CN101268199A - Detection of nucleic acid amplification - Google Patents

Abstract

Methods for detecting a target polynucleotide sequences are provided that utilize a probe having a target-complementary segment and a detectable tag. By cleaving the detectable tab and associating the tag with a tag complement coupled to an electrode, an electrochemical signal can be detected that is related to the presence of the tag: tag complement complex.

Description

The detection of nucleic acid amplification

The sequence number 60/699 that the application submitted to based on July 15th, 2005, the sequence number 60/749 that 950 U.S. Provisional Patent Application and on December 9th, 2005 submit to, 003 U.S. Provisional Patent Application, and according to the 119th rights and interests that require them of United States Code the 35th volume, they incorporate the application separately by reference into thus.

Foreword

Detection of nucleic acids can be undertaken by multiple mensuration form.Described mensuration can be qualitatively, for example when being used to assess biological sample.Yet many kinds of biologic applications can be improved and not needed the engram technology or the required usually costliness and the accurate instrument of optical means of trouble by the ability that detects target nucleic acid.

The accompanying drawing summary

Fig. 1 is according to the synoptic diagram of one embodiment of the invention description with the example amplification probe of hybridizing as the polynucleotide sequence of amplicon template.

Fig. 2 describes the synoptic diagram of cutting from the flank part (flap moiety) of the nucleic acid complex compound of hybridization.

Fig. 3 describes to use according to one embodiment of the invention to detect the synoptic diagram that oligonucleotide detects polymerase chain reaction (PCR).

Fig. 4 is described in the amplification procedure and can self causes the synoptic diagram of the purposes of the nucleotide sequence that himself extends according to one embodiment of the invention.

Fig. 5 is a synoptic diagram of describing the nucleotide sequence that comprises the hairpin loop that contains sequence label according to one embodiment of the invention.

Fig. 6 is described in the amplification procedure according to one embodiment of the invention can cut the synoptic diagram of the purposes of sequence label with detection oligonucleotide complementary.

Fig. 7 describes the synoptic diagram that detects the sequence label of remote cleavage site by means of the interaction of label that cuts and electrode surface.

Fig. 8 is the synoptic diagram according to the microfluid system of one embodiment of the invention.

Fig. 9 shown by the amplicon that relatively carries out with control reaction electrophoretic analysis confirmed, the existence of sequence label does not influence the pcr amplification of target sequence, as described in embodiment 1.

Figure 10 has shown the Electrochemical Detection of sequence label, as described in embodiment 1.

Figure 11 has shown another example of the Electrochemical Detection of sequence label, as described in embodiment 2.

Figure 12 is described in the synoptic diagram that the label through static bonded redox reaction (redox) center detects on the electrode, as described in embodiment 4.

Figure 13 is a voltammogram of describing the electrochemical reaction of mediation immunomodulator compounds, as described in embodiment 7.

Figure 14 is a compound 1With 7The graphic representation of integration electric charge (integrated charge) and DNA concentration, as described in embodiment 7.

Figure 15 has shown the cyclic voltammogram of the amplification probe of compound 21, as described in embodiment 10.

Figure 16 has shown the cyclic voltammogram of the amplification probe of compound 7, as described in embodiment 10.

Figure 17 has shown the difference between the detection of the cutting of sequence label 1,2 and 3 and uncut sequence label, as described in embodiment 11.

The explanation of each embodiment

This explanation relates to the method for the system that is used to detect the target polynucleotide sequence.Described method can be included under the condition that effectively makes probe formation probe-target complex compound described probe is contacted with the sample that comprises at least a target polynucleotide sequence, but wherein said probe self comprises complementary fragment of target and detection label.But then can be from the described detection label of described probe cutting, the label of Shi Fanging combines with the label complement that is coupled to electrode subsequently.Owing to immobilized label: being fixed on electrochemical signals that the label complement complex compound on the electrode detects can be associated with the hit existence of polynucleotide sequence of sample.

In certain embodiments, this explanation comprises a kind of method that is used to detect nucleic acid amplification.In the method, with reference to figure 1, amplification probe 10 is hybridized with the polynucleotide sequence 12 as amplicon template that is used for the polynucleotide amplification process or target.Amplification probe 10 comprises complementary polynucleotide sequence 14 and one or more detection label 16.In amplification procedure, one or more detection label of enzyme effect cutting complementary sequence.The detection of detection label to cutting detects the cutting incident again, and therefore detects duplicating of amplicon template, as shown in Figure 1.

This paper employed " hybridization " is meant that two polynucleotide sequences form stable duplex structure by the hydrogen bonded between the base of two sequences.Even two sequences are non-fully and strictly complementaries, but one of them sequence can be considered to " complementation " in another sequence, condition is that these two sequences comprise and are enough to make the hybrid that produced stable complementary region under standard laboratory conditions.Can with the amplicon template at least substantially any complementary sequence of selective cross be the suitable complementary sequence that is used for this method purpose.Usually, described complementary sequence is made up of Nucleotide and/or its analogue, has the length that is enough to give at least some binding specificities of amplification probe.Described complementary sequence can comprise RNA or DNA, or its mixture or hybrid.Described complementary sequence can comprise natural acid polymkeric substance (biogenetic derivation) or synthetic nucleic acid polymers (manually modified or preparation).

Described complementary sequence can have any suitable natural and/or artificial structure.Nucleic acid can comprise phosphodiester backbone, makes nucleic acid have negative charge in the aqueous solution of neutral pH.Phosphodiester backbone generally includes the sugar-phosphate radical skeleton of alternative sugar and phosphate radical part (phosphate moieties), and nucleotide base (purine or pyrimidine group usually) is connected with each sugar moieties (sugar moiety).Can comprise any sugar in the skeleton, comprising ribose (for RNA), ribodesose (for DNA), pectinose, hexose, 2 '-analog of fluoro ribose and/or sugar.The present invention instructs nucleic acid analyte in the content and/or probe can be to comprise the analogue of any suitable optional skeleton.The optional skeleton of example can have the negative charge that lacks than phosphodiester backbone and neutral (not positively charged also not electronegative) substantially.The optional skeleton of example can comprise phosphamide, phosphorothioate, phosphorodithioate, O-methyl phosphoramidite (methylphosphoroamidite), peptide nucleic acid(PNA) (comprising N-(2-aminoethyl) glycine skeleton unit), lock nucleic acid (referring to, Koshkin etc. for example, Tetrahedron 54:3607-30 (1998), WO 98/39352, WO 99/14226, WO 00/56746, and WO 99/60855, they incorporate the application separately by reference into thus), positively charged skeleton, non-ribose skeleton etc.The nucleic acid that has artificial skeleton and/or part (moieties) can be suitable for for example increasing or reduce total charge, increases or reduces base pairing stability, increases or reduce chemical stability, or changes by the ability of reagent effect, or the like.In the embodiment of example, the nucleic acid probe (for example peptide nucleic acid(PNA)) that has a negative charge that reduces can be used for being used to detect with increase based on the analyte of phosphodiester the sensitivity of the optical element of described analyte.

Described complementary sequence is optional to be contained the base or the connecting key of one or more modifications or contains non-covalent or covalently bound mark.For example, the base of described modification can be the base of naturally occurring modification or the base that synthetic changes.Comprise in the situation of nucleotide base of modification at nucleic acid; described base includes but not limited to VITAMIN B4; cytosine(Cyt); guanine; thymus pyrimidine; uridylic; inosine; the 2-aminoadenine; 2-sulphur thymus pyrimidine; the 3-methyladenine; the C5-bromouracil; the C5-Fluracil; the C5-iodouracil; the C5-methylcystein; 7-denitrification VITAMIN B4; 7-denitrification guanine; 8-oxygen VITAMIN B4; 8-oxygen guanine; 2-sulphur cytosine(Cyt); the 4-acetylcytidine; 5-(carboxyl hydroxymethyl) uracil riboside; 2 '-the O-methylcytidine; 5-carboxyl methylamino methyl-2-sulphur uridine; 5-carboxyl methylamino methyluridine; dihydrouridine; 2 '-the O-methyl pseudouridine; β-D-semi-lactosi Q nucleosides; 2 '-the O-methylguanosine; the N6-riboprine; the 1-methyladenosine; the 1-methyl pseudouridine; the 1-methylguanosine; the 1-methylinosine; 2, the 2-dimethylguanosine; the 2-methyladenosine; the 2-methylguanosine; the 3-methylcytidine; the 5-methylcytidine; the N6-methyladenosine; the 7-methylguanosine; 5-methylamino-methyluridine; 5-methoxyl group aminomethyl-2-sulphur uridine; β-D-mannose group Q nucleosides; 5-methoxycarbonyl methyl-2-sulphur uridine; 5-methoxycarbonyl methyluridine; 5-methoxyl group uridine; 2-methylthio group-N6-riboprine; N-((9-β-D-ribofuranosyl-2-first sulphur purine-6-yl) carbamyl) Threonine; N-((9-β-D-ribofuranosylpurine-6-yl) N-methyl carbamyl) Threonine; uridine-5-fluoroacetic acid methyl esters; uridine-5-fluoroacetic acid; wybutoxosine; pseudouridine; the Q nucleosides; 5-methyl-2-sulphur uridine; the 2-thiocytidine; 5-methyl-2-sulphur uridine; 2-sulphur uridine-4-sulphur uridine; 5-methyluridine N-((9-β-D-ribofuranosylpurine-6-yl)-carbamyl) Threonine; 2 '-O-methyl-5-methyluridine; 2 '-the O-methyluridine; wybutosine; 3-(3-amino-3-carboxyl propyl group) uridine and (acp3) u.

