CN101280318B - Recombinant human HNP gene liposome complex, preparation and use thereof - Google Patents

Abstract

The invention relates to a recombinant human HNP gene liposome complex, the preparation method and the usage thereof, which belong to the gene therapy field. The utility model solves the technical problem that a new tumor gene therapeutic drug is provided. The eukaryotic expression vector contains coding genes which can express human alpha-defensin mature peptide, and can be prepared into liposome complex. The eukaryotic expression vector and the liposome complex thereof can express in a tumor and excrete human alpha-defensin mature peptide with cytotoxic activity, thus plays an obvious role of anti-tumor effect, the default that the activity of the human alpha-defensin mature peptide is easy to be influenced by serum protein and calcium ion concentration is avoided, thus the invention provides a new choice for the gene therapy of the tumor.

Description

Recombinant human HNP gene liposome complex, Preparation method and use

Technical field

The present invention relates to field of gene, be specifically related to recombinant vectors, the liposome complex of α-alexin (HNP) mature polypeptide coding sequence, and preparation method thereof and purposes.

Background technology

Human alpha alexin (α-alexin) is interior cation activity polypeptide (the Human neutrophil peptides of AG that derives from people's neutrophilic granulocyte, HNPs), molecular weight is 4～5KD, contain 6 conservative cysteine residues, form 3 typical intramolecular disulfide bonds (Ganz and Lehrer 1995).At present α-alexin (HNPs) of finding has four kinds, but the performance major function mainly contain three kinds: HNP1, HNP2, HNP3, gene structure can roughly be divided into three parts, respectively coded signal peptide, precursor peptide and mature peptide.With HNP1 is example, the polypeptide (prepro-HNP1) of at first synthetic 94 amino-acid residues, obtain 45 amino acid whose precursor peptide sections after signal peptide is cut, derived from the nickase excision of myeloid cell, what generate finally that 30 amino acid constitute has an active positively charged ion mature peptide (Valore and Ganz 1992).

External, HNPs has the germ resistance of wide spectrum, comprising bacterium, and fungi, and some viruses (Selsted andOuellette 2005).Studies show that in recent years shows cytotoxicity (Lichtenstein, Ganz et al.1988 at external HNPs to kinds of tumor cells; Aarbiou, Tjabringa et al.2006), HNPs can destroy cytolemma and then cause the irreversible damage of cell, behind the permeability changes of cytolemma, HNPs enters in the cell immediately, the effect of its secondary damage of performance in born of the same parents, HNPs is in cracking even even more important (Lichtenstein 1991) of intracellular damaging action for tumour cell.And exist many difference between normal cell and the tumour cell, the surface of cell membrane of tumour cell has more negative charge than Normocellular surface of cell membrane, and there is a large amount of microvilluss at tumor cell surface, it is long-pending to have increased surface of tumor cells, make more alexin can be incorporated into the cytolemma of tumour cell, special relatively performance antitumor action (Zwaal and Schroit 1997).But these in vitro studies find that HNPs is subjected to serum protein easily and the Ca ionic concn influences and inactivation, thereby thinks that HNPs is difficult to be used in vivo tumor treatment, and (Lichtenstein 1991; Aarbiou, Tjabringa et al.2006).

As antibacterial peptide, HNPs not only plays a role in innate immunity, and similarly it can also regulate the acquired immunity (Selsted and Ouellette 2005) of body.Except direct killing activity, the monocyte that HNP1 can the chemotactic mankind, T cell and immature dendritic cell (Territo, Ganz et al.1989; Yang, Chen et al.2000), and these cells and tumour immunity are closely related.HNP1-3 can also increase tumour necrosis factor alpha (TNF-α), reduce interleukin-11 0 (the IL-10) (Chaly that monocyte produces, Paleolog et al.2000), the TNF-α that raises can inducing tumor cell apoptosis, and the IL-10 of downward modulation has reduced the immunosuppression of IL-10 mediation.Nearest studies show that, HNPs (the Hubert that in the tumour of virus infection, may play a role, Herman et al.2007), also may influence the propagation (Muller of kidney cancer cell, but still do not have evidence to show that HNPs can mediate antineoplastic immune at present Markovic-Lipkovski et al.2002).

Fiberonectin (FN) and acceptor integrin alpha 5 β 1 (integrin α 5 β 1) are the relevant important albumen of the outer mechanism of the born of the same parents of vasculogenesis.There are some researches show that at present HNPs can be by influencing combining of FN and integrin α 5 β 1, and then influence that endotheliocyte adheres to and endothelial cell proliferation is regulated vasculogenesis, and can suppress retinal vessel hyperplasia (Economopoulou, Bdeir et al.2005) due to the diabetes.But still not studying report HNPs at present can suppress tumor-blood-vessel growth and then suppress tumor growth.

In fact, the HNPs that above-mentioned research is adopted is main manually to extract the restriction that HNPs not only is subjected to the cell source directly from people's neutrophil leucocyte extraction, and the HNPs that is extracted also is the mixture of HNP1-3, be difficult to separately, obtain active than strong monomer with three kinds of main effective constituents.External artificial synthetic HNPs is the cost costliness not only, and the activity of polypeptide also remains to be confirmed.And, and have the unstable that is subjected to serum protein and the influence of Ca ionic concn easily because the effect of HNPs polypeptide presents concentration relies on, make the HNPs polypeptide be difficult to be developed and be used for clinical treatment as medicine.Because the maturation of HNP1 relates to the processes such as shearing modification of polypeptide, use carrier loading gene fragment to enter to express in the body and bring into play its effect and have very big uncertainty.At present do not utilize HNP1 gene design genomic medicine to be used for the report of oncotherapy yet.

