CN101280020A - Fused protein of human serum albumin and human insulin C-peptide, and preparation thereof - Google Patents

Abstract

The invention relates to a preparation method of a fused protein of human serum albumin and human insulin C peptide, and the product thereof, belonging to the technical field of long-effetive recombinant fused protein drugs. Human serum albumin(HSA) cDNA and C peptide cDNA are directly connected, without adding any connecting peptide therevetween, obtaining HAS-CP cDNA which is then integrated with a cell of the host to express. The fused protein of the invention comprises a first region with at least 85% of the sequence congenetic with human serum albumin and a second region with at least 85% of the sequence congenetic with human C peptide, and the two regions are directly connected without any connecting peptide therebetween. Under the premise of not being changed in characteristics, the fused protein is capable of the substitution, deletion or addition of specific amino acid residues. The host cell can be bacteria, barm, insect cell, zooblast, plant cell, etc. The fused protein maintains the physiological characteristics of the human C peptide and prolonges the half life of the human C peptide within human body; therefore the fused protein is of good application prospect in pharmacy.

Description

The fusion rotein of human serum albumin and human insulin C-peptide and preparation thereof

Technical field

The preparation method of the fusion rotein of human serum albumin and human insulin C-peptide and product belong to long-acting fusion rotein technical field of pharmaceuticals.

Background technology

Human serum albumin (Human serum albumin, HSA) be major protein composition in the blood plasma, concentration in blood plasma is 40mg/mL (Phillip P.Minghettis et al., THE JOURNAL OF BIOLOGICAL CHEMISTRY, 1986 261:6747-6757), it can also comprise hormone, toxic metabolite product, medicine etc. in conjunction with endogenous and/or exogenous part except having the infiltration of plasma of keeping compression functions.By in conjunction with these parts, HSA can regulate the toxicity of hormonal activity, endogenous and/or exogenous material and the availability of medicine (Ji-Sook Ha et al., Biochimica et Biophysica Acta, 20031640:119-128).The Half HSA of structures such as David S.Park (preceding 297 amino-acid residues of intercepting HSA) has the similar secondary structure of wild-type HSA respective area, kept ability (the David S.Park et al. of wild-type HSA simultaneously in conjunction with thyroxine and thyroxine analogues, IUBMB Life, 1999 48:169-174), the human serum albumin that translation is just come out in the cell has typical pre-pro-protein structure, comprises the signal peptide of 18 amino-acid residues and the former peptide of 6 amino-acid residue propetides.Signal peptide and propetide are cut in transhipment and excretory process, and sophisticated HSA is made up of 585 amino-acid residues, contains 17 pairs of disulfide linkage, and molecular weight is about 66.5KDa.Generally, HSA is a non-glycosylated protein, yet also exists N-to connect glycosylation (seeing the proteinALBU_HUMAN among the Uniprot) in the mutant that has.The viewpoint of Peters think evolve out the advantage of high molecular weight protein be reduce its when internal recycle through renal excretion (Peters T.Jr., Adv.Protein Chem., 1985 37:161-245).The molecular weight of HSA is relatively large, under normal circumstances, is difficult for by glomerular filtration, and its plasma half-life is about 20 days.

Insulin C-peptide (C-Peptide, CP) be the connection peptides that connects INSULIN A chain and B chain in the proinsulin molecule, form that molecular weight is 3020Da by 31 amino acid, be that proinsulin changes the split product in the Regular Insulin process into, secrete from beta Cell of islet with the Regular Insulin equimolecular.Insulin C-peptide by with cytolemma on the receptors bind of G protein coupling, make Ca ²⁺Channel opener activates Na ⁺-K ⁺The activity of-atpase activity and nitricoxide synthase, vasodilation, blood flow increasing, improve erythrocyte deformability, the excretion that reduces the renal glomerulus urinary albumin increases nerve conduction velocity, thereby improve diabetic subject's kidney, nerve, microangiopathies, the latent effect of insulin C-peptide in diabetic complication is worth more and more is subjected to extensive attention.Normal people basis plasma insulin C peptide level is about 0.4nmol/L, transformation period is 20min, and these characteristics have caused very big obstacle for the medicine progress of insulin C-peptide, the medicineization of research insulin C-peptide, at first to improve its stability, improve its bioavailability.In order to overcome above-mentioned shortcoming, can be modified insulin C-peptide, to prolong its transformation period.Main method is made slow release formulation, utilizes chemical means to modify (as using PEG, glucan-modified), is utilized genetic engineering means that itself and other high molecular weight protein is merged.The present invention will carry out amalgamation and expression to insulin C-peptide and HSA, by the long-actingization technology of research and development human insulin C-peptide, improve pharmacokinetics proterties in the insulin C-peptide body, develop a kind of long-acting new drug with independent intellectual property right.

