CN101307365A - Method for rapidly detecting arabis mosaic virus from lily - Google Patents

Abstract

The invention discloses a method for quickly detecting Arabis mosaic virus in lilies. The method utilizes an Arabis mosaic virus genome sequence logged in NCBI to design special primers of the Arabis mosaic virus, F1/R1 and F2/R2, wherein, the F1/R1 is an outer primer, the F2/R2 is an inner primer, an F2/R2 amplified fragment is positioned inside an F1/R1 amplified fragment, and the F1/R1 and the F2/R2 are nested primers; and then a RT-PCR assay and a nested PCR assay are adopted to detect. The method has good detection specificity, can avoid a false positive or a false negative phenomenon, has high sensitivity, and is economic and practical.

Description

The method of arabis mosaic virus in the rapid detection lily

Technical field

The invention belongs to plant inspection quarantine technical field, more particularly, the present invention relates to the method for arabis mosaic virus in a kind of rapid detection lily.

Background technology

Arabis mosaic virus (Arabis mosaic virus ArMV) different name (Raspberry yellowdwarf virus, Rhabarber mosaic virus, Rhubarb mosaic virus), English name (Arabis mosaic nepo virus), belong to Comoviridae (Comoviridae) Nepovirus (Nepovirus) member, it is China two classes quarantine property plant virus, virion is isometrical polyhedron, three kinds of sedimentation component: coat protein T (53S) are arranged, nucleoprotein M (93S) and nucleoprotein B (126S), the about 30nm of diameter, for+ssRNA dyad virus, main by the juice frictional inoculation, seedling is propagated, and also can pass through amboceptor nematode (Xiphinema diverslcan datum) and propagate.ArMV mainly is distributed in Belgium, Bulgaria, Czech, Denmark, France, Germany, breast is inferior sharp, Ireland, Italy, Luxembourg, Holland, Poland, Romania, Sweden, Switzerland, Britain, New Zealand, France, Japan, South Africa, Canada, countries such as Australia and New Zealand, the ArMV host range is extensive, can infect about 174 and belong to 215 kinds of wild and cultivate unifacial leaves, dicotyledons, comprise Beta main the genus, shepherd's purse belongs to, Chenopodium, Fragaria, Glycine, Lactuca, lamium, tomato belongs to, myosotis, green winter Solanum, Plantago, annual bluegrass belongs to, Polygonum, Rheum, Senecio, Stellaria etc.The crop of mainly causing harm has: mould, the hops of grass, Paeonia, immature fruit of Juteleaf Raspberry, Rheum, Williams Elder Twig, in other Cultivar and wild kind of sweet dish, celery, narcissus, Europe woman, horseradish, trifolium, Tang Changpu genus, capsicum, Ge Ba, gladiolus, turmeric, tobacco, Dianthus caryophyllus L., narcissus, rose and some.Adding that China vegetation is abundant, the diversity of weather condition makes that the host plant and the environment of suitable this virus parasitized breeding are more, because ArMV infects many cash crop, also grow surely in case import China into, cause enormous economic loss will for China's related industries.Symptoms such as ArMV shows as mainly that blade is mottled, floral leaf, yellow chlorisis, stigma, deformity (comprising that ear is prominent), dwarfing even necrosis, the symptom performance on the different host is different, and with different variation of strain system, Cultivar, season and time.

At present, the detection and the authentication method that are used for ArMV mainly contain biological method, serological method, electron microscopic observation, wherein be most widely used with elisa technique, but exist false positive or false negative phenomenon, and detection sensitivity is not high, sero-fast preparation is difficulty relatively, and expensive price also need be carried out plant indicator discriminating and virulence simultaneously and detect.Its step is numerous and diverse, and the time is tediously long even exceed defectives such as time domain that nursery stock survival allows and carry out for the smooth implementation of quarantine to have caused certain difficulty, can't satisfy the needs of port quarantine.This is a technical barrier that presses for solution.Do not find relevant report in the prior art as yet.

Summary of the invention

The objective of the invention is at the deficiencies in the prior art, fill up the blank of arabis mosaic virus molecular level context of detection in the lily, the method for arabis mosaic virus in a kind of rapid detection lily is provided.

Purpose of the present invention is achieved by following technical proposals.

The invention provides the method for arabis mosaic virus in a kind of rapid detection lily, this method adopts following steps:

(1) utilizes the arabis mosaic virus genome sequence of logining among the NCBI, design arabis mosaic virus Auele Specific Primer F1/R1, F2/R2, wherein, F1/R1 is an outer primer, and F2/R2 is an inner primer, the F2/R2 amplified fragments is in F1/R1 amplified fragments inside, and F1/R1 and F2/R2 are nested primers;

(2) adopt the amplification of RT-PCR and nest-type PRC.

Principle of work of the present invention and process:

Along with the continuous development of Protocols in Molecular Biology, be applied to the rapid detection of plant virus more and more widely based on the highly sensitive RT-PCR method of nucleic acid level.But, carry the extremely seed of trace virus for some, plant ball and other asexual propagation material, ELASA technology and regular-PCR method also do not reach its desired detection sensitivity far away.Nido RT-PCR is the more highly sensitive molecular detecting method that has that is based upon on the common RT-PCR method, its principle is two pairs of primers of design, wherein a pair of primer is taken turns certain gene of PCR reaction pair by first round RT-PCR one and second and is detected on another fragment to primer extension product.Usually for the first time adopt the bigger segmental primer that can increase,, the product that increases is for the first time carried out the second time as template increase through behind 25～35 cyclic amplifications.The proteic gene conserved sequence design of coding CP primer on the ArMV sequence RNA 2 that the present invention has announced according to GenBank has been set up the nido RT-PCR detection method of lily ArMV.Primer sequence is: F1:5 ' ACATTTCGCCACCCTAACTG3 ', R1:5 ' TGCCAAACACCTGATGCTCC3 '; F2:5 ' TGGCATAGTGGTTAGAGTTG3 ', R2:5 ' GAAGGATGGCACAGTTAGAT3 '.About F1/R1 amplified production length 930bp, about F2/R2 amplified production length 260bp.