The present main policies of gene therapy for cancer concentrates on three aspects, and the one, introduce the tumor death regulatory gene, as p53, the 2nd, introduce the gene that suppresses tumor vascular growth, as endostatin, the 3rd, introduce immunogene, as IL-2.The validity of introducing apoptogene and angiogenic growth suppressor gene is confirmed by most institutes, but the performance of its effect must depend on transfection efficiency and inhibiting lasting performance efficiently, and the advantage that adopts immunogene only need to be part transfection tumor cell to get final product the induced tumor immunity, but under the bigger situation of tumor load, produce little effect, therefore, an ideal strategy of gene therapy at present is the ideal candidates gene that obtains to have dual or multiple action.

Summary of the invention

First technical problem that the present invention will solve provides a kind of carrier for expression of eukaryon.This carrier for expression of eukaryon contains and can expressing human α-alexin mature peptide encoding gene.

Wherein, above-mentioned carrier for expression of eukaryon is recombinant phage vector, adenovirus carrier or plasmid vector.Because there is certain antivirus action in people's α-alexin (HNP) mature peptide, so the preferred plasmid vector that uses.

Further, above-mentioned plasmid vector is pSecTag2B or pcDNA3.1.

Wherein, the encoding sequence of above-mentioned people α-alexin mature peptide is shown in SEQ ID NO.1 (being the encoding sequence of HNP1 mature peptide) or SEQ ID NO.2 (for the encoding sequence of HNP3 mature peptide).

Further, 5 ' of the α in the above-mentioned expression vector-alexin mature peptide encoding gene end is connected with immunoglobulin (Ig) signal peptide encoding gene or cytokine signaling dna encoding peptide.

Wherein, above-mentioned immunoglobulin (Ig) signal peptide encoding gene is preferably the encoding gene that the encoding gene of human IL-2's secreting signal peptide, above-mentioned cytokine signaling dna encoding peptide are preferably immunoglobulin (Ig) kappa chain (the following Ig K that all is called for short) signal peptide.

The HNP1 fusion gene sequence that has connected the IgK signal coding sequence is (SEQ ID NO.3):

ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCA CTGGTGACGCGGCCCAGCCGGCCGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTATGGAACCTGCATCTACCAGGGAAGACTCTGGGCATTCTGC?TGCTGA

Wherein, underscore partly is an Ig K signal coding sequence.

The HNP1 fusion gene sequence that has connected the IL-2 signal coding sequence is (SEQ ID NO.4):

ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGA ATTCGGCCGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTATGGAACCTGCATCTACCAGGGAAGACTCTGGGCATTCTGCTGCTGA

Wherein, underscore partly is the IL-2 signal coding sequence.

Further, above-mentioned carrier for expression of eukaryon has the nucleotide sequence shown in the SEQ ID NO.5.

Second technical problem to be solved by this invention provides the method for the above-mentioned carrier for expression of eukaryon of preparation.This method may further comprise the steps: a, amplification obtains people α-alexin mature peptide encoding gene fragment from total RNA of human lymphocyte; B, change over to people α-alexin mature peptide encoding gene fragment in the carrier for expression of eukaryon and place and express after the starting element.

The 3rd technical problem to be solved by this invention provides the liposome complex of above-mentioned carrier for expression of eukaryon.The preferred cationic-liposome that uses.

Further, the liposome in the above-mentioned liposome complex is that 1: 1 DOTAP and Chol forms by mol ratio, and the mass ratio of liposome and carrier for expression of eukaryon is preferably 3～5: 1.

The 4th technical problem to be solved by this invention provides the method for the above-mentioned liposome complex of preparation.This method may further comprise the steps: the ion liposome is mixed with recombinant vectors; Place liquid nitrogen to cool off rapidly, taking-up is put into 4 degrees centigrade of refrigerators and is treated its thawing, multigelation 1～6 time then; After freeze thawing finishes, put into the freeze drier freeze-drying, promptly.

The 5th technical problem to be solved by this invention provide above-mentioned carrier for expression of eukaryon or liposome complex in the purposes of preparation in the antineoplastic pharmaceutical compositions.

The 6th technical problem to be solved by this invention provides a kind of pharmaceutical composition.This pharmaceutical composition be by above-mentioned carrier for expression of eukaryon or liposome complex add pharmaceutically acceptable complementary composition and be prepared from.This pharmaceutical composition can play antineoplastic action by promoting apoptosis of tumor cells, suppressing tumor vascular growth and induced tumor immunity mainly by drug administration by injection.

Need to prove, produce among the present invention and the correlation technique of operation recombination, recombinant vectors and antitumor injection is that the technology of the description that can finish according to disclosed operational guidance and handbook of those skilled in the art is finished.