Summary of the invention

The preparation method and the product that the purpose of this invention is to provide the fusion rotein of a kind of human serum albumin and human insulin C-peptide.Fusion rotein of the present invention prolongs its transformation period in vivo on the basis of the physiological property that has kept human insulin C-peptide, at pharmaceutical field good prospects for application is arranged.

Technical scheme of the present invention: synthetic CP cDNA; Increase from people's tire liver cDNA library by PCR and to obtain HSA cDNA; Utilization is cut catenation principle with the frame enzyme, connects HSA cDNA and CP cDNA, and the centre does not add any connection peptides, and the HSA-CP cDNA fusion gene that obtains is inserted among the cloning vector pBlu2KSP to be preserved; HSA-CP cDNA fusion gene is integrated in host's the karyomit(e), expresses in host cell.

The clone of CP cDNA, the clone of HSA cDNA contains the structure of the cloning vector of HSA cDNA and CP cDNA fusion gene, and the recombination yeast of fusion rotein HSA-CP makes up and the step of the expression of fusion rotein HSA-CP sees embodiment for details.

With the human serum albumin of method for preparing and the fusion rotein of human insulin C-peptide, comprise with first district of the partial amino-acid series of first district of human serum albumin at least 85% sequence homology or human serum albumin and with second district of human insulin C-peptide at least 85% sequence homology; Described and human serum albumin homologous first district is positioned at the N-terminal of fusion rotein, and described and human insulin C-peptide homologous second district is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides; Or described and human insulin C-peptide homologous second district is positioned at the N-terminal of fusion rotein, and described and human serum albumin homologous first district are positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides.

Preferably described fusion rotein comprise with first district of human serum albumin at least 95% sequence homology and with second district of human insulin C-peptide at least 95% sequence homology.

First district of described fusion rotein can be made up of or human serum albumin after structural domain is reset is formed human serum albumin part-structure territory, comprise outside the naturally occurring multiformity of all HSA, the part fragment that also comprises HSA, described in EP322094 [HSA (1-n) by name, n is 369-419].

Described fusion rotein comprises first district identical with the human serum albumin amino acid residue sequence and second district identical with the human insulin C-peptide amino acid residue sequence, or the function equivalent in above-mentioned two districts.

Described function equivalent is under the prerequisite that does not change described fusion rotein characteristic, the polypeptide that replacement, disappearance or the adding of the indivedual amino-acid residues of fusion rotein obtained.

Host system is bacterium, yeast, insect cell, zooblast or vegetable cell etc.Preferred host system is a yeast.Preferred yeast is a pichia spp.Preferred pichia spp is pichia spp GS115 and KM71.

Another content of the present invention provides the host of expressed fusion protein coding region.

Because the CP gene is shorter, and G in its sequence, the C base contents is higher, adopts synthetic to obtain CP cDNA.HSA cDNA can be by the PCR acquisition of increasing from people's tire liver cDNA library.The HSA cDNA that obtains is inserted among the cloning vector pBlu2KSP, order-checking.The principle that utilization is cut connection with the frame enzyme connects CP cDNA and HSA cDNA, the centre does not add any connection peptides, avoiding because of connection peptides adds the fusion rotein stability bring and the problem of immunogenicity aspect, structure contains the cloning vector pBlu2KSP-HSA-CP of CP cDNA and HSA cDNA fusion gene.

