CN101285096A - Process for quickly detecting DNA methylation - Google Patents
Process for quickly detecting DNA methylation Download PDFInfo
- Publication number
- CN101285096A CN101285096A CNA2008100384538A CN200810038453A CN101285096A CN 101285096 A CN101285096 A CN 101285096A CN A2008100384538 A CNA2008100384538 A CN A2008100384538A CN 200810038453 A CN200810038453 A CN 200810038453A CN 101285096 A CN101285096 A CN 101285096A
- Authority
- CN
- China
- Prior art keywords
- dna
- sodium bisulfite
- methylation
- modification
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to the medical biology detection technical field and discloses a method for quickly detecting DNA methylation. Aiming at the disadvantages of the prior method, the method provided by the invention improves the following three aspects: 1. catalyst TAC and guanidine hydrochloride are added to accelerate the modification reaction; 2. short-time high-temperature melting is performed during the modification reaction for times so as to fully expose basic groups to transform cytimidine which is not made from methylation modification to sulfonated uracil; 3. aiming at fussy dialysis desalination steps after the modification, when a modified DNA product is purified, the modified DNA product is combined into a glass fiber membrane or pellosil or other pillars for washing desalination, then is treated by sulfated reagent and eluted, thereby obtaining a methylated PCR template which can be directly used for PCR augmentation and greatly saves desalination time. The method has low cost, short detection time and good repetitiveness.
Description
Technical field
The present invention relates to Medical Biology detection technique field, specifically is a kind of method of rapid detection dna methylation.
Background technology
The abnormal methylation of gene and the generation of tumour, development are in close relations, and in vertebrates, the CpG dinucleotides is the main site that dna methylation takes place.The normal cluster of CpG exists, and people are called CpG island (CpGisland) with the section of DNA that is rich in CpG in the genome.The CpG island often is positioned near the transcription regulatory region, and the research of dna methylation is inseparable with the research on CpG island.Methylate cancer, precancerous lesion unusually in early days, even promptly occur in some benign lesions, the promoter region CpG island hyper-methylation of a plurality of cancer suppressor genes in the precancerous lesion of many malignant tumours, all found.It is reported, detect a plurality of gene generation abnormal methylation relevant in the carcinoma of the pancreas tissue, as abnormal methylation (Virmani AK, the et al.Clin Cancer Res2001 of p16 gene with carcinoma of the pancreas; 7:584-9), MUC2 (Ho JJ, et al.Int J Oncol 2003; 22:273-9), NPTX2 (Sato N, et al.Cancer Res, 2003,63:3735-3742) etc., so relative dna methylates and tumorigenic relation is subject to people's attention day by day, becomes one of oncomolecularbiology research focus.
The research of gene methylation has a lot of methods, wherein the most frequently used detection method is methylation status of PTEN promoter (the methvlation-specific PCR that Herman etc. set up in 1996, MSP), its ultimate principle is by the modification of sodium bisulfite to the DNA sample, make unmethylated cytosine(Cyt) generation desamination reaction, under the sodium hydroxide effect, become uridylic at last, and desamination reaction can not take place in methylated cytosine(Cyt), base does not change, both base sequences are just different like this, carry out the PCR of primer specificity then.Need two pairs of primers of design among the MSP, and require: 1, the primer end all designs to detection site and finishes; 2, the two pairs of primers respectively can only with the sequence complementary pairing after handling through sodium bisulfite, wherein a pair of in conjunction with the methylate DNA chain after handling, another is in conjunction with the not methylate DNA chain after handling.Further analyze the PCR product by gel electrophoresis or dna sequencing,, illustrate that this detected site existence methylates if use primer can amplify fragment at the methylate DNA chain after handling; If use primer can amplify fragment, illustrate that detected site does not exist to methylate at the not methylate DNA chain after handling.
The MSP method comprises the steps:
1, prepare DNA to be measured:
Get tissue homogenate according to a conventional method, with phenol chloroform method (see F.M. Ao Sibai etc. for details, fine works molecular biology experiment guide, Beijing: Science Press, 2005:46) or the genome DNA extraction test kit extract DNA.