Except there being one or more detection label, described probe also can comprise reactive functional groups, or is replaced by the link coupled material, so that for example uncut probe is partially or completely removed from component mixture.Especially, described probe can be modified so that uncut probe separates from the detection label of cutting.For example, described complementary probe can be 3 ' end uses vitamin H be modified, and make surface or the matrix immobilization that the complementary probe of cutting can be modified by Streptavidin.

By detecting the detection label of cutting, can detect duplicating of target amplicon.Can use any method that is suitable for the object of the invention to carry out the probe cutting.The limiting examples that is used to carry out the example of probe cutting comprise as this paper describe in further detail 5 '-nuclease method (for example Gelfand etc., United States Patent (USP) 5,210,015 and 5,487,972), INVADER ^TMMethod (for example, Prudent etc., United States Patent (USP) 5,985,557,5,994,069 and 6,090,543), and FEN-LCR method (for example Bi etc., United States Patent (USP) 6,511,810).In INVADER class form, a pair of oligonucleotide is provided, described oligonucleotide forms the cutting complex compound in conjunction with the contiguous sequence in the target polynucleotide, wherein 5 of the target complementary portion of 3 of the target complementary portion of the first oligonucleotide ' end and second oligonucleotide ' end next-door neighbour or overlapping.This complex compound is contained the enzyme identification of flank endonuclease enzymic activity (being also known as 5 ' nuclease), and described enzyme cuts second oligonucleotide in 5 ' side of 5 ' end complementary nucleotide of the complementary segmental 3 ' terminal nucleotide of target of contiguous first probe.First probe contains in the embodiment of the one or more complementary Nucleotide that are connected with 3 of its target complementary sequence ' end therein, and the cutting of second probe takes place in 3 ' side of 5 ' end complementary nucleotide.In certain embodiments, second probe of cutting can be replaced by new uncut probe and produce the probe of other cutting.In the FEN-LCR method, first and second oligonucleotide can link together after second oligonucleotide is cut, and produce the new copy of the amplicon of linearity or index amplification.Can be used for additive method of the present invention and comprise for example Walder (United States Patent (USP) 5,403,711) and Duck (United States Patent (USP) 5,011,769) disclosed probe cutting method, for example, wherein use RNA enzyme H cutting to contain the probe of RNA, or wherein can by suitable endonuclease for example the endonuclease IV of intestinal bacteria (E.coli) cut the probe that contains no base (abasic) subunit.Another example of probe cutting method is the recombinase polymeric enzymatic amplification (RPA) when it is comprised that by modification the probe that can cut combines with the target of amplification, for example (PLoSBiology 4:1115-1121 (2006)) and coworkers such as Piepenburg (for example, U.S. Patent Publication 2005/0112631 and PCT announce WO 03/072805) is described.Other cutting methods and enzyme also are disclosed in United States Patent (USP) 5,869, among 245 (Yeung) and 5,698,400 (Cotton etc.).In all situations, but the probe cutting produces detection label, described label contain one or more electrochemistry part, one or more be used for detecting subsequently in conjunction with right, for example as herein describedly partly detect but perhaps can use with the interactional electrochemistry of detection label.

Detection label can comprise one or more detectable labels 18.For detectable label, being meant can detected and/or quantitative any part.Detection label can directly or indirectly be detected.In the situation that detection label is directly detected, optional detectable label, for example the electrochemistry part of comprising of detection label.

Alternatively, detection label can be by indirect detection, for example by detection label and other detection reagent interaction.For example, detection label can comprise specificity in conjunction with right member, the haptens of traget antibody for example, or by the nucleotide sequence of complementary sequence mark.Detection label can comprise for example digoxin part, and it can be used as the target of the antibody of electrochemistry part mark.Other detection reagent can comprise the electrochemistry part, makes described reagent and combining of detection label be convenient to the Electrochemical Detection of detection label.

In certain embodiments, the present invention includes the target amplification of choosing wantonly in the presence of electrochemistry part through Electrochemical Detection.The mark that described electrochemistry partly can be used as on the detection label is combined, or as existing with the interactional detection reagent of detection label.Described electrochemistry partly can be can be with any part of transfer transport to electrode or self-electrode metastatic electron.The specific composition of selected probe is depended in the selection of part.Particularly preferred part comprises transition metal complex.Suitable transition metal complex for example comprises, Ru ²⁺(2,2 '-two pyridine) ₃(Ru (bpy) ₃ ²⁺), Ru ²⁺(4,4 '-dimethyl-2,2 '-two pyridines) ₃(Ru (Me ₂-bpy) ₃ ²⁺), Ru ²⁺(5,6-dimethyl-1,10-phenanthroline) ₃(Ru (Me ₂-phen) ₃ ²⁺), Fe ²⁺(2,2 '-two pyridine) ₃(Fe (bpy) ₃ ²⁺), Fe ²⁺(5-chlorine phenanthroline) ₃(Fe (5-Cl-phen) ₃ ²⁺), Os ²⁺(5-chlorine phenanthroline) ₃(Os (5-Cl-phen) ₃ ²⁺), Os ²⁺(2,2 '-two pyridine) ₂(imidazolyl), rhenium dioxide ¹⁺Phosphuret-(t)ed hydrogen, and rhenium dioxide ¹⁺Pyridine (ReO ₂(Py) ₄ ¹⁺).Some anion complex that can be used as part is: Ru (bpy) ((SO ₃) ₂-bpy) ₂ ^2-And Ru (bpy) ((CO ₂) ₂-bpy) ₂ ^2-, some zwitter-ion complex compound that can be used as part is Ru (bpy) ₂((SO ₃) ₂-bpy) and Ru (bpy) ₂((CO ₂) ₂-bpy), and wherein, (SO ₃) ₂-bpy ₂-be 4,4 '-the disulfonic acid root closes-2,2 '-two pyridines, (CO ₂) ₂-bpy ₂-be 4,4 '-dicarboxyl-2,2 '-two pyridines.The suitable substitutive derivative of pyridine, dipyridyl (bypyridine) and phenanthroline group can be applied in the complex compound with the metal of any front.Wherein, suitable substitutive derivative includes but not limited to 4-aminopyridine; the 4-lutidine; the 4-acetylpyridine; the 4-nitropyridine; 4,4 '-diamino-2; 2 '-two pyridines; 5,5 '-diamino-2,2 '-two pyridines; 6; 6 '-diamino-2,2 '-two pyridines; 4,4 '-diethylene diamine-2; 2 '-two pyridines; 5,5 '-diethylene diamine-2,2 '-two pyridines; 6; 6 '-diethylene diamine-2,2 '-two pyridines; 4,4 '-dihydroxyl-2; 2 '-two pyridines; 5,5 '-dihydroxyl-2,2 '-two pyridines; 6; 6 '-dihydroxyl-2,2 '-two pyridines; 4,4 '; 4 " triamino-2,2 ', 2 " three pyridines; 4; 4 ', 4 " triethylene diamine-2,2 '; 2 "-three pyridines; 4,4 ', 4 " trihydroxy--2; 2 ', 2 '-three pyridines; 4,4 '; 4 "-trinitro--2,2 ', 2 " three pyridines; 4; 4 ', 4 " triphenyl-2,2 '; 2 " three pyridines; 4,7-diaminostilbene, 10-phenanthroline; 3; 8-diaminostilbene, 10-phenanthroline; 4,7-diethylene diamine-1; 10-phenanthroline; 3,8-diethylene diamine-1,10-phenanthroline; 4; 7-dihydroxyl-1, the 10-phenanthroline; 3,8-dihydroxyl-1; the 10-phenanthroline; 4; 7-dinitrobenzene-1, the 10-phenanthroline; 3,8-dinitrobenzene-1; the 10-phenanthroline; 4; 7-phenylbenzene-1, the 10-phenanthroline; 3,8-phenylbenzene-1; the 10-phenanthroline; 4; 7-two spermine-1, the 10-phenanthroline; 3,8-two spermine-1; the 10-phenanthroline; two pyridos [3; 2-a:2 ', 2 '-c] azophenlyene, and 6; 6 '-two chloro-2,2 '-two pyridines.

For the ease of detecting, can be by the detection label that the probe cutting produces from uncut probe separates.Separating step can be by simple diffusion, and wherein detection label or complementary sequence connect or combination in position, makes the product of cutting to spread.Alternatively, or in addition, the product of one or more cuttings, or uncut probe can be from the reaction mixture mechanical separation.On the one hand, complementary sequence comprises functional group, the biological example element, and it is convenient to remove complementary sequence from reaction mixture, and therefore removes uncut probe.In the situation of using the functionalized complementary sequence of biotin moiety, the pearl of reaction mixture with Streptavidin bag quilt mixed, or the matrix that reaction mixture is modified by Streptavidin, can for example catch complementary sequence and uncut probe and be convenient to detect uncut detection label.

In certain embodiments, detection label comprises sequence label.Described sequence label can comprise polynucleotide, and can comprise the above-mentioned any nucleic acid composition that is used for complementary sequence.In certain embodiments, select described sequence label to make it not combine with the hybridization of amplicon template or with it.In addition, described sequence label is connected with complementary probe by the connection by enzyme effect cutting usually.Preferably, described sequence label can be by for example enzyme cutting of PCR of amplification of being convenient to nucleic acid amplification, particularly amplicon template.For example, can easily cut described sequence label by 5 ' nuclease of archaeal dna polymerase from probe.In certain embodiments, described sequence label and described complementary sequence are dna sequence dna.For example, described sequence label can comprise about 14 to about 40 bases.Alternatively, institute's sequence label can comprise about 14 to about 20 bases.Of this method special aspect, described sequence label is that 19 bases are long.