CP cDNA and HSA cDNA fusion gene can be expressed in a plurality of host systems, as bacterium, yeast, insect cell, zooblast, vegetable cell, and organism (as vertebrates, insect) etc.Goal gene is integrated in host's the karyomit(e) or is inserted in the plasmid in these expression systems.The present invention is yeast expression system preferably, this system except easy to operate, the growth that possesses prokaryotic expression system rapidly, the nutritional requirement characteristics simple, that easily industry is amplified, also have modification system behind the eukaryotic albumen, help the high-quality recombinant protein of mass production.More preferably the pichia yeast expression system is compared with the yeast saccharomyces cerevisiae expression system, and the pichia yeast expression system has remarkable advantages aspect protein excretion and the glycosylation.Pichia yeast self excretory albumen is few, very helps purifying; Degree of glycosylation is low, the immunogenicity problem of having avoided the super glycosylation of yeast saccharomyces cerevisiae to bring.

Pichia yeast expression system secreted expression carrier mainly contains pPIC9K, pHIL-S1, pPICZ α, pYAM75P6; The type expression vector mainly contains in the born of the same parents: pPIC3K, pPICZ, pHWO10, pGAPZ, pGAPZ α (invitrogen) etc., pichia spp secreted expression carrier pPIC9K preferably, it is a yeast integration plasmid, has selected marker HIS4, AOX1 promotor, MF α secreting signal peptide and the G418 resistant gene elements such as (can be used as the mark of screening recon) of His defective type.The AOX1 promotor is a strong promoter, can start the expression of goal gene efficiently.Encode altogether in pichia yeast two kinds of alcohol oxidase AOX1 and AOX2, the vigor of most alcohol oxidases is to be provided by AOX1 in the cell.At methyl alcohol is in the sole carbon source cultured cells, and this enzyme can account for more than 30% of total protein of cell.Though the homology of AOX2 and AOX1 is up to 97%, enzyme is lived very low.When AOX1 genetically deficient, when only having AOX2, the forfeiture of most oxidation of ethanol enzyme activity, cell utilizes the methyl alcohol ability to reduce, and cell is that growth is very slow on the substratum of sole carbon source at methyl alcohol.

Have the expression vector that merges cDNA and can transform host system by transforming lithium salts method, PEG method, protoplasm body or electroporation.The success cell transformed, the cell that promptly has the DNA of the present invention's structure, can be identified by method well known in the art, as collecting cell, extract DNA after the cracking, carry out Southern hybridization and PCR then and identify, also can be with HSA antibody and/or CP antibody test nutrient solution supernatant behind abduction delivering.

Beneficial effect of the present invention:

Utilization is cut catenation principle with the frame enzyme, connect HSA cDNA and CP cDNA, swift and convenient to operate, the centre does not add any connection peptides, to avoid adding the fusion rotein stability (avoiding the proteasome degradation at connection peptides) bring and the problem of immunogenicity aspect because of connection peptides.

Preferred yeast expression system except easy to operate, the growth that possesses prokaryotic expression system rapidly, the nutritional requirement characteristics simple, that easily industry is amplified, also have modification system behind the eukaryotic albumen, help the high-quality recombinant protein of mass production.More preferably pichia yeast expression system is compared with the yeast saccharomyces cerevisiae expression system, and pichia yeast expression system has remarkable advantages aspect protein excretion and the glycosylation.Pichia spp self excretory albumen is few, very helps purifying; Degree of glycosylation is low, the immunogenicity problem of having avoided the super glycosylation of yeast saccharomyces cerevisiae to bring.

Can have the host system of the DNA of the present invention's structure by cultivation, produce fusion rotein of the present invention.Host system is cultivated and is preferably carried out on bio-reactor, cultivates and divides two stages, and the fs is mainly used in the host system growth, and it is synthetic that subordinate phase is mainly used in product.Can in the cell culture that contain DNA construct of the present invention, separate with the method for various albumen sepn, purified fusion protein.As saltout, the combination of technology such as precipitation, ultrafiltration, chromatography, preparation electrophoresis and these technology.