The present invention adopts signal peptide gene sequence with secreting function and the people α-alexin mature peptide encoding gene gene fusion construct with cytotoxicity, and use the fusion gene construction recombination plasmid, implement gene therapy, directly the people α-alexin mature peptide gene that merges is introduced tumour cell inside, confirmed and to have expressed people α-alexin mature peptide that justacrine has killing activity in inside tumor, people α-alexin the mature peptide of expressing has produced obvious antineoplastic, avoided the shortcoming that people α-alexin mature peptide activity is subject to serum protein and the influence of Ca ionic concn, reduced the treatment cost, this area is thought and can not be adopted the HNPs polypeptide to implement the judgement of tumour interior therapeutic before having broken through.And provide the foundation for carrying out complex therapy in conjunction with other oncotherapy means on this basis.It is to bring into play the promotion apoptosis of tumor cells that the present invention has also optimized ripe peptidyl 1 (HNP1) gene of α-alexin, suppresses tumor-blood-vessel growth and mediates the desirable effector of the multiple action of tumour immunity.The present invention utilizes the liposome complex of HNP1 mature polypeptide coding sequence recombinant vectors that different types of tumors is carried out gene therapy, confirm that HNP1 can express justacrine outside tumour cell in tumour cell, the HNP1 that expresses can effectively promote apoptosis of tumor cells in vivo and in vitro, and can suppress tumor vascular growth in vivo, the more important thing is, the DNA liposome complex that the present invention obtains can induce to produce special antineoplastic immune in vivo, strengthens and prolonged the treatment curative effect.The liposome complex of while HNP1 mature polypeptide coding sequence recombinant vectors of the present invention, improved the transfection efficiency of genomic medicine, can use repeatedly, the toxicity of street virus carrier and shortcoming that can not prolonged and repeated use have been avoided, made things convenient for further clinical application, and because multiple-effect, especially its immunological effect of its treatment, make it in oncotherapy, only need transfection part tumour cell can produce therapeutic action, thereby provide the ideal genomic medicine for treatment for cancer.

Description of drawings

Fig. 1 HNP1 total length and ripe segmental PCR product.M, marker; 1, total length HNP1 PCR product, the about 280bps of full length fragment; 2, ripe HNP1 PCR product, fragment adds the about 120bps of signal peptide that primer is introduced.

Fig. 2 goal gene is connected to pSecTag2B, the electrophoretogram (1%Agarose electrophoresis) of PCR checking, and wherein: M is marker, 1 is the HNP1 gene fragment from the people of recombinant plasmid amplification.

Fig. 3 verifies that recombinant plasmid is secreted into the expression amount of HNP1 in the cell conditioned medium behind the expression of rna level and transfection recombinant plasmid.The expression of A:RNA level.B:ELISA detects the expression amount of HNP1 in the cell conditioned medium.The Untreated group refers to reorganization not implemented to intervene.

Fig. 4 immunohistochemical methods detects HNP1 in the intracellular expression of A549 and to the influence of A549 cell.A: after transfection pSec-HNP124 hour, the part cell performance HNP1 positive, and the dead cell of a high-visible part.B: transfection pSec-HNP1 is after 48 hours, and it is few than 24 hours that HNP1 expresses positive cells, and still dead cell is showed increased but.C, D: transfection pSecTag and untreated cell (untreated) do not have the HNP1 positive, and cell growth state is good.

The external HNP1 inducing apoptosis of tumour cell of Fig. 5.Hoechst 33258 coloration results show, transfection the cell of the pSec-HNP1 apoptotic body (A-a) that shows pyknosis and contain nuclear fragment, and transfection pSecTag (A-b), lipofectAMINE 2000 (B-c), and untreated (untreated group, B-d) cell does not then almost have apoptotic cell.The fluidic cell detected result further shows, cell transfecting pSec-HNP1 (C-a), pSecTag (C-b), LipofectAMINE 2000 (C-c), and do not process (untreated) (C-d) after, apoptosis rate is respectively 45.7%, 18.2%, 4.1%, and 3.6%.

The intravital anti-tumour effect of Fig. 6 HNP1.A is the A549 nude mice model, and B is a 4T1 mammary cancer Balb/c model.The result shows that the pSec-HNP1 treatment group is compared with PBS group nude mice with pSecTag and shown tangible tumor growth inhibition.

Fig. 7 histologic analysis and apoptosis detect.H﹠amp; The E coloration result shows that control group (pSecTag and PBS) growth of tumour cell is in good condition, and necrosis and lymphocytic infiltration are seldom arranged.In treatment group (pSec-HNP1) tumor tissues, tangible lymphocytic infiltration and necrosis are arranged then; The immunohistochemical staining result shows that HNP1 expresses the positive in treatment group (pSec-HNP1) tumour cell, and control group does not then have the expression of HNP1.TUNEL result is shown to the apoptosis of tumor cells for the treatment of with pSec-HNP1 obviously to be increased.

Capillary blood vessel immunohistochemical observation in Fig. 8 tumor tissues.A, pSec-HNP1; B, pSecTag; C, PBS; D, the capillary blood vessel counting, the tumor tissues microvessel density in pSecc-HNP1 treatment nude mice source obviously descends.

Fig. 9 pSecc-HNP1 induces at Balb/c mouse 4T1 model and produces special cellular immunization. ⁵¹The Cr release experiment shows that the T cell that derives from HNP1 treatment mouse compares with vehicle group and physiological saline treatment group, has the special killing activity of enhanced.

Figure 10 pSecc-HNP1 induces the host to produce antibody response at the 4T1 tumour cell.1 be the vehicle treated group in contrast, 2 for the mice serum that tumor growth is subjected to obvious inhibition occurring after the pSecc-HNP1 processing, 2 for the mice serum of tumor regression occurring after the pSecc-HNP1 processing, the result shows, can produce antibody after the pSecc-HNP1 treatment mouse 4T1 tumour.

The invention will be further described below in conjunction with the description of accompanying drawing by embodiment, but this is not a limitation of the present invention, those skilled in the art are according to basic thought of the present invention, can make various modification or improvement, only otherwise break away from basic thought of the present invention, all within the scope of the present invention.