In certain embodiments, can use to contain 5 '-endonuclease or 5 '-enzyme of exonuclease activity removes the flank part and produces described sequence label from suitable hybrid complex, and described enzyme for example has described active flank endonuclease or archaeal dna polymerase.For example, described complex compound can have the form of A example in the scheme shown in Figure 2.

The complex compound (" cutting complex compound ") that is designated as A among Fig. 2 comprise as or contain the polynucleotide chain (" target chain ") of target sequence (" amplicon template "), this paper with from left to right 3 ' describe to 5 ' direction.With the hybridization of 3 ' side of amplicon template be 5 ' end and 3 with complex compound A left side ' hold upstream polynucleotide of (unmarked).In certain embodiments, the upstream polynucleotide can produce by the primer extension original position in the process of polymerase chain reaction (PCR).In other embodiments, the upstream polynucleotide can be used as the complete material that does not have further modification or extend provides.In the right side (5 ') of amplicon template side hybridization is the cut probe that contains in conjunction with the fragment of template and sequence label (or claim simply " label "), wherein, in conjunction with the fragment of template and the complementary sequence hybridization in the amplicon template, sequence label is not connected with the segmental 5 ' end in conjunction with template that can cut probe with the hybridization of amplicon template.Aforesaid cutting complex compound and the reaction of suitable enzyme provide and have comprised amplicon template, upstream polynucleotide and from the segmental cutting complex compound (being appointed as B among Fig. 2) that combines template that can cut probe.Also produced sequence label, as further described herein, it can discharge from the complex compound that is used for detecting subsequently.

In certain embodiments, sequence label can produce in 5 ' nuclease polymerase chain reaction.Provide and contained and relative terminal complementary first primer of duplex target sequence to be amplified and the reaction mixture of second primer, make the primer of winning to cause the synthetic of the amplicon template strand complementary chain of hybridizing by polymerase-mediated primer extension, and second primer can cause the polymerase-mediated synthetic of amplicon template strand or its copy by polymerase-mediated primer extension with first primer.Described reaction mixture also comprises aforesaid cutting probe, and described cutting probe has the fragment in conjunction with the amplicon template, and described fragment is in conjunction with the complementary sequence in the amplicon template between the first and second primer bonded sequences.When having triphosphopyridine nucleotide, preferably cause described cutting probe non-extensible at its 3 ' end, for example partly replace the ribose of 3 ' terminal nucleotide subunit or 3 ' hydroxyl of ribodesose by use hydrogen, fluorine, amino or other non-hydroxyls, or by using blocking groups for example 3 ' amino, 3 ' fluorine, 3 ' H, 3 '-phosphate radical, 3 ' methyl, 3 ' tertiary butyl or 3 ' trityl sealing, 3 ' hydroxyl.

For example, when first primer and cutting probe when all hybridizing with the amplicon template strand, can triphosphopyridine nucleotide (NTP) for example ATP, CTP, GTP or TTP or its analogue in the presence of the archaeal dna polymerase of use with dependence template of 5 ' nuclease extend described primer.Make its 3 ' end with 5 of described cutting probe ' when end is contiguous or overlapping (seeing the scheme I of above-mentioned A), the nuclease of polysaccharase cuts described probe when extending described primer, discharge flank part (seeing the scheme II of B) from described cutting complex compound thus.Because described primer extension passes through and the cutting probe of the described cutting of process, polysaccharase can dissociate from the amplicon template until described segmental remainder in conjunction with template in the fragment in conjunction with template of other sites cutting probes.Then, the primer that the is extended template that can be used as second primer works with replicating original (initial) amplicon template strand.

Primer that uses in above-mentioned PCR embodiment and probe can have the multiple length that is suitable for producing the detected flank that the inventive method detects and any length and the conformation in the conformation.Usually, primer can be about 18 to about 30 length of nucleotides, or 20 to 25 length of nucleotides, but also can use the length outside these scopes.For example, when containing the one or more nucleotide analogs that have enhanced base pairing avidity with respect to employed DNA or RNA, primer (when for example locking nucleic acid (LNA) or peptide nucleic acid(PNA) (PNA), can use short length.The fragment in conjunction with template of probe can be similarly any suitable length, for example, and usually between 8 and 30 Nucleotide.When probe also contains the timesharing of polynucleotide flank section, according to required detection specificity and sensitivity, described flank part can contain the polynucleotide sequence of any length, for example 10 to 40 Nucleotide.

First primer and second design of primers can be become produce the amplified production of any desired length, at least 30 or at least 50 length of nucleotides usually, and reach 200,300,500,1000 or more a plurality of length of nucleotides.Can provide probe and primer with any suitable concentration.For example, can provide forward primer and reverse primer with the concentration that is less than usually or equal 500nM, for example from 20nM to 500nm, or 50 to 500nM, or from 100 to 500nM, or from 50 to 200nM.

In certain embodiments, provide probe with the concentration that is less than or equal to 1000nM usually, for example, from 20nM to 500nM, or 50 to 500nM, or from 100 to 500nM, or from 50 to 200nM.Example condition for the concentration of NTP, enzyme, primer and probe was also shown in U.S. Patent No. 5,538 for 848 (incorporating into by reference thus), maybe can use the reacted constituent of commercially available acquisition (for example to realize, can be from Applied Biosystems, Foster City, CA obtains).

In the one side of this method, but, it modifies described sequence label by being combined with detection label.Can use electrochemical activity part or specificity in conjunction with to the member at the described sequence label of 5 ' end mark.Alternatively, described sequence label can combine with detection reagent or otherwise become after being cut and combine with detection reagent.As mentioned above, the sequence label of described cutting can detect in solution or catch or the detection of fixing back.Randomly, this method comprises the separating step that prevents that uncut sequence label from disturbing the sequence label of cutting to detect.Aforementioned method taught also is applied to not contain the label of polynucleotide sequence.

In the one side of this method, after the enzyme cutting, described sequence label is hunted down and/or is fixing.But comprise in the situation of detection label at described sequence label, but detect detection label then.In the situation of using detection reagent label sequence subsequently, but the immobilized sequence label of described detection reagent mark or with its complexing.

Described sequence label can be fixed owing to specificity or non-specific interaction.For example, described sequence label can use specificity in conjunction with the member is derived, and described specificity combination is to the combination of member's specificity or be complementary to particular space and the polar structure of specificity in conjunction with other right members.Typical specificity combination is to comprising part and acceptor, and can include but not limited to following pairing: Ag-Ab, biotin-avidin, vitamin H-Streptavidin, IgG-A albumen, IgG-G albumen, carbohydrate-lectin, enzyme-enzyme substrates, DNA-antisense DNA, and RNA-sense-rna.

Be or comprise in the situation of nucleotide sequence that described sequence label self can be by basic and described sequence label complementary label complement sequence capturing and/or fixing at described sequence label.For example, the sequence label of the described cutting antisense oligonucleotide of catching that can self be fixed in surface or other matrix is caught and is fixed.

The few sequence of antisense is used as acquisition sequence (label complement), can make that this method is varied, and for example, by designing multiple complementary probe, each probe has the characteristic sequence label.Be used in a plurality of isolating detection zones with the array of the capture oligo that is complementary to selected sequence label respectively separately and concentrate and catch each sequence label.

Comprising in the situation of complementary polynucleotide sequence 22 that with target sequence 21 complementary complementary sequences 20 described sequence label can be mixed with the other sequence of sequence complementary that comprises with other detection oligonucleotide 23 shown in Figure 3.By allow the cooling of PCR reaction mixture in the PCR working cycle, detection oligonucleotide in addition can and can still be hybridized with complementary probe bonded sequence label with the sequence label that cuts.The duplex 24 of the sequence label of the new cutting that forms and other detection oligonucleotide extends at free 3 ' end, cause forming more stable double-stranded DNA, and the duplex that has uncut sequence label does not still have productivity, and just dissociates after temperature increase subsequently.

The extension of described sequence label produce with in the new sequence of the immobilized sequence complementary in test section at a distance.On the one hand, immobilized sequence 26 is peptide nucleic acid(PNA) (PNA) sequences, makes it can not disturb the PCR process.Can pass through sequence label self (usually 3 ' or 5 ' end) as mentioned above but on the existence of detection label 28, but or by the combination of detection label and sequence label subsequently, or the combining of sequence label and immobilization sequence, detect the combination of the sequence label of extension.In addition, Fig. 3 also is used for non-PCR embodiment.

On the one hand, immobilized sequence is the PNA sequence that is immobilized onto on the gold electrode 30, and the existence with the sequence label that extends of cutting detects by means of the electroactive mark 28 of detecting of 5 of described sequence label ' end.

On the other hand, sequence label 32 comprises the inverted repeats of the stable ring-stem structure of selected formation 34, as shown in Figure 4.Therefore, when from complementary probe cutting sequence label, 3 of described sequence label ' end can cause himself certainly and extend 36.Can produce and the new sequence of immobilization sequence 38 complementary from elicitation procedure, described immobilization sequence 38 can be the PNA sequence and can be immobilized onto electrode 40.