Description of drawings

Fig. 1. plasmid pPIC9K-HSA-CP structure

Fig. 2. plasmid pPIC9K-HSA-CP makes up

The agarose electrophoretic analysis of Fig. 3 .HSA-CP fusion gene

1:DNA Marker 2000; 2: with the HSA-CP gene that from recombinant plasmid pBlue-HSA-CP, increases of HSA upstream primer and PC2; 3: with PC1 and PC2 amplification CP gene; 4. from pBlue-HSA, there is not amplified band with HSA upstream primer and PC2; 5.: from pBlue-HSA, do not have amplified band with PC1 and PC2

The restricted enzyme cutting analysis of Fig. 4 recombinant plasmid pPIC9k-HSA-CP

1:DNA Marker (λ DNA/HindIII/EcoRI); The pPIC9k-HSA-CP of 2:EcoRI and NotI double digestion; The pPIC9k-HSA-CP that the 3:EcoRI enzyme is cut; The pPIC9k-HSA-CP that the 4:NotI enzyme is cut; The pPIC9k that the 5:EcoRI enzyme is cut

Fig. 5. the SDS-PAGE of fusion rotein analyzes

Lane M: low molecular weight protein standard; Lane 1-8: the fermented liquid supernatant of different reorganization bacterium GS115/pPIC9K-HSA-CP

Fig. 6. high expression level amount reorganization fermented liquid supernatant SDS-PAGE

M: low molecular weight protein standard; High expression level amount reorganization fermented liquid supernatant

Fig. 7. the CP antibody of fusion rotein and HSA antibody test (Western blot)

M: low molecular weight protein standard; Lane1:HSA-CP and the hybridization of HSA antibody; Lane2:HSA-CP and and CP antibody hybridization

Fig. 8 .CP is to the influence of human embryo kidney (HEK) 293 cells growth

Specific implementation method

The clone of embodiment 1:CP cDNA

By sea, the Shanghai firm biotechnology synthetic CPcDNA of Services Co., Ltd (93bp), it is cloned on the carrier pMD18T, inserting the site is EcoR V, recipient bacterium is an e.colistraindh5.

The clone of embodiment 2:HSA cDNA

Utilize PCR to amplify HSA cDNA from people's tire liver cDNA library, used primer is:

PH1：5’-CAGC GAATTCGATGCACACAAGAGTGAGGTTGCTC-3’

PH2：5’-CACC GCGGCCGCTTTATAAGCCTAAGGCAGCTTGACTT-3’

The PH1 underscore partly is an EcoR I restriction enzyme site, and the PH2 underscore partly is the NotI restriction enzyme site

The PCR reaction system: each 1.5 μ L of the PH1 of 10 μ mol/L and PH2 primer, the dNTP 4 μ L of 2.5mmol/L, 10 * pfu Buffer, 5 μ L, the pfu archaeal dna polymerase 0.5 μ L of 5U/ μ L, people's tire liver cDNA library 1 μ g adds distilled water polishing 50 μ L.PCR response procedures: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended 3min, circulate 30 times; 72 ℃ are extended 10min.

Agarose gel electrophoresis analytical reaction product target stripe occurs at the application of sample swimming lane, reclaims the purpose segment that test kit is purified into 1.8kb with PCR fragment glue.Purpose segment that purifying is good and carrier pBlu2KSP are respectively through EcoR I and Not I double digestion, and agarose gel electrophoresis identifies that PCR fragment glue reclaims test kit and reclaims the purpose segment.The T4 dna ligase connects through the HSA of double digestion cDNA and carrier pBlu2KSP, connect product transformed into escherichia coli DH5 α competent cell, conversion product is coated the LB agar plate that contains X-gal, IPTG and 100 μ g/mL penbritins, 37 ℃ of overnight incubation.The picking white colony is inoculated in 20mL and contains in the LB substratum of 100 μ g/mL penbritins, and 37 ℃ of overnight incubation are extracted the conversion plasmid with the plasmid extraction test kit.Adopt pcr amplification, EcoR I and Not I double digestion are identified positive colony, and dna sequencing is carried out in zone between recombinant plasmid EcoR I and Not I double enzyme site.Positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃.Recombinant plasmid called after pBlu2KSP-HSA, positive recombinant called after DH5 α/pBlu2KSP-HSA.

Embodiment 3: the structure that contains the cloning vector of HSA cDNA and CPcDNA fusion gene

(1) the pBlu2KSP-HSA carrier of Gou Jianing contains the restriction enzyme site of Saul I and Not I at the C-terminal of HSA gene, can be by introducing Saul I and Not I restriction enzyme site in the upstream and downstream primer that is used in the CP gene respectively, design make the CP gene behind Saul I and Not I double digestion be connected with frame with the pBlu2KSP-HSA of Not I double digestion through Saul I.