Embodiment

The structure of embodiment one recombinant vectors of the present invention

Present embodiment is with the RT-PCR method HNPs fragment that increases from the total RNA of human lymphocyte, adopt the molecular cloning means that fusion gene cloning is arrived destination carrier, because HNP1 and HNP2 have high similarity, the Gene Bank of NCBI is appointed as same gene at present, be HNP1, so the present invention has cloned and has made up HNP1 mature peptide and HNP3 mature peptide fusion gene recombinant plasmid, is example with HNP1:

Design and synthesize the RT-PCR primer according to people HNP1 gene order, the PCR product directly inserted cloning vector-T carrier (available from Promega company), adopt primer sequence as follows:

Total length HNP1 upstream primer (SEQ ID NO.6) is (full-HNP1-forward):

5’-ATAGGATCCGCCATGAGGACCCTCGC?CATCCTTG-3’。

Total length HNP1 downstream primer (SEQ ID NO.7) is (full-HNP1-reverse):

5’-GAGATATCAGCAGCAG?AATGCCCAGAGTC-3’。

Ripe HNP1 upstream primer (SEQ ID NO.8) (mHNP1-forward) is:

5’-GCGGCCCAGCCGGCCgcctgct?attgcagaata-3’。

Ripe HNP1 downstream primer (SEQ ID NO.9) (mHNP1-reverse) is:

5’-GAGATATCAGCAG?CAGAATGCCCAGAGTC-3’。

RT-PCR reaction conditions: 50 ℃ of 30min; 94 ℃ of 4min; 94 ℃ of 30s, 52 ℃ of 30s, 72 ℃ of 30s, 30 circulations, 72 ℃ of 5min.PCR reaction conditions: 94 ℃ of 4min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations, 72 ℃ of 5min.On the amplification mature peptide gene fragment, downstream primer is introduced Sfi I and EcoRV restriction enzyme site respectively.

The HNP1 mature peptide coding gene sequence that amplifies is shown in the SEQ ID NO.1.

After reaction was finished, 1% agarose gel electrophoresis detected the RT-PCR product, the result show amplify with expect clip size consistent 100 ⁺Dna fragmentation about bps (Fig. 1).Subsequently above-mentioned fragment enzyme is cut rear clone to pSecTag2B, utilize above-mentioned mature peptide primer PCR checking earlier, the result can amplify purpose fragment (Fig. 2), confirm through the order-checking of Invitrogen company again, the HNP1 mature peptide gene order that shows the fusion in the resultant recombinant plasmid is consistent with expection, and is connected in after the Ig K secreting signal peptide that pSecTag2B carries acquisition recombinant plasmid pSecTag2B-HNP1, hereinafter to be referred as pSec-HNP1, its complete sequence is shown in SEQID NO.5.The present invention adopts expression vector pcDNA3.1 to make up the integrative gene expression vector that merges IL-2 secreting signal peptide and α-alexin mature peptide with similar approach.

Adopt method similarly, obtain the gene of HNP3 mature peptide, its sequence is shown in SEQ ID NO.2.And connect after the Igk secreting signal peptide that pSecTag2B carries, obtained the recombinant plasmid pSecTag2B-HNP3 of HNP3, hereinafter to be referred as pSec-HNP3.

Then, by relatively pSec-HNP1 and pSec-HNP3 utilize active stronger reorganization fusion gene among mtt assay screening pSec-HNP1 and the pSec-HNP3 to the inhibition activity of different tumour cells.

Experimental technique: can go endotoxic qiagen plasmid extraction agent box to prepare plasmid on a small scale the recombinant plasmid employing that obtains, the plasmid that obtains is quantitative.Adopt A549 cell, mouse CT26 and 4T1 cell shop by 96 orifice plates respectively, every porocyte 1 * 10 ⁴Individual, the cell attachment growth is after 8 hours, the lipofectine2000 of the Invitrogen company transfection reagent box difference transfection pSec-HNP1 or the pSec-HNP3 that utilize the merchant to sell, every hole changes plasmid 5ng, 10ng and 20ng over to, each concentration three multiple hole, three kinds of tumour cells of every kind of equal transfection of plasmid adopted mtt assay to detect the tumor growth situation respectively at 24 hours, 48 hours after the transfection.

Experimental result: the MTT experimental result shows that pSec-HNP1 is better than pSec-HNP3 to the inhibition activity of tumour, so the present invention mainly adopts pSec-HNP1 to prepare liposome complex in the following embodiments and carries out compliance test result.

The liposome complex of embodiment two preparations recombinant vectors of the present invention

At first utilize QIAGEN company to remove the extraction test kit extracting pSec-HNP1 and the pSecTag2B vector plasmid and quantitative of endotoxic a large amount of plasmids.

The liposome complex for preparing HNP1 mature peptide recombinant vectors then by the following method.

Obtain liposome: accurately take by weighing DOTAP 58mg, cholesterol Chol 32mg (mol/mol=1: 1), revolve in 100ml and to steam in the bottle, add the dissolving of 20ml chloroform, afterwards on rotatory evaporator rotary evaporation 45 minutes to remove chloroform, place Vacuumdrier after dry 12 hours, take out, add a certain amount of 5% glucose solution, 60 degrees centigrade of following probes ultrasonic (power is 400W) 10 minutes, gained liquid is continued to hatch 1 hour down at 60 degrees centigrade, promptly.