On the other hand, the disclosure of invention provides and has used the probe that contains the hairpin loop that comprises the zipcode sequence.It illustrates the A-5C in Fig. 5.Probe 41 uses mark 42 marks with electrode activity and can comprise two polynucleotide sequences that link together by introns (spacer) 43.Usually for example ethanoyl or phosphate groups are protected from 3 ' exonuclease enzymic digestion (shown in Fig. 5 A) to the hydroxyl of probe 3 ' end by 3 ' blocking groups.Probe also can comprise sequence label, and described sequence label is produced unconjugated sequence label (shown in Fig. 5 B) by 5 ' nuclease (for example 5 ' nuclease of the archaeal dna polymerase in the PCR process) cutting.The flank of cutting has 3 '-the OH group.Subsequently, 3 of the flank of cutting ' end can be by the enzymic digestion of 3 ' exonuclease, for example exonuclease I II (shown in Fig. 5 C).It is active but also act on and have the 3 ' overhang that is less than 4 bases that exonuclease I II has double-stranded specific 3 '-5 ' exodeoxyribonuclease.If desired, after digestion step, exonuclease I II can be by heating and inactivation at 80 ℃.The enzymic digestion of 3 ' exonuclease stops at introns 43, and described introns 43 can only be for example organic connexon.Opposite side at described introns is the exclusive sequence label of probe 44.Therefore, after the sequence label on the flank of cutting becomes strand, it can with complementary immobilization sequence 45 hybridization, for example in conjunction with the complementary immobilization sequence (shown in Fig. 5 D) of electrode surface 46.The sequence label of uncut probe can not be used for hybridization owing to have hairpin loop.Therefore, before detecting, do not need separation cuts and uncut probe.After thermal cycling, 3 ' end exonuclease can be added into the PCR reaction, perhaps it can be stored in the sensing chamber that comprises electrode.As described herein, can in electrode on the Electrochemical Detection flank of catching.

On the other hand, add with sequence label 54 complementations but than long detection oligonucleotide 52, and when carrying out the sequence label cutting, after using the detection oligonucleotide that the sequence label of cutting is annealed, produced 3 '-the OH group can be extended and detect the oligonucleotide complementation, shown in hybrid complex among Fig. 6 56.Detectable label can be connected to sequence label (shown among Fig. 3 28) or detectable label can be connected to detection oligonucleotide (shown among Fig. 6 58).As mentioned above, new sequence can be complementary to and therefore in conjunction with immobilization sequence 60, described immobilization sequence 60 can be the PNA sequence and can be fixed in electrode 62.

Label: label complement complex compound can detect by any mechanism in the multiple suitable mechanism.Usually, under testing conditions, select to combine or form the label of complex compound by covalently or non-covalently interact (for example by hydrogen bonded, ion pairing or Van der Waals'attractive force) and label complement of specificity, described specificity covalently or non-covalently interact with passive interaction only diffuse into or diffuse through the size exclusion pore matrix or barrier relative.This specific specificity between label and the label complement interact can provide extra the specificity level to increase signal to noise ratio.In addition, testing conditions also can choose the signal that comprises from electrochemistry part wantonly can be by the electrochemical mediators or the matrix of its amplification.Partly be present in the situation of label or label complement at electrochemical activity, such part can be used as medium and works.Alternatively, one or more electrochemical mediators can exist in solution.The example of such medium is an xitix.Yet when the electrochemistry part self provided appropriate signal, described medium was not that operation of the present invention is required.

In certain embodiments, probe is covalently bound to the surface or the matrix that contact with the solution that the probe cutting wherein takes place.In the PCR embodiment, the amplicon of sex change can be hybridized with complementary probe.Then, suitable primer can be annealed to amplicon, and the extension of amplicon sequence can continue.In the extension process, enzymic activity can cause the complementary probe cutting.For example, in situation about increasing by PCR, complementary probe is by the endonuclease enzymic activity cutting of polysaccharase.

In the situation of using one or more sequence label mark complementary probe, the cutting of complementary probe causes the release of sequence label.Then, the degree of reaction can or quantitatively be measured by the existence of sequence label in the reaction soln.Be or comprise in the situation of electrochemical activity mark at sequence label, but the progress Electrochemical Detection of reaction.

Be in the situation of remote site detection label sequence that interactional mode is modified sequence label, remote site or the two is helpful to increase between remote detection site and the sequence label.Comprise in the situation of electrochemical activity mark that at sequence label remote detection site can be electrode surface.Alternatively, sequence label can concentrate on remote surface, and combines with the electrochemical activity mark subsequently.For example, comprise in the situation of polynucleotide that electrochemical activity mark alternative is in conjunction with polynucleotide, for example in electrochemical activity partly mixes in conjunction with the situation of the intercalating agent of polynucleotide (as described in embodiment 2) at sequence label.

Comprise in the situation of electrochemical activity mark at sequence label, can directly detect described mark, or detect described mark through one or more intermediate oxidation reduction (redox) activess.Described redox active thing can make electronics shuttle back and forth to the electrochemical activity mark from electrode surface, or makes electron shuttle to the another kind of redox active thing that shuttles back and forth.

Sequence label can be modified by comprising one or more parts of catching, with the interaction of enhancing with distant site.On the one hand, described distant site comprises golden metallic surface, and the described part of catching comprises sulfydryl or disulphide functional group.Avidity between sulfur-containing group and the gold surface causes the combination of sequence label.Sequence label can comprise paradigmatic structure or dendritic structure, comprises a plurality of functional groups that contain sulfydryl so that with the maximization that combines of gold surface.Electrochemical active group can be mixed the sequence label of sulfhydrylation, or can combine (seeing embodiment 7) before or after being adsorbed to gold surface with sequence label.

For example, shown in Fig. 7 A, can use PCR chamber 64, wherein said chamber comprises inert solid matrix 66 and away from the electrode 67 of solid substrate.With a plurality of nucleic acid chains 58 of required amplicon complementary can in conjunction with or otherwise be fixed in solid substrate.Described complementary strand can be functionalized by polyanion part 70, and wherein said polyanion part can be mixed a plurality of sulfydryls or disulphide functional group, or other functional groups of performance joining gold surface affinity.

Shown in Fig. 7 B, in amplification procedure, complementary strand 68 and amplicon 72 hybridization, polyanion part 70 is cut from described chain, and the spontaneous chemisorption that proceeds to gold electrode surfaces, shown in Fig. 7 C.Then, the interpolation of detection reagent 74 subsequently can be used for electrochemistry partly is transported to adsorbed sulfhydrylation sequence label, shown in Fig. 7 D.

For example, electrochemical active group can be mixed the hydrophilic branch-shape polymer based on polyoxyethylene.Described branch-shape polymer can mix a plurality of redox actives site (referring to embodiment 6).On the other hand, electrochemical activity part can be mixed a plurality of positive charges with through ion and/or electrostatic interaction and immobilized nucleotide sequence interaction (referring to embodiment 3).

Institute of the present invention choosing method can be designed for real-time detection and (for example monitor in the time period of selecting or the detection signal in a plurality of amplification cycles, or detect in each circulation or the signal of chosen point afterwards), or be used for end point determination, detection signal after amplification is finished wherein, and with itself and initialize signal or threshold signal comparison existing, not existing or measuring with definite target polynucleotide.For example, the described embodiment by 7 of Fig. 3 can help detecting in real time or end point determination, and other embodiments can be suitable for end point determination.

In addition, although this paper has described some scheme of using the probe that is fixed in the surface, these schemes are also applicable in the solution, as described in embodiment 8.Other governing principles that are used for the Compounds and methods for of Electrochemical Detection are found in European patent EP 733058 B and EP 871642 B and PCT and announce WO 98/20162 (Meade, Kayyam, etc.).

Microflow control technique

Method disclosed herein and material can use in conjunction with any instrument in multiple instrument or the equipment or equipment.Of the present invention favourable aspect, disclosed method can be implemented in conjunction with microfluidic device.Microfluidic device is to utilize to receive to rise or even the flat small volume fluidic equipment of skin premium on currency.Microfluidic device can be utilized multiple microchannel, micropore and/or the valve that is provided with different geometries, with preparation, transportation and/or analytic sample.These microchannels, micropore and/or valve can have millimeter (mm) to micron (μ m) or even the size of nanometer (nm) scope.Without limitation, microfluidic device also can be described as " mesoscale " equipment, or " micromachine " equipment.The responsible multiple power of microfluidic device makes fluid transport pass through described equipment, and wherein said power comprises injection, pump, the suction that applies, capillary action, osmosis and thermal expansion and contraction etc.In one embodiment, microfluidic device can be dependent on effective electric osmose to help the transportation of aqueous specimen, reagent and damping fluid.Multiple microfluidic device is described in the U.S. Patent No. 5,296,375 (1994) of authorizing Kricka etc., authorize the U.S. Patent No. 5,498,392 (1996) of Wilding etc., and the International Publication No. WO 93/22053 of Wilding etc., they incorporate the application separately by reference into.

The microfluidic device that can be used for detecting the target polynucleotide sequence generally includes the matrix that wherein forms a plurality of microfluidic chamber and passage, and the coverture that is attached to described stromal surface.This equipment generally includes inlet and one or more chamber, described inlet is configured to receive the sample that contains at least a target polynucleotide sequence, described chamber is provided for making probe to contact with biological sample, but wherein said probe contains complementary fragment of aforesaid target and detection label.Described microfluidic device can comprise one or more chambers, but described chamber is provided for making described sample to stand the polymerase chain reaction, cut detection label and the label of release is combined to form immobilized label with the label complement that is coupled to electrode from described probe: label complement complex compound.Usually detect and label by being arranged for: the instrument of the electrochemical signals that the existence of label complement complex compound is associated detects and/or quantitative label: label complement complex compound; And the existence/amount of the target polynucleotide sequence in detected/quantitative signal and the described sample is relevant.

