CN101260384A - Polynucleotide containing ubiquitous chromatin-opening element (UCOE) - Google Patents

Abstract

The present invention relates to a polynucleotide comprising a ubiquitous chromatin opening element (UCOE) which is not derived from an LCR. The present invention also relates to a vector comprising the polynucleotide sequence, a host cell comprising the vector, use of the polynucleotide, vector or host cell in therapy and in an assay, and a method of identifying UCOEs. The UCOE opens chromatin or maintains chromatin in an open state and facilitates reproducible expression of an operably-linked gene in cells of at least two different tissue types.

Description

Polynucleotide with open Expression element of omnipresence chromatin (UCOE)

The application for International Application PCT/GB99/02357 in March 21 calendar year 2001 enter the China national stage, application number is 99811155.4, denomination of invention is divided an application for " polynucleotide with open Expression element of omnipresence chromatin (UCOE) ".

The present invention relates to have the polynucleotide of the open Expression element of omnipresence chromatin (UCOE) of the non-LCR of being derived from.The invention still further relates to the carrier with this polynucleotide sequence, host cell, in treatment and test, use the method for this polynucleotide, carrier and host cell and the method for identifying UCOEs with this carrier.

The existing model of more high eukaryotic chromosome matter structure requires group structure gene (Dillon and Grosveld, 1994) in " zone ".The chromatin zone can be made of several groups of genes, and one group of gene is expressed in the tissue-specific mode of strictness, as (the Grosveld et al. of human beta globin albumen family, 1993), another the group gene be generally express as human TBP/C5 locus (Trachtulec, Z.et al., 1997).Perhaps, the chromatin zone can be made of the mixture of tissue-specific gene and the gene of generally expressing, as mouse source gamma/delta TCR/dad-l locus (Hong et al., 1997; Ortiz et al., 1997) and human alpha globin gene seat (Vyas et al., 1992).Two kinds of specific genes of different tissues also can be close-connected.For example, human growth plain gene and chorionic somatomammotropin gene (Jones et al., 1995).The chromatin district can exist with sealing, " cohesion ", Transcriptional Silencing attitude, perhaps exists with " decondensation ", the open structure that can transcribe.The open chromatin Structure of super acylations that it is characterized in that susceptibility, DNA methylenation and the histone of DNA enzyme I is counted as the prerequisite that genetic expression begins.

The discovery that is called as tissue-specific transcription's regulatory element of locus control region (LCR) makes people to following mechanism new understanding arranged, and the chromatin district of the opening that can transcribe is established under certain condition and keeps.The definition of LCR be based on its have the connection gene that makes in cis qualification type host cell obtain not rely on the gene integration site, depend on ability (Grosveld et al., 1987 that copy number is expressed; Lang et al., 1988; Greaves et al., 1989; Diaz et al.., 1994; Carson and Wiles, 1993; Bonifer et al., 1990; Montoliuet al., 1996; Raguz et al., 1998; EP-A-0 332 667), transgenosis (Ellis et al., 1996 of especially single copy; Raguz et al., 1998).LCR can stop the chromatinic diffusion of allos, prevents that position effect from changing (Festenstein et al., 1996; Milot et al., 1996).This phraseology that LCR determined illustrates that these elements have the open chromatin district that transcriptional activity also can be set up and maintain to powerful chromatin re-configurability.In addition, find that also LCR has intrinsic transcriptional activation ability, this ability can make them not rely on that it is promoter related and tissue-specific gene takes place express (Blom van Assendelft et al., 1989; Collis et al., 1990; Antoniou and Grosveld, 1990; Greaves et al., 1989).

All LCR all with have a tissue-specific remarkable composition or organize the gene regions of limited composition relevant, and it is relevant with a series of DNA enzyme I hypersensitive sites, this site can be positioned at 5 of its regulatory gene ' end (Grosveld et al., 1987; Carson and Wiles, 1993; Bonifer et al., 1994; Jones et al., 1995; Montoliu et al., 1996) or 3 ' end (Greaves et al., 1989).In addition, find also that recently the LCR element is present in (Hong et al., 1997 between the closely adjacent spaced cdna; Ortiz et al., 1997).The element of the similar LCR of existing report includes position (Aronow et al., 1995) in gene.In only several cases that have been studied, these elements are equivalent to big bunch of (Talbot et al., 1990 of tissue specificity and ubiquitous transcription factor binding site; Philipsen et al., 1990; Pruzina et al., 1991; Lake etal., 1990; Jarman et al., 1991; Aronow et al., 1995).

It is that mode is organized with level that the discovery of LCR discloses the regulatory element that the control tissue-specific gene expresses from given chromatin district.It seems that this LCR be the effect of main switch, and wherein its activation can cause having precedence over the foundation of the open chromatin Structure of any genetic expression.Transcribing of physiology desired level can obtain by the LCR of chromatin individual gene and the direct interaction between local promotor and enhancer element, and described interaction is to come out to realize by the ring that interleaves DNA.(Hanscombe?et?al.，1991；Wijgerde?et?al.，1995；Dillon?et?al.，1997)。

As implied above, the principal feature of LCR is its tissue specificity.People such as Ortiz (1997) have studied the tissue specificity of LCR, and he has deleted the hypersensitive site of many DNA enzyme I of T-cell report α (TCR α) LCR, and have identified in many tissues the open chromatinic LCR element of deriving.People such as Talbot (1994, NAR, 22,756-766) the similar LCR element that is considered to make connection genetic expression in many tissues has been described.But do not obtain the reproduced expression of this connection gene.Based on by every copy of expressing gene, the mean value standard deviation of expression level is about 74%, and the transgenosis copy number is 3 or bigger.When copy number was 1 or 2, this gene expression dose reduced by 10 times, and being 49% by the mean value standard deviation of each gene copy of expressing gene.The disclosed element of people such as Talbot does not provide the reproduced expression that connects gene.Clearly, the height variability of these and this system has limited the utilization of this system.

Utilize gene therapy to proofread and correct genetic disorder requirement transcription unit for a long time and can keep and continue enough high-caliber expression to reach result of treatment.This can adopt two kinds of measures to realize.A kind of method is that transcription unit stably is integrated in the host cell gene group, for example, uses retroviral vector (Miller.1992; Miller et al., 1993) or adeno associated virus (AAV) carrier (Muzyczka, 1992; Kotin, 1994; Flotte and Carter, 1995).Another kind method is that therapeutic gene is attached on the episomal vector of self-replicating, and this carrier comprises the replication orgin of virus, as EBV (Yates et al., 1985), human papovavirus BK (De Benedetti andRhoads, 1991; Cooper and Miron, 1993) and BPV-1 (Piirsoo et al., 1996).

Unfortunately, in most of the cases, it is too low or to reach the time that the gene expression dose of result of treatment continues too short to be integrated into the observed expression level of normal energy of the gene in the genome.This is mainly caused by well-known " position effect ".The gene transcription that is imported into depends on the site of its integration, and this site or be subjected to competing the influence of activation elements (promotor/enhanser) perhaps is suppressed the influence of (chromatin silence) element more.Position effect constantly produces substantial restriction to the therapeutic action of the viral base carrier that is integrated with retrovirus and adeno associated virus (AAV) source.Near the integration site chromatin element is easy to make virus transcription controlling element silence.The inclusion of typical promotor and enhancer element does not solve this subject matter (Dai et al., 1992 as the part of virus formulation body in the high level expression gene; Lee et al., 1993).

Inclusion as the global function LCR of the part of transcription unit has overcome this defective, because this element can be used to start the continuous expression of the predictable physiological level of required gene (referring to Yeoman and Mellor, 1992 in particular cell types; Brines and Klaus, 1993; Needham et al.1992 and 1993; Tewari et al., 1998; Zhumabekov et al., 1995).The degree of this expression predictability is the key of safety, successful strategies in gene therapy.

Using reproducible episomal vector (REV) is that integrator gene virus is so that realize another tempting method of the long-term expression of gene.At first, different with virus vector, REV does not have the size restriction to treatment with transcription unit, can insert the fragment (Sun et al., 1994) above 300kb.Secondly, owing to be the type that dissociates, REV can not produce and insert the relevant potentially dangerous of mutagenesis sudden change, and this mutagenesis sudden change is to integrate virus vector institute inherent problem.At last, can use non-viral delivery systems that REV is imported target cell, the comparable viral delivery systems of non-viral delivery systems makes more cheaply.

Verified non-transient transfection plasmid (Reeves et al., 1985 of duplicating; Archer et al., 1992) and REV (Reeves et al., 1985; Smith et al., 1993) nucleosome that combines.Assembly on REV more can be organized well, this assembling is similar to natural chromatin, though and the nucleosome on instantaneous plasmid can inhibition of gene expression (Archer et al., 1992) can not be arranged well and can be allowed some transcription factor near target sequence.Proved that recently LCR makes tissue-specific gene carry out long-term expression (International Patent Application WO 98/07876) in REV.

The preparation that produces the cultivation mammalian cell of high level treatment protein product is one and is in expanding industry.It is big, time-consuming and cost is high that the chromatin position effect makes it implement difficulty.Produce the most frequently used means of this Mammals " cell factory " depend on by drug resistant gene inductive gene amplification (as DHFR, glutamine synthetase (Kaufman, 1990)) and must maintenance in free high cytotoxic drug concentration.Use has preparation (Needham et al., 1992 of having simplified this class clone from the carrier of the LCR in cance high-expression gene district greatly; Needham et al., 1995).

Using the problem of LCR is that they are tissue-specific, and can reproduce expression can only obtain in particular cell types.So, in having a kind of types of organization of LCR or in multiple types of organization, can not obtain reproducible expression.Therefore, need the non-UCOE that is derived from LCR.

As mentioned above, people such as Ortiz (1997) disclose a kind of LCR deutero-element, and it can open the chromatin in many tissues.There are many problems in people's such as Ortiz (1997) LCR deutero-element.Particularly must use recombinant DNA technology for the essential regions that makes this element have LCR sets up carefully, and this element can not produce the reproducible expression level that connects gene in the histological types cell, particularly copies or the transgenosis of less copy number when (being less than 3) when this element is one.

Though disclose the element that comprises bidirectional promoter and no methylated CpG island is arranged, not have open or point out this element can open the reproduced expression that chromatin maybe can make chromatin maintenance open state and promotion can be operatively connected gene in the cell of at least two kinds of histological types.

People's Surfeit locus span is about 60kb, and is positioned at karyomit(e) 9q34.2 place.This locus has bidirectional promoter (Huxley et al., molecular cytobiology (Mol.Cell.Biol.), 10,605-614,1990 between SURF5 and the SURF3 gene and between SURF1 and SURF2 gene; Duhig et al., genomics (Genomics) .52.72-78.1998; Williams et al., molecular cytobiology (Mol.Cell.Biol.), 6,4558-4569,1986).But do not point out that these districts can open the reproduced expression that chromatin maybe can make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types.

People such as Brayton (journal of biological chemistry (J.Biol.Chem.), 269,5313-5321,1994) also disclose a kind of bidirectional promoter between fowl source GPAT and AIRC gene.But still do not point out that this district can open the reproduced expression that chromatin maybe can make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types.

People such as Ryan (gene (Gene), 196,9-17,1997) disclose a kind of bidirectional promoter between plastosome chaperonins (chaeronin) 60 genes and chaperonins 10 genes, but still do not pointed out that this district can open the reproduced expression that chromatin maybe can make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types.

Also disclose a kind of bidirectional promoter relevant, but still do not pointed out that this district can open chromatin and maybe can make chromatin keep open state and lack two kinds little the reproduced expression that promote to be operatively connected gene in the cell of organizing type complete with mouse source HTF9 gene.

People such as Palmiter (PNAS USA, 95,8428-8430,1998) and International Patent Application WO 94/13273 disclose a kind of element relevant with metallothionein gene.This element has and the irrelevant DNA enzyme I hypersensitive site of promotor.Furthermore, there is not evidence to show the reproduced expression that this element can not be opened chromatin or make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types.

As everyone knows, use non-replicability transient transfection plasmid can obtain genetic expression, but the just short-term of using non-replicability transient transfection plasmid to obtain is expressed (generally being no more than 72 hours) by transfectional cell.It is generally acknowledged that this short-term expression is to be caused by losing of plasmid in the fracture of plasmid or the cell.This drawbacks limit the use of this plasmid.

The invention provides the polynucleotide of a kind of UCOE of containing, it can open the reproduced expression that chromatin maybe can make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types, the wherein non-locus control region that is derived from of this polynucleotide.

" locus control region " (LCR) is defined as from a kind of tissue-specific gene seat of eukaryotic host cell and obtains a kind of gene element, when it is connected with goal gene and is integrated in the karyomit(e) of host cell, can make goal gene produce tissue-specific do not rely on integration site but depend on the expression of copy number.The polynucleotide that is derived from LCR can be any part or a few part of LCR.The polynucleotide that is derived from LCR preferably can be opened any part of chromatinic LCR.LCR is with relevant with irrelevant one or more DNA enzymes I hypersensitization (HS) site of promotor, and the HS site that UCOE does not preferably comprise and promotor has nothing to do.HS is that those of ordinary skills are known, and can identify according to standard technique described here.

Term " promotion can be reproduced expression " is meant that UCOE can promote that can be operatively connected gene transcription can reproduce the activatory ability.We think that this process relates to UCOE and makes the chromatin zone (or being the transcription factor binding site point at least) that comprises this gene ability near the transcription factor zone.Though can reproduce expression mainly be meant when described polynucleotide can be operationally connected on the expressible gene chromatinic environment and no matter the cell tissue type how, this polynucleotide can both make described quilt can be operatively connected gene and produce the expression of par in fact.Preferably, the expression of par can be meant in every gene copy expression level standard error of the mean less than 48% in fact, less than 40% better, is preferably less than 25%.The expression of par also can be meant in single-gene copy in fact, and changes of expression level is less than 10 times, less than 5 times better, be preferably less than 3 times.The expression level that this expression level is preferably measured in transgenic animal.Particularly preferably be when can be operatively connected gene with single or low copy number (less than 3) when existing UCOE promote to be operatively connected the reproduced expression of gene.

Terminology used here " connection " is meant that cis connects, and wherein UCOE and gene show as cis relation on the identical nucleic acid molecule.Term " by being operatively connected " is meant that cis connects, and wherein the expression of gene that will express is subjected to the promotion of UCOE.

Open chromatin or the chromatin that is in open state are meant that dyeing is in non-condensed state, and also refer to euchromatin.Condensed chromatin also is known as heterochromatin, and as mentioned above, sealing (cohesion) attitude chromatin is in the Transcriptional Silencing attitude.Open (non-cohesion) chromatin is the chromatin that can transcribe.The establishment of open chromatin Structure is that the super acetyl with DNA enzyme I susceptibility, DNA methylenation and histone turns to feature.Identify that open chromatinic standard method is those of ordinary skills' a common practise, and at Wu, 1989, enzyme molecules method, 170:269-289; Crane-Robinson etc., method (Methods), 12:48-56; Rein etc., 1998, N.A.R. states among the 26:2255-2264.

Term " two or more types of organization's cells " is meant the cell of at least two kinds of following histological types, at least 4 kinds better, preferably more kinds of, these types of organizations are: the heart, kidney, lung, liver, intestines, skeletal muscle, sexual gland, spleen, brain and thymic tissue.Preferred polynucleotide of the present invention can promote can reproduce expression, promptly amorphous specificity in non-tissue specificity ground.Polynucleotide more preferably of the present invention is promoting to reproduce expression at least 50% and preferably whole types of organizations that have the active gene expression to take place.

Polynucleotide of the present invention can promote to be operatively connected the reproduced expression of gene on physiological level.Physiological level then means in a cell, in a group cell or the gene expression dose among the patient show a kind of physiological effect.Physiological level preferably depends on the suitableeest physiological level of wanting the result.Preferably, the physiological water reason is equal to the expression level of native gene of equal value.

UCOE of the present invention can be any element, this element can be opened the reproduced expression that chromatin maybe can make chromatin keep open state and promote to be operatively connected gene in the cell of at least two kinds of histological types, and condition is that this UCOE is derived from LCR.In one embodiment, UCOE comprises the no methylated CpG island of prolongation.Be 40% with GC horizontal among total DNA and compare, the average GC content in CpG island is about 60%.Those of ordinary skill in the art is easy to use standard technique to identify the CpG island, is specific to the restriction enzyme of C and G sequence as use.People such as people such as Larsen 1992 and Kolsto described this technology in 1986.The no methylated CpG island that prolongs is to extend through the zone that is comprising a plurality of transcription initiation sites and/or extend a kind of no methylated CpG island that is preferably greater than 500bp greater than 300bp.

