O
4Seed is modified with the 3-aminopropyl triethoxysilane;
(6) coupling of magnetic nano-particle and coating antigen:
The golden nanometer particle preparation of (7) two kinds of particle diameters;
The preparation of (8) two kinds of gold nano-probes;
(9) immune response in the flow injection system:
(10) real-time fluorescence quantitative PCR detects: 3-methyl-quinaldic acid and polyclonal antibody are passed through in the glass microchannel, competition in conjunction with after polyclonal antibody with through the common gold nano-probe reaction of modifying of goat anti-rabbit antibody and double-stranded DNA, sex change obtains single stranded DNA and with its collection, the single stranded DNA that collection obtains carries out real-time fluorescence quantitative PCR and detects, and obtains the typical curve about 3-methyl-quinaldic acid's concentration and Ct value;
(11) detection of testing sample: the Ct value that testing sample records is compared with the typical curve that obtains, and obtains the content of 3-methyl-quinaldic acid in the testing sample.
2,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that the preparation of coating antigen:
Get 3-methyl-quinaldic acid 102mg, be dissolved in 6mL N, among the N-dihydroxy formamide DMF, add 120 μ L tri-n-butylamines, reacted 0.5 hour, add 75 μ L isobutyl chlorocarbonates again, reacted 1 hour, mix with the pH9.6 sodium carbonate buffer solution 6mL solution that contains the 100mg gavaculine again,, have precipitation to produce in the process 4 ℃ of following stirring reactions 2 hours, centrifugal, taking precipitate, drying obtains 3-methyl-quinaldic acid's haptens; Get 3-methyl-quinaldic acid's haptens 9.9mg, N-hydroxy-succinamide NHS 11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg, join 3mL N, among the N-dihydroxy formamide DMF, the stirring at room reaction is spent the night, the centrifugal precipitation of going, supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 60mg ovalbumin OVA again, and is centrifugal, and supernatant was with ultrapure water dialysis 3 days, freeze-drying ,-20 ℃ of preservations are standby.
3,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method, it is characterized in that immunogenic preparation: get 3-methyl-quinaldic acid 102mg, N-hydroxy-succinamide NHS11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg, join 3mL N, among the N-dihydroxy formamide DMF, stirring at room reaction is spent the night, the centrifugal precipitation of going, and supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 130mg ovalbumin OVA again, centrifugal, supernatant was dialysed 3 days with ultrapure water, freeze-drying, and-20 ℃ of preservations are standby.
4,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that the modification of magnetic nano-particle: prepare FeSO respectively with redistilled water
47H
2O and FeCl
36H
2The solution of O and NaOH solution are with join two kinds of iron salt solutions mixing, Fe in the mixed solution of molysite
2+The concentration of ion is 0.12mol/L, Fe
3+Concentration be 0.2mol/L; The concentration of NaOH solution is 2.5mol/L; NaOH solution with certain volume under vigorous stirring slowly is added drop-wise in the mixed molysite solution, gained is deposited in 60 ℃ of ageings 2 hours, with redistilled water with sediment undergoes washing for several times, again 60 ℃ of dryings 24 hours, grinding the back products therefrom in agate mortar is Fe after the filtration
3O
4Seed.With Fe
3O
4Seed 0.125g 100mL ethanol and the aqueous dispersion of 1mL second distillation, ultrasonic 30min drips 0.4mL 3-aminopropyl triethoxysilane APTES, and stirring at room 7 hours is with the centrifugal 30min of 8000r/min, with the Fe of APTES modification
3O
4Nano particle separates from reaction medium, and with ethanolic solution it is cleaned 5 times, and is again 60 ℃ of dryings 24 hours, standby after the filtration.
5,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that the coupling of magnetic nano-particle and coating antigen: get the Fe that gained APTES modifies
3O
4Nano particle 10mg, N-hydroxy-succinamide NHS11.5mg, N, N-dicyclohexyl diimine DCC 20.63mg joins 3mLN, among the N-dihydroxy formamide DMF, stirring at room reaction is spent the night, the centrifugal precipitation of going, and supernatant spends the night at 4 ℃ of following stirring reactions with the solution that 3mL contains 60mg ovalbumin OVA again, centrifugal, supernatant carries out magnetic resolution with ultrapure water dialysis 3 days to solution in the bag filter, abandons supernatant, add the pH9.6 sodium carbonate buffer solution sealing that contains 2% gelatin, add the PBST cleansing solution again, washing back magnetic separates, and removes supernatant, add the Tris damping fluid of 1mL 0.02mol/L pH7.6 in the centrifuge tube that last magnetropism was separated, 4 ℃ of preservations are standby.
6,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that the preparation of golden nanometer particle: used glass apparatus all strong acid soaks, and distilled water cleans, and dries standby; During preparation, adding 100mL mass concentration is 0.01% gold chloride in the Erlenmeyer flask of cleaning, heating, boil, and then add 1% citric acid three sodium solution 3.5mL or 1mL, heat while stirring, solution colour is from the faint yellow redness that becomes, reaction continues 6-8 minute trisodium citrate makes the complete sedimentation of golden nanometer particle, gained gold nanometer particle grain size correspondence is respectively 13nm or 30nm, and last, solution is cooled to room temperature respectively, be diluted to 100mL, 4 ℃ of preservations.