(2) pcr amplification of CP cDNA, the primer is as follows:

PC1：5’GAAAC CCTTAGGCTTAGAAGCTGAGGACTTGCAAGTTGGTC?3’

PC2：5’GTT GCGGCCGCTTATTGAAGAGAACCTTCCAAAGCCA?3’

Wherein the Pc1 underscore partly is a Saul I restriction enzyme site, and the Pc2 underscore partly is a Not I restriction enzyme site

The PCR reaction system: each 1.5 μ L of the PC1 of 10 μ mol/L and PC2 primer, the dNTP 4 μ L of 2.5mmol/L, 10 * pfu Buffer, 5 μ L, the pfu archaeal dna polymerase 0.5 μ L of 5U/ μ L, plasmid template pMD18T-CP 1ng adds distilled water polishing 50 μ L.PCR response procedures: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 30s, 65 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 30 times; 72 ℃ are extended 10min.

(3) cut connection HSA cDNA and CP cDNA fusion gene with the frame enzyme

Agarose gel electrophoresis analytical reaction product target fragment occurs in the 100bp place, reclaims the CP gene that test kit purifying pcr amplification obtains with PCR fragment glue.With the PCR product and the pBlu2KSP-HSA carrier of Saul I and Not I double digestion purifying, reclaim test kit with PCR fragment glue and reclaim CP gene and pBlu2KSP-HSA carrier.With transformed into escherichia coli DH5 α after the T4 dna ligase connection two recovery fragments, conversion product is coated the LB agar plate that contains X-gal, IPTG and 100 μ g/mL penbritins, 37 ℃ of overnight incubation.The picking white colony is inoculated in 20mL and contains in the LB substratum of 100 μ g/mL penbritins, and 37 ℃ of overnight incubation are extracted the conversion plasmid with the plasmid extraction test kit.Adopt pcr amplification, EcoR I and Not I double digestion are identified positive colony, and dna sequencing is carried out in zone between recombinant plasmid EcoR I and Not I double enzyme site.Positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃.Recombinant plasmid called after pBlu2KSP-HSA-CP, positive recombinant called after DH5 α/pBlu2KSP-HSA-CP.

Embodiment 4:HSA-CP expression of recombinant yeast system constructing and Expression of Fusion Protein:

(1) structure of fusion rotein HSA-CP yeast expression system:

Get a frozen DH5 α/pBlu2KSP-HSA-CP, be inoculated into 20mL and contain 37 ℃ of overnight incubation in the LB substratum of 100 μ g/mL penbritins, extract plasmid, the plasmid pBlu2KSP-HSA-CP and the Yeast expression carrier pPIC9K that extract, respectively through EcoR I and Not I double digestion, the agarose gel electrophoresis purifying reclaims test kit with PCR fragment glue and reclaims.Get the good pBlu2KSP-HSA-CP fragment 5 μ L of purifying behind the double digestion, pPIC9K 5 μ L add 2 μ L, 10 * ligation buffer, and 0.4 μ L T4 ligase enzyme adds distilled water polishing 20 μ L, and 15 ℃ of reactions are spent the night.Connect product transformed into escherichia coli DH5 α competent cell, conversion product is coated the LB agar plate that contains 100 μ g/mL penbritins, 37 ℃ of overnight incubation; Several bacterium colonies that grow of picking are inoculated in 37 ℃ of overnight incubation in the UB substratum of 20mL penbritin (100 μ g/mL), extract plasmid with ordinary method; By PCR, and EcoRI and NotI double digestion, agarose gel electrophoresis is identified positive colony, positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃; Recombinant plasmid called after pPIC9k-HSA-CP, positive recombinant called after DH5 α/pPIC9k-HSA-CP.

Extract the plasmid among DH5 α/pPIC9k-HSA-CP, after the SalI enzyme was cut, electric shock transformed pichia spp GS115, and conversion product is coated on the MD flat board that contains the 1mol/L sorbyl alcohol, in 30 ℃, cultivates 3-6 days.With the 2ml bacterium deionized water wash that went out, collect washings on the every flat board.Get the washings that part is collected, separate application contains the YPD flat board of 1mg/mL, 2mg/mL, 3mg/mL, 4mg/mLG418, in 30 ℃, cultivates 3～6 days.Picking grows bacterium colony on the YPD of maximum concentration G418 flat board, be inoculated in the 20mL MD substratum, cultivates 24 hours for 30 ℃, extract the recombinant yeast pichia pastoris gene DNA with ordinary method, by PCR, agarose gel electrophoresis is identified, positive recombinant called after GS115/pPIC9k-HSA-CP.