UCOE is derived from a sequence, and this sequence is relevant with the omnipresence expressing gene during source position in it is natural, and is adjacent better.UCOE also preferably contains at least one transcription factor binding site point.The transcription factor binding site point comprises promoter sequence and enhancer sequence.Contain the dual or bidirectional promoter that can run in the opposite and transcribe among the preferred UCOE.Double starting here is defined as one or more promotor independent of each other, and the activation of one of them promotor or inactivation do not influence another promotor.Bidirectional promoter is the zone of performance promotor effect on both direction, but can not only activate in one direction or inactivation.UCOE preferably comprises double starting or the bidirectional promoter (can transcribe in the relative direction guiding) that can run in the opposite and transcribe, and their natural interior source position is related with the omnipresence expressing gene.UCOE preferably comprises double starting that Divergence is transcribed.This UCOE can comprise allogeneic promoter, promptly is not the natural promotor relevant with other sequence of UCOE.For example, can use CMV promotor and the HP1H-γ promotor that has the UCOE relevant with hnRNP A2.Hereinafter will do further to discuss to this.The present invention also provides the UCOE that comprises one or more allogeneic promoters.This allogeneic promoter can replace one or more endogenesis promoters of UCOE, perhaps is attached on one or more endogenesis promoters of UCOE to use.Allogeneic promoter can be any promotor, comprises tissue-specific promoter, as tumor-specific promoters and omnipresence promotor.Allogeneic promoter is the omnipresence promotor preferably, preferably the CMV promotor.

At the EMBO magazine, 6:2773-2779 (1987) is described as people such as Lavia, and UCOE preferably is not the 3725bp EcoRI1 fragment that contains the bidirectional promoter of the small fragment of HpaII (HTF) island HTF9.

UCOE preferably is not the 149bp MES-1 element (Williams et al., Mol.Cell.Biol, 13:4784-4792,1993) in the mouse source SURF1 of Surfeit locus and the 800bp BamHI genomic fragment between the SURF2 gene.Preferred UCOE neither be at the SURF5 and the bidirectional promoter between the SURF3 gene (Williams et al., Mol.Cell.Biol, 13:4784-4792,1993) of Surfeit locus.Also preferred UCOE is derived from as people such as Duhig at Genomics, span defined in the 52:72-78 (1998) is 60kb and is positioned at human Surfeit locus or corresponding mouse source locus (Huxley et al. on the karyomit(e) 9q34.2, Mol.Cell.Biol.10:605-614,1990).

Preferred UCOE is positioned at contained fowl source GPAT of the 1350bp SmaI fragment (sequence number L12533) of preserving in the gene information storehouse and two-way startup subarea (the Gavalas etal. between the AIRC gene, Mol.Cell.Biol., 13:4784-4792,1993) or same district (Brayton et al. such as corresponding human, J.Biol.Chem., 269:5313-5321,1994).

Preferred UCOE is not the 3894bp genomic DNA fragment (gene pool sequence number U68562) that comprises rat source plastosome chaperonins 60 and chaperonins 10 genes.Also preferred UCOE neither contain the 581bp fragment (Ryan et al., Gene, 196:9-17,1997) of bidirectional promoter in the intergenic region between rat source plastosome chaperonins 60 and chaperonins 10 genes.

In a preferred embodiment of the invention, UCOE is a 44kb dna fragmentation of crossing over human TATA conjugated protein (TBP) gene, its 5 ' and 3 ' flanking sequence be 12kb, or its function autoploid or function fragment.

In another preferred embodiment of the present invention, UCOE is a 60kb dna fragmentation of crossing over human hnRNPA2 gene, and its 5 ' flanking sequence is 30kb, and 3 ' flanking sequence is 20kb, or its function autoploid or function fragment.In another preferred embodiment, UCOE comprises the sequence between Nucleotide 1 to 6264 among Figure 21, or its function autoploid or function fragment.This sequence is comprising human hnRNP A2 promotor (Nucleotide 5636-6264), and 5 ' flanking sequence of 5.5kb comprises HP1H-γ promotor.

In another preferred embodiment of the present invention, UCOE is a 25kb dna fragmentation of crossing over human TBP gene, and its 5 ' flanking sequence is 1kb, and 3 ' flanking sequence is 5kb, or its function autoploid or function fragment.

In another preferred embodiment of the present invention, UCOE is a 16kb dna fragmentation of crossing over human hnRNPA2 gene, and its 5 ' flanking sequence is 5kb, and 3 ' flanking sequence is 1.5kb, or its function autoploid or function fragment.

In another preferred embodiment, UCOE comprises sequence and the CMV promotor between the Nucleotide 1 to 5636 among Figure 21 (5 ' flanking sequence of the 5.5kb of human hnRNP A2 promotor), or its function autoploid or function fragment.

In another preferred embodiment, UCOE comprises the sequence between Nucleotide 4102 to 8286 among Figure 21, or its function autoploid or function fragment.This sequence comprises hnRNP A2 and HP1H-γ promotor.

In another preferred embodiment, UCOE is included in the sequence between Nucleotide 1 and 7627 among Figure 21, or its function autoploid or function fragment.This sequence comprises the exons 1 of hnRNP A2 and HP1H-γ promotor and hnRNP A2 gene.

In another preferred embodiment, UCOE is included in the sequence between Nucleotide 1 and 9127 among Figure 21, or its function autoploid or function fragment.3 ' flanking sequence that this sequence comprises hnRNP A2 and HP1H-γ promotor and hnRNP A2 promotor is near (up to) but do not comprise the exon 2 of hnRNP A2 gene.

Also preferred UCOE of the present invention has the nucleotide sequence of Figure 20 or Figure 21, perhaps its function fragment or function autoploid.

Here used term " function autoploid or fragment " is meant can open autoploid or the fragment that chromatin maybe can make chromatin keep open state and promote to be operatively connected the reproduced expression of gene at least in the cell of two kinds of histological types.Described autoploid can be corresponding to the kind autoploid of certified UCOE or the autoploid relevant with the omnipresence expressing gene.In order to discern the conserved sequence primitive that can identify and synthesize other UCOE, the sequence that can carry out between UCOE compares.The suitable software package that carries out this sequence comparison is that those of ordinary skills are known.The software package that carries out this sequence comparison preferably be PCGENE (Intelligenetics, Inc., USA).Adopt the method that produces known UCOE fragment and quiz function to be easy to identify function fragment.Identifying that the conserved sequence primitive also will help to identify function fragment, also may be functional because comprise the fragment of conserved sequence primitive.Functional autoploid also comprises adorned UCOE, and wherein the element of UCOE is replaced by like, as replaced one or more promotors of UCOE with different allogeneic promoters.As mentioned above, allogeneic promoter can be any promotor, comprises the tissue-specific promoter and the omnipresence promotor of similar tumor-specific promoters.Allogeneic promoter is strong and/or main omnipresence promotor, preferably a CMV promotor preferably.

In another preferred embodiment of the present invention, provide at least two kinds of different tissues cells, promoting to be operatively connected the method that UCOE that gene can reproduce expression identifies, comprising:

(1) candidate UCOE is test by at least two kinds of different tissues cells of transfection with the carrier with candidate UCOE, this candidate UCOE can be operationally connected on the marker gene;

(2) determine whether in two or more different histocytes, can obtain the reproduced expression of this marker gene.

The present invention identifies that the method for UCOE also preferably includes another step of selecting candidate UCOE, one or more related in this candidate UCOE and the following part: the no methylated CpG island of omnipresence expressing gene, dual or bidirectional promoter and prolongation.

Preferably in the cell of the UCOE that contains the single copy that is connected with marker gene, determine the reproduced expression of this marker gene.

In this method provided by the invention, the test of candidate UCOE is following finishing: prepare its cell and contain wherein that candidate UCOE can be operationally connected to the non-human transgenic animal of the carrier on the marker gene, and determine whether to obtain the reproduced expression of this marker gene in two or more histological types cells.This non-human transgenic animal preferably F1 or non-human transgenic animal than advanced lines.Non-human transgenic animal is rodent preferably, more preferably mouse.

The invention provides a kind of UCOE that is derived from the nucleotide sequence relevant or adjacent with the omnipresence expressing gene.Described nucleotide sequence preferably comprises the CpG island of no methylated prolongation.Further preferred this nucleotide sequence comprises at least one transcription factor binding site point.Preferred described nucleotide sequence comprises the dual or bidirectional promoter that runs in the opposite and transcribe.Preferred this nucleotide sequence comprises double starting that can run in the opposite and transcribe.It is relevant with the omnipresence expressing gene that preferred this nucleotide sequence comprises can run in the opposite dual or bidirectional promoter and this promotor of transcribing.It is relevant with the omnipresence expressing gene that preferred this nucleotide sequence comprises can run in the opposite double starting and this promotor of transcribing.

The present invention also provides and used polynucleotide of the present invention or its fragment in the test of identifying other UCOE.The preferred described polynucleotide fragment that comprises conserved sequence or structural motif that uses.The method of carrying out this test is that those of ordinary skills are known.

The invention provides the carrier that contains polynucleotide of the present invention, preferred this carrier includes the expressing gene that can be operationally connected on this polynucleotide.Described expressible gene has the necessary element that can make genetic expression, as suitable promotor, enhanser, shearing receptor sequence, internal ribosome entry site sequence (IRES) and Transcription Termination site.The suitable element that makes genetic expression is that those of ordinary skills are in common knowledge.The suitable element that makes genetic expression can be the natural endogenous element related with this gene, also can be for the gene expression dose that obtains being different from native gene or tissue distribution and the allos element that uses.Preferred vector has and can handle relevant promotor and polynucleotide with expressible gene.This promotor can be the natural endogenesis promoter of expressible gene, also can be allogeneic promoter.Allogeneic promoter can any promotor, comprises tissue-specific promoter, as tumor-specific promoters and omnipresence promotor.Allogeneic promoter is strong and/or main omnipresence promotor, preferably a CMV promotor preferably.

Carrier can be any carrier that can advance the DNA transfection cell.Promptly can be that integrating vector also can be an episomal vector.

Preferred integrating vector comprises the retroviral vector of reorganization.The retroviral vector of reorganization comprises at least a portion DNA of reverse transcription virus gene group, and this part can target cell infection.Used term " infection " is meant that virus shifts genetic stocks the process of its host cell into or target cell.Used retrovirus also can be given replication defective in making up carrier of the present invention, to remove virus replication effect in the target cell.In this case, can utilize the helper virus packing that the viral genome of replication defective is arranged according to conventional art.In a word, any retrovirus that can functions of use transgenosis ability in enforcement of the present invention conforms to above-mentioned standard with the transfection performance.

Suitable retroviral vector comprises the known pLJ of those of ordinary skills, pZip, pWe and pEM, but is not limited to this.Concerning the retroviral viral strain that is used to pack replication defective, comprise Ψ Crip, Ψ Cre, Ψ 2 and Ψ Am.

Other useful virus vector of the present invention comprises adenovirus, adeno associated virus, SV40 virus, vaccinia virus, HSV and poxvirus vector.The preferred carrier that uses is an adenovirus.Adenovirus carrier is known to a person of ordinary skill in the art and has been used for to many cell type delivery of gene, comprise delivery of gene (Hitt in tracheal epithelium, skeletal muscle, liver, brain and skin cells, MM, Addison CL and Graham, FL (1997) are used for the human adenovirus carrier (Human adenovirus vectors for gene transfer intomammalian cells) to the mammalian cell metastatic gene. pharmacology progress (Advances in Pharmacology) 40:137-206; And Anderson WF (1998) human gene therapy (Human gene therapy). nature (Nature) 392 (6679Suppl): 25-30).

Also preferably use gland to follow carrier (AAV).The AAV carrier is known to a person of ordinary skill in the art, and in using, gene therapy has been used for the human T-lymphocyte of stable transduction, inoblast, sense of smell polymerization cell, skeletal muscle, brain, red corpuscle and heamopoietic stem cell (Philip et al., 1994, cellular elements biology (Mol.Cell.Biol.), 14:2411-2418; Russell et al., 1994, PNAS USA, 91,8915-8919; Flotte et al., 1993, PNASUSA, 90:10613-10617; Walsh et al., 1994, PNAS USA, 89:7257-7261; Miller et al., 1994, PNAS USA, 91:10183-10187; Emerson, 1996, Blood, 87,3082-3088), International Patent Application WO 91/18088 has been described concrete AAV base carrier.

Episomal vector comprises the non-replicability episomal vector of transient transfection and has the self-replacation episomal vector of the function of the virus replication starting point of EBV, human papovavirus (BK) and BPV-1 freely preferably.Integrated and the episomal vector of this class all is known to a person of ordinary skill in the art, and is all fully described in document known to a person of ordinary skill in the art.Suitable episomal vector has particularly been described among the WO98/07876.

The also preferably mammiferous artificial chromosome of carrier that the present invention is used.(1996, TIG 12:463-466) has described mammiferous artificial chromosome's use to Colos.

In a preferred embodiment, carrier of the present invention is a plasmid.Also preferred plasmid is the nonconformity type plasmid of non-replicability.

Here used term " plasmid " is meant any nucleic acid of coding expressible gene, comprises line style or circular nucleic acid and two strands or single-chain nucleic acid.Nucleic acid can be DNA or RNA, can comprise adorned Nucleotide or ribonucleotide, can be through the chemical mode modified, as methylate or contain protecting group or have cap or stern construction.

Nonreplicative nonconformity type plasmid is not duplicate a kind of nucleic acid that also is not integrated into (not having high frequency ground to integrate or not in the specificity site yet) in this host cell gene group specifically when host cell is advanced in transfection.

Adopt the canonical measure method can identify the replicability plasmid, comprise people such as Ustav at EMBOJ., 10:449-457, the standard replicated test method described in 1991.

Preferred non-replicability nonconformity type plasmid is to be stabilized the plasmid that remains in the cell, it does not rely on duplicating of genomic dna, three times or repeatedly in the daughter cell after the cell fission plasmid copy number significant minimizing is arranged, promptly the plasmid molecule decreased average in the daughter cell is about more than 50% during given cell fission algebraically.In a word, in the self-replacation carrier, use the virus replication starting point and provide the needed one or more virus replication factor of duplicating that is mediated by this specific virus replication starting point that the self-replacation function is provided.The self-replacation carrier has been described among the WO98/07876.Here used term " the nonconformity type plasmid of transient transfection " is identical with the term " non-replicability nonconformity type plasmid " of above-mentioned definition.

Above-mentioned plasmid is naked nucleic acid preferably.Term as used herein " naked nucleic acid " is meant that nucleic acid molecule did not both have direct physical interconnection by hydrogen bond and protein, phosphorus matter, carbohydrate or glycoprotein by covalent linkage yet.This term does not refer to have or not in the nucleic acid adorned Nucleotide or ribonucleotide, and perhaps whether all or part nucleic acid molecule has adopted and methylated or affix protecting group or cap or stern construction and carried out chemically modified.

Carrier of the present invention preferably contain among Figure 20 in the sequence between Nucleotide 1 and 7627 (comprising hnRNP A2 and HP1H-γ promotor) but, the gene of CMV promotor, multiple clone site, poly-acetylated sequences and the coding selective marker under suitable controlling elements effect.CET200 that carrier of the present invention is preferably shown in Figure 49 or CET210 carrier.

The present invention also provides the host cell with carrier transfection of the present invention.Host cell can be any cell, as yeast cell, insect cell, bacterial cell and mammalian cell.Host cell is preferably mammalian cell, and can produce as Chinese hamster ovary celI system, 293 clones and NS0 cell from mammal cell line.

Can be operatively connected preferably a kind of treatment nucleotide sequence of gene.Can be used for treatment of the present invention comprises coding acceptor, enzyme, part, regulatory factor, hormone, antibody or antibody fragment and structural protein with nucleotide sequence sequence.Treatment with nucleotide sequence also comprise coding nucleoprotein, cytoplasm protein, mitochondrial protein, secretory protein, with the sequence of film related protein, serum protein, virus antigen, bacterial antigens, protozoon antigen and parasite antigen etc.The used nucleotide sequence of the present invention also comprises the sequence of coded protein, peptide, lipoprotein, glycoprotein, phosphorprotein and nucleic acid (as RNA and antisense nucleic acid).Can comprise that with the protein of nucleic acid sequence encoding or polypeptide hormone, somatomedin, enzyme, coagulation factors, Apo, acceptor, erythropoietin, treatment are with antibody or its fragment, medicine, oncogene, tumour antigen, tumour-inhibitory substance, virus antigen, parasite antigen and bacterial antigens by this treatment.The object lesson of these compounds comprises proinsulin, tethelin, androgen receptor, insulin-like growth factor I, insulin-like growth factor II, insulin-like growth factor binding protein, Urogastron, the transformation growth factor ' alpha ', the transformation growth factor beta, platelet-derived somatomedin, the former factor of blood vessel (tart fibroblast growth factor, the fibroblast growth factor of alkalescence, vascular endothelial growth factor and angiogenin), stromatin (IV Collagen Type VI, the VII Collagen Type VI, kelp ammonia element), Phenylalanine hydroxylase, tyrosine hydroxylase, carcinogenic protein is (as by byras, fos, myc, erb, src, neu, sis, those that jun is coded), HPV E6 or E7 carcinogenic protein, p53 albumen, Rb albumen, cytokinin receptor, IL-1, IL-6, IL-8 and from virus, being used to of bacterium and Parasites produces the protein of immunne response in vivo and other acts on significant protein in vivo.Only encoded its availability of nucleotide sequence of the selection of the gene that will be impregnated in is limited.Those of ordinary skill in the art will appreciate that because increasing protein and polypeptide are identified that they can be integrated in the polynucleotide of the present invention and be expressed.

