CN101281561A - Method for quantitative analyzing evolution of RNA structure steadiness - Google Patents

Abstract

The invention relates to a computer program, more specifically to a method for quantitatively analyzing the evolution of RNA structural robustness. The invention aims to provide a quantitative analytical method capable of analyzing RNA structural robustness simply, conveniently and quickly, solves the problem that RNA structural robustness is difficult to evaluate and quantify, reaches the objective of analysis of biological robustness origin and evolution thereof, thus improving the understanding of biological evolution. The invention is based on a RNA secondary structure as the research platform, provides a method for quantitatively analyzing the evolution of RNA structural robustness. The method comprises the steps of checking the validity of a RNA sequence inputted from a computer terminal, generating a control sequence, calculating RNA structural robustness, and quantitatively analyzing the evolution of the RNA structural robustness.

Description

A kind of method of evolution of quantitative analyzing RNA structure steadiness

Technical field

The present invention relates to a kind of computer program, more specifically, is a kind of method of evolution of quantitative analyzing RNA structure steadiness.

Background technology

Biological robustness is the most basic and ubiquitous a kind of phenomenon in the biosystem.Before it is understood to be in various interference surface, still can keep a kind of ability of stabilization function.According to the difference of jamming pattern whether (can heredity), robustness be divided into hereditary robustness and environment robustness.The heredity robustness is meant before the genetic mutation interference surface insensitivity of phenotype; And before the environment robustness is meant the interference surface of environmental factor externally, the insensitivity of phenotype.All the time, the biologist pays special attention to the research of biological robustness, studies the canalization research of Waddington from the dominance of Fisher.Studies show that, on each level of biosystem, all have robustness, comprise that gene expression, protein folding, metabolic flux, health self-care are regulated, growth, even cmot.The origin of robustness and evolution will help our understanding to biological evolution in the correct understanding biosystem.

The RNA secondary structure is a good platform of the biological robustness of research.In fact, there has been Many researchers to study robustness among RNA viruses, viroid and the microRNA.Although there is a lot of research to pay close attention to the evolutionary mechanism of robustness, up to now, the origin of robustness and evolution thereof still are not very clear.Cause the reason of this present situation, mainly owing in biosystem, being difficult to provide the quantitative analysis method that robustness is evolved.

Summary of the invention

The present invention aims to provide a kind of quantitative analysis method that can measure the evolution of RNA structure steadiness simply, quickly and easily, solve difficult, the quantitatively difficult problem of robustness evolution assessment, reach the origin of the biological robustness of analysis and the purpose of evolution thereof, improve understanding therefrom biological evolution.

In order to achieve the above object, the present invention is a research platform with the RNA secondary structure, a kind of method of evolution of quantitative analyzing RNA structure steadiness is provided in computer system, this method comprises legitimacy, generation control sequence, the calculating RNA structure steadiness of inspection from the RNA sequence of terminal input, the step of the evolution of quantitative analyzing RNA structure steadiness.

In a kind of method of evolution of quantitative analyzing RNA structure steadiness, the generation of control sequence is on the basis of selected disorder method, along the hamming distance of the RNA sequence of importing (length is l), adopt monte carlo method stochastic sampling N bar sequence, common property is given birth to l * N bar random series.The present invention has realized five kinds of disorder methods that produce control sequence altogether, specifically describes as follows:

● completely random: produce the random series that has equal length with list entries;

● single base scramble: the position of base in the random permutation sequence;

● double alkali yl scramble:, obtain double alkali yl scramble sequence according to the Erikson-Altschul algorithm.