2, the DNA sodium bisulfite is modified:
With the DNA sex change, become single stranded DNA, base is fully exposed; Adding final concentration is the sodium bisulfite of 1mol-6mol, makes on the dna single chain unmethylated cytosine(Cyt) carry out modification reaction with sodium bisulfite and generates the sulfonation cytosine(Cyt), and the sulfonation cytosine(Cyt) is deaminizating generation sulfonated urine pyrimidine under the effect of water; And the 5 '-cytosine(Cyt) that methylates can not be modified; DNA product after modifying through dialysis desalting, is taken off sulfonation with sodium hydroxide, make the sulfonated urine pyrimidine become uridylic.After DNA was modified, unmethylated cytosine(Cyt) base became uridylic, and methylated cytosine(Cyt) is then constant.
3, purifying:
DNA after modified with ethanol sedimentation, washing, is made pcr template after the dissolving again.
4, pcr amplification and check and analysis:
Because the normal oligodeoxynucleotide sequence of testing gene, the quantity and the site, place of cytosine(Cyt) are clear and definite, therefore can design corresponding forward and reverse methylation-specific primer and methylation-specific primer not, with the DNA after modifying is template, carry out pcr amplification, the primer of the methylation-specific methylated sequence that can only increase, not the methylation-specific primer unmethylated sequence that can only increase; At last with the PCR product by gel electrophoresis or dna sequencing analysis, just can determine survey in the tissue cytosine methylation degree on CpG island in this gene.
Concrete steps are mainly:
1, prepares DNA to be measured: according to a conventional method as phenol chloroform method extracting DNA from tissue.
2, the DNA sodium bisulfite is modified:
1), get 1 μ g DNA, be dissolved in the 20 μ l water, 95 ℃ of water-baths 10 minutes are put in ice bath immediately; Add 2 μ l 10M sodium hydroxide, make the DNA sex change, become single stranded DNA;
2), add sodium bisulfite decorating liquid 230 μ l (the 3M sodium bisulfite, the 10mM quinhydrones, PH5.0); Place 55 ℃ of lucifuges to modify 16 hours, DNA is modified, and unmethylated cytosine(Cyt) is modified to the sulfonated urine pyrimidine.
3, the purifying of dna modification product:
1), above-mentioned dna modification product is down used the distilled water dialysed overnight at 4 ℃, removes unnecessary sodium bisulfite;
2), take off sulfonation: it is 0.3M that adding 10M NaOH makes its final concentration, room temperature 20 minutes; Add in the 1M hydrochloric acid of equivalent again and NaOH, the sulfonated urine pyrimidine becomes uridylic after taking off sulfonation;
3), precipitation: add 10M ammonium acetate and 2 times of volume ethanol of 1/4th volumes, place-20 ℃ of precipitations to spend the night the dna modification product;
4), washing: centrifugal 10 minutes of 13000rpm, abandon supernatant, wash 2 times with 70% alcohol; Dry 10 minutes, add 20 μ lTE and make its dissolving, get the dna modification product of purifying, that is pcr template.
4, pcr amplification and check and analysis: with the design testing gene forward and reverse methylation-specific primer and not the methylation-specific primer carry out pcr amplification.
The PCR reaction system is as follows:
10x?PCR?buffer(without?MgCl
2) 2.5μl
MgCl
2(25mM) 2μl
dNTP(2.5mM) 2μl
Forward primer (20 μ M) 0.5 μ l
Reverse primer (20 μ M) 0.5 μ l
H2O 16μl
Taq enzyme (5u/ μ l) 0.5 μ l
Cumulative volume 25 μ l
Reaction conditions is as follows:
94 ℃ 3 minutes
72 ℃ 5 minutes
Check and analysis: pcr amplification product and standard substance are carried out detected through gel electrophoresis or dna sequencing analysis, just can determine the cytosine methylation degree of this gene.If wherein most gene generation abnormal methylation then just point out this patient may get corresponding cancer.