When polynucleotide of the present invention are included in the plasmid, preferably in single-gene treatment, use this plasmid, as in the treatment of Du Guang Shi muscular dystrophy and in dna immunization and immunization method, use.

For example, in order to increase the amount of gene product, polynucleotide of the present invention also can be used for expressing the gene (being natural gene or homologous gene) of having expressed at host cell.But should be pointed out that when homogenic expression might produce and take off when regulate expressing that this expressions is owing to being overexpression in cell, thereby may not be subjected to the control of UCOE.

Polynucleotide of the present invention can handled the genome that inserts cell on the related position with endogenous (innately) gene, thereby cause the expression of this native gene to increase.It is known to a person of ordinary skill in the art at specific site element being injected genomic method, and in US-A-5578461 and US-A-5641670 description is arranged.In addition, polynucleotide of the present invention can have the gene that is inserted in its endogenous (natural) position on genome, and it is relevant that the position of this gene and polynucleotide can be handled, so that make the gene that is inserted into produce genetic expression.Explanation is once more, and the method for gene being inserted the genome specific site is known to a person of ordinary skill in the art, and in US-A-5578461 and US-A-5641670 description is arranged.

The invention provides polynucleotide of the present invention and be used to increase the purposes that native gene is expressed, be included in native gene and can handle related position, thereby increase this expression of gene this polynucleotide reeve cellular genome.

To be delivered to many technology in the cell be known and it is used to can be the present invention carrier described here, comprise and use nucleic acid flocculation agent, electroporation, use asbestos, 1,5-dimethyl-1,5-phenodiazine 11 methylene radical gather Methobromide, DEAE Mierocrystalline cellulose, dextran, liposome, cationic-liposome, lipid polymeric amide, poly ornithine complexometry, particle bombardment method, direct microinjection method (referring to Kucherlapati and Skoultchi, Crit.Rev.Biochem.16:349-379 (1984); Keown et al., Methods Enzymol.185:527 (1990))

Carrier of the present invention can adopt virus or non-viral delivering method is non-specific or specifically the appointed part of host cell (promptly to) be delivered in the host cell.The preferred delivery method of viral source comprises that viral packaging signal is by the genetic modification mistake, as those adenovirus, simplexvirus, papovavirus in this receptor the transfection acceptor of the package cell line of producing virion as carrier of the present invention.Also can use basic gene delivery measure of non-virus and method in the present invention, comprise direct injection, nucleic acid cohesion peptide or non-peptide, the cationic-liposome and liposomal encapsulated of uncorrected gene expression.

Carrier is directly sent the into existing description of tissue, and obtained the expression of gene short-term.Clearly described in the prior art carrier has directly been sent into muscle (Wolff et al., Science, 247:1465-1468,1990), Tiroidina (Sykes et al., Human Gene Ther., 5,837-844,1994), melanoma (Vile et al., Cancer Res., 53,962-967,1993), skin (Hengge et al., Nature Genet, 10,161-166,1995), liver (Hickman etal., Human Gene Therapy, 5,1477-1483,1994) and expose after airway epithelial (Meyer et al., Gene Therapy, 2,450-460,1995).

The various peptides of aminoacid sequence deutero-(Plank et al., J., Biol.Chem.269:12918-12924 (1994)) when being applied to jointly, in transgenosis, have been used by virus envelope protein with the polylysine DNA mixture.Trubetskoy etc. in BioconjugateChem.3:323-327 (1992), WO91/17773, WO92/19278 and Mack etc. propose that in Am.J.Med.Sci.307:138-143 (1994) multipolymer of puting together with cation lipid and polylysine can improve gene transfering efficiency.International Patent Application WO 95/02698 discloses uses virus composition to attempt to increase the efficient of cation lipid transgenosis.

The nucleic acid flocculation agent that can use in the present invention comprises o-dime thyl phosphoroamidothioate, o-dime thyl phosphoroamidothioate derivative, histone, cationic peptide, the non-peptide of positively charged ion, as polymine (PEI) and polylysine.The o-dime thyl phosphoroamidothioate derivative is meant the homologue and the o-dime thyl phosphoroamidothioate derivative of o-dime thyl phosphoroamidothioate, comprises the described compound of International Patent Application WO 93/18759 (publication on September 30th, 1993).

In addition, referring to (above-mentioned) such as Trubetskoy, cystine linkage (Cotton et al., Meth.Enzymol.217:618-644 (1992) have been used in the binding of peptide component and delivery vector.

For example Wu and Wu is at J.Biol.Chem., among the 263:14621 (1988) and Wilson etc. in J.Biol.Chem.267:963-967 (1992) and described in the United States Patent (USP) NO.5166320, send into that the delivery vector of cell is known to a person of ordinary skill in the art to DNA construct, and comprise the DNA/ polycation mixture that the pair cell surface receptor is special.

According to the present invention, the poly-peptide of available core acid cure of sending of carrier is finished.WO96/41606 has described nucleic acid cohesion peptide, and this peptide particularly is applicable to the cohesion carrier and carrier is sent into cell.As described in WO96/41606, can be attached to the peptide that is used to send carrier of the present invention to functional group.These functional groups can comprise that target is the part of specific cell class, as monoclonal antibody, Regular Insulin, Transferrins,iron complexes, take off sialoglycoprotein or sugar.This part can be in nonspecific mode or to be subjected to the specificity mode targeted cells of cell type restriction.

Functional group also can comprise the lipid of similar palmityl, oleoyl, stearyl class; The neutral hydrophilic polymer of similar polyoxyethylene glycol (PEG) or polyvinylpyrrolidone (PVP); The fusogenic peptide of similar influenza virus HA peptide; Perhaps recombinase or intergrase.Functional group can also comprise transport protein in the born of the same parents, escapes signal or protein is directly pointed to cytoplasmic signal as nuclear localization sequence (NLS) and endosome.

The present invention also provides polynucleotide of the present invention, carrier or the host cell that uses in treatment.

Preferred use above-mentioned polynucleotide, carrier or host in gene therapy.

The present invention also provides polynucleotide of the present invention, carrier or host cell to be used for the purposes of the composition of gene therapy in preparation.

The present invention also provides a kind of methods of treatment, comprises polynucleotide of the present invention, carrier or host cell to patient's administration effective dose of this treatment of needs.The disease that preferred patient is suffered from is available gene therapy treatment.

The present invention also provides a kind of pharmaceutical composition, and it contains and pharmaceutically acceptable vehicle bonded polynucleotide of the present invention, carrier or host cell.

The present invention also provides and used polynucleotide of the present invention, carrier or host cell in cell culture system, so that obtain the method for gene prod.The cell culture system that is suitable for is known to a person of ordinary skill in the art, and in document known to the ordinary skill people detailed description is arranged.

The present invention also provides the application in producing transgenic plant of polynucleotide of the present invention, carrier or host cell.It is known to a person of ordinary skill in the art increasing output, the preparation of transgenic plant such as resistance is arranged.The present invention also provides the transgenic plant of the cell that contains polynucleotide of the present invention.

The present invention also provides the transgenic nonhuman with the cell that comprises polynucleotide of the present invention animal.

Pharmaceutical composition of the present invention can contain polynucleotide of the present invention, carrier or host cell, if necessary, can be with drug acceptable carrier or releases rare dose of blended, is used for the treatment of disease or favourable albumen or function is provided for the cell of particular organization.

Polynucleotide of the present invention, carrier or host cell or pharmaceutical composition can pass through the variety of way administration, comprise in the whole-body muscle, intravenously, aerosol, oral (solid or liquid form), part, eye, suppository, and in intraperitoneal and/or the sheath with mode such as local direct injection.

Certainly definite dosage need be measured each patient by the doctor, and this amount depends on the type of the target tissue of being treated by the proteic definite character and the quilt of destination gene expression.

This dosage also depends on the symptom and the route of administration of disease.Preferably the treatment phase is a successive or up to necrocytosis.With the effect data of agent number of times fibrous root according to disease and clinical trial gained.

The scope of carrying out the amount of polynucleotide that effective gene treatment sent or carrier DNA according to the present invention is preferably about 50ng-1000 μ g carrier DNA/kg body weight, and 1-100 μ g carrier DNA/the kg body weight is better.

Although the present invention preferably gives administration polynucleotide, carrier or host cell so that allow cell in vivo absorb, also can adopt stripped mode, promptly cell is taken off from animal body, with transplanting the precession thing behind polynucleotide or the carrier transduction again.For example, adopt the mode of exsomatizing to enter liver, promptly from animal body, take off liver cell, this liver cell of external transduction, again by the hepatocyte transplantation precession object of being transduceed (as Chowdhury etc. at Science254:1802-1805, at exempting from the described of son, or Wilson is at Hum.GeneTher.3:179-222 in 1991, described at the mankind in 1992).This method is also sent in the various cell colonys in the recycle system or lymphsystem such as red corpuscle, T cell, B cell and the raw blood stem cell effectively.

In other embodiment of the present invention, provide and used polynucleotide of the present invention, carrier or host cell to measure the Mammals model of tissue specificity and/or gene therapy effect.This Mammals model comprises the transgenic animal that have carrier of the present invention in its cell.Preparation transgenic mouse (Gordon et al., newspaper (Proc.Natl.Acad.Sci.USA) 77:7380 (1980) of institute of American Academy of Sciences; Harbers et al., Nature 293:540 (1981); Wagner et al., newspaper (Proc.Natl.Acad.Sci.USA) 78:5016 (1981) of institute of American Academy of Sciences; Wagner et al., newspaper (Proc.Natl.Acad.Sci.USA) 78:6376 (1981) of institute of American Academy of Sciences, sheep, pig, chicken are (referring to Hammer et al., the method of Nature 315:680 (1985) etc. is commonly known in the art, and can use in the present invention.Before being carried out clinical trial, can on these animals, test human body.

Transgenic animal with polynucleotide of the present invention can be used for the long-term production of target protein matter.

The present invention also relates in functional genomics is used, use polynucleotide of the present invention.Functional genomics is mainly concerned with the order-checking of gene specific expressed in special cells or morbid state, and they provide the thousands of new gene orders with potential benefit that are used for drug development or gene therapy purpose now.The subject matter of using these information to be used for new treatment research is how to determine the function of these genes.In order to determine the function of gene order, UCOE can be used for the application of many functional genomicses.Functional group gene of the present invention is used and be may further comprise the steps, but is not limited thereto:

(1) uses polynucleotide of the present invention easily to take the continuous expression of the antisense version in library apart, thereby determine the effect of disactivation gene on the cell phenotype to obtain gene order or ribozyme.

(2) use polynucleotide of the present invention to prepare the expression library of gene order, the gene order of cell produces reliable reproducible continuous expression so that send into.The cell of expressing the gained of this gene order can be used for determining the whole bag of tricks of function or drug development.For example, the antibody of preparation gene product is to be used for its active neutralization; The fast purifying of this used gene protein product in structure, function or drug screening research; Perhaps in cell based drug screening, use.

(3) in the research that relates to mouse embryonic stem cell (ES) or transgenic mouse, use polynucleotide of the present invention.A measure of the most useful functional genomics is that the gene to constructed mouse ES cell inserts at random, described construct only allows to carry out medicament selection after injecting the gene of being expressed, and in order-checking, be easy to be saved (G.Hicks et al., Naure Genetics16,338-334).Subsequently, be easy to prepare and have having of new sequence in the gene and reject the transgenic mouse of sudden change to survey its function.At present, this technology is very suitable to 10% musculus cdna in the fine expression of mouse ES cell.UCOE mixed to make this technological expansion in the conformability construct into to identifying all genes of in mouse, being expressed.

With reference to the description of drawings the following examples, but also limit the present invention never in any form.Describe preparation, test and the analysis of several representative polynucleotide of the present invention below in detail.Those skilled in the art can these steps of appropriate change to be used to prepare the polynucleotide of inventing other with advance copy.Accompanying drawing is as follows:

Fig. 1 represents human TBP locus.

A: the synoptic diagram that contains the pCYPAC-2 clone of the human TBP gene that is useful on this research.Can indicating not, the NotI of identified gene position and the position of SacII restriction site have been labeled out.

B: expression is across the CpG island in 5 ' TBP/C5 district.The length that the prompting of the density of CpG dinucleotide residue does not have an island that methylates is to extend between HindIII site in first intron of 3.4kb and FspI site in the intron I of C5 and TBP.

C: be another representative graph from the clone in TBP/C5 district.The arrangement of this gene with in Figure 1A, provide opposite.Note that the C5 gene is also referred to as the PSMB1 gene.257kb continuum and relative restrictions site from telomere to karyomit(e) 6q that expression has the gene location of 3 close connections are labeled out (B, BssHII; N, NotI; S, SacII).Also indicated pac clone with its title.Also shown subclone pBL3-TPO-puro.NotI site in the first exon PDCD2 is 150kb to the distance between the telomere iteron beginning.

Fig. 2 represents the analysis of TLN:3 and TLN:8 transgenic mouse terminal fragment.The Southern engram analysis of transgenic mouse tail biopsy DNA sample is to survey with the little dna fragmentation in following site respectively: (a) transgenosis 3 ' end, (b) 5 ' end.(c) promotor, (d) from TBP mRNA CAP site-the 7.7kb fragment, (e) from TBP mRNA CAP site-the 12kb fragment.TLN:3 result (a, b) hybrid belt that has only of two terminal probes is used in expression, this with any head to head, tail or the tail predicted size to the tail concatermer is not conformed to.May in this strain, have only a transgenosis copy.Yet (c) figure is presented at also should genetically modified second copy that is lacked in this strain, because from seeing two bands the engram analysis of promoter probe.(a) TLN:8 in analyzes and has shown at transgenosis concatermer band at 6kb place with at the terminal fragment band at 7.8kb place.The intensity of this concatermer is the twice of terminal fragment intensity, and this represents that the copy number in this strain is 3.5 ' the end that lacks hybridization explanation these three copies at all in (b) has all produced disappearance, is carrying out the figure work of doing of this respect.Figure (d) and (e) represent that transgenosis is complete at 5 of TBP gene ' end 12kb that has an appointment.

Fig. 3 A represents the analysis of TLN:28 mouse.The Southern blot hybridization of the DNA of TLB:28 to a probe that is positioned at 3 of transgenosis seat ' end.Can see multi-ribbon can with this probe hybridization, this explanation has a plurality of integration incidents.Should be to see a very strong concatermer band on the position of head to the integration incident of tail but.The copy number that the strength of signal of this result and terminal fragment is compared in this as can be seen strain is about 4.

Fig. 3 B is illustrated in the summary of genetically modified organism structure in the TLN mouse strain.TLN:3: the transgenosis that contains two copies of the mode of tail being arranged with head.In this arrangement 5 ' and 3 ' end disappearance has all taken place.5 ' disappearance extends into 5 ' flanking region of TBP, makes that the C5 gene in this copy lacks fully.At 3 ' end, disappearance extends into 3 ' UTR of TBP, and remaining C5 gene is kept perfectly.Therefore this animal has C5 gene and TBP gene copy that function is arranged of single copy.TLN:8 contains three copies tail being arranged with head.Each copy only seems 5 ' terminal the disappearance, but also do not know the degree of this disappearance at present, lacked in this strain as people's C5 mRNA, and it lacks and does not extend to the C5 gene.TLN:28 contains 5 copies that head is arranged tail, but also has many additional clip as can be seen, represents that this arrangement may be more complicated.

Fig. 3 C is illustrated in the up-to-date summary of genetically modified organism in the TLN mouse system.The figure shows the prediction weave construction that the TLN transgenosis is arranged in every kind of mouse system.Only demonstrate functional gene, and only represented a kind of in arranging of 3 kinds of possibilities of TLN:3 mouse.

Fig. 4 is illustrated in the analysis that lacks in the TLN:3 mouse.A series of probe hybridizations are advanced in the Southern trace of TLN:3DNA.Have only 5 ' probe farthest to provide single band, show that the copy that is lacked does not contain this sequence.The disappearance collection of illustrative plates is until the upstream of main TBP mRNA CAP site, Ets factor binding site and DNA enzyme hypersensitive site.Also do not know in this copy, whether to have lacked whole 5 ' district at present, perhaps produce a small-sized inside disappearance.