● based on the scramble of zeroth order Markov model: single base frequency P (b) in the sequence of calculation.According to this frequency in the different base of each site stochastic sampling till the length that reaches list entries;

● based on the scramble of single order Markov model: the conditional probability P (a|b) that given base b base a occurs in the sequence of calculation.Select the base x in first site at random ₁, according to conditional probability P (x _I+1| x _i) select the base x in next site _I+1, till the length that reaches list entries;

In a kind of method of evolution of quantitative analyzing RNA structure steadiness, adopt the quantitative test index of neutral value as the RNA structure steadiness, neutral value is defined as

$\mathrm{\γ}=\frac{1}{3\×l}\underset{i=1}{\overset{3\×l}{\mathrm{\Σ}}}\frac{l-d_i}{l}---\left(1\right)$

Wherein, d _i, i=1,2 ..., 3 * l is the structure distance between RNA sequence and its i mutant sequence, l is the length of RNA sequence.Neutral value γ is big more, shows that this RNA sequence has the robustness of higher level.Structure between RNA sequence and its mutant sequence is divided into two kinds of situations apart from the calculating of d: under the situation of only considering the minimum free energy structure, d is the RNA sequence of employing different structure metric calculation and the distance of the minimum free energy structure between its mutant sequence, these degree of structuration measurings comprise the string editing distance, tree editing distance and base-pair distance; Under the situation of considering the suboptimum structure, d by the structural entity between RNA sequence and its mutant sequence apart from δ _mProvide.Structural entity is apart from δ _mBe defined as follows:

${\mathrm{\δ}}_m(x,y)=\underset{S,S^{\′}}{\mathrm{\Σ}}{p}_x\left(S\right)p_y\left(S^{\′}\right)\mathrm{\δ}(S,S^{\′})---\left(2\right)$

Wherein, p _x(S) be the equilibrium probability of structure S in the structural entity of sequence x, p _y(S ') is the equilibrium probability of structure S ' in the structural entity of sequences y, and δ (S, S ') is the distance of structure S and S '.

In a kind of method of evolution of quantitative analyzing RNA structure steadiness, the quantitative test of the evolution of RNA structure steadiness is to carry out along the hamming distance of the RNA sequence of input.Concrete operations are as follows: calculate the RNA sequence of input respectively and the robustness γ of the control sequence that produces along the hamming distance samples and

Wherein N is the number of the control sequence of generation on each hamming distance, and l is the length of the RNA sequence of input.Each hamming apart from j on, relatively γ and Υ ^j, the conspicuousness of the RNA sequence of analysis input robustness on each hamming distance is calculated the last corresponding p-value value of each hamming distance.And provide the curve of RNA structure steadiness with the hamming variable in distance, the i.e. quantitative analysis results of the evolution of RNA structure steadiness thus.Hamming apart from j on, the p-value value defined is

$p^j=\frac{M}{N+1}---\left(3\right)$

Wherein, M represents set

In, the number of the sequence more sane, i.e. set than the RNA sequence of input

In the number of the neutral value bigger than the value of γ.

Description of drawings

Fig. 1 is the The general frame of method of the evolution of a kind of quantitative analyzing RNA structure steadiness of the present invention;

Fig. 2 is the process flow diagram that calculates the evolution of RNA structure steadiness among Fig. 1;

Fig. 3 is the analysis result of the evolution of the structure steadiness of microRNA let-7 in the nematode.

Embodiment

Fig. 1 is the The general frame of the method for the evolution of a kind of quantitative analyzing RNA structure steadiness of the present invention.

To RNA sequence,, do validity checking according to the definition of RNA sequence from the terminal input.The RNA sequence is to take from alphabet A character string R=r ₁, r ₂..., r _n, wherein I=1,2 ..., n.To not meeting the list entries of this definition, then return and re-enter.Adopt the present invention, the example of analysis is that length is the sequence of the microRNA let-7 precursor of l=99 in the nematode:

UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGU

GAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

After to the RNA sequence checking legitimacy of importing from terminal, hamming distance along the RNA sequence of importing, the disorder method of the completely random in selected five kinds of disorder methods, adopt monte carlo method stochastic sampling N=1, article 000, random rna sequence, common property is given birth to l * N=99,000 random rna sequence.