There is following shortcoming in this traditional detection method: 1, complex operation, and particularly in the sodium bisulfite modification, modification reaction is slow, and the time is long, needs 16-18 hour usually; 2, after the DNA sex change became strand, the base on the strand also can be matched mutually, and it is insufficient that base is exposed, thereby caused sodium bisulfite to be modified not exclusively, and experimental repeatability is not high, influences result's reliability; 3, after sodium bisulfite was modified, the dialysis desalting time was also very long, and workload is big, had therefore restricted the research of MS-PCR.But if dna methylation detection kit (the EZ DNA Methylation-Gold that adopts Zymo company to produce
TMKit), though easy to operate, detection time is short, cost an arm and a leg, and the pcr template that at every turn obtains can only be used for detections that methylate of 2 genes, has limited the carrying out of polygene detection, can not satisfy the needs of most experiments.
Summary of the invention
The invention provides the detection method of the dna methylation of a kind of with low cost, detection time of short, good reproducibility.
Operation steps of the present invention also mainly comprises preparation DNA to be measured, the modification of DNA sodium bisulfite, purifying and four steps such as pcr amplification and check and analysis, but the deficiency that the present invention is directed to traditional method has been done the improvement of following three aspects:
1, at long deficiency of sodium bisulfite dna modification time, adopt and add catalyzer TAC and Guanidinium hydrochloride acceleration modification reaction, DNA is accelerated under the effect of catalyzer and the sodium bisulfite reaction;
2, adopt repeatedly short time high temperature to unwind in the modification reaction, the base with abundant exposure DNA makes unmethylated cytosine(Cyt) be converted into the sulfonated urine pyrimidine, thereby improves the repeatability of experiment;
3, loaded down with trivial details dialysis desalting step when modifying back DNA purifying, adopt purification column to carry out purifying, DNA product after will modifying earlier is adsorbed on the purification column that glass fibre membrane or diatomite or pellosil make, wash desalination, desulfonate processing, washing and DNA wash-out more successively, thereby obtain the pcr template of the detection DNA gene methylation of purifying, can be directly used in pcr amplification, save the desalination time greatly.
Concrete steps are mainly:
1, prepares DNA to be measured: according to a conventional method.
2, the DNA sodium bisulfite is modified:
1), get 1 μ g DNA, be dissolved in the 20 μ l water 95 ℃ of water-baths 10 minutes; Be put in ice bath immediately; Add 2 μ l 10M sodium hydroxide, make the DNA sex change, become single stranded DNA;
2), add the sodium bisulfite decorating liquid (the 5M sodium bisulfite, the 10mM quinhydrones, 1mMTAC, the 0.3M Guanidinium hydrochloride, PH5.0) 230 μ l divide behind the mixing to install to three PCR pipes, the about 80-90 μ of every pipe l;
3), three PCR pipes put into the PCR instrument, the operation follow procedure carries out sodium bisulfite modification reaction (about 2.5 hours):
95 ℃ 20 seconds
Hold?at?4℃
Because the repeatedly short time high temperature in the modification reaction unwinds, base is exposed fully, so dna modification is more complete, unmethylated cytosine(Cyt) is modified to the sulfonated urine pyrimidine.
3, the purifying of dna modification product:
(1), adopt the UNIQ-10 post to carry out purifying: merge the above-mentioned dna modification solution of respectively managing, add 1ml 6M guanidine hydrochloride solution and be beneficial to absorption as wedding agent, behind the mixing solution is transferred in the UNIQ-10 post that is mounted in the 2ml collection tube, room temperature was placed 2 minutes.8, centrifugal 30 seconds of 000rpm room temperature is abandoned the waste liquid in the collection tube, and DNA is incorporated on the pillar;
(2), the washing: with lavation buffer solution (10mM Tris, PH=6.8,80% ethanol) washing 2 times, each 500 μ l, 8, centrifugal 30 seconds of 000rpm room temperature is abandoned washings;
(3), take off sulfonation:
1), take off sulfonation reaction: add 250 μ l and take off sulfonated liquid (containing 30% ethanol, 5% glycerine, 200mM NaOH, 100mM NaCl), take off sulfonation reaction, room temperature was placed 10 minutes.8, centrifugal 30 seconds of 000rpm room temperature is abandoned the waste liquid in the collection tube;
2), the washing: with lavation buffer solution (the same) washing 2 times, each 500 μ l, 8, centrifugal 30 seconds of 000rpm room temperature is abandoned washings;
4, wash-out:
The UNIQ-10 post is put into a new 1.5mlEP pipe, add TE (10mM Tris, the PH=8.0 of 30 ℃ of-80 ℃ of preheatings; 1mM EDTA) 35 μ l room temperatures are centrifugal, collect elutriant, and this is the dna solution after modifying, and promptly pcr template can be directly used in PCR, also can temporarily be stored in-20 ℃ standby.