The preparation lyophilized injectable powder: with cationic-liposome and HNP1 recombinant plasmid according to mass ratio 2～10: 1 mixes in the freeze thawing pipe, place liquid nitrogen to cool off rapidly the freeze thawing pipe afterwards, take out after 10 seconds, put it at once in 4 degrees centigrade of refrigerators and treat its thawing, so multigelation is 4 times.After last freeze thawing finishes, all move into liquid in the cillin bottle, again to wherein add 20% formula mannitol injection liquid (guarantee N.F,USP MANNITOL quality in the final system be no more than total mass 5%), at last liquid is put into the freeze drier freeze-drying, promptly get pSec-HNP1 liposome DNA mixture, adopt identical method to prepare of the reference substance use of the liposome complex of pSecTag2B carrier as later experiments.

The mensuration of plasmid DNA encapsulation rate is also calculated plasmid concentration: the glucose of lyophilized powder employing 5% redissolves in the back immigration centrifuge tube, 10000rpm is centrifugal, get supernatant, survey absorption value under the 260nm, that is: encapsulation rate=OD260 (supernatant liquor)/OD260 (before the parcel) * 100% calculates the amount of recombinant plasmid on this basis and carries out next step experimentation on animals.

In the preparation of liposome complex, the present invention passes through encapsulation rate, the stability of liposome complex under solution state, and the ratio of liposome and recombinant vectors is estimated in three aspects of transfection efficiency.What draw liposome and recombinant vectors is weight ratio 3～5: 1 than the ratio of greater inequality example, and optimum proportion is 3: 1.In view of the present invention in testing has in vivo all taked this liposome complex, in following example, if not specify, still refer to corresponding liposome complex with pSec-HNP1 and pSecTag, wherein the ratio of liposome and recombinant vectors was weight ratio 3: 1.

Experimental example three. recombinant vectors of the present invention is at external ability to express and anti-tumor activity

1, the detection of recombinant vectors expression of the present invention:

With recombinant plasmid transfection A549 cell, collecting cell extracts RNA and is RT-PCR after 48 hours, have only transfection the cell of pSec-HNP1 plasmid can amplify HNP1 mature peptide gene fragment, and the simple pSecTag plasmid of transfection, and the RNA of the A549 cell of untransfected can not amplify purpose band (Fig. 3 A).

For the expression amount of HNP1 in the secretion that detects HNP1 and the supernatant, 24,48 hours collecting cell supernatants respectively detect by ELISA after transfection.The result shows, after the transfection in 24 hours supernatants the amount of HNP1 be about 102ng/ml, the amount of 48 hours HNP1 mature peptides is about 120ng/ml after the transfection, cellular control unit does not then have the expression (Fig. 3 B) of HNP1 mature peptide.

2, the anti-tumor activity of recombinant vectors of the present invention detects

At first detected the expression of HNP1 mature peptide in born of the same parents, found that 24 hours HNP1 mature peptides promptly have obvious expression after transfection by the immunohistochemical methods method, promptly observed at 48 hours positive cell obvious apoptosis (Fig. 4, A-B).Further by Hoechst 33258 dyeing, from view of morphology find transfection the tumour cell of pSec-HNP1 obvious apoptosis feature, i.e. pyknosis are arranged, formation contains apoptotic body (Fig. 5 of nuclear fragment, A-a), flow cytometer detect apoptosis obviously increase (Fig. 5, B-a)

The expression in vivo activity and the anti-tumor activity of experimental example four liposome complexes of the present invention

1, experimental technique

At first set up human lung cancer cell A549 nude mice tumor model.Adopt pSec-HNP1 and pSecTag single therapy tumour then; dosage is 20 μ g; 50 μ g; 100 μ g; treatment back the 3rd day results tumour; detect the expression of HNP1; after in confirming knurl, the expression of HNP1 being arranged, make up the Balb/c tumor model of human lung cancer cell A549 nude mice tumor model and mouse breast cancer 4T1 respectively, be divided into 3 groups respectively: PBS or physiological saline (n.s) treatment group; empty carrier group (pSecTag) and HNP1 genome; every group 10; when the about 3-5mm of diameter of tumor, treated, intratumor injection 100mg vector plasmid or HNP1 gene liposome, treatment in 2 days is once; treat altogether 5 times, observe the tumour size.

2, experimental result

The expression of HNP1 was promptly arranged behind intratumor injection pSec-HNP1 in 24 hours, the local expression of HNP1 is not only highly enriched in tumour cell, can also effectively be secreted into the intercellular substance, and porous is in tumor vessel, be attached on the tumor vessel wall, can observe the apoptosis of tumour cell at 48 hours, and can observe and knurl week lymphocytic infiltration is arranged, the expression of HNP1 presents certain dosage and relies on.Each group of experimental session is not all observed tangible toxic side effects.

PSec-HNP1 treatment group tumor growth rate is considerably slower than empty plasmid group, PBS or n.s group, occurs part tumour tumour after treatment in the treatment and disappears fully, and the growth of part mouse tumor obviously suppresses (Fig. 6, A are the A549 model, and B is the 4T1 model)

Experimental example five liposome complexes of the present invention are anti-tumor experiment in vivo.

1, experimental technique

Method by experimental example four is set up tumor model, implement treatment, treatment finishes one week of back, the results tumor tissues, the HNP1 mature peptide that detects the liposome complex expression of injection promotes the effect of tumor death, HE dyeing detects form, necrosis or the apoptosis situation of treatment back tumour inner tumour cell, and immunohistochemical methods detects the expression of HNP1 mature peptide, further adopts the TUNEL method to detect level of apoptosis.

Detect the restraining effect of vasculogenesis: the results tumor tissues, utilize CD31 antibody test intratumoral vasculature to generate situation respectively, calculate tumor vessel density, relatively vessel density difference in the knurl.