The typical microfluidic device that is suitable for the amplification of target nucleic acid polymer and detection subsequently is shown in Fig. 8.Diagram has been described microfluidic device 162, and for simply, it does not comprise all microchannels and the micropore that can be present in described microfluid system.Microfluidic device 162 comprises electrode assemblie 164 and controller 166, and controller 166 is arranged to the current potential of control application in electrode assemblie 164.Described controller is usually as power supply and the instrument of implementing current measurement.

The upstream of electrode assemblie 164 is the sample preparation zones 168 that are provided with the microfluidic device for preparing interested sample solution.Sample preparation zone 168 comprises that setting can be used for the reagent storage 170 of the reagent of specimen preparation process with supply.Each chamber of microfluidic device is interconnected through being suitable for by the microfluidic channel system 172 of this equipment transportation reagent, sample solution and reaction product, and especially these matter transportation to electrode assemblie 164 or self-electrode assembly 164 is transported these materials.

Sample (biological sample usually) can be through the 174 introducing microfluidic devices that enter the mouth.Sample can be introduced by injection, capillary action or any other suitable introducing method.Optional pre-treatment hole or the chamber 176 of comprising of described microfluidic device.If desired, pretreatment chamber 176 allows biological sample and the reagent mix that is used for treatments of the sample, liquefaction or dilution.Described pre-treatment can be used for providing flowability to be enough to improve the biological sample of the validity of downstream process.

After this pre-treatment, can through strainer 178 sample be transported to reaction chamber 180 by electro-osmotic pumps usually.Strainer 178 can be used for removing the macrobead that can disturb downstream reaction.Described strainer can be can be compatible with the biological sample of being studied any suitable filtering medium.For example, strainer 178 can comprise the film filter with for example about 100 μ m of larger aperture, or fritted glass filter.

Reaction chamber 180 can be used for the cracking and the sex change of sample.As shown in Figure 8, the reagent that is used for cracking and/or denaturation process can add from reagent storage 182 through valve 184.Cracking and/or denaturation process can be by quickening through heating unit 86.Heating unit 86 can comprise that one or more lamps of heating, heating coil, fluid heat exchanger or any other suitable heating unit and fan, hair-dryer, heat exchanger or other are used to cool off the suitable refrigerating unit of reaction chamber 180.

After cracking and/or sex change, sample is transported to PCR chamber 188 by way of strainer 190.Different with thicker strainer 178, select the strainer 190 of about 5-10 μ m pore size, be intended to remove the unwanted by-products of cracking/denaturation process.In case sample arrives PCR chamber 188, is added into PCR chamber 188 through valve 194 from the reagent that PCR reagent storage 192 will can be used for the PCR process.In one aspect of the invention, the reagent that is added into reaction chamber comprises aforesaid probe of the present invention, but it contains and target polynucleotide complementary fragment and the detection label that can cut.Can be by heating unit heating PCR chambers 188 196.Similar to heating unit 186, heating unit 196 can be for ease of any suitable heating unit of PCR process, and generally includes refrigerating unit, makes and can realize heating cycle in PCR chamber 188.Selected suitable thermocirculator is described in the U.S. Patent No. 5,455,175 (1995) of authorizing Wittwer etc., and this patent is incorporated the application by reference into thus.Should understand the PCR chamber and can be used for the isothermal pattern, not needing be used for the application of thermal cycling.

After finishing PCR, sample is transported to tank room 197 by the strainer 198 that another has about 5-10 μ m aperture.Tank room 197 comprises the electrode 200 by controller control.Although be described as being electrically connected on controller 166 among Fig. 8, the controller of electrode 200 can be identical or different with the controller of electrode 164.Suitable reagent can be added into tank room 197 from reagent storage 202 through valve 204.Then, in the PCR process, can combine wherein optional existence detection and label: the electrochemical signals that the existence of label complement complex compound is associated with the label complement that is coupled to electrode 164 through one or more electrochemical mediators by the label of nuclease from the probe cutting.

After finishing amplification, current potential can be put between the electrode 206 of the electrode 200 of electrolysis micropore 197 and electrolysis micropore 208.Usually, electrode 200 is remained on cathode potential, electrode 206 remains on anode potential, makes through gel 210 electrophoresis to take place in conjunction with thin layer crosslinked polyacrylamide gels 208.When electrophoresis took place, electrode 164 was generally electric neutrality.

Polyacrylamide gel uses the low cross-linking preparation usually.Under these deposition conditions, all nucleic acid fragments except the DNA of complexing and hybridization all migrate to tank room 210.Bigger nucleic acid complex compound is owing to its large size falls behind with the relative thin layer crosslinked polyacrylamide gels that can not penetrate.

Although described electrophoretic separation, but any suitable separation method all can be used for the label of separation cuts, comprises that for example mechanical separation, size exclusion chromatography,, use deutero-pearl or matrix (for example comprising the matrix that magnetic bead or Streptavidin are modified) are separated.

Described with the following examples as mentioned, in case label: label complement complex compound combines with electrode surface, but can detect and/or quantitatively be present in detection label in the complex compound.

Test kit

The method according to this invention, probe disclosed herein can provide with the form of the test kit that is used to detect the target polynucleotide sequence.But optional one or more probes that contain with selected target polynucleotide sequence complementary fragment and detection label that comprise of these test kits.Described test kit can comprise that many independent and different target polynucleotide sequences are had optionally probe.Described test kit can comprise having probe different and label that can detect separately separately.Described test kit is optional to be comprised when form label when described probe cuts label: one or more label complement of label complement complex compound.Described test kit is optional to be comprised corresponding to the sample of the target polynucleotide sequence of the probe that exists in the described test kit, for example is used for alignment purpose.Described test kit is optional to comprise that one or more are suitable for preparing the damping fluid or the buffer reagent of probe solution and/or target polynucleotide sequence solution.

Described test kit is optional to mix other reagent, includes but not limited to electrochemistry calibration criterion product, enzyme, enzyme substrates, nucleic acid staining agent, traget antibody and/or other other detection reagent.Probe of the present invention is optional to can be used as lyophilized solid or is used for the suitably prediluted solution existence of mensuration as spissated mother liquor or preparation.Usually, described test kit is designed to be applicable to automatically and/or high throughput assay, and therefore is designed to be suitable for fully microfluidic methods and/or other automatic high throughput methods.

Electrochemical composition

The present invention also provides electrochemistry compound for example as herein described.Described compound can be used for multiple electrochemical applications, includes but not limited to detect the method for target polynucleotide sequence as herein described.

For example, the disclosure of invention provides hereinafter two osmiums (bis-osmium) compound of scheme 5 described forms.

The invention also discloses the compound and the scheme 10 described compounds that use the structurally associated of optional aromatic alkyl amine reactant generation of 21 forms of compound shown in the scheme 10.

The invention also discloses poly-osmium (poly-osmium) compound of scheme 6 (for example compound 10 and 11), scheme 7 (for example compound 14 and 15), scheme 15 (for example compound 2), scheme 16 (for example compound 4), scheme 17 (for example compound 6) and scheme 18 to 20 described forms, and analogue and derivative.

Embodiment

The preparation of embodiment 1:DNA amplification probe

Preparation has optionally probe to the amplification of listeria spp cytolysin (Hly) gene of food pathogen monocytogenes listeria spp (Listeria monocytogenes).Complementary probe (or primer) at 5 of sequence ' end by biotinylation.Complementary probe also contains the vitamin H that is positioned at last dT residue place, and prevents 3 ' end amino that PCR process middle probe prolongs.Complementary sequence is modified by the sequence label of 19 bases that following boldface letter shows.

5′-CACGAATCAAAGCTCTCAACGCCTGCAAGTCC ^*AAGACGCCA-3′NH ₂

T wherein ^*The biotinylated base of mark.The pearl that biotinylation allows to use Streptavidin to modify is removed complementary sequence.

The existence of sequence label does not influence the pcr amplification of target sequence, as by with the amplicon of control reaction comparison electrophoretic analysis confirmed.

The forward and the reverse primer that use in the PCR process are as follows:

5 '-CATGGCACCACCAGCATCT and

5 '-ATCCGCGTGTTTCTTTTCGA, wherein 5 of each primer ' end is used to use the Streptavidin pearl to remove also by biotinylation.

Carry out PCR reaction 10 minutes at 95 ℃, containing 6mM MgCl then ₂The PCR buffer A (Applied Biosystems carries out (95 ℃ of 15 second, 63 ℃ 1 minute) x40 circulation in Ca#N808-0228).Primer and concentration and probe concentration are respectively 200nM and 400nM.(the 0.1M acetic acid triethanolamine, pH6.8) balance is from the HPLC post XTerroMSC18 (2.5mmx50mm) of Waters company to use 7%ACN (acetonitrile)+93%TEAA.Divide three steps carry out gradient elution (0.3ml/ minute, 60C): step 1:7%ACN+93%TEAA, 7 minutes; Step 2:10%ACN+90%TEAA, 10 minutes; Step 3:35%ACN+65%TEAA, 10 minutes.(ACN-acetonitrile, the acetic acid triethanolamine of TEAA-0.1M-pH6.8).Carry out PCR 10 minutes at 95 ℃, carry out (95 ℃ of 15 second, 63 ℃ 1 minute) x40 circulation then respectively at 200nM primer and 400nM concentration and probe concentration.