5, pcr amplification and check and analysis:
The dna modification product that purifying is good with the forward and reverse methylation-specific primer of testing gene and not the methylation-specific primer carry out pcr amplification.Carry out the gel electrophoresis analysis pcr amplification product then.
The present invention compares short, good reproducibility detection time with traditional method; Compare with the agent box, with low cost, sodium bisulfite is modified also more complete, the result is more reliable, and the DNA output after the modification that obtains is far more than the method for test kit, and the present invention can detect and be no less than 15 genes, and the DNA output of test kit only enough detects 2 genes.
Description of drawings
Fig. 1 detects the gel electrophoresis spectrum of liver cancer sample p16 gene methylation for the present invention;
Fig. 2 is for detecting the gel electrophoresis contrast collection of illustrative plates of liver cancer GSTP1 gene methylation with the inventive method and traditional method, Zymo company methylating reagent cassette method.
Embodiment
Be that example elaborates to the present invention with p16 gene and GSTP1 gene in the detection liver cancer sample below, but present embodiment only is used to the present invention is described and is not used in restriction protection scope of the present invention.
Key instrument and reagent source:
Eppendorf Model 5415R, the little supercentrifuge of Centrifuges low temperature, Britain TECHNE company product; TC-512 grads PCR instrument, Britain Techne company product; The full-automatic ultraviolet of FR-200A and visible analytical equipment, company of Shanhai Furi Science and Technology Co., Ltd. product; Sodium bisulfite is available from traditional Chinese medicines group, and Guanidinium hydrochloride is available from traditional Chinese medicines group, and quinhydrones is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Testing sample is taken from the individual specimen of 3 liver cancer patients of east, Shanghai liver and gall hospital.The p16 gene has been proved to be in liver cancer hyper-methylation (Naoyuki Umetani has taken place, MichielF.G.de Maat, Eiji Sunami, Suzanne Hiramatsu, Steve Martinez, and Dave S.B.Hoon Methylation of p16 and Ras Association DomainFamily Protein 1a during Colorectal Malignant Transformation), but be not that hyper-methylation by a gene just can be diagnosed as liver cancer, liver cancer patient p16 gene that neither be all hyper-methylation can occur, and methylating of p16 gene only is one of reference index.Operation steps following (3 sample method are identical):
1, prepare DNA to be measured:
Get fresh liver tissue 50mg, extract DNA, the by specification operation with genome DNA extraction test kit (Xinsheng Gene Tech Co., Ltd., Shanghai No.2 Hospital).
2, the DNA sodium bisulfite is modified:
1), get 1 μ g DNA, be dissolved in the 20 μ l water 95 ℃ of water-baths 10 minutes; Be put in ice bath immediately; Add 2 μ l 10M sodium hydroxide, make the DNA sex change, become single stranded DNA;
2), add the sodium bisulfite decorating liquid (the 5M sodium bisulfite, the 10mM quinhydrones, 1mMTAC, the 0.3M Guanidinium hydrochloride, PH5.0) 230 μ l divide behind the mixing to install to 3 PCR pipes, the about 80-90 μ of every pipe l;
3), 3 PCR pipes are put into the PCR instrument, the operation follow procedure carries out the sodium bisulfite modification reaction:
95 ℃ 20 seconds
Hold?at?4℃
3, the purifying of dna modification product:
1), purifying: merge above-mentioned three pipe dna modification solution, add 1ml PH and be 5.0 6M guanidine hydrochloride solution and be beneficial to absorption as wedding agent, behind the mixing solution is transferred in the UNIQ-10 post that is mounted in the 2ml collection tube, room temperature was placed 2 minutes, 8, centrifugal 30 seconds of 000rpm room temperature is abandoned the waste liquid in the collection tube;
2), washing: add 500 μ l lavation buffer solutions (10mM Tris, PH=6.8,80% ethanol), 8, centrifugal 30 seconds of 000rpm room temperature is abandoned washings, adds 500 μ l lavation buffer solutions once more and cleans once;
3), take off sulfonation: add 250 μ l and take off sulfonated liquid (containing 30% ethanol, 5% glycerine, 200mM NaOH, 100mM NaCl) in above-mentioned UNIQ-10 post, room temperature was placed 10 minutes, 8, centrifugal 30 seconds of 000rpm room temperature is abandoned the waste liquid in the collection tube;
4), washing: add 500 μ l lavation buffer solutions (10mM Tris, PH=6.8,80% ethanol), 8, centrifugal 30 seconds of 000rpm room temperature is abandoned washings, adds 500 μ l lavation buffer solutions once more and cleans once.