7,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that the preparation of gold nano-probe:
The preparation of 30nm gold nano-probe: goat-anti rabbit stirring reaction in the alkaline aqueous solution of pH9.1 of 30nm golden nanometer particle and 1.5 μ g, and then, oligonucleotides 5 '-TACGAGTTGAGACCGTTAAGACGAGGCAATCATGCAATCCTGAATGCGt (the 10)-SH-3 ' that in solution, adds sulfydryl modification, room temperature reaction 20 hours, again with containing 0.1M NaCl, the phosphate buffered solution of 10mM is regulated pH to 7.0, salt after old 40 hours in centrifugal 30 minutes of-4 ℃ of following 2000r.p.m, abandon supernatant, red precipitate is with containing 0.1MNaCl, the phosphate buffered solution dissolving of 10mM, the oligonucleotides 5 '-CGCATTCAGGATTGCATGAATGCCTCGTCTTAACGGTCTCAACTCGTA-3 ' that adds 1.5 μ M was hybridized 4 hours for 37 ℃, the centrifugal once more supernatant that goes, crossover process repeats 4 times, precipitation is dissolved at last and contains 0.3MNaCl, the phosphate buffered solution of 10mM, obtain the common 30nm gold nano-probe of modifying of goat anti-rabbit antibody and double-stranded DNA, as 4 ℃ of preservations of storing solution;
The preparation of 13nm gold nano-probe: directly in gold nano solution, add sulfydryl oligonucleotides 5 '-GGCAATCATGCAATCCTGAATGCGa (10)-SH-3 ', room temperature reaction 20 hours, regulate pH value to 7.0 with the phosphate buffered solution that contains 0.1M NaCl, 10mM again, salt after old 40 hours in centrifugal 30 minutes of-4 ℃ of following 2000r.p.m, abandon supernatant, red precipitate dissolves with the phosphate buffered solution that contains 0.1M NaCl, 10mM, 4 ℃ of preservations.
8,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method, it is characterized in that the immune response in the flow injection system: clean microtubule and immune response pond with the washing lotion that contains 0.1M NaCl, pH7.0,0.01M PBS earlier, the super paramagnetic nano particle solution of then 40 μ L antigens being modified of 0.5mg/mL sucks in the solenoid, inject in the immune response pond with the speed of 5 μ L/s again, the electromagnet energising, the absorption magnetic bead is fixed in the reaction tank; 50 μ L antibody and 50 μ L 3-methyl-quinaldic acid's mixed solution of preincubate are sucked in the solenoid, and wherein, 3-methyl-quinaldic acid is dissolved in pH7.4, contains among the 0.01M PBST of 0.05%Tween-20, and concentration is from 1pg/mL to 100pg/mL; Then, mixed solution was injected immune response pond room temperature reaction 10 minutes, inject 400 μ L pH7.0, contain the washing lotion of the 0.01MPBS of 0.1M NaCl with the speed of 20 μ L/s again, afterwards, the goat anti-rabbit antibody of 100 μ L and the solution of the common 30nm gold nano-probe of modifying of double-stranded DNA are injected reaction tank with the speed of 1 μ L/s, reacted flushing 6 minutes; Inject the distilled water of 100 μ L with the speed of 2 μ L/s, 60 ℃ of reactions 6 minutes, the distilled water of the 100 μ L that reinject is at last collected required single stranded DNA, removes magnetic field, and the washing pillar is in order to using again.
9,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method is characterized in that real-time fluorescence quantitative PCR detects: design
Sense primer F is: 5 '-CGCATTCAGGATTGCATGA-3 ',
Antisense primer R is: 5 '-CGAGTTGAGACCGTTAAGACGA-3 ';
The preparation cumulative volume is the reaction solution of 20 μ L, each component is respectively: TOYOBO SYBR GreenReal-time PCR Master Mix 10.0 μ L, ultrapure water 6.8 μ L, sense primer F 0.6 μ L, the single stranded DNA 2.0 μ L of antisense primer R0.6 μ L and collection; This mixed solution is put into the real-time fluorescence PCR instrument, carry out following operation: the pre-sex change of 95 ℃/30s; Increase, 95 ℃/5s, 60 ℃/5s, 72 ℃/10s, totally 45 circulations; Carry out the melting point curve analysis: 95 ℃/0s, 45 ℃/15s, 95 ℃/0s, 0.1 ℃/s, collect fluorescence continuously, 1 circulation; Finally obtain typical curve about 3-methyl-quinaldic acid's concentration and Ct value.