(2) HSA-CP Expression of Fusion Protein

GS115/pPIC9k-HSA-CP is seeded to 100mL BMGY (100mM potassiumphosphate, pH 6.0,1.34% no amino acid whose yeast nitrogen base, 4 * 10 are housed ^-5% vitamin H, 1% glycerine) in the 500mL triangular flask, 250rpm, 29 ℃ are cultured to A _600nmValue is 2～6, centrifugal collection thalline.The thalline of collecting is seeded to 20mL BMMY (100mM potassiumphosphate, pH 6.0,1.34% no amino acid whose yeast nitrogen base, 4 * 10 are housed ^-5% vitamin H, 1% methyl alcohol) the 100mL triangular flask in, added a methyl alcohol to final concentration 1% (V/V), induced 3 days in per 24 hours.Centrifugal collection supernatant, the SDS-PAGE checking is carried out in filtration sterilization, and immunogenicity and the HSA immunogenicity of the CP of fusion rotein HSA-CP molecule identified in Western hybridization.

Embodiment 5: the biological activity assay of fusion rotein HSA-CP

Srb assay detects the growth promoting function of HSA-CP to human embryo kidney (HEK) 293 cells: human embryo kidney (HEK) 293 cells are cultivated with the DMEM that contains 10% calf serum, and culture condition is 5%CO ₂, 37 ℃.Cell is according to 10 ⁵Individual/mL is layered in 96 orifice plates, 100 μ L cell suspension/holes.Cultivate after one day, low serum starvation was cultivated 24 hours, realized the synchronization of cell growth.Change the DMEM cell culture fluid 200 μ L/ holes of 10% calf serum that contains different concns CP standard substance and HSA-CP sample.Control group does not add CP and HSA-CP, and 48h is cultivated in 4 repetitions of each condition setting.Nutrient solution is removed in suction, and every hole adds 100 μ L, 50% trichoroacetic acid(TCA), leaves standstill to move into 4 ℃ of refrigerators behind the 5min and left standstill 1 hour.After cleaning with deionized water, 4% the SRB 100 μ L that every hole adds the preparation of 1% acetate behind the dyeing 30min, outwell dye liquor.With the unconjugated dyestuff of 1% acetate flush away, add pH 10.5 Tris alkali lye 150 μ L after the drying at room temperature, the 5min that vibrates on the oscillator plate measures the light absorption value of each hole at the 540nm place on the microplate reader.

Claims (10)

1, the fusion rotein of human serum albumin (HSA) and human insulin C-peptide (CP).It is characterized in that comprising with partial amino-acid series first district of first district of human serum albumin at least 85% sequence homology or human serum albumin and with second district of human insulin C-peptide at least 85% sequence homology; Described and human serum albumin homologous first district is positioned at the N-terminal of fusion rotein, and described and human insulin C-peptide homologous second district is positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides; Or described and human insulin C-peptide homologous second district is positioned at the N-terminal of fusion rotein, and described and human serum albumin homologous first district are positioned at the C-terminal of fusion rotein, and the centre does not add any connection peptides.

2, the fusion rotein of human serum albumin according to claim 1 and human insulin C-peptide.It is characterized in that described fusion rotein comprise with first district of human serum albumin at least 95% sequence homology and with second district of insulin C-peptide at least 95% sequence homology.

3, the fusion rotein of human serum albumin according to claim 1 and human insulin C-peptide.First district that it is characterized in that described fusion rotein is made up of human serum albumin part-structure territory or the human serum albumin after structural domain is reset is formed.

4, the fusion rotein of human serum albumin according to claim 1 and human insulin C-peptide.It is characterized in that described fusion rotein comprises identical first district with the human serum albumin amino acid residue sequence and second district identical with the human insulin C-peptide amino acid residue sequence, or the function equivalent in above-mentioned two districts.

5, the fusion rotein of human serum albumin according to claim 4 and human insulin C-peptide.It is characterized in that described function equivalent is under the prerequisite that does not change described fusion rotein characteristic, the polypeptide that replacement, disappearance or the adding of the indivedual amino-acid residues of fusion rotein obtained.