In Balb/c mouse 4T1 tumor model, detect the immunization after the HNP1 treatment, the splenocyte action effect cell of results treatment back Balb/c mouse, with 4T1 as target cell, ⁵¹Cr release experiment vitro detection splenocyte is to the special killing activity of tumour cell.The results mice serum is anti-as one, wherein collects the mice serum and the tumor suppression mice serum of tumor regression respectively, detects the specific antibody that whether produces in the serum at the 4T1 membranin.

2, experimental result

Necrosis and apoptosis are obvious in the HE demonstration of dyeing, liposome complex treatment group mouse tumor, visible lymphocytic infiltration in the tumour, and the TUNEL method detects and confirms, and the liposome complex treatment promotes the apoptosis (Fig. 7) of tumour cell.Microvessel density in the CD31 discovery of dyeing, HNP1 treatment group tumour obviously descends, and proves that liposome complex expresses the HNP1 mature peptide in vivo and can suppress tumor-blood-vessel growth (Fig. 8). ⁵¹The Cr release experiment confirms that the HNP1 mature peptide can produce special toxicity CTL (Fig. 9) by inducing mouse, and all has the specific antibody (Figure 10) at the 4T1 membranin in the mice serum that the mouse of tumor regression and tumour obviously suppress.

By this example as can be known, the present invention makes up HNP1 mature peptide liposome complex can suppress tumor-blood-vessel growth and inducing antitumor immunity by promoting apoptosis of tumor cells, suppresses tumor growth in vivo effectively.Has the advantage that other therapy of tumor medicine hardly matches.

Above more excellent embodiment is that the present invention is further illustrated, but be not limitation of the scope of the invention, those skilled in the art are according to basic thought of the present invention, can make various modification or improvement, only otherwise break away from basic thought of the present invention, all within the scope that spirit of the present invention and claims of being enclosed define.As by this area general knowledge as can be known, if different requirements is arranged, the consumption of the carrier of reorganization HNP1 mature peptide gene can change in a big way at one in the antitumor drug of the present invention.Those skilled in the art can be according to some known factors, such as the kind of disease, and the degree that is in a bad way, patient body weight, formulation, selected routes of administration etc. are determined at an easy rate.