Compared with prior art, the present invention has following beneficial effect.

The present invention detects arabis mosaic virus first on molecular level on Yunnan Province's import lily ball, common RT-PCR and nested PCR detection method have been set up at the lily arabis mosaic virus, compare with traditional E LISA method, detection specificity of the present invention is good, other virus and healthy plant detected result all are negative, have avoided false positive or false negative phenomenon simultaneously.Detection sensitivity is compared with common RT-PCR with ELISA than higher, and sensitivity has improved 1000 times; Detection time is short, and whole testing process is compared required time with ELISA and shortened greatly, only needs just can finish in 6～8 hours; Economical and practical, sero-fast preparation is difficulty and costing an arm and a leg relatively, and the present invention adopts common RT-PCR and nest-type PRC to detect, and only needs several to special primer and Taq enzyme system.

Description of drawings

Fig. 1 is Shanghai China Shun plant (leaves) RNA mini kit (50) two lily kind lily Tiber extracting that test kit (centrifugal column type) extracts and the agarose gel electrophoresis figure of Siberia blade RNA;

Fig. 2 is two lily kind lily Tiber extracting of sky, Beijing root RNAprep plant kit plant total RNA extraction reagent box (centrifugal column type) and the agarose gel electrophoresis figure of Siberia blade RNA;

Fig. 3 be F1/R1 outer primer RT-PCR amplification Tiber and Siberia with the agarose gel electrophoresis figure of malicious plant and healthy plant cDNA, wherein, be with malicious plant and healthy plant on the 1-2:Tiber, be with malicious plant and healthy plant on the 3-4:Siberia; 5-6, positive control and negative control;

Fig. 4 is the band poison plant of nest-type PRC amplification and the agarose gel electrophoresis figure of healthy plant cDNA, wherein, is with malicious plant on the 1-2:Tiber, is with malicious plant on the 3-4:Siberia, 5-6:Tiber and Siberia healthy plant, 7-8: positive control;

Fig. 5 is with malicious plant nest-type PRC detection sensitivity figure, wherein, and 1:10 ^-1Doubly dilution, 2:20 doubly dilutes, and 3:50 doubly dilutes, 4:10 ^-2Doubly dilution, 5:200 doubly dilutes, and 6:500 doubly dilutes, 7:10 ^-3Doubly dilution, 8:10 ^-4Doubly dilution.

Embodiment

In order to understand essence of the present invention better, the invention will be further described below in conjunction with embodiment and accompanying drawing, but they are not limitations of the present invention.

Embodiment

The kind that is used to study has siberian (Siberia), day despot's oriental hybrid lily kinds such as (Tiber).The lily material of choosing for band arabis mosaic virus (Arabis mosaic virus ArMV), the band poison gladiolus blade that positive control is preserved for this research department, negative control is the healthy plant of two kinds of lily kinds, and extracting the RNA position is the lily plant leaf.

1.RNA extract the result relatively

Figure (1,2) T3 in, T5 represent the numbering of the poison of the band among detected Tiber plant among the DAS-ELISA, the healthy plant among the strong expression of the T Tiber, S9 represents the numbering of the poison of the band among detected Siberia plant among the DAS-ELISA, the healthy plant among the strong expression of the S Siberia.The result: it is higher that Shanghai China Shun plant (leaves) RNA mini kit (50) extraction test kit extracts purity, and integrity is RNA preferably.

2.RT-PCR and nest-type PRC

The specific amplification result (Fig. 3) of F1/R1 outer primer, F1/R1 carries out the RT-PCR amplification to the cDNA of total RNA reverse transcription of the detected These positive bands poison of DAS-ELISA plant, amplification obtains the specific band about 930bp, the specific amplification result (Fig. 4) of F2/R2 inner primer, get the PCR product of F1/R1 external primer amplification, increase with the F2/R2 inner primer, amplification obtains the specific band about 260bp.

3. the detection of nest-type PRC sensitivity

In order to check the susceptibility of nest-type PRC, with F1/R1 amplification PCR products dilution 10 ^-1, 20,50,10 ^-2, 200,500,10 ^-3, 10 ^-4Doubly increase (Fig. 5) with inner primer F2/R2 as template in the back, and the result shows that nest-type PRC sensitivity is compared with common RT-PCR and exceeded 10 ³Doubly.

4.PCR product cloning and sequential analysis

With DNA Star software analysis nest-type PRC amplified production sequence (KMS6547), the result shows the ArMV sequence A B279740 that has logined among viral isolates sequence in this example and the GenBank, NC_006056, AB279739, AB279741, D10086, X55460, homology on Nucleotide and amino acid levels is respectively 95.2%, 95.8%, 96.4%, 99.2%, 98.1%, 98.7% shows that isolate is ArMV.

Claims (1)

1. the method for arabis mosaic virus in the rapid detection lily, this method adopts following steps:

(1) utilizes the arabis mosaic virus genome sequence of logining among the NCBI, design arabis mosaic virus Auele Specific Primer F1/R1, F2/R2, wherein, F1/R1 is an outer primer, and F2/R2 is an inner primer, the F2/R2 amplified fragments is in F1/R1 amplified fragments inside, and F1/R1 and F2/R2 are nested primers;

(2) adopt RT-PCR and nest-type PRC amplification method to detect.

Images