Finish polymerase chain reaction (PCR) afterwards, reaction mixture is being adjusted to 1M salt by adding NaCl solution.Then with reaction mixture with the magnetic bead incubation of streptavidin bag quilt 15 minutes.Biotinylated complementary probe comprises the complementary probe that still contains uncut sequence label, is adsorbed in magnetic bead and removes from reaction mixture.Biotinylated amplicon is similarly removed from mixture, keeps the sequence label of cutting in the solution.

Use 5 ' end uses the sequence label of fluorescent mark (fluorescein) mark to increase and cuts, identify by HPLC then, show the cleaved products that produces 20 base length, and use the pearl consumption reaction mixture of Streptavidin bag quilt to remove uncut probe.As shown in Figure 9, parent material with the 3000 listeria spp DNA that copy cuts about 50% probe, and has the oligonucleotide that the template contrast does not contain cutting, yet, produce in reaction mixture after the 3 copy templates, this method enough produces detectable cleaved products delicately.

But sequence label is Electrochemical Detection also.After being to consume on the pearl of Streptavidin bag quilt, the sample and the no template contrast solution that contain target all are exposed to gold electrode separately, and described gold electrode is by functionalized with the immobilized capture probe of sequence complementary that cuts.Directly make this solution 45 ℃ of hybridization 1 hour, then, use 10mM Tris, 100mM NaCl (pH=8) rinsing from the pearl separating step.Then in electrochemical cell with electrodes exposed in being used in 10mM Tris, electrocatalysis osmium 2 among the 100mM NaCl (pH=8), 100 μ g/mL screw-type intercalating agent (threading intercalator) solution of two (two pyridines) (referring to structure of the scheme 1) marks of 2-.(20mM phosphoric acid salt and 100mM sodium-chlor after the phosphate buffered saline buffer washing that pH7) washing and the NaCl in 10% ethanol are saturated, obtain base current at 0.2V vs Ag/AgCl in 200 μ L PBS using the PBS damping fluid.When adding 800 μ L 6.25mM xitix matrix, electric current is with proportional with the amount of intercalating agent and increase (see figure 10) pro rata with the amount of the target of hybridization thus.

Target electrode and electrochemical appliance.Use has 100 dust Cr layers, is that (blanket formula sputter CA) applies 4, and " silicon chip (siliconwafer) comes the preparation work electrode to 2000 dusts gold layer for Lance Goddard Associates, Foster City then.The manual cut silicon chip forms the fragment of about 1cmx1.5cm then.Use UV-Ozone sanitising agent (Model 42, Jelight Company, and Inc, Irvine, CA) cleaning electrode is 20 minutes, is exposed to dehydrated alcohol then 20 minutes.Then with electrodes exposed in 0.5 μ M solution of the DNA capture probe of the sulfhydrylation in 1M potassium phosphate buffer (pH=7) 10 minutes, then 5 second water rinse.And then sequence capture probe is shown in as follows:

5′(DTPA)(DTPA)(DTPA)AAA?AAA?TTG?AGA?GCT?TTG?ATT?CGTG?3′

Wherein DTPA is the scheme 20 described phosphate radical connecting key types that contain disulfide linkage, its by dimercapto phosphoramidite preparation (Glen Research, Sterling, VA).The 1mM aqueous solution that electrode is spent the night be exposed to the sulfydryl hexanol then, be then 30 second water rinse.Dried electrode under nitrogen then.

Can in electrochemical cell, use CHI type 660B potentiostat (CH Instruments, Austin, TX) with 1/8 " ID O type circle limit working electrode district and Ag/AgCl reference electrode (Cypress Systems, Lawrence, KS) and platinum coil counter electrode carry out electrochemical measurement.

Embodiment 2: the probe of use ferrocene (Fc) mark carries out the electrochemical monitoring of PCR process

In this experiment, identical among the composition of reaction mixture and amplification scheme and the embodiment 1 is except described probe is partly replaced (" Synthegene ", Houston at its 5 ' end by ferrocene, TX) and the listeria spp DNA of 100,000 copies as template.With six test tubes that contain the identical PCR reaction mixture of 50 μ l equal portions put into 9700 thermal cyclers (Applied Biosystems, Foster City, CA).After 20,26,29,32 and 38 circulations of amplification, take out test tube in turn from thermal cycler.After 38 circulations, take out test tube corresponding to no template contrast (NTC).As described in embodiment 1, use the 20-mer fragment (but detection label) that contain ferrocene of Streptavidin magnetic bead from uncut probe purifying cutting.The Fe20-mer (in 1M NaCl) of the purifying of 30 μ l equal portions is positioned over gold electrode surfaces to make and complementary capture oligo hybridization in 1 hour.After using the quick rinsing electrode of PBS damping fluid, each electrode is put into embodiment described chamber 1.Use about 100ul PBS buffer filled chamber, and the Electrochemical Detection of carrying out as shown in Figure 11.

The electrochemical signals amplitude depends on the PCR round-robin quantity of being implemented.Figure 11 A has shown that the gel electrophoresis analysis of amplicon and densometer are quantitative.Figure 11 B is the graphic representation of amplicon quantity and PCR loop number.Figure 11 C has shown the Electrochemical Detection result.Figure 11 D has shown the graphic representation of electrochemical signals value (peak district) with the PCR loop number.The curve correspondence that Figure 11 B and 11D show shows that this method allows Quantitative Monitoring PCR reaction.

Embodiment 3: the preparation of electrocatalysis nucleic acid intercalating agent

Detection reagent is chosen wantonly and is the electrochemistry part as the nucleic acid chains intercalating agent.The intercalating agent of example has the formula shown in the following scheme 1

Scheme 1

And by being similar to (Anal Chem.2005,77 (1), method preparation 126-134) such as Tansil.Will be in the two neck round-bottomed flasks of 50mL of packing into of 6.0mL (24.92mmol) 1 (3-aminopropyl) the imidazoles solution among the anhydrous THF of 3.0mL, described flask is equipped with water cooled condenser, equalized pressure adds funnel and 1/4 " magnetic stirring bar.Reaction scheme provides in scheme 2.

Scheme 2

In 15 minute period, continue to stir down to this solution and make an addition to 0.6058g (2.26mmol) 1,4,5 among the anhydrous THF of 3.0mL, 8-naphthalene tetracarboxylic dianhydride.Heated this reaction mixture 24 hours in adverse current.The color of reaction mixture became very dark brown in 30 minutes from bright yellowish orange.When the reaction times finishes, reaction mixture is cooled to room temperature and adds 20mL acetone (3: 1 v: v) under stirring fast.Make this mixture leave standstill 5 minutes in room temperature.Pour out supernatant layer.In residue, add 10mL methyl alcohol, stir the slurry that is produced.Collect yellow crystal by suction filtration.Use the quick washing and filtering piece of methyl alcohol and use suction to carry out dry air.(1: 1 v: v) recrystallization precipitates, and then 40 ℃ of vacuum-dryings of spending the night, produces the product of 0.236g (22% productive rate, the productive rate 85% of previous report) by 20mL chloroform/ethanol mixture.Product ¹That is reported in H-NMR spectrum and the document is in full accord.The scheme of this reaction is provided in the scheme 3.

Scheme 3

Under in 10 minute period, continuing to stir, to the 0.642g in 16.0mL ethylene glycol (0.52mmol) Os (bpy) ₂Cl ₂Add 0.236g (0.25mmol) PIND (referring to the structure in scheme 3 left sides) in the solution.Final mixture 30-40 minute of 180 ℃ oil bath temperature heating.By removing ethylene glycol, produce heavy-gravity oiliness residue at 60 ℃ of rotary evaporations.The powerful stirring added 150mL TNF down in this heavy-gravity residue, form final precipitation.By the suction filtration collecting precipitation, use anhydrous TNF rinsing, and, produce the very easily water-soluble and alcoholic acid mulberry powdered product of 129.3mg (50% productive rate, the productive rate 78% of previous report) through the filter drying.By contrast, parent material (Os (bpy) ₂Cl ₂Be not soluble in water and be dissolved in alcoholic acid mulberry powder hardly.That is reported in the UV visible spectrum of this product and the document is consistent.

Embodiment 4: polycation electrochemistry part

Aspect the selection of method disclosed by the invention, sequence label is fixed in remote electrode before detection.For example, sequence label comprise one or more sulfur-bearing functional groups (as sulfydryl or disulfide linkage) and as described in electrode comprise in the situation of golden metallic surface.In these areas, can be by adding the detection of partly being convenient to sequence label with the electrochemistry of adsorbed sequence label electrostatic interaction.Described electrostatic interaction does not rely on or needs the hybridization of surperficial polynucleotide probes and described sequence label.

The bonded sequence label of polycation and sulfhydrylation combine the sketch that is shown in the following scheme 4:

Scheme 4

Wherein, polycation comprises a plurality of reversibility redox center.Static bonded redox center can mediate the detection at electrode surface, as shown in figure 12.Note " matrix " of Figure 12 but can refer to be convenient to any redox active compound of detection of detection label or material (here the bonded label be for polycation and with the ssDNA flank (for example osmium complex) of the polycation part complexing that contains the redox active part, the existence of wherein said redox active part can be by oxidation reduction cycle detection shown in Figure 22).

Embodiment 3A. redox reversible polycation can comprise α, and the osmium complex of ω-diimidazole alkane is shown in following scheme 5.

Scheme 5

Embodiment 3B. alternatively, polycation electrochemistry part can comprise other osmium complexs, and is as mentioned below.Two osmium complexs or four osmium complexs synthesize by making the reaction of suitable diacid or tetracid and thionyl chloride respectively.Except additive method, the acid chloride compounds that is produced can be by the vacuum distilling purifying.In some aspects, acid chloride compounds can be converted into its N-hydroxy-succinamide (NHS) ester resemblance.The NHS ester can prepare by using two succinimdyl carbonates (DSC) to handle acid in the presence of diisopropylethylamine (DIPEA).Response strategy is shown in scheme 6.