Fig. 5 represents the comparison from human and muroid TBP and C5 mRNA sequence.(a) show from the human C5 mRNA sequence of nt.358-708 (gene pool sequence number D00761) and the remarkable homology of muroid C5 mRNA sequence from nt.355-705 (gene order X80686).RT-PCR amplification human and muroid mRNAs produces the mixture of the 350kb dna molecular of these two kinds of sequences.Primer location (showing the 5 ' primer C5RTF that has added shading, 3 ' primer C5R among the figure) is positioned so that across a plurality of exons, eliminates and carries out the error that pcr amplification causes because of contaminating genomic dna.Although it is limited showing son/exons structure in the mankind or the muroid, the distance between primer is a fixed, because of primer is fixed in the different exons.Use PstI to carry out the PCR product that incubation just can distinguish mouse and people, because of PstI only cuts the muroid sequence.When separating on denaturing polyacrylamide gel, the radio-labeling of C5RTF primer provides the 173nt product.(b) expression is to the human TBP mRNA sequence (gene pool sequence number No.M55654) of the nt.1185 to the exon 7 of nt.901 from exon 5 with from the similar analysis of the muroid TBP mRNA sequence (gene pool sequence number No.D01034) of nucleotide position 655 to 939.First Nucleotide of Nucleotide that exon is last and next contiguous exon is represented with redness.The primer (demonstration has added shading among the figure) is 5 ' TB-22 and 3 ' TB-14.The product size (picture frame) that is amplified that above-mentioned two sequences have primer is 284bp.Obviously as can be seen, apart from 5 of PCR product ' terminal 63nt the Bsp1407I site make the transcript of people and mouse to distinguish.Size with the human specificity product of radiolabeled TB-14 on polyacrylamide gel is 221nt.

Fig. 6 represents the analysis that human TBP expresses in the TLN transgenic mouse.

At total RNA (1 μ g) with the various mouse tissues of use in the reverse transcription reaction of avian myeloblastosis virus reverse transcriptase.In contrast, human rna and non-transgenic mouse RNA have also been used from the K562 cell.(a) expression is the position of the recognition site of human specificity restriction endonuclease in TB22/14 RT-PCR product.(b) expression is the analysis that TLN:3 expresses in various tissues.As can be seen, people's expression level all be physiological level in a organized way.(c) expression is similar analysis to LTN:8.(d) expression is analysis to LTN:28, and the expression level of representing human TBP mRNA expression levels and native gene once more is similar.

What Fig. 7 represented is the analysis that human C5 expresses in the TLN transgenic mouse.

Carried out the analysis identical with Fig. 6.What last figure (a) represented is the position of the recognition site of mouse specificity restriction endonuclease in the C5RTF/C5RRT-PCR product.(b) C5 expresses in the various tissues of TLN transgenic mouse as can be seen, and people's expression level all is physiological in all tested tissue.

Fig. 8 is illustrated in (a) human TBP genetic expression and (b) the quantity summary of human C5 genetic expression in the TLN transgenic mouse.

Fig. 9 represents the synoptic diagram of pWE-TSN cosmid.

Figure 10 represents the transgenosis copy number mensuration of pWE-TSN L cell clone.

With pWE-TSN cosmid transfection mouse Lcell, DNA isolation also is used to produce the Southern trace.This trace use from the dna fragmentation of 2 copies of the vav locus in mouse source and from the TBP gene-probe at 7kb place surveys.Copy number be according to determine with the ratio of the TLN:8 of 3 copies contrast and mark in each swimming lane bottom.The copy number scope is 1-60.

Figure 11 represents the summary of pWE-TSN cosmid clonal expression in the mouse Lcell.

Figure 12 represents the analysis of human TBP locus DNA enzyme I hypersensitive site.Use is positioned at apart from the probe at TBP gene 40kb place, surveys the Southern trace by the K562 nuclear that increases the digestion of DNA enzyme I concentration.Two hypersensitive sites at the promotor place of PSMB1 and TBP gene have only been found to be positioned at.The concentration of DNA enzyme I increases from left to right in all cases.

Figure 13 A represents to show the synoptic diagram of human hnRNP A2 locus of the big clone MA160 of pCYAC deutero-160kb.Reverse arrow is represented HPIH-γ gene.Two SacII sites of box indicating do not have the island of methylating.

Figure 13 B represents to be derived from the 60kb AatII subfragment of MA160, and the two all is used to the preparation of transgenic mouse.

Figure 13 C represents the stretching, extension across the CpG island (red line) of hnRNP A2 gene 5 ' end.Represent the CpG residue with vertical line.Numeral is with respect to for the transcription initiation site (+1) of hnRNP A2 gene (solid arrow).Dotted arrow represents to carry on the back the position of dragging the HP1H-γ gene of transcribing.Also demonstrated the 16kb subfragment that contains complete hnRNP A2 gene.

Figure 14 represents the quantity of people and mouse hnRNP A2 genetic expression.With the primer of the exons 12 of hnRNP A2 gene with people (K562) and mouse RNA reverse transcription.Use primer Hn9 and Hn11 to adopt the pcr amplification sample subsequently across exons 10 to 12.Then the product that is produced enzymic digestion at random, to find out unique point of contact of each product.The mouse product contains the HindIII that does not have appearance in the human product as can be seen.

Figure 15 is illustrated in the analysis with human hnRNPA2 genetic expression in the transgenic mouse of Aa60 fragment (Figure 13 B) microinjection.As shown in figure 15, analyzed from total RNA in a organized way.Carrying out behind the RT-PCR, sample is being handled (-) with HindIII (+) digestion or without HindIII, on polyacrylamide gel, separating then, producing people source (H) and mouse source (M) product.Measure the intensity of band with phosphorescence pattern analysis instrument.

Figure 16 is illustrated in the analysis with human hnRNP A2 genetic expression in the transgenic mouse of 160kb NruI fragment (Figure 13 A) microinjection.Transgenic mouse is dissected and from tissue, extracts total RNA.RNA Hn11 reverse transcription, adopt primer Hn9 and Hn11 to carry out pcr amplification then, wherein Hn9 uses ³²It is end-labelled that P has carried out radioactivity.Sample is handled (-) with HindIII (+) digestion or without HindIII, then, separate containing on 5% polyacrylamide gel of 8M urea as denaturing agent, produce people source (H) and mouse source (M) product.Measure the intensity of band with phosphorescence pattern analysis instrument.

Figure 17 represents the quantity of hnRNP A2 transgene expression.RT-PCR with people source hnRNP A2 genetic expression in the quantitative various mouse tissues of phosphorescence pattern analysis instrument analyzes.With the transgenosis copy number serves as that level is represented with the percentage that mouse source hnRNP A2 expresses in the basis.A: the mouse (seeing Figure 15) that has MA160.B: the mouse (seeing Figure 16) that has Aa60.

Figure 18 represents human hnRNP A2 locus DNA enzyme I hypersensitive site collection of illustrative plates.With the nuclear of cumulative DNA enzyme I concentration digestion from the K562 cell.Subsequently the DNA of a little nucleic acid is digested with AatII and NcoI restriction enzyme, and carry out the Southern engram analysis.Use then from the 766bp EcoRI/NcoI fragment of the exon II of hnRNP A2 gene this trace is surveyed.Transcribe corresponding to hnRNP A2 the beginning site 5 ' end-1.1 ,-0.7 and-the 0.1kb place identifies three hypersensitive sites.

Figure 19 represents analysis of biological information and sequence comparison between hnRNP A2 and TBP locus.

Figure 20 represents the genomic clone nucleotide sequence of the TBP locus that (Nucleotide 1-9098) locates since 5 ' HindIII site.

Figure 21 represents the genomic clone nucleotide sequence of the hnRNP A2 locus that begins from the 5 ' HindIII site shown in Figure 22 (Nucleotide 1-15071).

Figure 22 represents to contain the expression vector that is positioned at the subfragment that is in the double startup subarea between RNP and HP1H-γ, and described RNP and HP1H-γ are with GFP and Neo ^RReporter gene is specified.These carriers are: a control vector that has the RNP promotor (RNP) that starts the GFP/Neo expression; A carrier (5.5RNP) that contains RNP promoter region upstream 5.5kb fragment and RNP promotor; Use the carrier of shearing the acceptor construction of strategy, it is characterized in that shearing the front that acceptor/branch consensus sequence (being derived from the exon 2 of RNP gene) is cloned in the GFP gene, produce and to show son 1 (7.5RNP carried the RNP gene of about 7.5kb before GFP) in the part of exons 1/GFP upstream; With a carrier (1.5RNP) that contains RNP promoter region upstream 1.5kb fragment and RNP promotor.

Figure 23 represents to contain the expression vector that is positioned at the subfragment that is in the double startup subarea between RNP and HP1H-γ, and described RNP and HP1H-γ are with GFP and Neo ^RReporter gene is specified.This class carrier contains allos CMV promotor.These carriers are: have the CMV promotor that starts the GFP/Neo expression and be positioned at Reo ^RThe control vector (CMV-EGFP) of the SV40 promotor of reporter gene upstream, this CMV promotor have (a) internal ribosome entry site sequence (CMV-EGFP-IRES) and (b) do not have an internal ribosome entry site sequence; One contains and is positioned at RNP promoter region upstream 5.5kb fragment and has internal ribosome entry site and drive the carrier (5.5CMV) of the CMV promotor that GFP/Neo expresses; One contains the carrier (4.0CMV) the 4.0kb sequence and that start the CMV promotor of GFP/Neo expression that is comprising RNP and HP1H-γ promotor, and this carrier has the SV40 promotor in the upstream of NeoR reporter gene; And one contain 7.5kb RNP gene order and start the CMV promotor that GFP/Neo expresses and be positioned at reporter gene Neo ^ROn the carrier (7.5CMV) of SV40 promotor, this RNP gene comprises in exons 1 and the part and shows son 1.

Figure 24 represents RNP-and the transfection of CMV-construct are advanced several G418 that produce in the Chinese hamster ovary celI ^RThe clone.

Figure 25 is illustrated in the comparison of expressing with GFP among the CHO that is selected by the G418 clone of RNP-that has and do not have upstream element and the transfection of CMV-construct.

Figure 26 represents to be cloned in average meta GFP fluorescence level in time of 40 days with the CHO that is selected by G418 that has and do not have a RNP-construct transfection of upstream element.

Figure 27 be illustrated in GFP in the CMV-GFP storehouse of cultivating under the situation that does not have G418 be expressed in 103 days during in the FACS distribution plan.

Figure 28 be illustrated in GFP in the 5.5CMV-GFP storehouse of cultivating under the situation that does not have G418 be expressed in 103 days during in the FACS distribution plan.

Figure 29 is illustrated in the percentage of the transfectional cell minimizing of the interior GFP of expression of time after 68 days.

Figure 30 is illustrated in time of 66 days the meta fluorescence with the cell of being selected by G418 of CMV-construct transfection.

Figure 31 is illustrated in time of 66 days the percentage with the positive cell of being selected by G418 of CMV-construct transfection.

Figure 32 is illustrated in the 13rd day meta fluorescence with the cell of being selected by G418 of CMV-construct transfection after the transfection.

Figure 33 is illustrated in time of 27 days the percentage with the positive cell of being selected by G418 of CMV-construct transfection.

Figure 34 represents the clone number of Chinese hamster ovary celI after transfection with various CMV-constructs.

Figure 35 represents the Dot blot analysis to people source PSMB1, PDCD2 and TBP mRNA.Use a plurality of people source tissue to analyze the tissue distribution of TBP bunch of intragentic mRNA: each fragment is a certain amount of poly-(A) in the load all ⁺RNA (amount of A is marked under every kind of tissue, represents with ng).With (B) PSMB1 cDNA, (C) contain the 4.7kb genomic fragment (MA445) of part PDCD2 gene and (D) TBP cDNA carry out Dot blot hybridization.Ubiquitin contrast probe (E) shows that the method for this standard is successful, and RNA is complete.

Figure 36 represents the effect of pWE-TSN clone long-term cultivation.In 60 generations of many pWE-TSN mouse Lcells clone cultured continuously.For freeze/thaw, in liquid nitrogen, at least the clone was stored 2 days, before results RNA, thaw and cultivated for 1 week, then cell freezing is carried out next one and circulate.In substratum with and test without G418.As described here, measure the expression of TBP with TB14 oligonucleotide and people source specificity restriction restriction endonuclease (use+representing).All samples is all analyzed under the situation of enzyme not having, and the result is consistent.Also show the sample of representative (-).

Figure 37 is illustrated in the analysis of TBP genetic expression among the pBL3-TPO-puro clone.As described here, use total RNA and TB14 primer to TBP genetic expression analyze, this total RNA is isolated from the mouse Lcell with the transfection of pBL3-TPO-puro construct.The source specific enzymes digestion of having chosen of (+) expression PCR product on the swimming lane top, digestion (contrast) of (-) expression.Also show people source (K562) and mouse source (non-transgenic lung) RNA contrast and do not have RNA contrast (dH ₂O).Arrow represents not cut (people and mouse or mouse) position and people source specificity product.Copy number is corrected into expression values, and 100% expression is meant the same horizontal expression of genetically modified single copy with one of two endogenous murine genes.All copy numbers change in 1-2, and are indicated on the top of each post figure.

Figure 38 represents that (B) people source HP1 γ mRNA expresses and (C) the Dot blot analysis of people source hnRNP A2 mRNA.Use a plurality of people mRNA of source tissue Dot blots to analyze HP1 γ mRNA in hnRNP A2 bunch and the tissue distribution of hnRNP A2 mRNA: to give each fragment load a certain amount of poly-(A) ⁺RNA (scale of A is shown in the below of every kind of tissue, and unit is ng).Carry out dot hybridization with (B) from a 717nt PCR fragment of HP1 γ cDNA sequence and the 1237nt PCR probe of the PCR primer 5 ' GCTGAAGCGACTGAGTCCATG3 ' that (C) uses to express hnRNP A2 and 5 ' CCAATCCATTGACAAAATGGGC3 ' generation.

Figure 39 represents to be integrated into the TBP transgenosis fish analysis result of mouse Ltk cell, proves that transgenosis is incorporated on the allos chromatin of kinetochore.(A) the kinetochore integration does not take place in expression, (B) with (C) two independently kinetochore integration of expression.

Figure 40 is illustrated in the expression with erythropoietin (EPO) in the Chinese hamster ovary celI storehouse of CET300 and CET301 construct stable transfection, and CET300 and CET301 construct include the gene of the 7.5kb subfragment, CMV promotor and the coding EPO that are positioned at the double starting subarea between RNP and HP1H-γ.

Figure 41 represent the fluorescence EGFP with the mouse Ltk cell clone of 16RNP-EGFP transfection express with and with the relation of copy number.Clone F1, G6 and I3 have the 16RNP-EGFP that is positioned on the allos chromatin of kinetochore, mouse source.

Figure 42 represents the fish analysis with the mouse Ltk cell of 16RNP-EGFP transfection.(A) expression does not have the clone H4 that the kinetochore is integrated, (B, C, ﹠amp; D) expression has clone G6, F1 and the I3 that the kinetochore is integrated respectively, and t is 16RNP-EGFP, and c is kinetochore, mouse source.

Figure 43 is illustrated in the FACS distribution plan with EGFP expression in the Hela cell of EBV transfection that the condition with hygromycin B was cultivated 41 days, and described EBV comprises 16RNP.

Figure 44 is illustrated in the FACS distribution plan with EGFP expression in the Hela cell of EBV transfection when the hygromycin B existence being arranged in the whole culturing process and removing hygromycin B in the time of the 27th day, and EBV includes 16RNP.

Figure 45 is illustrated in EPO output in the cell of CET300, CET301 and CMV-EPO transient transfection.

Figure 46 is illustrated in the ELISA result of the NTR expression that detects various AFP constructs in HepG2 (AFP+ve) and KLN205 (AFP-ve) cell.

Figure 47 is illustrated in CTL102/CTL208 and carries out in the tumour injection back NTR in the HepG2 tumour and the expression in host mouse liver.

Figure 48 represents to carry out with CTL102/CTL208 and CB1954 that the HepG2 growth of tumor suppresses behind the tumour inner injecting and administering.

Figure 49 represents the structure of support C ET200 and CET210.

Figure 50 represents the construct that produced and the comparison of used fragment and hnRNP A2 native gene group locus.

Figure 51 represents the meta fluorescence FAC analysis chart with the HeLa cell colony of non-replicability plasmid transient transfection.

Figure 52 represents the synoptic diagram with the low magnification field of HeLa cell colony of non-replicability plasmid transient transfection.

Embodiment

Material and method

Library screening

From P1 deutero-artificial chromosome (pCYPAC-2) library (CING-1; Ioannou et al., 1994) isolate genomic clone across people source TBP and hnRNP A2 locus.Polymerase chain reaction (PCR) with Bacterial Lysates screens.

The primer that is used for TBP

With (1995) described portion gene group sequences Design primers such as Chalut, this primer is as follows: TB3[5 ' ATGTGACAACAGTGCATGAACTGGGAGTGG3 '] (605) and TB4[5 ' CACTTCCTGTGTTTCCATAGGTAAGGAGGG3 '] (119) hybridize to 5 of TBP gene ' untranslated district (5 ' UTR) and only produce the 486bp PCR product (seeing the result) be derived from human source gene.Numeral in the parenthesis is corresponding with the mRNACAP site that (1990) such as Peterson are limited.