5), wash-out: the UNIQ-10 post is put into a new 1.5mlEP pipe, add TE (10mM Tris, the PH=8.0 of 70 ℃ of preheatings; 1mM EDTA) 35 μ l, 12, centrifugal 2 minutes of 000rpm room temperature is collected elutriant, and this is the dna solution after modifying, i.e. pcr template.
4, pcr amplification and check and analysis:
1), pcr amplification:
According to P16 gene design and synthesis of methylation Auele Specific Primer and methylation-specific primer not, comprise forward primer and reverse primer (synthetic) by Shanghai lottery industry bio tech ltd:
Forward primer (MF): TTATTAGAGGGTGGGGCGGATCGC methylates
Reverse primer (MR): GACCCCGAACCGCGACCGTAA methylates
Expanding fragment length: 150bp
Forward primer (UF): TTATTAGAGGGTGGGGTGGATTGT does not methylate
Reverse primer (UR): CAACCCCAAACCACAACCATAA does not methylate
Expanding fragment length: 151bp
PCR is divided into 2 pipes and increases, an effective methylation-specific primer, and another effective not methylation-specific primer amplification, PCR reaction system following (wherein forward primer is represented with P1, and reverse primer is represented with P2):
10xPCR?buffer(without?MgCl
2)?2.5μl
MgCl
2(25mM) 2μl
dNTP(2.5mM) 2μl
P1(p16，20μM) 0.5μl
P2(p16，20μM) 0.5μl
H2O 16μl
Taq enzyme (5u/ μ l) 0.5 μ l
Cumulative volume 25 μ l
Reaction conditions is as follows:
94 ℃ 3 minutes
72 ℃ 5 minutes
Methylate and modify and the DNA of unmodified methylated the respectively primer and the primer amplification that do not methylate.
2), check and analysis:
Get amplified production 8 μ l respectively and carry out gel electrophoresis routinely, electrophoresis result is seen Fig. 1.Wherein the Marker size be 100,200,300,400,500,600,700,800,900,1000,1200,1500bp; M is the primer extension product that methylates; U is the primer extension product that do not methylate; 1,2, No. 3 samples are respectively the primer amplification band that do not methylate.As seen from Figure 1,1, No. 2 sample does not amplify band with the primer that methylates, and has only No. 3 samples to go out band with the primer amplification that methylates, and illustrates that the p16 gene that has only No. 3 samples is by part methylization.
Embodiment 2: the inventive method and traditional method, kit method detect the contrast experiment of GSTP1 gene methylation
According to GSTP1 gene design and synthesis of methylation Auele Specific Primer and methylation-specific primer not, comprise forward primer and reverse primer (synthetic) by Shanghai lottery industry bio tech ltd:
Forward primer (MF): TTCGGGGTGTAGCGGTCGTC methylates
Reverse primer (MR) methylates: GCC CCAATACTAAATCACGACG
Expanding fragment length: 101bp
Forward primer (UF): GATGTTTGGGGTGTAGTGGTTGTT does not methylate
Reverse primer (UR) does not methylate: CCACCCCAATACTAAATCACA ACA
Expanding fragment length: 101bp
PCR is divided into 2 pipes and increases, an effective methylation-specific primer, and another effective not methylation-specific primer amplification, PCR reaction system and condition are with embodiment 1 (wherein forward primer is represented with P1, and reverse primer is represented with P2).