SEQUENCE?LISTING

＜110〉Sichuan University

＜120〉recombinant human HNP gene liposome complex, Preparation method and use

<130>A080136k

<160>9

<170>PatentIn?version?3.4

<210>1

<211>93

<212>DNA

<213>artificial

<220>

<223>artificial

<400>1

gcctgctatt?gcagaatacc?agcgtgcatt?gcaggagaac?gtcgctatgg?aacctgcatc 60

taccagggaa?gactctgggc?attctgctgc?tga 93

<210>2

<211>90

<212>DNA

<213>artificial

<220>

<223>artificial

<400>2

gactgctatt?gcagaatacc?agcgtgcatt?gcaggagaac?gtcgctatgg?aacctgcatc 60

taccagggaa?gactctgggc?attctgctgc 90

<210>3

<211>171

<212>DNA

<213>artificial

<220>

<223>artificial

<400>3

atggagacag?acacactcct?gctatgggta?ctgctgctct?gggttccagg?ttccactggt 60

gacgcggccc?agccggccgc?ctgctattgc?agaataccag?cgtgcattgc?aggagaacgt 120

cgctatggaa?cctgcatcta?ccagggaaga?ctctgggcat?tctgctgctg?a 171

<210>4

<211>156

<212>DNA

<213>artificial

<220>

<223>artificial

<400>4

atgtacagga?tgcaactcct?gtcttgcatt?gcactaagtc?ttgcacttgt?cacgaattcg 60

gccgcctgct?attgcagaat?accagcgtgc?attgcaggag?aacgtcgcta?tggaacctgc 120

atctaccagg?gaagactctg?ggcattctgc?tgctga 156

<210>5

<211>5192

<212>DNA

<213>artificial

<220>

<223>artificial

<400>5

gacggatcgg?gagatctccc?gatcccctat?ggtcgactct?cagtacaatc?tgctctgatg 60

ccgcatagtt?aagccagtat?ctgctccctg?cttgtgtgtt?ggaggtcgct?gagtagtgcg 120

cgagcaaaat?ttaagctaca?acaaggcaag?gcttgaccga?caattgcatg?aagaatctgc 180

ttagggttag?gcgttttgcg?ctgcttcgcg?atgtacgggc?cagatatacg?cgttgacatt 240

gattattgac?tagttattaa?tagtaatcaa?ttacggggtc?attagttcat?agcccatata 300

tggagttccg?cgttacataa?cttacggtaa?atggcccgcc?tggctgaccg?cccaacgacc 360

cccgcccatt?gacgtcaata?atgacgtatg?ttcccatagt?aacgccaata?gggactttcc 420

attgacgtca?atgggtggac?tatttacggt?aaactgccca?cttggcagta?catcaagtgt 480

atcatatgcc?aagtacgccc?cctattgacg?tcaatgacgg?taaatggccc?gcctggcatt 540

atgcccagta?catgacctta?tgggactttc?ctacttggca?gtacatctac?gtattagtca 600

tcgctattac?catggtgatg?cggttttggc?agtacatcaa?tgggcgtgga?tagcggtttg 660

actcacgggg?atttccaagt?ctccacccca?ttgacgtcaa?tgggagtttg?ttttggcacc 720

aaaatcaacg?ggactttcca?aaatgtcgta?acaactccgc?cccattgacg?caaatgggcg 780

gtaggcgtgt?acggtgggag?gtctatataa?gcagagctct?ctggctaact?agagaaccca 840

ctgcttactg?gcttatcgaa?attaatacga?ctcactatag?ggagacccaa?gctggctagc 900

caccatggag?acagacacac?tcctgctatg?ggtactgctg?ctctgggttc?caggttccac 960

tggtgacgcg?gcccagccgg?ccgcctgcta?ttgcagaata?ccagcgtgca?ttgcaggaga 1020

acgtcgctat?ggaacctgca?tctaccaggg?aagactctgg?gcattctgct?gctgatatcc 1080

agcacagtgg?cggccgctcg?agtctagagg?gcccgaacaa?aaactcatct?cagaagagga 1140

tctgaatagc?gccgtcgacc?atcatcatca?tcatcattga?gtttaaaccc?gctgatcagc 1200

ctcgactgtg?ccttctagtt?gccagccatc?tgttgtttgc?ccctcccccg?tgccttcctt 1260

gaccctggaa?ggtgccactc?ccactgtcct?ttcctaataa?aatgaggaaa?ttgcatcgca 1320

ttgtctgagt?aggtgtcatt?ctattctggg?gggtggggtg?gggcaggaca?gcaaggggga 1380

ggattgggaa?gacaatagca?ggcatgctgg?ggatgcggtg?ggctctatgg?cttctgaggc 1440

ggaaagaacc?agctggggct?ctagggggta?tccccacgcg?ccctgtagcg?gcgcattaag 1500

cgcggcgggt?gtggtggtta?cgcgcagcgt?gaccgctaca?cttgccagcg?ccctagcgcc 1560

cgctcctttc?gctttcttcc?cttcctttct?cgccacgttc?gccggctttc?cccgtcaagc 1620

tctaaatcgg?ggcatccctt?tagggttccg?atttagtgct?ttacggcacc?tcgaccccaa 1680

aaaacttgat?tagggtgatg?gttcacgtag?tgggccatcg?ccctgataga?cggtttttcg 1740

ccctttgacg?ttggagtcca?cgttctttaa?tagtggactc?ttgttccaaa?ctggaacaac 1800

actcaaccct?atctcggtct?attcttttga?tttataaggg?attttgggga?tttcggccta 1860

ttggttaaaa?aatgagctga?tttaacaaaa?atttaacgcg?aattaattct?gtggaatgtg 1920

tgtcagttag?ggtgtggaaa?gtccccaggc?tccccagcag?gcagaagtat?gcaaagcatg 1980

catctcaatt?agtcagcaac?caggtgtgga?aagtccccag?gctccccagc?aggcagaagt 2040

atgcaaagca?tgcatctcaa?ttagtcagca?accatagtcc?cgcccctaac?tccgcccatc 2100

ccgcccctaa?ctccgcccag?ttccgcccat?tctccgcccc?atggctgact?aatttttttt 2160

atttatgcag?aggccgaggc?cgcctctgcc?tctgagctat?tccagaagta?gtgaggaggc 2220

ttttttggag?gcctaggctt?ttgcaaaaag?ctcccgggag?cttgtatatc?cattttcgga 2280

tctgatcagc?acgtgttgac?aattaatcat?cggcatagta?tatcggcata?gtataatacg 2340

acaaggtgag?gaactaaacc?atggccaagt?tgaccagtgc?cgttccggtg?ctcaccgcgc 2400

gcgacgtcgc?cggagcggtc?gagttctgga?ccgaccggct?cgggttctcc?cgggacttcg 2460

tggaggacga?cttcgccggt?gtggtccggg?acgacgtgac?cctgttcatc?agcgcggtcc 2520

aggaccaggt?ggtgccggac?aacaccctgg?cctgggtgtg?ggtgcgcggc?ctggacgagc 2580

tgtacgccga?gtggtcggag?gtcgtgtcca?cgaacttccg?ggacgcctcc?gggccggcca 2640

tgaccgagat?cggcgagcag?ccgtgggggc?gggagttcgc?cctgcgcgac?ccggccggca 2700

actgcgtgca?cttcgtggcc?gaggagcagg?actgacacgt?gctacgagat?ttcgattcca 2760

ccgccgcctt?ctatgaaagg?ttgggcttcg?gaatcgtttt?ccgggacgcc?ggctggatga 2820