With TB5[5 ' GGTGGTGTTGAGAAGATGGATGTTGAGG3 '] (1343) and TB6[5 ' GCAATACTGGAGAGGTGGAATGTGTCTGGC3 '] (1785) amplification is from the zone of 3 ' UTR, and because people and mouse DNA have remarkable sequence homology in this zone, and produce the 415bp product of the two since then.Numeral in the parenthesis is corresponding with the cDNA sequence that (1990) such as Peterson are limited.

The primer that is used for HnRNP A2

Be designed for the primer of HnRNP A2 by (1994) described genome sequences such as Biamonti.With the Hn1[5 ' ATTTCAAACTGCGCGACGTTTCTCACCGC3 ' among 5 ' UTR] (309) and Hn2[5 ' CATTGATTTCAAACCCGTTACCTCC3 '] (199) provide the PCR product of 508bp.With Hn3[5 ' GGAAACTTTGGTGGTAGCAGGAACATGG3 '] (7568) and Hn4[5 ' ATCCATCCAGTCTTTTAAACAAGCAG '] (8176) zone in the exon second from the bottom (numeral 10) of increasing, provide the PCR product of 607bp.Numeral in the parenthesis is corresponding with the transcripting start point that (1994) such as Biamonti are limited.

The PCR flow process

In a reaction, use the merged clone's material of 1 μ l to carry out PCR, wherein in 25 μ l total reaction liquid, contain: dATP, dGTP, each 25mM of dCTP, dTTP, 1 * reaction buffer (50mM Tris-HCl[pH9.1], 16mM (NH ₄) ₂SO ₄, 3.5mM MgCl ₂,, 150 μ g/ml bovine serum albumins), the Taq Supreme polysaccharase (Fermentas) of 2.5 units and every kind of primer 1 μ M.Cycling condition is: preceding 4 cycling conditions are 94 ℃ of 1 fen kinds, 62 ℃ 1 minute, 72 ℃ 1 minutes, 30 cycling conditions subsequently be 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 1 minute.At the T-Broth that contains 30 μ g/ml kantlex (12g Tryptones, 24g yeast extract (the two is the product of Difco), 23.1gKH ₂PO ₄, 125.4gK ₂HPO ₄, every liter of distilled water 0.4% glycerine; Tartof and Hobbs, 1987) cultivate in and be identified as the male clone.Being prepared as of the non-recoverable storage liquid of bacterium: 1 * storage buffer (3.6mM K ₂HPO ₄, 1.3mM KH ₂PO ₄, 2.0mM Trisodium Citrate, 1mM MgSO ₄, 4.4% glycerine) in liquid suspension freezing at-80 ℃.

CYPAC-2 DNA separates

As described below, use alkali bacteriolyze method (Birnboim and Dolly, the 1979) isolated plasmid dna of improveing.Single bacterial colony moved into contain in 2 liters of iris type glass flask of 1 liter of T-Broth, at 37 ℃ of continuous vibration incubations 16 hours.Obtained bacterium with Beckman J6 whizzer down in centrifugal 10 minutes at 4200rpm (5020 * g, institute subsequently is similar with it in steps).Stir throw out, make throw out at 15mM Tris-HCl[pH8.0], suspend and incubation 15 minutes at room temperature among 10mM EDTA, the 10 μ g/ml RNaseA (200ml) once more.Stir the limit gently with 2 minutes limits and add lysate (0.2M NaOH, 1%SDS; 200ml), stir the limit gently with 5 minutes limits more subsequently and add 200ml neutralization solution (3M potassium acetate [pH5.5]).Make the bacteria breaking thing 4 ℃ of following precipitations 1 hour, centrifugal then 15 minutes and use the sterile gauze filtering supernatant.In 1 hour with Virahol (400ml; Ultimate density is 40%) at room temperature add sedimentary plasmid DNA.Centrifugal 15 minutes also with behind the 70% alcohol flushing particle, DNA is suspended in the 4ml solution that is made of 1 * TNE (50mM Tris-HCl[pH7.5], 5mM EDTA, 100mM NaCl), 0.1%SDS and 0.5mg/ml Proteinase K (Cambio), so that remove remaining protein once more.55 ℃ of incubations 1 hour, then use phenol: (1: 1v/v) extract, 100% ethanol or the Virahol with 1 volume precipitates DNA to chloroform subsequently, and this DNA is put into 2mlTE damping fluid (10mM Tris-HCl[pH8.0], 1mM EDTA).Can obtain 50 μ g/ml products routinely.

The Restriction Enzyme mapping

By the oligonucleotide hybridization (Southern, 1975) to the Southern trace of the cloning DNA of above-mentioned being limited property enzymic digestion that is derived from pCYPAC-2 and TBP gene order, carry out the Restriction Enzyme mapping.Use just hybridizes to the oligonucleotide near the pCYPAC-2 sequence in BamHI site, and described Bam HI site is that genomic fragment is cloned the site in this.The sequence of this oligonucleotide is:

EY2：[5′-TGCGGCCGCTAATACGACTCACTATAGG-3′]

189：[5′-GGCCAGGCGGCCGCCAGGCCTACCCACTAGTCAATTCGGGA-3′]

Excise arbitrary genome insertion fragment with NotI from pCYPAC-2 and mean that segmental each section of being sent will keep a spot of plasmid sequence.In the EY2 side 30bp will be arranged, and the major part of EY2 sequence will be arranged in the excision fragment.Therefore, to the pCYPAC-2 sequence that is digested by NotI, the genome band that is transmitted should manifest in the Southern engram analysis highlightedly with this oligonucleotide hybridization.In pCYPAC-2, will contain 39bp in the plasmid sequence in the cut fragment of 189 sides, and the major portion of 189 oligonucleotide sequences be 3 of NotI site '.So this oligonucleotide can hybridize on the carrier in pCYPAC-2 clone's NotI digestion place.The condition (Fermentas) of using the producer to recommend, with the about 100ng plasmid DNA of digestion with restriction enzyme, use 0.5 * TAE damping fluid (20mM Tris-[pH8.0], 1mM EDTA, 0.5 μ g/ml ethidium bromide) to make it on 0.7% sepharose or pulsed field gel, carry out electrophoresis subsequently.The condition of carrying out pulsed field gel electrophoresis (PFGE) is in CHEF-DRII system (Biorad), 1%PFGE agarose (FMC)/0.5 * TAE gel, and 6V/cm 14 hours, be 1 second to 30 seconds switching time.In this research process, all PFGE are analyzed the unified condition of having used.In the ultraviolet lighting phase front, put gel in the 1 μ g/ml ethidium bromide solution painted.

In the preparation of Southern engram analysis, at first sepharose is exposed to 254nm UV-light (180000 μ J/cm ²In the UVP linking agent, UVP), immersed subsequently among 0.5M NaOH, the 1.5M NaCl 40 minutes and make the DNA sex change when after 20 minutes, changing a solution, thereby make DNA that depurination take place.Just by 16 hours boundary of capillarity DNA is transferred to HYBOND-N nylon membrane (Amersham) in the denaturing soln a large amount of.By with 120000 μ J/cm ²Be exposed under the 254nm ultraviolet lamp, can make nucleic acid and nylon crosslinked.At 0.5M Tris-HCl[pH7.5], made the film neutralization in 20 minutes among the 1.5MNaCl, and use 2 * SSC flushing before use.(1 * SSC is 150mM NaCl, 15mM Trisodium Citrate, [pH7.0])

With the T4 polynucleotide kinase and ³²P-γ ATP labeled oligonucleotide probe 5 ' end, thus specific fragment on the Southern trace can be detected.Each experiment is used the oligonucleotide of 100ng mark and carry out labeled reactant in the specific damping fluid of manufacturer, wherein uses 2 μ l ³²P-γ ATP (＞4000Ci/mmol; 10mCi/ml is Amersham) with 10 T4 of unit polynucleotide kinases (Fermentas)., go up chromatography at the Sephadex of watering balance G50 post (Pharmacia) and remove unconjugated Nucleotide after 2 hours at 37 ℃ of incubations.End-labelled probe typically is tagged to specific activity＞1 * 10 ⁸Dpm/ μ g.

Hybridize with the film that is clipped between the inner nylon mesh sheet of vial, have in the bottle 25ml preheating hybridization mixture (1mM EDTA[pH8.0], 0.25M Na ₂HPO ₄[pH7.2], 7%SDS; Church and Gilbert, 1984) and the salmon sperm DNA through shearing of 100 μ g/ml sex change.After 1 hour, slowly pour out solution at 65 ℃ of prehybridizations, replace with and contain the same solution that is labeled probe.The suitableeest hybridization temperature determines according to experiment, finds that it is 20 ℃ of Tm that are lower than Nucleotide in the TE damping fluid, and calculation formula is Tm=59.9+41[%GC]-[675/ primer length].After 16 hours, remove Hybond membrane and wash 3 times, with 6 * SSC, 0.1%SDS flushing 2 minutes, subsequently, (BioMAX Kodak) took pictures with the X-exograph X.

DNA construct

Cross over the TBP gene and have 12kb 5 ' and the 44kb genomic dna district of 3 ' flanking sequence from deriving as the segmental pCP2-TNN pCYPAC-2 clone of NotI (see figure 9).Cloning it into, assembling plasmid vector pWE15 (Clontech) produces pWE-TSN (Fig. 9)., therefore must exchange carrier because but the pCYPAC-2 plasmid does not contain the selective marker of eukaryotic cell transfection research usefulness.NotI makes a 44kb fragment be released out to the digestion of pCP-TNN, and this fragment is inserted segmental 5 ' end from genome and extended to the NotI site, and this site is arranged in the genome sequence at the last 12kb place, exon downstream of TBP (referring to Fig. 9).In addition, also produced and contained fragment and the pCYPAC-2 carrier that in the clone, is keeping 20kb 3 ' flanking sequence.PCP2-TNN and the similar shearing of 200ng pWE15 with about 1 μ g NotI digestion in 10 μ l reaction solutions carry out ligation under these conditions.Behind T4 dna ligase heat inactivation, put in the lambda particles phage particle (Stratagene) that infects connecting mixture fully with Gigapack Gold III.The bacteriophage of reorganization is stored in SM damping fluid (500 μ l 50mM Tris-HCl, 100mM NaCl, 8mM MgSO ₄, 0.01% (w/v) gelatin, 2% chloroform).The infection of carrying out is as follows: 5ml is crossed the E.coliDH5 α centrifugal (3000 * g, 5 minutes) that liquid is cultivated, and bacterium is suspended in 2.5ml 10mM MgCl again ₂In.The packaged material of equal volume and E.coli are mixed,, add 200 μ l L-liquid nutrient mediums subsequently 25 ℃ of incubations 15 minutes, this mixture at 37 ℃ of incubations 45 minutes again.This suspension is placed on the LB ammonia benzyl cyanomycin agar plate the little goods that analyzed single bacterium colony was used as later a couple of days.The a large amount of pWE-TSN of preparation from 1 liter of culture is used for the pCYPAC-2 clone.

PCYPAC-2 DNA subclone method

Follow procedure is used for small-sized (less than 10kb) restriction enzyme fragment that subclone derives from the pCYPAC-2 clone.DNA is digested with restriction enzyme, and, be to take a picture under the ultraviolet ray of 365nm at 0.6% low melting-point agarose gel (FMC) electrophoresis and at wavelength, so that the DNA of ethidium bromide staining (Hartman, 1991) otch reduces.The segmental gel district of containing desired size is downcut from the gel,, use 5 minutes balances to 37 ℃ again 68 ℃ of fusings 10 minutes.Plasmid vector pBluescriptKS (+) (Stratagene) is carried out similar digestion with Restriction Enzyme, obtain compatible end, handled 1 hour so that self connects minimizes with the calf intestinal phosphatase enzyme (Fermentas) of 10 units with pCYPAC-2 deutero-DNA.By using phenol: (1: 1v/v) extraction is also used ethanol sedimentation to chloroform subsequently, can carry out purifying to it.The gel film of fusing is mixed with this carrier products of 50ng, reach fragment carrier molecule mol ratio 4: 1.With the T4 dna ligase (10 units Fermentas) add with specific damping fluid, and this mixture 16 ℃ of incubations 16 hours, make enzyme heat inactivation (65 ℃, 20 minutes) subsequently, to improve transformation efficiency (Michelsen, 1995).Use the competent DH5 α of existing program (Sambrook et al, 1989) preparation calcium chloride E.Coli, and carry out conversion subsequently.Fusing with neutralize after this is connected mixture to 37 ℃, add 100 μ l competent cells and keep final agarose concentration to be no more than 0.02%, thereby can finish conversion.37 ℃ of heat shocks 5 minutes, add 1ml SOC medium (20mM glucose in 20g Tryptones, 5g yeast extract, 0.5gNaCl, the per 1 liter of distilled water, [pH7.0] subsequently on incubation bacterium on ice after 2 hours; Sambrook et al., 1989).Again 37 ℃ place 1 hour after, cell and 50 μ l are selected solution (36mg/ml Xgal, 0.1M IPTG) mix, and be placed on the suitable LB antibiotin flat board that contains 20 μ g/ml ammonia benzyl cyanomycins (10g NaCl[pH7.0], 10g Tryptones, 5g yeast extract, every liter of distilled water 20g agar).At 37 ℃ of incubations after 16 hours, because of the beta galactosidase enzyme gene activity is damaged, so the white of itself (check colors mutually and be blue look) can be used for identifying the bacterial colony that contains recombinant plasmid.By separated DNA from the small-sized preparation sample of single bacterium colony is carried out restrictive diges-tion, selecteed bacterium colony is analyzed.Use this program to advance the fragment subclone that is 20kb to the maximum in pBluescriptKS (+) carrier.

With following program the product of pcr amplification is cloned.In 50 μ l volumes, use 1ngpCYPAC-2 deutero-cloned DNA to carry out Standard PC R reaction, afterwards, 10 T4 of unit archaeal dna polymerases (Fermentas) are added in this reaction as template, and 37 ℃ of incubations 30 minutes.After making polysaccharase inactivation (96 ℃, 20 minutes), 7 μ l PCR products are connected in pBluescriptKS (+) carrier of 50ng EcoRV digestion, final volume is 10 μ l.Produce recombinant clone (data is not showed) at high proportion by using the T4 archaeal dna polymerase to mend flat PCR product end.

The generation of PBL3-TPO-puro

PBL3-TPO-puro contains whole 19kb TBP gene (about 1.2kb 5 ' and 4.5kb 3 ' flanking sequence) and puromycin resistance gene box, and it is advanced the pBL3 carrier by subclone.This obtains by 3 successive clone steps.

At first, the 4.5kb sequence is become the NotI-SacII fragment from the pCP2-TLN subclone, wherein 3 ' end side of 4.5kb sequence people source TBP gene in the pCP2-TLN plasmid.The SacII site of this fragment from 3 ' UTR of TBP gene extends in the pCYPAC-2 carrier the NotI site near OL189.This fragment cloning is advanced the pBL3 and the called after MA426 of SacII and NotI digestion.Remaining TBP gene order is stayed on the 19kbp SacII fragment, and this fragment extends to SacII site among 3 ' UTR from about 1.2kb of the upstream of mRNA cap site.This fragment is connected the into linearizing MA426 of usefulness SacII, and correct orientation is carried out colony screening.

Dna sequencing and computer sequential analysis

Use Flexi-Prep system (Pharmacia) preparation DNA, the automatic fluorescence order-checking of DNA is provided with BaseClear (Netherland).Use aforementioned research tool (Altschul et al., 1997) that dBEST and nonredundancy Genbank database are inquired about.All that are used in this research are to obtain by I.M.A.G.E. consortium (Lennon et al., 1996) by the expressed sequence marker clone.(Intelligenetics Inc. USA) carries out the arrangement contrast of a plurality of sequences and the restriction enzyme digestion method of known dna sequence predicted to service routine PCGENE.(InformaxInc. USA) draws to CpG dinucleotide frequency to use VectorNTI software.