6, the preparation of the fusion rotein of human serum albumin according to claim 1 (HSA) and human insulin C-peptide (CP).It is characterized in that synthetic CP cDNA; Increase from people's tire liver cDNA library by PCR and to obtain HSA cDNA; Cut connection HSA cDNA and CP cDNA with the frame enzyme, the centre does not add any connection peptides, and the HSA-CP cDNA fusion gene that obtains is inserted in the cloning vector to be preserved; Utilizing the pichia spp secreted expression carrier HSA-CP cDNA fusion gene to be incorporated in host's the karyomit(e) expresses.

(1) clone of CP cDNA

By sea, the Shanghai firm synthetic CP cDNA of Bioisystech Co., Ltd (93bp), it is cloned on the carrier pMD18T, inserting the site is EcoR V, recipient bacterium is an e.colistraindh5.

(2) clone of HSA cDNA

Utilize PCR to amplify HSA cDNA from people's tire liver cDNA library, used primer is:

PH1：5’-CAGC GAATTCGATGCACACAAGAGTGAGGTTGCTC-3’

PH2：5’-CACC GCGGCCGCTTATAAGCCTAAGGCAGCTTGACTT-3’

The PH1 underscore partly is an EcoR I restriction enzyme site, and the PH2 underscore partly is the NotI restriction enzyme site

The PCR reaction system: each 1.5 μ L of the PH1 of 10 μ mol/L and PH2 primer, the dNTP 4 μ L of 2.5mmol/L, 10 * pfu Buffer, 5 μ L, the pfu archaeal dna polymerase 0.5 μ L of 5U/ μ L, people's tire liver cDNA library 1 μ g adds distilled water polishing 50 μ L.PCR response procedures: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended 3min, circulate 30 times; 72 ℃ were extended 10 minutes.

Agarose gel electrophoresis analytical reaction product target stripe occurs at the application of sample swimming lane, reclaims the purpose segment that test kit is purified into 1.8kb with PCR fragment glue.Purpose segment that purifying is good and carrier pBlu2KSP are respectively through EcoR I and NotI double digestion, and agarose gel electrophoresis identifies that PCR fragment glue reclaims test kit and reclaims the purpose segment.The T4 dna ligase connects through the HSA of double digestion cDNA and carrier pBlu2KSP, connect product transformed into escherichia coli DH5 α competent cell, conversion product is coated the LB agar plate that contains X-gal, IPTG and 100 μ g/mL penbritins, 37 ℃ of overnight incubation.The picking white colony is inoculated in 20mL and contains in the LB substratum of 100 μ g/mL penbritins, and 37 ℃ of overnight incubation are extracted the conversion plasmid with the plasmid extraction test kit.Adopt pcr amplification, EcoR I and NotI double digestion are identified positive colony, and dna sequencing is carried out in zone between recombinant plasmid EcoR I and NotI double enzyme site.Positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃.Recombinant plasmid called after DH5 α/pBlu2KSP-HSA, positive recombinant called after DH5 α/pBlu2KSP-HSA.

(3) cloning vector that contains HSA cDNA and CP cDNA fusion gene makes up

1. the pBlu2KSP-HSA carrier of Gou Jianing contains the restriction enzyme site of Saul I and Not I at the C-terminal of HSA gene, can be by introducing Saul I and Not I restriction enzyme site in the upstream and downstream primer that is used in the CP gene respectively, design make the CP gene behind Saul I and Not I double digestion be connected with frame with the pBlu2KSP-HSA of Not I double digestion through Saul I.

2. the pcr amplification of CP cDNA, the primer is as follows:

PC1：5’GAAAC CCTTAGGCTTAGAAGCTGAGGACTTGCAAGTTGGTC?3’

PC2：5’GTT GCGGCCGCTTATTGAAGAGAACCTTCCAAAGCCA?3’

Wherein the PC1 underscore partly is a Saul I restriction enzyme site, and the PC2 underscore partly is a Not I restriction enzyme site

The PCR reaction system: each 1.5 μ L of the PC1 of 10 μ mol/L and PC2 primer, the dNTP 4 μ L of 2.5mmol/L, 10 * pfu Buffer, 5 μ L, the pfu archaeal dna polymerase 0.5 μ L of 5U/ μ L, plasmid template pMD18T-CP 1ng adds distilled water polishing 50 μ L.PCR response procedures: 95 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change 30s, 65 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 30 times; 72 ℃ are extended 10min.