To the RNA sequence microRNA let-7 and the last contrast RNA sequence of each hamming distance thereof of input, calculate their structure steadiness, Fig. 2 has provided the process flow diagram that calculates the evolution of RNA structure steadiness.To every RNA sequence, because each site has four bases

Available, remove itself, can produce three mutant in each site.For example, to the microRNA let-7 precursor sequence of input, the base U in its first site can sport other three base A, C and U, and such three mutant sequences are:

Site mutation body sequence

AACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCA

1

CCGGUGAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

CACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCA

1

CCGGUGAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

GACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCA

1

CCGGUGAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

Utilize the folding program RNAfold of RNA secondary structure of standard, the RNA sequence of input and three mutant sequences (having 3 * l mutant sequence) in each site thereof are folded into corresponding secondary structure.If only consider the minimum free energy structure, utilize the RNA secondary structure distance metric program RNAdistance of standard, selected distance tolerance (string editing distance, tree editing distance or three kinds of distance metrics of base-pair distance), the RNA sequence of calculating input and the structure between its each mutant sequence are apart from d.If consider the suboptimum structure, then utilize the RNA secondary structure overall distance tolerance program RNApdist of standard, the RNA sequence of calculating input and the structural entity between its each mutant sequence are apart from δ _mAfter the structure distance that obtains between RNA sequence and its mutant sequence,, calculate 3 * l mutant sequence

I=1,2 ..., the value of 3 * l is added up their mean value, promptly obtains the neutral value γ of defined RNA sequence in (1) formula.

In a kind of method of evolution of quantitative analyzing RNA structure steadiness, according to top flow process, calculate the RNA sequence of input and the robustness γ of the control sequence that produces along the hamming distance samples and

Wherein N is the number of the control sequence of the last generation of each hamming distance, and l is the length of the RNA sequence of input.Subsequently, analyze the evolution of RNA structure steadiness.On each hamming distance, according to formula (3), calculate the last corresponding p-value value of each hamming distance, and provide the analysis result of the evolution of RNA structure steadiness thus.What Fig. 3 showed is the analysis result of the evolution of the structure steadiness of microRNA let-7 in the nematode.

The present invention adopts the structure steadiness of neutral value qualitative assessment RNA molecule, can be simply, the quantitative analyzing RNA structure steadiness is along with the evolution of hamming distance quickly and easily, and RNA is evolved has important significance for theories and practical value.

Claims (5)

1. the method for the evolution of a quantitative analyzing RNA structure steadiness is characterized in that described method comprises the following steps:

1) receives the RNA sequence of importing from terminal (length is l), differentiate the legitimacy of this sequence;

2) select disorder method, on each hamming distance, generate corresponding control sequence;

3) according to the definition of neutral value, the RNA sequence of calculating input and each hamming thereof are apart from the neutral value of last control sequence;

4) evolution of quantitative analyzing RNA structure steadiness.

2. the method for the evolution of a kind of quantitative analyzing RNA structure steadiness according to claim 1, wherein said disorder method, it is characterized in that it comprises that completely random, single base scramble, double alkali yl put, amount to five kinds of method of randomization that produce control sequence based on the scramble of zeroth order Markov model with based on the scramble of single order Markov model.

3. the method for the evolution of a kind of quantitative analyzing RNA structure steadiness according to claim 1, wherein said neutral value is characterized in that, the structure in its definition between RNA sequence and its mutant sequence is divided into two kinds of situations apart from the calculating of d:

1) under the situation of only considering the minimum free energy structure, the structure between RNA sequence and its mutant sequence is apart from d, and by the string editing distance of the minimum free energy structure between RNA sequence and the mutant sequence, tree editing distance or base-pair distance provide;

2) under the situation of considering the suboptimum structure, the structure between RNA sequence and its mutant sequence apart from d by the structural entity between RNA sequence and its mutant sequence apart from δ _mProvide.

4. the situation of consideration suboptimum structure according to claim 3 is characterized in that, it is meant consideration all suboptimum structures in the minimum free energy 1kcal/mol of RNA sequence of importing and mutant sequence.

5. the method for the evolution of a kind of quantitative analyzing RNA structure steadiness according to claim 1, the evolution of wherein said quantitative analyzing RNA structure steadiness, it is characterized in that its result is provided with the curve of hamming variable in distance by the p-value value of the conspicuousness of the structure steadiness of the RNA sequence of input.

Images