Scheme 6

Embodiment 3C. alternatively, two osmium complexs or four osmium complexs can be prepared according to scheme hereinafter described.2-in aqueous ethanol (2-aminoethyl) pyridine and Os (bpy) ₂Cl ₂Reaction, precipitation and purified product produce required osmium complex.Diacyl chlorine and four acid chloride compounds (the NHS ester analogs that comprises them) can prepare according to such scheme.Synthesis strategy is shown in scheme 7.

Scheme 7

Embodiment 3D. In yet another embodiment, the redox reversible polycation can be the polymkeric substance that comprises a plurality of electric activity center, for example osmium complex.Described polymeric polycation can be similar to U.S. Patent No. 5,262 by basis, and the scheme of being reported 035 (incorporating into by reference thus) is handled poly-(4-vinylpyridine) and Os (bpy) ₂Cl ₂And prepare.In order to prevent α-elimination, can use methyl group to replace 2-amino or the 2-hydroxyethyl that is connected with the pyridine ring system at high pH.Synthesis strategy is shown in scheme 8.

Scheme 8

Embodiment 3E. is in selected optional embodiment, and polycation electrochemistry part can as mentioned belowly be prepared by poly-(1-vinyl imidazole).Polymer backbone can prepare as the solution polymerization that initiator carries out the 1-vinyl imidazole by use ammonium persulphate in the presence of TEMED.The radical polymerization of 1-vinyl imidazole also can cause by water-soluble azo compounds, for example 2,2 '-two [2-(2-tetrahydroglyoxaline-2-yl) propane] dihydrochlorides of azo.The polymkeric substance that is produced 18For water-soluble and can carry out purifying by for example dialysis.Use for example Os in aqueous ethanol (bpy) ₂Cl ₂Handling the polyimidazole compound causes a plurality of redox actives center to be added on the polymkeric substance.Imidazole ring seldom is still in the situation of unsubstituted high-degree of conversion therein, and the polycationic compounds that is produced can be by by THF precipitate and separate and purifying.In some aspects, required monomer for example N,N-DMAA can use the copolymerization of ethene imidazolium compounds, so that the specific physics of the polymkeric substance that is produced and chemical property are as required and different.Synthesis strategy is shown in scheme 9.

Scheme 9

Embodiment 3F. is in selected embodiment, polycation electrochemistry part can comprise the water-soluble polymers of hydroxy azetidine (hydroxylazetidinium) group that has along polymer backbone, described water-soluble polymers is by N, the polymerization of N-diallyl-3-hydroxy azetidine salt or copolymerization and prepare.Alternatively, the POLYCUP polymkeric substance can be by using hexanodioic acid polymeric amide and N, N-two (2-aminoethyl) amine processing list chloropharin and preparing.Polymkeric substance 20Be high-cation and very easily water-soluble.The azetidine muriate has hyperergy for amino and carboxyl.Redox reversible imidazolyl-Os (bpy) ₂Cl can mix as described and produce 21, described 21Can be by separating by methyl alcohol or TNF precipitation and can passing through the dialysis purifying.

Scheme 10

Embodiment 3C. alternatively, electroactive ferrocene complex compound (rather than osmium complex) can pass through 20With the reaction of 2-aminoethyl ferrocene or acetic acid ferrocene and mix.

Embodiment 3D. in a particular embodiment, the POLYCUP polymkeric substance with 12% 20The equal portions of solution add the polyfunctional amine poly-(ethyleneimine) of equivalent 2410% aqueous solution in.This reaction mixture is converted into solid gel in heat in 50 ℃ of water-baths 15 minutes, shows 20In the azetidine ring for the hyperergy of amine functional group.Work as polyfunctional amine 24By monofunctional amines 3-aminopropyl imidazoles 25Replace with 20During reaction, do not form gel.Referring to scheme 11.

Scheme 11

Embodiment 5:1,1 '-preparation of (1,6-hexane two bases) two (imidazoles)

Under agitation to 250mL three neck round-bottomed flasks pack into 3.0mL water and 5.82g (103.7mmol) potassium hydroxide, described flask is equipped with magnetic stirring bar, adds funnel and Dean-Stark distiller.When KOH decomposes, add 100mL toluene, add 6.81g (100.0mmol imidazoles then.When imidazoles decomposes, add the DMSO of 40.0mL.

Heating and stir this mixture in 133 ℃ of oil baths, up to do not have water again condistillation go out or about 4 hours.Produce about 8mL water.

When the temperature of reaction mixture is brought down below 90 ℃, drip 1 of 12.07g (49.5mmol), the 6-dibromo-hexane under continuing to stir.In the interpolation process, form white precipitate.

Stirred this mixture 17 hours at 85-90 ℃.

Remove Potassium Bromide by filtering.(49 ℃, 0.5mmHg) toluene and the DMSO that removes in the filtered liquid produces heavy-gravity oily matter by underpressure distillation.

Vacuum distilling is white crystalline solid (90 ℃ 0.02mmHg), and are passed through in a small amount ¹The H-NMR spectrography is accredited as imidazoles.Use methylene dichloride and the carbinol mixture of 1: 1 v: v to make residual oily matter stand chromatogram purification, produce 8.0g (74% productive rate) product.This product ¹H-NMR spectrum is consistent with expected structure.Synthetic schemes is shown in scheme 12.

Scheme 12

Embodiment 6: osmium replace 1,1 '-preparation of (1,6-hexane two bases) two (imidazoles)

In the 500mL round-bottomed flask that magnetic stirring bar and distiller are housed, add 1 of 2.0g (3.5mmol) bipyridyl osmium dichloride, 0.38g (1.76mmol), two (imidazoles) hexanes of 6-, 100.0mL ethanol and 100.0mL deionized water.This reaction mixture of heating produces mulberry solution to gentle adverse current 16 hours in oil bath.Then, this reaction mixture is cooled to room temperature, under reduced pressure removes solvent.

In the THF of 60mL, ground residue 15 minutes.By suction filtration collecting precipitation thing, use the THF rinsing to remove 1, two (imidazoles) hexanes of 6-, and suction air drying produce the mulberry crystalline powder.

In 55 ℃ of these products of vacuum-drying that spend the night, produce 2.26g (94.5% productive rate) product.This product ¹H-NMR spectrum is consistent with the structure of expection.Synthetic schemes is shown in scheme 13.

Scheme 13

Embodiment 7: compound 7 is in the reaction of the electrode of dna modification

By having 10nm chromium layer, being that the blanket formula sputter of 500nm gold layer applies oxidized silicon chip and comes the preparation work electrode then.Use commercial UV-Ozone sanitising agent to clean the line fragment 30 minutes of this silicon chip then, in dehydrated alcohol, soaked 20 minutes then.Dried electrode under nitrogen then.Use the PDMS packing ring to limit exposure zone, the DNA chain of 25 bases that the DTPA of different concns is modified placed electrode surface 20 minutes (wherein DTPA is the phosphoric acid ester connexon that contains disulfide linkage of scheme 20 shown types), was exposed to the 1mM sulfydryl hexanol 10 minutes in the water then.After use water rinse, then with electrodes exposed in Millipore water 7The 100 μ g/mL solution of (referring to scheme 14) 1 minute, and rinsing 20 minutes in water.

Scheme 14

Then electrode is packed into have 3mm diameter O shape circle electrochemical cell to limit electrode district.Use electrode to use platinum counter electrode and Ag/AgCl reference electrode to carry out the cyclic voltammetric collection of illustrative plates in 10mM Tris damping fluid (pH8) second, as shown in figure 13 at 100mV/.

The integration electric charge that will detect then is with respect to compound 1With 7DNA concentration draw.The graphic representation that is produced is shown in Figure 14.

Embodiment 8: dendroid electrochemistry part

The redox reversible medium can (prepare by Polymer Source (Quebec, Canada) commercially available) through poly-(ethylene oxide) succinimide terminated tetramethylolmethane of four arms.As mentioned below, the reaction of erythritol intermediate produce a kind of then with Os (bpy) ₂) Cl ₂Reaction produces the compound of four arm redox part.The compound possess hydrophilic property that is produced, and more insensitive for chemisorption.For each polycation as herein described, counterion can be through for example ion exchange resin or the dialysis and being substituted under greater than 7 pH of any suitable ion-exchange techniques.

The synthesis strategy for preparing four arm electrochemistry part is shown in scheme 15.

Scheme 15

The redox reversible medium also is prepared into the arm with other quantity.For example, six arm portions can similarly use six arms to gather (ethylene oxide) succinimide-terminated Dipentaerythritol (also commercially available acquisition (Polymer Source, Quebec, Canada)) prepares.Shown in scheme 16, the reaction that contains amine complex of succinimide ester cpds and transition metal produces six arm dendroid media.

Scheme 16

The optional example of six arm dendroid electrochemistry part can be as following scheme 17 listed being prepared, and wherein poly-(ethylene oxide) succinimide terminated TriMethylolPropane(TMP) of six arms is used to prepare the six arm dendroid media that comprise based on the redox center of osmium.

Scheme 17

Embodiment 8: comprise the preparation of the detection label at osmium redox center

The detection label that can comprise the electroactive part of osmium according to the synthesis strategy preparation of scheme 18.

Scheme 18

Surrogate as based on the detection label of imidazoles also can prepare the detection label that comprises the osmium center of mixing pyridine ring, shown in the synthesis strategy in the scheme 19.