3. cut with the frame enzyme and connect HSA cDNA and CP cDNA fusion gene

Agarose gel electrophoresis analytical reaction product target fragment occurs in the 100bp place, reclaims the CP gene that test kit purifying pcr amplification obtains with PCR fragment glue.With the PCR product and the pBlu2KSP-HSA carrier of Saul I and Not I double digestion purifying, reclaim test kit with PCR fragment glue and reclaim CP gene and pBlu2KSP-HSA carrier.With transformed into escherichia coli DH5 α after the T4 dna ligase connection two recovery fragments, conversion product is coated the LB agar plate that contains X-gal, IPTG and 100 μ g/mL penbritins, 37 ℃ of overnight incubation.The picking white colony is inoculated in 20mL and contains in the LB substratum of 100 μ g/mL penbritins, and 37 ℃ of overnight incubation are extracted the conversion plasmid with the plasmid extraction test kit.Adopt pcr amplification, EcoR I and Not I double digestion are identified positive colony, and dna sequencing is carried out in zone between recombinant plasmid EcoR I and Not I double enzyme site.Positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃.Recombinant plasmid called after pBlu2KSP-HSA-CP, positive recombinant called after DH5 α/pBlu2KSP-HSA-CP.

(4) structure of the yeast expression system of fusion rotein HSA-CP

Get a frozen DH5 α/pBlu2KSP-HSA-CP, be inoculated into 20mL and contain in the LB substratum of 100 μ g/ml penbritins, 37 ℃ of overnight incubation are extracted plasmid with the plasmid extraction test kit.The plasmid pBlu2KSP-HSA-CP and the Yeast expression carrier pPIC9K that extract, respectively through EcoR I and Not I double digestion, agarose gel electrophoresis is identified, reclaims test kit with PCR fragment glue and reclaims gene HSA-CP and carrier pPIC9K.Connect two with the T4 dna ligase and reclaim fragment, connect product transformed into escherichia coli DH5 α competent cell, conversion product is coated the LB agar plate that contains 100 μ g/mL penbritins, 37 ℃ of overnight incubation.The bacterium colony that picking grows is inoculated in 20mL and contains in the LB substratum of 100 μ g/mL penbritins, and 37 ℃ of overnight incubation are extracted plasmid with the plasmid extraction test kit.Adopt pcr amplification, EcoR I and Not I double digestion are identified positive colony.Positive recombinant is kept among the LB that contains 20% glycerine, freezes in-80 ℃.Recombinant plasmid called after pPIC9K-HSA-CP, positive recombinant called after DH5 α/pPIC9K-HSA-CP.

Extract the plasmid among DH5 α/pPIC9K-HSA-CP, through the SalI single endonuclease digestion, after DNA glue reclaims the test kit recovery, electric shock transforms pichia spp GS115, extract the recombinant yeast pichia pastoris genomic dna, pcr amplification is identified, positive recombinant called after GS115/pPIC9K-HSA-CP.

(5) expression of fusion rotein HSA-CP

GS115/pPIC9K-HSA-CP is seeded in the 50mL triangular flask that 10mL BMGY is housed, and 250rpm cultivated 24 hours for 30 ℃, centrifugal collection thalline, the thalline of collecting is resuspended among the 3mL BMMY, in the 50mL triangular flask, 250rpm, 30 ℃ are continued to cultivate, add a methyl alcohol in per 24 hours to final concentration 1%, induced centrifugal collection fermented liquid supernatant 3 days, carry out the SDS-PAGE checking, the CP and the HSA immunogenicity of fusion rotein HSA-CP molecule identified in Western hybridization.

7, method according to claim 6 is characterized in that host system is bacterium, yeast, insect cell, zooblast or vegetable cell expression system.

8, method according to claim 7 is characterized in that preferred host system is a yeast.

9, method according to claim 8 is characterized in that preferred yeast is a pichia spp.

10, method according to claim 9 is characterized in that preferred pichia spp is pichia spp GS115 and KM71.

Images