tcctccagcg?cggggatctc?atgctggagt?tcttcgccca?ccccaacttg?tttattgcag 2880

cttataatgg?ttacaaataa?agcaatagca?tcacaaattt?cacaaataaa?gcattttttt 2940

cactgcattc?tagttgtggt?ttgtccaaac?tcatcaatgt?atcttatcat?gtctgtatac 3000

cgtcgacctc?tagctagagc?ttggcgtaat?catggtcata?gctgtttcct?gtgtgaaatt 3060

gttatccgct?cacaattcca?cacaacatac?gagccggaag?cataaagtgt?aaagcctggg 3120

gtgcctaatg?agtgagctaa?ctcacattaa?ttgcgttgcg?ctcactgccc?gctttccagt 3180

cgggaaacct?gtcgtgccag?ctgcattaat?gaatcggcca?acgcgcgggg?agaggcggtt 3240

tgcgtattgg?gcgctcttcc?gcttcctcgc?tcactgactc?gctgcgctcg?gtcgttcggc 3300

tgcggcgagc?ggtatcagct?cactcaaagg?cggtaatacg?gttatccaca?gaatcagggg 3360

ataacgcagg?aaagaacatg?tgagcaaaag?gccagcaaaa?ggccaggaac?cgtaaaaagg 3420

ccgcgttgct?ggcgtttttc?cataggctcc?gcccccctga?cgagcatcac?aaaaatcgac 3480

gctcaagtca?gaggtggcga?aacccgacag?gactataaag?ataccaggcg?tttccccctg 3540

gaagctccct?cgtgcgctct?cctgttccga?ccctgccgct?taccggatac?ctgtccgcct 3600

ttctcccttc?gggaagcgtg?gcgctttctc?aatgctcacg?ctgtaggtat?ctcagttcgg 3660

tgtaggtcgt?tcgctccaag?ctgggctgtg?tgcacgaacc?ccccgttcag?cccgaccgct 3720

gcgccttatc?cggtaactat?cgtcttgagt?ccaacccggt?aagacacgac?ttatcgccac 3780

tggcagcagc?cactggtaac?aggattagca?gagcgaggta?tgtaggcggt?gctacagagt 3840

tcttgaagtg?gtggcctaac?tacggctaca?ctagaaggac?agtatttggt?atctgcgctc 3900

tgctgaagcc?agttaccttc?ggaaaaagag?ttggtagctc?ttgatccggc?aaacaaacca 3960

ccgctggtag?cggtggtttt?tttgtttgca?agcagcagat?tacgcgcaga?aaaaaaggat 4020

ctcaagaaga?tcctttgatc?ttttctacgg?ggtctgacgc?tcagtggaac?gaaaactcac 4080

gttaagggat?tttggtcatg?agattatcaa?aaaggatctt?cacctagatc?cttttaaatt 4140

aaaaatgaag?ttttaaatca?atctaaagta?tatatgagta?aacttggtct?gacagttacc 4200

aatgcttaat?cagtgaggca?cctatctcag?cgatctgtct?atttcgttca?tccatagttg 4260

cctgactccc?cgtcgtgtag?ataactacga?tacgggaggg?cttaccatct?ggccccagtg 4320

ctgcaatgat?accgcgagac?ccacgctcac?cggctccaga?tttatcagca?ataaaccagc 4380

cagccggaag?ggccgagcgc?agaagtggtc?ctgcaacttt?atccgcctcc?atccagtcta 4440

ttaattgttg?ccgggaagct?agagtaagta?gttcgccagt?taatagtttg?cgcaacgttg 4500

ttgccattgc?tacaggcatc?gtggtgtcac?gctcgtcgtt?tggtatggct?tcattcagct 4560

ccggttccca?acgatcaagg?cgagttacat?gatcccccat?gttgtgcaaa?aaagcggtta 4620

gctccttcgg?tcctccgatc?gttgtcagaa?gtaagttggc?cgcagtgtta?tcactcatgg 4680

ttatggcagc?actgcataat?tctcttactg?tcatgccatc?cgtaagatgc?ttttctgtga 4740

ctggtgagta?ctcaaccaag?tcattctgag?aatagtgtat?gcggcgaccg?agttgctctt 4800

gcccggcgtc?aatacgggat?aataccgcgc?cacatagcag?aactttaaaa?gtgctcatca 4860

ttggaaaacg?ttcttcgggg?cgaaaactct?caaggatctt?accgctgttg?agatccagtt 4920

cgatgtaacc?cactcgtgca?cccaactgat?cttcagcatc?ttttactttc?accagcgttt 4980

ctgggtgagc?aaaaacagga?aggcaaaatg?ccgcaaaaaa?gggaataagg?gcgacacgga 5040

aatgttgaat?actcatactc?ttcctttttc?aatattattg?aagcatttat?cagggttatt 5100

gtctcatgag?cggatacata?tttgaatgta?tttagaaaaa?taaacaaata?ggggttccgc 5160

gcacatttcc?ccgaaaagtg?ccacctgacg?tc 5192

<210>6

<211>34

<212>DNA

<213>artificial

<220>

<223>artificial

<400>6

ataggatccg?ccatgaggac cctcgccatc cttg 34

<210>7

<211>29

<212>DNA

<213>artificial

<220>

<223>artificial

<400>7

gagatatcag?cagcagaatg?cccagagtc 29

<210>8

<211>33

<212>DNA

<213>artificial

<220>

<223>artificial

<400>8

gcggcccagc?cggccgcctg?ctattgcaga?ata 33

<210>9

<211>29

<212>DNA

<213>artificial

<220>

<223>artificial

<400>9

gagatatcag?cagcagaatg?cccagagtc 29

Claims (4)

1. contain the liposome complex of the carrier for expression of eukaryon of energy expressing human α-alexin mature peptide encoding gene, it is characterized in that the nucleotides sequence of described carrier for expression of eukaryon is classified as shown in the SEQ ID NO.5; Described liposome is that 1: 1 DOTAP and Chol forms by mol ratio, and the mass ratio of liposome and carrier for expression of eukaryon is 3: 1.

2. the method for preparing the described liposome complex of claim 1 is characterized in that may further comprise the steps: cationic-liposome is mixed with recombinant vectors; Place liquid nitrogen to cool off rapidly, taking-up is put into 4 degrees centigrade of refrigerators and is treated its thawing then, and so multigelation is 1～6 time; After last freeze thawing finishes, liquid is put into the freeze drier freeze-drying, promptly.

3. the purposes of the described liposome complex of claim 1 in the pharmaceutical composition of preparation anti-lung cancer or anti-breast cancer.

4. a pharmaceutical composition is characterized in that it being to add pharmaceutically acceptable complementary composition by the described liposome complex of claim 1 to be prepared from.

Images