Scheme 19

The detection label of mixing osmium redox center and disulfide linkage part prepares shown in the synthesis strategy of scheme 20.

Scheme 20

As mentioned above, the oligonucleotide parent material of disulfide linkage mark self can be used as detection label, and this is because disulfide linkage partly is convenient to be adsorbed to golden metallic surface, and the polyanion phosphate groups is convenient to partly interact with polycation electrochemistry.Yet the existence permission detection label of terminal amino group further is modified into comprises osmium electrochemistry part.

Embodiment 10: charged label catching on the gold electrode of unmodified

The PCR condition is with identical described in the embodiment, except having the reporter probe of following sequence, wherein DTPA is the phosphoric acid ester connexon that contains disulfide linkage of scheme 20 described types, and 3 DTPA in the probe promote chemisorption to electrode surface and the amixia incident: (DTPA) (DTPA) (DTPA) CAC GAA TCA AAG CTC TCA ACG CCT GCAAGT CCT AAG ACG CCA (vitamin H)

After PCR, use the above-mentioned scheme that is used for the Dynal magnetic bead of Streptavidin bag quilt to remove uncut probe and amplicon then.

Preparation as discussed previously and cleaning electrode.After the Dynal pearl of using Streptavidin bag quilt separates uncut probe and amplicon, solution is exposed to the gold electrode 20 minutes of new cleaning, be then 5 second water rinse and be exposed to the 1mM aqueous solution 10 minutes of sulfydryl hexanol.Then with electrodes exposed in the aqueous solution of specified cationic oxidation reduction reporter molecules 10 minutes, and 20 seconds of rinsing in water then.The solution of record 800nM probe and compound 21 (shown in the scheme 10) is with respect to the cyclic voltammetric collection of illustrative plates of Ag/AgCl reference electrode and platinum counter electrode, as shown in figure 15.Record 800nM probe and compound 7 solution are with respect to the cyclic voltammetric collection of illustrative plates of Ag/AgCl reference electrode and platinum counter electrode, as shown in figure 15.

Embodiment 11: the label that detects cutting in the presence of uncut probe

This embodiment has described following embodiment: promptly wherein the label complement has specific sulfydryl part (partly being provided by DTPA) by performance herein to joining gold surface (as gold electrode) and is fixed in electrode, and can cut probe contain (i) but be connected to the polynucleotide sequence of the complementary fragment 5 of target ' end and (ii) detection label, it label complement that comprises that the label of cutting is immobilized is caught the complex compound that contains osmium that is used for Electrochemical Detection afterwards.

Can be by selecting suitable capture probe (label complement) to detect and/or measure the probe of cutting in the presence of uncut probe, wherein capture probe makes the instability of catching of uncut (complete) probe near the label that does not cut probe of electrode surface by selective binding.Therefore, than the not cutting label segment of bonding probes, capture probe is more stably hybridized with the cutting label.

Prepare 50 μ l reaction mixtures, described reaction mixture contains: 1X PCR buffer A (Applied Biosystems, P/N N808-0228), 6mM MgCl ₂, 200 each dNTP of μ M, 200nM forward and reverse primer (seeing embodiment 1), the probe of 400nM 5 '-Os mark (row scheme 21 is used to be coupled to the osmium complex marking agent of each probe 5 ' amino as follows), the GoldAmpliTaq of 0.05 unit ^TMThe monocytogenes listeria spp DNA of polysaccharase and 3,000 copies.

Three kinds of various combinations that can cut probe and fixed labels complement have been detected, described in hereinafter combination, the probe of the cutting of Shang Mian sequence (underlining) expression osmium mark to be detected wherein, following sequences are represented by the 3DIPA part in its 5 ' end connection electrode and contain the capture probe of the label complement of combination tag sequence:

Combination #1

Label 1:5 '-CACGAATCAAAGCTCTCAAX-3 '

Cap 1:

3′GTGCTTAGTTTCGAGAGTTGTGTGAACTTAACGACCCCAAAAAAA5′

Combination #2

Label 1:5 '-CACGAATCAAAGCTCTCAAX-3 '

Cap 2:3 ' AAAAAAGTGCTTAGTTTCGAGAGTT (C18) 5 '

Combination #3

Label 2:5 '-ATCAAAGCTCTCAAX-3 '

Cap 2:3 ' AAAAAAGTGCTTAGTTTCGAGAGTT (C18) 5 '

Wherein X=CGCCTGCAAGTCCTAAGACGCCA-3 ' (target-specific fragment) and C18=(OCH ₂CH ₂) ₆(DTPA) ₃

Carried out thermal cycling 10 minutes at 95 ℃, then (92 ℃ of 15 second, 66 ℃ 1 minute) x40 circulation.Then, the PCR mixture electrochemical cell of packing into is used for Electrochemical Detection, as described in embodiment 1 and 2.Use detects 31 ℃ (be less than about 10 ℃ of the melting temperature (Tm)s of sequence label of the 15-mer cutting of aforesaid combination #3, as using the IDT website: the Tm counter program on the www.idt.com is calculated) from the hybridization buffer of embodiment 2.The results are shown in Figure 16.

Scheme 21

Although show with reference to aforementioned operation principle and preferred embodiment and described the present invention, it will be evident to one skilled in the art that in the various changes that can carry out under the situation that does not deviate from spirit and scope of the invention on form and the details.The invention is intended to contain all such replacements, modifications and variations.

Claims (22)

1. method that detects the target polynucleotide sequence, it comprises:

Probe is contacted under the condition that effectively makes described probe formation probe-target complex compound with the sample that comprises at least a target polynucleotide sequence, but wherein said probe comprise complementary fragment of target and detection label;

But from the described detection label of described probe cutting;

D/d label is combined, on electrode, to form immobilized label: label complement complex compound with the label complement that is coupled to electrode;

Detect and described label: the electrochemical signals that the existence of label complement complex compound is associated; And

The signal that is detected is associated with the existence of target polynucleotide sequence described in the described sample.

2. the method for claim 1, it also comprises makes the signal that is detected be associated with the amount of target polynucleotide sequence described in the described sample.

But the process of claim 1 wherein that 3. but the described detection label of described cutting comprises the described detection label of enzyme effect cutting.

4. the method for claim 3, wherein said cutting comprise the probe that uses the nuclease cutting cross.

5. the method for claim 4 is wherein cut described probe in the primer extension process, and described method also comprises by the described target sequence of polymerase chain reaction (PCR) amplification.

6. each method of claim 3 to 5, wherein said cutting is by 5 ' nuclease mediation of archaeal dna polymerase.

7. each method of claim 3 to 5, wherein said probe comprises the RNA fragment, and described cutting comprises and makes described probe-target complex compound and have the active enzyme of RNA enzyme H and combine.

8. each method of aforementioned claim, it also comprises:

Make the hybridization of second probe and described target polynucleotide; And

But probe cutting second detection label from hybridization.

9. each method of aforementioned claim, but the detection label that is wherein discharged comprises non-target complementary polynucleotide sequence, and described label complement comprises and described non-target complementary polynucleotide sequence complementary polynucleotide sequence.

10. each method of aforementioned claim, wherein but the detection label that is discharged comprises the L-DNA polynucleotide sequence, but and described label complement comprise with the detection label that discharged in described L-DNA polynucleotide sequence complementary L-DNA polynucleotide sequence.

11. each method of aforementioned claim, wherein said electrochemical signals is to use and described label: label complement complex compound double center chain district bonded electrochemical mediators produces.

12. each method of aforementioned claim, but the detection label that is wherein discharged comprises the polynucleotide part that can form complex compound with described label complement.

13. each method of claim 1-11, but the detection label that is wherein discharged comprises the non-polynucleotide part that can form complex compound with described label complement.

14. the method for claim 13, wherein said non-polynucleotide are partly with negative charge, and described label complement has positive charge.

15. the method for claim 13, wherein said label complement comprises the polycation part.

16. the method for claim 15, wherein said polycation partly comprise a plurality of nitrogen heterocyclic ring parts that have positive charge.

17. the method for claim 13, wherein said non-polynucleotide partly comprise one or more sulfydryls, and described label complement comprises gold.

18. the method for claim 13, wherein said non-polynucleotide partly comprise the polyanion part, and the described electrochemical signals polycation electrochemical mediators that is to use static to be bonded to described polyanion part produces.

19. each method of aforementioned claim, wherein said cutting is carried out under the situation of no described label complement.

Makes described sample and the multiple probe contact that is complementary to different target polynucleotide sequences separately 20. each method of aforementioned claim, wherein said contact comprise, and described detection comprises at least two kinds of different target sequences of detection.

21. each method of aforementioned claim, the concentration of wherein said probe is equal to or less than 800nM.

22. one kind is used for the microfluidic device that test right requires each described target polynucleotide sequence of 1-21, it comprises:

Matrix, it has a plurality of microfluidic chamber and the passage that is formed at wherein;

Coverture, it is attached to described stromal surface;

Inlet, it is configured to receive the sample that contains at least a target polynucleotide sequence;

One or more chambers, it is provided for making probe to contact with described sample, but wherein said probe contains complementary fragment of target and detection label;

One or more chambers, but it is provided for making described sample to stand temperature control, cut described detection label and the label that is discharged is combined to form immobilized label with the label complement that is coupled to electrode from described probe: label complement complex compound; And

Instrument, it is arranged for and detects and label: the electrochemical signals that the existence of label complement complex compound is associated and the signal that is detected is associated with the existence of target polynucleotide sequence described in the described sample.

Images