The generation of transgenic animal

Be used for the segmental preparation of TBP of micro-injection

By pCP2-TLN clone's NotI digestion, the 90kb genomic fragment (TLN) that comprises the TBP/PSMB1 gene regions is separated, and the sodium-chlor gradient method of preparing to be used to improve (Dillon and Grosveld, 1993) carries out micro-injection.At first, according to the guidance that the manufacturer provides, use LPS deletion box (Quiagen) from a large amount of prepared products of standard pCP2-TLN, to remove bacteria lipopolysaccharide (LPS).NotI (Fermentas) with 70 units digests 50 μ g DNA 1 hour, carries out little five equilibrium analysis by PFGE, to check complete digestion.Use commercial gradient former (LifeTechnologies) in Ultra-Clear Tube (Beckman), to prepare the 5-30% sodium-chlor gradient liquid that 14ml contains 3mM EDTA.With the wide-bore pipet point very small shear is carried out at the top that this DNA that is digested is placed on this gradient liquid, in the SW41Ti swing-out rotor (Beckmaan) with 37000rpm centrifugal 5.5 hours of this gradient liquid (25 ℃).From gradient liquid bottom (high-density) component of about 300 μ l is shifted and into to contain in each miniature centrifuge tube of 1ml 80% alcoholic acid, cultivated 1 hour at-20 ℃ subsequently.Centrifugal (14900 * g, 15 minutes) collect the DNA throw out.Throw out with 70% alcohol flushing, be dissolved in the 20 μ l transgenosis micro-injection damping fluids (10mMTris-HCl[pH7.4], 0.1mM EDTA) and with gel electrophoresis 5 μ l aliquots in the different components are analyzed, to estimate the pollution of carrier and chromosomal DNA.Collect free of contamination component, measure DNA concentration with the optical density of 260nm.

Carry out purifying by NotI digestion with aforesaid electroelution (Sambrook et al., 1989), can isolate 40kb genomic fragment (TSN) from pWE-TSN.Behind the electroelution, use the saturated phenol of TE damping fluid in turn: chloroform (1: 1, v/v), extract for twice removing residual ethidium bromide, thereby make the DNA purifying with water saturated propyl carbinol.100% ethanol with 2 volumes makes the DNA precipitation, and is suspended in once more in the micro-injection damping fluid.By PFGE and with the absorption measurement concentration of 260nm, measure complete segment.Except discharging insertion from carrier, from pBL3-TPO, isolate 25kb genomic fragment (TPO) with unified program by SalI digestion.

Be used for the segmental preparation of hnRNP A2 of micro-injection

As mentioned above, with NruI digestion pCP2-HLN with the supercentrifugal method of sodium chloride concentration gradient (seeing Figure 13 A), be separated to the 160kb genomic fragment (MA160) that comprises hnRNP A2 gene that is used for microinjection.

Method with above-mentioned AatII digestion and PFGE purifying has been separated to 60kb genomic fragment (HSN from MA160; See Figure 13 B).From gel, cut out the 60kb band, be cut into small thin slices again.Every 65 ℃ of fusings, get 30 μ l and analyze with PFGE.Reclaim those demonstrations and have the part of the segmental sample of the purest 60kb.Behind the gel tolerance volume of fusing, add agarase damping fluid (final concentration is 1X), 42 ℃ of balances 10 minutes, per 500 μ l add the agarase (EpicentreTechnologies) of 1 unit.Sample 42 ℃ be incubated overnight after, 4 ℃ are centrifugal 30 minutes.Supernatant liquor is with the sucking-off gently of wide rifle head, in the 10cm culture dish on 0.25 μ m filter to 15ml transgenosis microinjection damping fluid drop-dialysis 4 hours.The solution of having dialysed changes Eppendorf tube over to, and 4 ℃ centrifugal 30 minutes.Segmental integrity is checked by PFGE, and concentration is determined with the 260nm absorbancy.

The structure of transgenic mice

Zygote by nuclear injection C57/B16 mouse obtains transgenic mice.The injection concentration of each dna fragmentation is 1ng/ μ l in the transgenosis damping fluid.(StThomas ' s Hospital London) uses standard technique to identify by UMDS Transgenic Unit for this.Being PCR with isolating mousetail biopsy DNA cited below screens and identifies transgenic mice.Get 0.5cm tail live body from the body of 10-15 age in days mouse, add 500 μ l tail damping fluids (50mM Tris-HCl[pH 8.0], 0.1M EDTA, 0.1M NaCl, 1%SDS, 0.5mg/ml Proteinase K) 37 ℃ of incubations 16 hours.The isopyknic phenol of water: (1: the 1v/v) extracting of overturning lightly, 14900g is centrifugal 15 minutes subsequently for chloroform.Then use two volumes 100% ethanol from aqueous phase deposit D NA, use 70% washing with alcohol.Collect DNA at last, dissolve with 100 μ l TE.Usually can obtain 50-200 μ g DNA (determining) like this by the 260nm absorbancy.The condition of PCR reaction is the same with the screening conditions in pCYPAC-2 storehouse, template 100ng mousetail live body DNA, primer TB3/TB4.Positive mouse that obtains and wild-type C57/B16 mouse are backcrossed, thereby obtain complete genetically modified F1 first filial generation.

The integrity of transgene and copy number

The copy number of transgene and integrity are made the Southern engram analysis by the mousetail live body DNA with BamHI, BglII, EcoRI and HindIII digestion and are estimated.About 10 μ g DNA walk 0.7% agarose gel electrophoresis with the specific limited restriction endonuclease digestion of 20-30 unit, and damping fluid is 0.5X TBE (45mM Tris-boric acid, [pH8.0], 1mM EDTA), 1V/cm electrophoresis 16 hours.Except use positively charged matrix (HYBOND N+, Amersham) outside, the same with the condition of plasmid Southern trace, DNA is colored, and has transferred on the nylon membrane then.

By preparing dna probe with the carrier sequence of removing any clone with digestion with restriction enzyme, and with the Gene-Clean system (Bio 101, USA), purifying from low melting-point agarose.With commercial kit (Amersham) and dCTP, dGTP, dTTP respectively 200pmol and 3 μ l α- ³²(specific activity is greater than 3000Ci/mmol, and 10mCi/ml Amersham) carries out radio-labeling through nick translation to the 100ng probe sample for P-dATP.The enzyme solution that the standard buffer solution that adding contains the dna polymerase i of 0.5 unit by every 10pg DNase I forms, 15 ℃ of incubations 2.5 hours.Probe faces with before boiling 5 minutes with Sephadex G-50 chromatography purification.Usually can obtain specific activity greater than 1 * 10 ⁸The probe of cpm/ μ g.

The method of hybridization is consistent with above-mentioned plasmid Southern trace method.Film contains 15ml prehybridization solution (the 3X SSC of sex change salmon sperm DNA at 100 μ g/ml, 0.1%SDS, [100X Denhardt ' s solution is that (Type 400 for 2%Ficoll to 5X Denhardt ' s solution, Pharmacia), 2% Polyvinylpyrolidone (PVP), 65 ℃ of incubations are 1 hour in every liter of distilled water 2% bovine serum albumin (Fraction V, Sigma)]).Then solution changes the radiolabeled probe's of containing 100 μ g/ml sex change salmon sperm DNAs and thermally denature 15ml hybridization solution (adding T 500 to 10% in prehybridization solution) into.65 ℃ of hybridization were washed film three times with the 2X SSC that contains 0.1%SDS after 16 hours, each 30 minutes, at-80 ℃ with PhosphorImager (Molecular Dynamics) imaging or clap the X-ray sheet.In 0.2M NaOH, soak and removed the bonded probe in 20 minutes,, trace is analyzed once more with the aforesaid method neutralization.

Most of probe of using in the experiment is all from sequence in the genomic clone and unclear zone (such as the terminal probe of pCP2-TLN and other probes from TBP intron zone).Many probes are not to hybridize with the human gene group DNA specifically, and may there be competitive sequential element in this hint.In order to avoid this problem, with the dna probe equal portions one by one separately with multiple digestion with restriction enzyme and carry out electrophoresis and the Southern trace.The enzyme short with recognition site is digested to some littler fragments to probe.Radiolabeled people C0t-1 DNA is used as probe to show whether these fragments contain competitive sequence.Because used probe contains competitive sequence, so with this method fragment that the C0t-1 dna probe hybridizes that might obtain getting along well greater than 500bp.

The establishment of preparation cosmid DNA and single copy L-cell clone

With method for preparing pWE-TSN DNA from 1 liter of culture of alkaline process bacteriolyze to the isopropanol precipitating step.Be deposited in 25 ℃ of incubations after 1 hour, suspend, add 10ml Sephaglas FP DNA binding matrix (Pharmacia) subsequently with 300 μ l TE.Solution continues to turn upside down 10 minutes, and the DNA that is combined on the matrix collected with 280 * g in centrifugal 1 minute.Precipitation elder generation WS damping fluid (20mM Tris-HCl[pH7.5], 2mM EDTA, 60% ethanol) washing, recentrifuge is washed in centrifugal collection again with 70% ethanol.Precipitation suspends with 2ml TE damping fluid, and 70 ℃ of incubations also mixed in 10 minutes frequently, thereby DNA is eluted from matrix.With 1100 * g centrifugal solution 2 minutes, and the supernatant liquor that will contain DNA on average changed two Eppendorf tubes over to.Residual Sephaglas removed with 14950 * g in centrifugal 15 minutes, merged supernatant liquor, with two volumes ethanol sedimentation DNA.The DNA that twines with 70% washing with alcohol once and suspends with sterilized water that to make it concentration be 1 μ g/ μ l.Usually can obtain the pure cosmid DNA of 75-100 μ g with this method, this roughly is the 60-80% of the DNA that obtains without the Sephaglas purifying.

The adherent mouse L-of transfection cell (Earle etc., 1943) with the following method.About 1 * 10 ⁷Cell is grown in the DMEM that contains 10% heat-inactivated fetal bovine serum (PAA laboratory), 2mM L-glutaminate.With cell and the linearizing pWE-TSN DNA of 1 μ g SalI mixing, put and cultivate 10 minutes on ice.The DNA transfered cell, condition is 960 μ F with electroporation (Chu etc., 1987), and 250V, instrument are Biorad GenePulser.With the same substratum screening and the cultivation transfectional cell that contain 400 μ g/ml G418 (LifeTechnologies Inc.).Single clone obtains with clone's ring (Freshney, 1994) separation.Heavy wall stainless steel clone ring (Life TechnologiesInc.) is in the sterilization of silicone oil mesohigh and be transferred in the tissue culturing plate, with this isolated cell group.Add trypsin solution (300 μ l, 0.25% trypsinase [pH7.6] (Difco), 0.25MTris-HCl[pH8.0], 0.4%EDTA[pH7.6], 0.12M NaCl, 5mM glucose, 2.4mM KH ₂PO ₄, 0.84mM Na ₂HPO ₄12H ₂O, 1% is phenol red), 37 ℃ of incubation plates 5 minutes.Cell is changed over to 24 plates and sets up cloned cell line.Preserve the clone in the following method.Centrifugal results about 1 * 10 ⁷Cell suspends with 0.75ml freezing mixed liquid (70% type culture liquid contains the DMSO of 20% foetal calf serum and 10%), with dry ice quick-frozen 1 hour, changes in the liquid nitrogen then and preserves.

Method (Sambrook etc., 1989) with standard can obtain genomic dna from these L-cell clones.The cell cultures of T75 culturing bottle (is approximately 4 * 10 to growing up to individual layer ⁷), remove nutrient solution, with PBS (2.68mM KCl, 1.47mM KH ₂PO ₄, 0.51mM MgCl ₂, 136.89mMNaCl, 8.1mM Na ₂HPO ₄[pH7.3]) wash culturing bottle, add then 2ml dissolving damping fluid (10mM Tris-HCl[pH7.5], 10mM EDTA, 10mM NaCl, 0.5%SDS, 1mg/ml proteolytic enzyme-K).Cell is scraped from culturing bottle, change the 15ml centrifuge tube over to the macropore pipette.68 ℃ of dissolvings use phenol after 16 hours: chloroform (1: 1v/v) extraction once, and with equal-volume isopropanol precipitating DNA.After 70% ethanol is washed, with suspend once more DNA and determine concentration of 1ml TE with the 260nm absorbancy.

The rotaring redyeing gene copy number is determined with the Southern engram analysis of the genomic dna of Bgl II digestion.Detect people TBP with a particular probe (1.4HX) that is positioned in the C5 gene (TBP transcription initiation zone 5 ' end 4kb and its are measured a 4.2kb fragment (see figure 10)).Trace is used from the 1kb Ncol fragment of endogenous mouse vav locus (Ogilvy etc., 1998) and is surveyed simultaneously, and it produces band and the single copy of the conduct reference standard of a 5.2kb.By the transgenic mice with reference to 3 copies after analyzing trace at PhosphorImager is TLN:8, and the ratio of contrast TBP and vav signal is determined people TBP transgenosis copy number.

Handle about 4 * 10 with 1ml 3M LiCl, 6M urea ⁷Cell adopts the method for selective precipitation to prepare full RNA (Auffrey and Rougeon, 1980; With reference to Antoniou, 1991).

DNase I hypersensitive site is analyzed

Aforementioned method (Forrester etc., 1987 are adopted in this experiment; Reitmann etc., 1993).From about 1 * 10 ⁹Prepare nucleus (Lozzio and Lozzio, 1975) in the K562 cell.The cell of results is washed with PBS, with the RSB of 4ml ice precooling (10mM Tris-HCl[pH7.5], 10mM NaCl, 3mM MgCl ₂) suspend, add and be equipped with in the glass homogenizer of movable pestle.After adding 1ml 0.5%NP40/RSB, make the cell homogenizing and add 50mlRSB through 10-20 stroke, centrifugal 5 minutes of 4 ℃ of 640xg gather in the crops nuclear with this.Remove supernatant liquor, with containing 1mMCaCl ₂1ml RSB suspension cell nuclear.Get 100 μ l (about 1 * 10 at once ⁸Nuclear), by following method purify DNA, to note controlling endonuclease activity in the separation.

Carry out the digestion of DNase I by following method.Get 0.2mg/ml DNaseI (Worthington) different volumes (0,0.5,1,2,3,4,5,6,8,10 μ l), add and to contain nuclear each tubule of 100 μ l, 37 ℃ of incubations 4 minutes.Add 100 μ l 2X stop solutions (20mM Tris-HCl[pH8.0], 10mM EDTA, 600mM NaCl, 1%SDS) and 10 μ l proteolytic enzyme-K (concentration is 10mg/ml), 55 ℃ of incubations 60 minutes are to stop endonuclease reaction.Use phenol: (1: 1v/v) extracting and ethanol sedimentation carry out the DNA purifying to chloroform.Sample is used by 0.7% agarose (0.5X TBE) gel electrophoresis ³²The radiolabeled probe Southern of P engram analysis.

Preparation RNA

The disconnected neck of 10-40 adult mice in age in week is put to death, and separates all tissues, quick-frozen in liquid nitrogen, and-80 ℃ of preservations are standby.Use 3M LiCl, 6M urea is handled, and adopts the method for selective precipitation to obtain full RNA (Auffrey and Rougeon, 1980).Tissue is changed in the 14ml tubule that contains 1ml LiCl-urea soln, and with a Ultra-Turrax T25 (Janke and Kunkel) homogenate 30 seconds.Through the fragmentation of 3 times 30 seconds ultrasonic pulses (Cole-Parmer Instrument Co.USA), homogenate changes the sterilization Eppendorf tube over to sample again, 4 ℃ of precipitated rnas 16 hours.Collect RNA by centrifugal (4 ℃, 14900xg, 20 minutes), with the washing of 500 μ l LiCl-urea solns, 500 μ l TES (10mMTris-HCl[pH 7.5], 1mM EDTA 0.5%SDS) suspends.Sample process phenol: behind the chloroform extraction, add sodium-acetate, add 1ml 100% ethanol and reach-20 ℃ of precipitations at least 1 hour to 0.3M.By centrifugal results RNA, suspend with 20 μ l sterilized waters, and determine concentration with the 260nm absorbancy.

Analysis based on competition RT-PCR

Analyst TBP expression of gene

Adopt a kind of improved competition RT-PCR method (Gilliland etc., 1990) to come accurately quantitatively people TBP and the expression of PSMB1 gene in mouse.The full RNA that extracts from transgenic mice tissue or clone (1 μ g) is at 25 μ l reaction systems (10 unit bird myeloblastemia syndrome virus [AMV] reversed transcriptive enzymes [Promega], 10mM DTT, 2.5mM each dNTP, 25 unit Yeast Nucleic Acid enzyme inhibitors [Fermentas], 1 μ M reverse primer [TB14 or C5R], 1X reverse transcription damping fluid [25mM pH8.3 Tris-HCl, 25mM KCl, 5mM MgCl ₂, 5mM DTT, 0.25mM spermidine]) in carry out reverse transcription.42 ℃ 1 hour, 52 ℃ 1 hour, 95 ℃ of hot inactivators carried out the synthetic of cDNA in 5 minutes.PCR reaction is increased with 1 μ l cDNA, and use therein reaction mixture is set forth in above mousetail live body screening one and saves and contain the primer that is specific to the sequence of just being inquired into.Primer is by two-wheeled Sephadex G25 chromatogram (Pharmacia) purifying, yield nearly 80%.The PCR reaction conditions be 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 1 minute, and 5 to 30 circulations are arranged.