One, experimental technique of the present invention is with embodiment 1.
Two, traditional method:
Key step is as follows:
1, the DNA sodium bisulfite is modified:
1), get 1 μ gDNA, be dissolved in the 20 μ l water, the DNA sex change becomes single stranded DNA, method is with embodiment 1;
2), the DNA sodium bisulfite is modified: add DNA sodium bisulfite decorating liquid (3M sodium bisulfite, 10mM quinhydrones, PH5.0) 230 μ l; Place 55 ℃ of lucifuges to modify 16 hours;
3), the purifying of dna modification product:
(1), the dna modification product under 4 ℃ to the distilled water dialysed overnight;
(2), take off sulfonation: it is 0.3M that adding 10M NaOH makes its concentration; Room temperature 20 minutes adds in the 1M hydrochloric acid and NaOH; Add ammonium acetate (10M) and 2 times of volume of ethanol of accounting for cumulative volume 1/4th, put-20 ℃ of deposit D NA and spend the night; Centrifugal 10 minutes of 13000rpm abandons waste liquid, again with 70% alcohol washing 2 times, and dry 10 minutes, add 20 μ lTE, make and modify good DNA dissolving.
4), pcr amplification:
Method is with embodiment 1.
Three, kit method
With the methylating reagent box that Zymo company produces, operation steps by specification.
(1), the modification of DNA:
1, get 500ng DNA sample (20 μ l) in the PCR pipe, add the CT (Conversion Reagent) of 130 μ l, sample hose is put into PCR instrument and operation according to the following steps:
(1), placed 10 minutes for 98 ℃;
(2), placed 2.5 hours for 64 ℃.
2, the purifying of dna modification product: the M-Binding Buffer that adds 600 μ l is in pillar, and post put into the Collection Tube that test kit provides, filling DNA sample is in the pillar that contains M-Binding Buffer, covering tight lid puts upside down post and comes for several times biased sample, at full speed (＞10,000xg) centrifugal 30 seconds.Remove waste liquid, the M-Wash Buffer that adds 100 μ l is in post.Centrifugal 30 seconds at full speed, remove waste liquid.
3, take off sulfonation: add 200 μ l M-Desulphonation Buffer in post and after room temperature (20 ℃-30 ℃) is down placed 15-20 minute centrifugal 30 seconds at full speed, abandon waste liquid; Add 200 μ lM-Wash Buffer in post, centrifugal 30 seconds at full speed, abandon waste liquid, add 200 μ l M-WashBuffer again, centrifugal 30 seconds, abandon waste liquid;
4, wash-out: directly add 10 μ l M-Elution Buffer in base for post matter, post is placed in the collection tube of 1.5ml, centrifugal at full speed, collect the DNA elutriant.
5, pcr amplification: get 2 μ l DNA elutriants and do template and carry out pcr amplification, method is with embodiment 1.
(2), electrophoresis detection comparative analysis: respectively get 8 μ l pcr amplification products and carry out gel electrophoresis respectively routinely, electrophoresis result is seen Fig. 2.Wherein the Marker size be 100,200,300,400,500,600,700,800,900,1000,1200,1500bp.M is the primer extension product that methylates; U is the primer extension product that do not methylate.A is the electrophoretogram of the inventive method, and B is the electrophoretogram of traditional method, and C is the electrophoretogram of Zymo company methylating reagent cassette method.From Fig. 2 as seen, sample 1,2,3 can go out dna fragmentation (101bp) with methylation-specific primer amplification not, can go out dna fragmentation with the methylation-specific primer amplification again, show 1,2, No. 3 sample all some GSTP1 gene methylated.3 kinds of method electrophoretogram unanimities illustrate that the inventive method is practicable.
Claims (3)
1, a kind of method of rapid detection dna methylation, comprise the steps: that the sodium bisulfite for preparing DNA to be measured, DNA is modified, purifying and the pcr amplification and the detection of dna modification product, it is characterized in that having added in the sodium bisulfite decorating liquid catalyzer TAC and Guanidinium hydrochloride, to quicken the sodium bisulfite modification reaction of DNA.