10,3-methyl-quinaldic acid's according to claim 1 Immunofluorescence PCR detecting method, it is characterized in that the detection of testing sample: the Ct value that testing sample records is compared with the typical curve that obtains, and obtains the content of 3-methyl-quinaldic acid in the testing sample.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100220311A CN101315370A (en) | 2008-06-23 | 2008-06-23 | Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNA2008100220311A CN101315370A (en) | 2008-06-23 | 2008-06-23 | Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101315370A true CN101315370A (en) | 2008-12-03 |
Family
ID=40106450
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2008100220311A Pending CN101315370A (en) | 2008-06-23 | 2008-06-23 | Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101315370A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101789296B (en) * | 2010-02-08 | 2011-12-21 | 北京交通大学 | Preparation method of gold-covered nano magnetic particle used for preparing magnetic liquid |
CN102879580A (en) * | 2011-07-11 | 2013-01-16 | 上海生物芯片有限公司 | Method for detecting trace protein |
CN110336031A (en) * | 2019-06-28 | 2019-10-15 | 陕西科技大学 | A kind of sulphur load molybdenum oxide/graphene hollow structure electrode material preparation method |
CN112730857A (en) * | 2020-12-14 | 2021-04-30 | 上海海洋大学 | Magnetic immunochromatographic test strip and method for rapidly detecting MS-222 |
-
2008
- 2008-06-23 CN CNA2008100220311A patent/CN101315370A/en active Pending
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101789296B (en) * | 2010-02-08 | 2011-12-21 | 北京交通大学 | Preparation method of gold-covered nano magnetic particle used for preparing magnetic liquid |
CN102879580A (en) * | 2011-07-11 | 2013-01-16 | 上海生物芯片有限公司 | Method for detecting trace protein |
CN110336031A (en) * | 2019-06-28 | 2019-10-15 | 陕西科技大学 | A kind of sulphur load molybdenum oxide/graphene hollow structure electrode material preparation method |
CN112730857A (en) * | 2020-12-14 | 2021-04-30 | 上海海洋大学 | Magnetic immunochromatographic test strip and method for rapidly detecting MS-222 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101382541B (en) | Immunofluorescence quenching detecting method for microcystin-LR | |
CN101382542B (en) | Immunofluorescence PCR detecting method for microcystin-LR | |
CN101315371B (en) | Immunofluorescence quench blanking detection method of 3-methyl-quinoline-2-carboxylic acid | |
US11073513B2 (en) | Separating target analytes using alternating magnetic fields | |
EP2503335B1 (en) | Method and device for detecting analytes | |
CN106366196B (en) | EpCAM antibody immunomagnetic beads and preparation method thereof | |
CN105396559A (en) | Affinity adsorption material based on anti-aflatoxin nanometer antibody | |
CN101144816B (en) | 3-methyl-quinoline-2-carboxylic acid immunomagnetic bead detection method | |
CN101315370A (en) | Immunofluorescence PCR detection method of 3-methyl-quinoline-2-carboxylic acid | |
CN102585005B (en) | Monoclonal antibody and ELLSA (Enzyme Linked Immunosorbent Assay) method for detection of methyl-3-quinoxaline-2-carboxylic acid (MQCA), and kit | |
CN105301252A (en) | Immunomagnetic bead for enrichment and purification of ochratoxin A, and preparation method and application of immunomagnetic bead | |
CN106366195B (en) | PD-L1 antibody immunomagnetic beads and preparation method thereof | |
CN110632148B (en) | Electrochemical immunosensor for determining secreted autophagosome and preparation method and application thereof | |
Khosravi et al. | Preparation of immunomagnetic beads coupled with a rhodamine hydrazine immunosensor for the detection of Mycobacterium avium subspecies paratuberculosis in bovine feces, milk, and colostrum | |
CN105396558A (en) | Affinity adsorption material based on anti-AFB1 nanometer antibody | |
CN107955069A (en) | The purposes of a kind of synthetic method and DOTA of improved heavy metal lead artificial antigen in heavy metal lead artificial antigen reagent is prepared | |
CN107955070A (en) | The purposes of a kind of synthetic method and NOTA of improved artificial antigen of heavy metal copper in artificial antigen of heavy metal copper reagent is prepared | |
CN101930002A (en) | Hypersensitization technology for detecting pathogenic bacteria in water environment | |
CN110632295A (en) | Fe3O4-Au antibody nano magnetic bead and preparation method and application thereof | |
CN102875512A (en) | Preparation method of anticoagulant raticide brodifacoum hapten and holoantigen | |
CN106279421B (en) | CD133, CD24 and CD44 multiple antibody immunomagnetic beads and preparation method thereof | |
CN109283347A (en) | The method that nano biological sensor based on immunomagnetic beads and fluorescence quantum quickly detects Enrofloxacin in broiler chicken | |
CN102879585A (en) | Indirect ELISA (enzyme linked immunosorbent assay) method for detecting soybean antigenic protein serum antibody | |
CN106279420B (en) | CD20 antibody immunomagnetic beads and preparation method thereof | |
CN105396557A (en) | Affinity adsorption material based on nanometer antibody capable of specially recognizing aflatoxin |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20081203 |