In order to distinguish people and mouse PCR product, respectively get 2-10 μ l sample, add 5 corresponding restriction enzymes of unit, 37 ℃ of incubations 2 hours.The reaction system volume is big (250 μ l), thereby can dilute salinity and washing agent in the PCR damping fluid, suppresses restriction enzyme enzymic activity (from results of comparison, this is necessary) to prevent them.Enzyme cut and do not have sample that enzyme cuts by with 25 μ g yeast tRNA (Sigma) and ethanol co-precipitation, centrifugal collection is with 5 μ l gel-loading buffer (5mM Tris-boric acid [pH8.3], 1mM EDTA, 7mM urea, 0.1% xylene blue AS, 0.1% tetrabromophenol sulfonphthalein) suspend.Sample wherein uses with 7M urea (NationalDiagnositics is 5% polyacrylamide gel of denaturing agent) through the prerunning analysis, and damping fluid is 0.5X TBE.The 40V/cm electrophoresis is after 1 hour, and the cutting gel is to remove residual uncorporated Nucleotide, and these Nucleotide run in the front of xylene blue AS dyestuff, carry out drying, claps the X-ray sheet or uses the PhosphorImager imaging analysis.

Analyst hnRNP A2 expression of gene

Adopt the accurately quantitatively expression of people hnRNP A2 gene in mouse of a similar competition RT-PCR method (Gilliland etc., 1990).After the reverse transcription, the cDNA sample increases by PCR, uses primer sets Hn9 and Hn12[5 '-CTCCACCATATGGTCCCC-3 '], one of them primer carries out end mark with aforesaid method.For identifier and mouse hnRNP A2 gene PCR product, respectively get 2-10 μ l sample, add the HindIII of 5 units, 37 ℃ digested 2 hours, purifying, 5% denaturing polyacrylamide gel electrophoresis, the result carries out quantitative analysis as stated above.

Clone's order-checking and bioinformatic analysis

The HindIII genomic clone of TBP (1-9098 Nucleotide is seen Figure 20) and hnRNP A2 (1-15071 Nucleotide is seen Figure 21) locus is by Baseclear, Leiden, and NL checks order.The primer walking method of using the primer that made by known array to begin records unknown nucleotide sequence zone (TBP Nucleotide 1-5642, hnRNP A2 Nucleotide 1-3686).

These sequences and known sequences information are stitched together, carry out bioinformatic analysis.

TBP and hnRNP A2 sequence are directly compared in Smith-Waterman search with standard.The result shows except that several Alu repeated sequences as shown in figure 19, do not have tangible homologous region.Shield these tumor-necrosis factor glycoproteinss, and compare with GCG best-fit program, the result has found two sections very short homologous sequences as follows.

RNP 3868-3836:TBP 8971-9003 length=33 homologys=75.758%

RNP 3425-3459:TBP 9049-9083 length=35 homologys=74.286%

Through identifying that the CpG-zone as shown in figure 19.Nucleotide position is as follows:

RNP?4399-5491，5749-6731

TBP?5285-5648，6390-6966

Carry out sequential analysis as stated above, obtain more sequence information with upstream region from RNP and TBP gene.

The sequence data that Figure 20 and 21 provides starts from 5 of HindIII site ' end, and comprises sequence that Baseclear records and the sequence data of having delivered that obtains through splicing.Wherein the TBP sequence that records of Baseclear is represented with capitalization.

The analysis revealed of these sequences exists a gene qualitatively, the heterochromatin associated protein H-γ (Figure 19 and 22) of HP1H-γ or RNP upstream region of gene.This gene of tissue Dot blot analysis revealed is generally expressed (this data are not provided).

Bioinformatic analysis and sequence alignment show between these two locus does not have the obvious sequence homology.The summary that has shown these data among Figure 19.Can see that several generally acknowledged Sp1 transcription factor binding site point locations are at the two-way startup subregion of these two locus.Also pointed out not by methylated CpG zone.Two locus have bi-directional configuration, and contain a series of genes of generally expressing.

The structure of hnRNP A2 EGFP report structure

By with KpnI and NotI digestion pEGFP-N1 (Clontech) to send the EGFP sequence, obtain CMV-EGFP-IRES, import the pIRESneo (Clontech) that is partly digested by KpnI and NotI.So just made up a carrier that contains the EGFP gene, and EGFP is positioned at 3 of CMV promotor ' end and is positioned at 5 of IRESneo ' end (CMV-EGFP-IRES).

The CMV promotor is replaced to the structure that the RNP promotor makes up Figure 22.Digest CMV-EGFP-IRES with AgeI, with T4 archaeal dna polymerase (50mM Tris pH7.5,0.05mMMgCl ₂, 0.05mM DTT, 1mM dNTP, the every μ g DNA T4 of 1 unit archaeal dna polymerase) and mend flat end, then cut the CMV promotor to produce EGFP-IRES with the NruI enzyme.From the hnRNP A2 HindIII of 8kb clone (8kb Hind BKS contains first exon of promotor and RNPA2 and HP1H-γ gene), remove the RNP promotor.Cut 8kbHind BKS (sending the promotor of 630bp) with BspEI and Tth111I, the T4 archaeal dna polymerase is mended flat terminal, and isolating RNP promotor is connected into EGFP-IRES.

The EGFP-IRES box is inserted 8kb Hind BKS make up 5.5RNP, thereby can control the expression of EGFP by the RNP promotor.The latter, cuts with the SalI enzyme with the flat end of T4 archaeal dna polymerase benefit through partly digesting with Tth111I again, thereby removes all sequences of RNP promotor 3 ' end.Cut an EGFP-IRES box with the AgeI enzyme and from CMV-EGFP-IRES, shift out, mend flat terminal back and cut with the XhoI enzyme.Connect the 8kb Hind BKS that advances to limit then.

By the CMV-EGFP-IRES box being injected 8kb Hind BKS, and remove the RNP promotor subsequently and make up 5.5CMV.8kb Hind BKS cuts through the BspEI enzyme, mends flat end, and the SalI enzyme cuts all sequences except that RNP promotor and promotor 3 ' end.Cut CMV-EGFP-IRES with NruI and XhoI enzyme and remove the CMV-EGFP-IRES box, then it is moved into the 8kbHind BKS that enzyme was cut.

Approximately from 5.5RNP, remove 4kb DNA, make RNP promotor 5 ' end only stay 1.5kb, be built into 1.5RNP.This process is by carrying out with BamHI digestion 5.5RNP, and it obtains 4,2.9 and three fragments of 5kb.Separation 2.9 and 5kb fragment reconnect, and are built into 1.5RNP when the 2.9kb fragment is inserted correct position.

Contain the hnRNPA2 sequence (construct 7.5RNP and 8.5RNP) that is positioned at RNP promotor 3 ' end 5.5RNP construct extends to, this zone comprises first exon and the intron of hnRNPA2 gene.For the EGFP-IRES reporter gene is added in these structures, must include the splice acceptor sequence of hnRNPA2 gene extron 2 and EGFP, like this, the exons 1 of hnRNPA2 gene can be spliced on the EGFP gene, and the EGFP expression of gene also can break away from the control of RNP promotor.Structure comprises two constructs in about 1kb zone of the hnRNPA2 gene splicing site of 80bp and second exon 5 ' end, and these sequences are to obtain from the MA160 that contains whole hnRNPA2 gene orders with PCR method.Separate 80bp sequence (20mM Tris-HCl pH8.4,50mM KCl, 1 μ M primer, 2mM MgCl with PCR method ₂0.2mM dNTP, 3.5 μ g MA160 DNA, 5 unit platinum Taq archaeal dna polymerases), wherein primer is [5 ' ACCGGTTCTCTCTGCAAAGGAAAATACC 3 '] and [5 ' GGTACCCTCTG CCAGCAGGTCACCTC 3 '], and separating 1kb fragment the primer is [5 ' ACCGGTTCTC TCTGCAAAGGAAAATACC3 '] and [5 ' GGTACCGAGCATGCGAATGGA GGGAGAGC TCCG 3 '].Designing these primers makes its PCR product contain KpnI and AgeI restriction enzyme site respectively at 5 ' end and 3 ' end.The PCR product cloning is arrived TA cloning vector pCR3.1 (Invitrogen).

From pCR3.1, isolate 80bp and 1kb KpnI-AgeI fragment, change the CMV-EGFP-IRES that KpnI partly digested over to, then cut processing, so just made up the in-frame fusion of EGFP gene and acceptor splicing site (SA) with the AgeI enzyme.

By mending flat end and SalI digestion, made up 7.5RNP with ClaI digestion 8kb Hind BKS, T4 archaeal dna polymerase., T4 archaeal dna polymerase partially digested with KpnI mended flat end and XhoI digestion, separates obtaining 80bp SA-EGFP-IRES fragment.It is imported the 8kb Hind BKS that ClaI-SalI digested.

8.5RNP structure as follows.Partly digest 8kb Hind BKS and the SalI enzyme is cut processing with SphI.Partly digest to cut obtaining 1kb SA-EGFP-IRES box then by similar SphI, box is imported 8kb Hind BKS make up 8.5RNP with the XhoI enzyme.

Make up 4.0CMV by from 8kb Hind BKS, cutting out a 4kb fragment with BamHI/HindIII/BstEII.Segmental terminal the benefit with Klenow and T4 archaeal dna polymerase put down.

With AseI pEGFP-N1 (Clontech) is carried out linearization process, mend flat end, handle with calf small intestine Phosphoric acid esterase (CIP) with top method.All fragments connect spends the night.

From p8kb Hind BKS, cut out the 8.3kb fragment, to make up p7.5CMV with HindIII.This fragment is terminal mends flat with Klenow and T4DNA polysaccharase.PEGFP-NI (Clontech) linearizing, end is as above mended flat with AseI, uses calf small intestine Phosphoric acid esterase (CIP) to handle again.These two kinds of fragments connections are spent the night.From all clones, carry out forward and the oppositely screening of 8.3kbUCOE insertion.

From MA551 (hnRNPA2 genomic clone, it comprises 5kb 5 ' sequence and the 1.5kb 3 ' sequence that contains whole coding region (the 16kb fragment shown in Figure 13 C)), cut out the fragment of a 16kb with SalI, to make up p16CMV.Segmental terminal the benefit with Klenow and T4 archaeal dna polymerase put down.With AseI pEGFP-N1 (Clontech) is carried out linearizing, end is as above mended flat, uses calf small intestine Phosphoric acid esterase (CIP) to handle then.Two kinds of fragments connect spends the night.From all clones, carry out forward and the oppositely screening of 16kb UCOE insertion.

The transfection of Chinese hamster ovary celI

From 2 * 10 ⁷Gather in the crops Chinese hamster ovary celI in the serum-free medium of cell/ml.Each with 1 * 10 ⁷Cell (0.5ml) carries out transfection, uses the smart carrier DNA of 1 μ g (5 μ l) linear DNA and 50 μ g (5 μ l) salmon simultaneously.After DNA and the cytomixis, put 10 minutes on ice.With BioRad Gene Pulser II ^TMUnder the condition of 975 μ F/250V, carry out cell electroporation, put afterwards 10 minutes on ice.Then mixture is added 10ml perfect medium (HF10), centrifugal 5 minutes of 1400rpm.Remove supernatant liquor, suspend with 5ml HF10 and precipitate.Then, with per 5 * 10 ⁴Or 1 * 10 ⁴Cell is layered on the 10cm Tissue Culture Dish or each T225 bottle 2 * 10 ⁶Cell.After 24 hours, screen with 300 μ g/ml G418, use 600 μ g/ml G418 after 4 days.After the transfection 10 days, thin group dyes and counting with methylene blue (with 2% solution of 50% ethanol preparation).The population of cells that the cell of parallel laboratory test is selected with strictness or the mode of single cell clone are protected kind of a cultivation.

The GFP expression of gene is analyzed among the Chinese hamster ovary celI clone of transfection

Transfectional cell screens with 600 μ g/ml G418.Wash cell from 6 orifice plates and make the GFP expression analysis.(PBS Gibco) washes cell, uses trypsinase/EDTA (Sigma) to cultivate then and splits away off from culture plate until cell with phosphate buffered saline buffer.(FCS, excessive Nutrient miscellany F12 (HAM) substratum (Gibco) Sigma) adds cell, and changes cell over to 5ml round bottom polystyrene tube with having added 10% foetal calf serum.With Becton-Dickinson FACscan analysis of cells, detect the GFP expression of gene by the autofluorescence that compares parental cell.Analyze 19RNP clone, 24 5.5RNP clone, 21 CMV clone and 12 5.5CMV clone, the result gets the fluorescence mean value of all positive colonies.

The GFP expression of gene is analyzed in the Chinese hamster ovary celI group of transfection

To from the T225 tissue culture flasks, take out through the Chinese hamster ovary celI group of the transfection of G418 screening, be layered on the 10cm Tissue Culture Dish about 100 colonies of wherein every dish.After colony is grown up, take out cell, the GFP expression analysis is done in this transfectional cell storehouse that has., detect GFP with ordinary method simultaneously and express with division in 1: 10 every 3-4 days cells.Cell all is assigned to 24 orifice plates before each the analysis, detects the similar length of cell on the same day like this to 50% fraction of coverage.Then take out cell, with the methods analyst identical with the front from 24 orifice plates.For expressing time-histories, selected a marked region (M1) that only contains the sub-fraction positive cell, be used for studying the reduction in time of GFP expression of gene.

The fish analysis of single copy or low copy integrator gene

TBP plasmid pWE-TSN or pBL3-TPO-puro with 40kb do fish analysis

With 40kb TBP plasmid pWE-TSN (Fig. 9) or 25kb cosmid pBL3-TPO-puro the mouse Ltk-cell that is grown in the DMEM-10% foetal calf serum is carried out electroporation.With 200mg/ml G418 (TSN) or 5mg/ml tetracycline (TPO) screening transfectional cell, single copy or low copy clone that title is mentioned have so just been obtained.Before the harvested cell, handle the logarithmic phase cell 1 hour among the clone be sieved to the 0.4mg/ml colchicine.Then,, and be layered on the microslide, obtain Metaphase Chromosome with methyl alcohol-acetic acid treatment of 3: 1 with cell hypotonic swelling in 0.056M KCl.Slide glass was handled 1 hour for 37 ℃ with the 2X SSC (1X SSC is 0.15M NaCl, the 0.015M Trisodium Citrate) that contains 100mg RNaseA/ml in advance, washes with 2X SSC, and through a series of ethanol (70,90 and 100% ethanol) dehydration.Make karyomit(e) 70 ℃ of sex change 5 minutes with the 2XSSC that contains 70% methane amide, drop into 70% ethanol of ice precooling, as above dehydration.Nick translation (Boehringer) method of utilizing the manufacturer to indicate, with digitoxin-11-dUTP and the vitamin H-TBP probe (carrying whole TPO plasmid) of 16-dUTP difference mark 100ng and mouse γ-satellite probe (Horz etc., the Nucl.Acids Res.9 of 50ng by the 25kb people's gene group sequence of TBP genomic constitution; 683-696,1981).The probe of mark suspends with 50% methane amide-2X SSC-1%Tween20-10% T 500 solution, 75 ℃ of sex change once more with 1mgcot-1 DNA and 5mg herring sperm dna precipitation.The TBP probe was 37 ℃ of preannealings 30 minutes, and enrichment is added on the slide glass.Spend the night 37 ℃ of hybridization.Slide glass is washed 4 times with 50% methane amide-2X SSC at 45 ℃, each 3 minutes; Wash each 3 minutes 4 times with 2X SSC for 45 ℃; Wash each 3 minutes 4 times with 0.1X SSC for 60 ℃.After washing 5 minutes with 4X SSC-0.1%Tween 20, with 4X SSC-5% skimmed milk sealing slide glass 5 minutes.By successively with the probe of following these reagent at the plain mark of 30 minutes detection of biological of 37 ℃ of incubations: the Texas Red of coupling avidin (Vector Laboratories Inc, USA), biotinylated resisting-avidin (VectorLaboratories Inc, USA), coupling the Texas Red of avidin (Vector LaboratoriesInc, USA).The probe and the vitamin H of digitoxin mark detect simultaneously, agents useful for same is as follows successively: anti--digitoxin-fluorescein (FITC, Boehringer), mouse anti-FITC (DAKO), the anti-mouse IgG of fluorescein bonded horse (Vector Laboratories Inc, USA).Between per twice incubation, wash slide glass 3 times with 4XSSC-0.1%Tween20, each 2 minutes.Redye slide glass with DAPI (4 '-6-diamidino-2-phenylindone), with Vectashield (Vector Laboratories Inc, USA) fixing.With object lens is the fluorescent microscope observed result of 100X oil mirror.Result images uses instrument Photometrics cooled charge-couple device camera and VysisSmartcapture software to obtain.

Do fish analysis with the 16RNP-EGFP construct

By some the RNP 5 ' sequences among EGFP-IresNeo expression cassette and the 8.5RNP are inserted MA551, made up the 16RNP-EGFP carrier.8.5RNP with XhoI digestion, the T4 archaeal dna polymerase is mended flat terminal, digests with PacI again.The fragment that obtains is at last imported NheI shear, mend the gentle MA551 that handled with PacI.As 8.5RNP, express by the RNP promoters driven, therefore the in-frame fusion that produces the exons 1 of EGFP and RNP.