2, by the method for the described rapid detection dna methylation of claim 1, short time high temperature unwinds to it is characterized in that adopting repeatedly in the sodium bisulfite modification reaction process, and the base with on the abundant exposure DNA chain makes dna modification more complete.
3, by the method for the described rapid detection dna methylation of claim 1, comprise the steps:
1), prepares DNA to be measured;
2), the DNA sodium bisulfite is modified:
(1), make the DNA sex change, become single stranded DNA;
(2), add the sodium bisulfite decorating liquid, carry out DNA sodium bisulfite modification reaction:
3), the purifying of dna modification product;
4), pcr amplification and check and analysis;
It is characterized in that:
(1), containing final concentration in the described DNA sodium bisulfite decorating liquid is that 1mM catalyzer TAC and final concentration are the 0.3M Guanidinium hydrochloride;
(2), when the DNA sodium bisulfite is modified, on PCR, carry out repeatedly short time high temperature and separate chain reaction by follow procedure:
95 ℃ 20 seconds
Hold?at?4℃
(3), during the purifying of modified outcome, adopt the UNIQ-10 post to carry out purifying, add 1ml PH in the dna modification solution and be 5.0 6M guanidine hydrochloride solution and be beneficial to absorption as wedding agent, after DNA is adsorbed in the UNIQ-10 post, clean with lavation buffer solution successively, lavation buffer solution is: 10mM Tris, PH=6.8,80% ethanol; Take off sulfonation with taking off sulfonated liquid, take off sulfonated liquid and be: 30% ethanol, 5% glycerine, 200mM NaOH, 100mM NaCl; Again with above-mentioned lavation buffer solution washing; Use TE elutriant wash-out at last, thereby obtain detecting the pcr template of gene methylation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100384538A CN101285096A (en) | 2008-06-03 | 2008-06-03 | Process for quickly detecting DNA methylation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100384538A CN101285096A (en) | 2008-06-03 | 2008-06-03 | Process for quickly detecting DNA methylation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101285096A true CN101285096A (en) | 2008-10-15 |
Family
ID=40057509
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100384538A Pending CN101285096A (en) | 2008-06-03 | 2008-06-03 | Process for quickly detecting DNA methylation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101285096A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984069A (en) * | 2010-09-19 | 2011-03-09 | 生工生物工程(上海)有限公司 | Kit and method for rapidly detecting DNA methylation |
| CN103805699A (en) * | 2014-01-25 | 2014-05-21 | 山东大学齐鲁医院 | Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis |
| CN105567850A (en) * | 2016-02-26 | 2016-05-11 | 福建师范大学 | Reagent kit and method for quantitatively detecting RPRM gene DNA methylation |
| CN107922941A (en) * | 2015-06-15 | 2018-04-17 | 塞弗德公司 | The purifying and measurement and mutation and/or the common measurement of mRNA expressions of the integration of DNA methylation in reaction box is automated |
| CN108753968A (en) * | 2018-06-12 | 2018-11-06 | 广州和实生物技术有限公司 | A kind of kit for detecting cervical carcinoma PAX1 gene methylations |
| CN110267744A (en) * | 2016-12-12 | 2019-09-20 | 塞弗德公司 | The purifying and measurement and mutation and/or the common measurement of mRNA expression of the integration of DNA methylation in automation reaction box |
-
2008
- 2008-06-03 CN CNA2008100384538A patent/CN101285096A/en active Pending
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101984069A (en) * | 2010-09-19 | 2011-03-09 | 生工生物工程(上海)有限公司 | Kit and method for rapidly detecting DNA methylation |
| CN101984069B (en) * | 2010-09-19 | 2012-07-25 | 生工生物工程(上海)有限公司 | Kit and method for rapidly detecting DNA methylation |
| CN103805699A (en) * | 2014-01-25 | 2014-05-21 | 山东大学齐鲁医院 | Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis |
| CN107922941A (en) * | 2015-06-15 | 2018-04-17 | 塞弗德公司 | The purifying and measurement and mutation and/or the common measurement of mRNA expressions of the integration of DNA methylation in reaction box is automated |
| US11603555B2 (en) | 2015-06-15 | 2023-03-14 | Cepheid | Integrated purification and measurement of DNA methylation and co-measurement of mutations and/or MRNA expression levels in an automated reaction cartridge |
| CN105567850A (en) * | 2016-02-26 | 2016-05-11 | 福建师范大学 | Reagent kit and method for quantitatively detecting RPRM gene DNA methylation |
| WO2017143866A1 (en) * | 2016-02-26 | 2017-08-31 | 福建师范大学 | Kit and method for quantitative detection of dna methylation in rprm genes |
| CN105567850B (en) * | 2016-02-26 | 2019-03-12 | 福建师范大学 | For quantitative detection RPRM gene DNA methylating reagent box and method |
| CN110267744A (en) * | 2016-12-12 | 2019-09-20 | 塞弗德公司 | The purifying and measurement and mutation and/or the common measurement of mRNA expression of the integration of DNA methylation in automation reaction box |
| US11260387B2 (en) | 2016-12-12 | 2022-03-01 | Cepheid | Integrated purification and measurement of DNA methylation and co-measurement of mutations and/or mRNA expression levels in an automated reaction cartridge |
| CN108753968A (en) * | 2018-06-12 | 2018-11-06 | 广州和实生物技术有限公司 | A kind of kit for detecting cervical carcinoma PAX1 gene methylations |
| CN108753968B (en) * | 2018-06-12 | 2022-04-12 | 广州和实生物技术有限公司 | Kit for detecting methylation of cervical cancer PAX1 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2045335B1 (en) | Methods for the analysis of cellular proliferative disorders | |
| CN101285096A (en) | Process for quickly detecting DNA methylation | |
| JP2004516821A (en) | Method for quantifying the degree of methylation of specific cytosine in sequence context 5-CpG-3 on genomic DNA | |
| CN109456968B (en) | Methylation modification-based tumor markers | |
| JP7308956B2 (en) | Tumor marker STAMP-EP3 based on methylation modification | |
| JP2016501028A (en) | Label-free method for isolation and analysis of nucleic acids in solid phase devices | |
| CN102628082A (en) | Method for qualitatively and quantitatively detecting nucleic acid based on high-flux sequencing technology | |
| JP7399169B2 (en) | Tumor marker STAMP-EP4 based on methylation modification | |
| CN105567850A (en) | Reagent kit and method for quantitatively detecting RPRM gene DNA methylation | |
| JP7301136B2 (en) | Tumor marker STAMP-EP6 based on methylation modification | |
| EP2099938B1 (en) | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders | |
| JP2023118716A (en) | Methylation-based modified tumor marker stamp-ep8 and application thereof | |
| CN110283891B (en) | Detection method for detecting methylation of specific gene | |
| CN103031375B (en) | DNA (deoxyribonucleic acid) methylation detection kit and detection method | |
| CN110257526B (en) | Kit for detecting methylation of GP5 gene 5' end and detection method thereof | |
| ES2669439T3 (en) | Methods and nucleic acids for bladder carcinoma analysis | |
| JP2023175696A (en) | Tumor marker stamp-ep9 based on methylation modification and application thereof | |
| CN112513265A (en) | Targeted enrichment and sequencing of modified nucleic acids for human cancer detection | |
| EP3964581A1 (en) | Tumor marker stamp-ep7 based on methylated modification and use thereof | |
| CN101285097B (en) | Process for detecting DNA methylation of paraffin specimen | |
| CN104342494B (en) | It is prepared by the direction specific single-chain DNA that the chemical modification primer applied to pyrosequencing mediates | |
| CN113215258A (en) | Nucleic acid composition, kit and detection method for detecting methylation of colorectal cancer related genes | |
| WO2006064737A1 (en) | Method of detecting gene methylation and method of examining neoplasm by detecting methylation | |
| CN110541040B (en) | Method for detecting methylation level by using ARMS-PCR technology, primer and kit thereof | |
| CN114941028A (en) | Reagent and kit for detecting and diagnosing colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20081015 |