Transfection the mouse LTK-cell clone of 16RNP-EGFP in DMEM-10% foetal calf serum and 200 μ g/mlG418, cultivate.Before the harvested cell, handled the logarithmic phase cell 1 hour with the colchicine of 0.4 μ g/ml.Then cell, with methyl alcohol-acetic acid treatment of 3: 1 and is layered on the microslide to obtain Metaphase Chromosome with the hypotonic swelling of 0.056M KCl.Slide glass was handled 1 hour at 37 ℃ with the 2X SSC (1X SSC is 0.15M NaCl, the 0.015M Trisodium Citrate) that contains 100 μ g RNase A/ml in advance, washes with 2X SSC, and through a series of ethanol (70,90 and 100% ethanol) dehydration.Make karyomit(e) 70 ℃ of sex change 5 minutes with the 2XSSC that contains 70% methane amide, drop into 70% ethanol of ice precooling, as above dehydration.Adopt the method for the nick translation (Boehringer) of manufacturer's explanation, with digitoxin-11-dUTP and vitamin H-16RNP-EGFP of 16-dUTP difference mark 100ng and mouse γ-satellite probe (Horz etc., Nucl.AcidsRes.9 of 50ng; 683-696,1981).The probe of mark precipitates with 1 μ g cot-1 DNA with 5 μ g herring sperm dna and ethanol sedimentations, RNP probe; Suspend with 50% methane amide-2X SSC-1%Tween20-10% T 500 solution; After 75 ℃ of sex change, the RNP probe was 37 ℃ of preannealings 30 minutes; Enrichment, and be added on the slide glass.Spend the night 37 ℃ of hybridization.Slide glass is washed 4 times with 50% methane amide-2XSSC at 45 ℃, each 3 minutes; Wash each 3 minutes 4 times with 2X SSC for 45 ℃; Wash each 3 minutes 4 times with 0.1XSSC for 60 ℃.After washing 5 minutes with 4X SSC-0.1%Tween20, with 4XSSC-5% skimmed milk sealing slide glass 5 minutes.By successively with following these reagent at 30 minutes detection of biological elements of 37 ℃ of incubations: coupling Texas Red (the VectorLaboratories Inc of avidin, USA), biotinylated resisting-avidin (Vector Laboratories Inc, USA), coupling the Texas Red of avidin (Vector Laboratories Inc, USA).Digitoxin and vitamin H detect simultaneously, and agents useful for same is as follows successively: anti--digitoxin-fluorescein (FITC, Boehringer), mouse anti-FITC (DAKO), the anti-mouse IgG of fluorescein bonded horse (Vector Laboratories Inc, USA).Between per twice incubation, wash slide glass 3 times with 4XSSC-0.1%Tween20, each 2 minutes.Redye slide glass with DAPI (4 '-6-diamidino-2-phenylindone), with Vectashield (Vector Laboratories Inc, USA) fixing.With object lens is the Olympus BX40 fluorescent microscope observed result of 100X oil mirror.Result images uses Photometrics cooled charge-couple device camera and VysisSmartcapture software to obtain.

Determining of copy number

Adopted the method (Sambrook etc., 1989) of standard from cell clone, to obtain genomic dna.Carry out the Southern engram analysis by genomic dna and determine the rotaring redyeing gene copy number HincII digestion.Use from 16RNP-EGFP comprise neomycin resistance gene and with [α- ³²P] (Megaprime dna marker system, 1kb fragment hybridization Amersham) can detect the transgenosis band of a 2.5kb to the dCTP mark.For stdn, trace is used for simultaneously from the hybridization of the 1k bp NcoI of the as above mark of mouse vav locus (Ogilvy etc., 1998) fragment, and it produces the band of a 1.4kb.As the copy number of criteria, digested by PstI from several pWE-TSN clone's DNA, and with above-mentioned probe hybridization.With the quantitative hybridization signal of Cyclone PhorsphorImager (Packard).

The GFP expression of gene is analyzed among the Ltk clone of transfection

Transfectional cell is kept under 200 μ g/ml G418 select.Scrape long cell from 6 orifice plates, do the GFP gene expression analysis to the 80-100% fraction of coverage.Cell is washed with PBS, handles splitting away off from culture plate until cell with trypsinase/EDTA (Sigma).In cell, add and contain the excessive DMEM (Gibco) of 10% foetal calf serum, and change 5ml round bottom polystyrene tube over to.Cell is analyzed with a Becton-Dickinson FACscan, and the autofluorescence by the relatively contrast of untransfected carries out the GFP fluoroscopic examination.

The generation of EBV report construct

Cut the green fluorescent protein (EGFP) that contains cytomegalovirus (CMV) promotor, reinforcement and the section of DNA fragment of simian virus 40 (SV40) polyadenylic acid sequence with restriction enzyme A seI and Afl II (NEB) from pEGFP-N1 (Clontech) carrier down in the condition (NEB) of manufacturer recommendation.With 0.5% agarose electrophoresis DNA with isolated fragment from carrier.From gel, cut out dna fragmentation, and from gel film, be purified into DNA with the glass milk purification technique of standard.Mend plain film section end with T4 archaeal dna polymerase (NEB) under the condition of manufacturer recommendation, by using isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting and ethanol sedimentation subsequently come purify DNA.

Then the reporter gene box is cloned into Epstein-Barr virus (EBV) carrier, p220.2 (referring to International Patent Application WO 98/07876).With HindIII (the unique point of contact in the polyclone sequence (MCS) of carrier) restriction enzyme digestion p220.2, mend flat end, as above carry out purifying.The reporter gene box is connected into p220.2 with T4 dna ligase (Promega).Ligation is carried out in 10 μ l systems, and it comprises: the linear p220.2 of 200ng, equivalent or 5 times of CMV-EGFP-SV40pA fragments are connected damping fluid (Promega) with 1X.Ligation is incubated overnight in room temperature.2.5 μ l are connected product change electroreception attitude DH5 α Bacillus coli cells over to the method for electroporation, condition is: 2.5kV, and 400 Ω, 25 μ F add 900 μ l SOB substratum subsequently, 37 ℃ of incubations 1 hour.Each converted product is got 200 μ l and is placed on the penbritin agar plate, and 37 ℃ are incubated overnight.

Carry out colony pcr (PCR) by the dna primer that is used in CMV and the EGFP sequence, in the gained bacterium colony, screen the existence of reporter gene box, wherein use the standard conditions of Taq polysaccharase (Advanced Biotechnologies) and manufacturer recommendation.Positive bacteria drops on overnight incubation in the LB-ampicillin medium, and be prepared as alkali bacteriolyze DNA in a small amount goods (Qiagen) analyze.Digest from DNA screening to have the fragment of correct orientation with Bam HI Restriction Enzyme.The structure called after p220.EGFP that finally obtains.

Use and following essentially identical method change its electroporation after the K562 cell over to, analyze with Becton-Dickinson FACScan, can illustrate that p220.EGFP expresses EGFP.

Structure contains the segmental EBV reporter gene of hnRNPA2 16kb (RNP16) UCOE construct

Method with SalI part digestion with restriction enzyme carrier is removed a SalI site from p220.EGFP, then mend flat end and reconnect carrier, the multiple clone site district (MCS) of carrier just has only a unique SalI site like this, and it can be used for cloning 16kb RNP fragment.The carrier that obtains SalI digestion with restriction enzyme is handled with calf small intestine Phosphoric acid esterase (preventing carrier recirculation when connecting), and use phenol: the method for chloroform extracting and ethanol sedimentation is carried out purifying.

Cut out 16kb RNP fragment from the MA551 carrier with restriction enzyme SalI, fragment is mended flat terminal, and the electroelution purifying is connected into linear carrier.Ligation uses and top identical method (using the equivalent fragment), then transforms and this segmental existence screening bacterium colony of basis.The bacterium colony that filters out is determined positive colony as DNA a small amount of goods with agarose electrophoretic analysis.Determine the segmental correct orientation of 16kb RNP with the NotI restriction endonuclease analysis.The construct called after p220.RNP16 that finally obtains.

With EBV reporter gene construct transfection Hela cell

With p220.EGFP and p220.RNP16 transfection Hela cell, wherein adopt the peptide-mediated transfer system of CL22 on 6 orifice plates, it is set forth in International Patent Application WO 98/35984 and following description.Cultivate after 24 hours, adding final concentration is hygromycin B (Calbiochem) candidate of 400 μ g/ml.The cell mass of moisture resistance mycin B is kept cultivation, with the interim expression of analyzing GFP of Becton-Dickinson FACScan.Cell is assigned to 24 orifice plates routinely analyzing the day before yesterday, analyze same day cell like this and can reach about 50% fraction of coverage.For expressing time-histories, set a mark region that contains GFP express cell group, this sign is used to study the time stability that GFP expresses.Also the Hela cell of transfection is removed the hygromycin B screening, with research when not having screening pressure, the UCOE disappearance or in the presence of, the stability of GFP genetic expression.

The clone of CET200

Cut PEGFPN1 with the NheI/NotII enzyme, with the annealing of following oligonucleotide and insert wherein, to produce multiple clone site district (MCS):

5′CTAGCGTTCGAAGTTTAAACGC?3′

5′GGCCGCGTTTAAACTTCGAACG?3′

The plasmid that obtains is cut with the AseI enzyme, mends flat end, inserts and mends flat terminal 8.3kbHindIIIRNPA2 fragment.Determine that orientation is to make up final support C ET200 (seeing Figure 49).

The clone of CET201 carrier

Digest pUC19 with EcoRI/ArI, mend flat end, remove a PvuI site, thereby produce a PvuI site that is used for linearizing (pUC19 Δ).Cut out MCS with NheI/AgeI from pEGFPN1, mend flat its end.So just produced the NheI site.Cut out an AflII-from CMV EGFP SV40 and mend flat AseI fragment, be inserted into the pUC19 Δ that PvuII digested, utilize NdeI to insert pGK puro bGH (from pGK-puro-BKS) simultaneously.The carrier that obtains cuts except that EGFP with the NheI/NotI enzyme, and with inserting MCS with top identical method.Digest the MCS that comprises carrier with HindIII, insert 8.3kb RNP HindIII fragment, thereby be built into final CET210 carrier (seeing Figure 49).

Contain the preparation of the plasmid of a UCOE

The clone who contains the RNP-UCOE of reporter gene construct

P8kb Hind BKS contains the HindIII genomic fragment of a 8.3kb of RNP locus, and it contains first exon and the HP1H-γ gene of promotor and RNPA2.

The structure of pCMV EGFP-IRES is as follows, and usefulness KpnI and NotI digestion pEGFP-N1 (Clontech, the same with CMV-EGFP, see Figure 35) to send the EGFP sequence, this is connected into the pIRESneo (Clontech) that partly digested with KpnI and NotI.Produced a carrier like this, EGFP gene 3 ' be the CMV promotor wherein, 5 ' be IRESneo.

The clone of IntronA-CMV is following to carry out, and cuts out a 1.5kbIntronA-CMV fragment with NruI (flat terminal cutting) and HindIII from pTX0350 (a pUC base CMV IntronA-MAGE1 plasmid).Digest pEGFP-NI with AseI, then mend flat terminal with Klenow and T4 archaeal dna polymerase.Then obtain a 4.2kb fragment with HindIII digestion.These two fragments connections are spent the night.

P4.0CMV makes up by cutting out a 4kb fragment with BamHI/HindIII/BstEII from p8kb Hind BKS.Fragment is terminal mends flat with Klenow and T4 archaeal dna polymerase.PEGFP-N1 (Clontech) uses the AseI linearizing, and end is as above mended flat, and handles with calf small intestine Phosphoric acid esterase (CIP).Two fragments connections are spent the night.The clone who screens 4kb UCOE forward simultaneously and oppositely insert.

P7.5CMV makes up by cutting out a 8.3kb fragment with HindIII from p8kb Hind BKS.Fragment is terminal mends flat with Klenow and T4 archaeal dna polymerase.PEGFP-Nl (Clontech) carries out linearization process with AseI, and end is as above mended flat, and handles with calf small intestine Phosphoric acid esterase (CIP).Two fragments connections are spent the night.The clone who screens 8.3kb UCOE forward simultaneously and oppositely insert.

P16CMV makes up by the fragment that cuts out a 16kb with SalI from MA551 (hnRNPA2 genomic clone, it contains 5kb 5 ' sequence and the 1.5kb 3 ' sequence that comprises whole coding regions).Fragment is terminal mends flat with Klenow and T4 archaeal dna polymerase.PEGFP-N1 (Clontech) uses the AseI linearization process, and end is as above mended flat, and handles with calf small intestine Phosphoric acid esterase (CIP).Two fragments connections are spent the night.The clone who screens 16kb UCOE forward simultaneously and oppositely insert.

Utilize CL22 peptide transfection Hela cell

The aminoacid sequence of CL22 peptide is:

NH ₂-KKKKKKGGFLGFWRGENGRKTRSAYERMCNILKGK-COOH

The CL22 peptide is used as a transfection instrument, and its method is referring to WO 98/35984.

The Hela cell is cultivated on the EF10 substratum routinely, the bottle that separated to converge in every 3-4 days 1: 10.In transfection preceding 24 hours, by every hole 5 * 10 ⁴Cell is layered on cell on 6 well culture plates.Before transfection one hour, add isopyknic DNA:CL22 (DNA and CL22 are respectively 40 μ g/ml and 80 μ g/ml, and damping fluid is Hepes buffer salt solution (10mM Hepes pH7.4,150mM NaCl)) and form mixture, and room temperature incubation 1 hour.Nutrient solution is removed from cell, washes with 1% phosphate buffered saline buffer.In cell, add 2.5 μ g DNA: mixture (125 μ l), and add RAQ (RPMI substratum (Sigma), 0.1% human albumin, 137 μ M chloroquines (the new adding)) and make volume increase to 1ml, wherein the final concentration of chloroquine is 120 μ M.Cell and mixture were 37 ℃ of incubations 5 hours.Then remove mixture, change EF10 substratum (MIN basic medium (Sigma), 10% foetal calf serum, 100 units/ml penicillin/0.1mg/ml Streptomycin sulphate, 1 * non-primary amino acid (Sigma)) into.

Analyze the expression of GFP in the Hela of transfection cell

Scrape cell from six orifice plates and do the GFP expression analysis.(incubation comes off from the culture plate surface until cell cell in trypsinase/EDTA (Sigma) for PBS, Gibco) washing with phosphate buffered saline buffer.(FCS, excessive EF10 substratum (Gibco) Sigma) adds in the cell, and cell is changed over to 5ml round bottom polystyrene tube containing 10% foetal calf serum.Analyze these cells with Becton-DickinsonFACscan, relatively detect the GFP expression of gene by autofluorescence with parental cell.

Prepare full DNA sample

In order to detect the amount of free gene DNA in the transfectional cell, the full goods of cell DNA have been prepared.Cell washs with PBS, then with molten born of the same parents' damping fluid [10mM Tris pH7.5,10mMEDTA pH8.0,10mM NaCl, 0.5% sarcosyl, the Proteinase K 1mg/ml F/C of the new preparation of its adding] dissolving.Change cellular lysate over to an Eppendorf pipe from culture plate with big mouthful of rifle head.65 ℃ be incubated overnight after, phenol/chloroform extraction, and ethanol sedimentation.At last DNA is suspended in again the TE of pH8.0.

Detect the episome DNA in the complete genome DNA sample

After the transfection 7 days, the complete genome DNA that will prepare from cells transfected is with restriction enzyme (DNA construct that it uses in the time of can making transfection and the episome DNA linearizing the sample) digestion, and Apa LI (NEB) is used to simulate, CMV-EGFP, IntronA-CMV and 4.0CMV forward and reverse sample.BspLU11I (Boehringer) is used to 7.5CMV forward and reverse sample.

By the condition of recommending, with the digestion with restriction enzyme 10 μ l of 30 units (whole samples 20%) complete genome DNA 16 hours.Sample carries out electrophoresis under 400volt/ hour condition, wherein use 0.6% agarose, and does contrast with the linear plasmid of 100pg or 4ng.Then the method with the Southern trace goes to Hybond-N hybridization transfer film (Amersham) to gel.In simple terms, gel is with 0.25M HCl incubation 15 minutes depurinations, then sex change 45 minutes in 1.5M NaCl/0.5MNaOH, and with among the 1.5M NaCl/0.5M Tris-Cl pH7.0 with 45 minutes.(3M NaCl, 0.3M Sodium Citrate, usp, Dihydrate Powder pH7.0), are transferred to DNA on the film from gel through 16 hours wicking actioies to utilize 20 * SSC.Filter membrane is air drying 1 hour, and with crosslinked 2 minutes of the UV-crosslinked instrument of UVPCL-100 (GRI), wherein energy settings was 1200.Under " Church hybridization conditions ", radiolabeled EGFP probe on the symphysis.Film 0.5M NaPipH7.2,1%SDS, at 65 ℃ of prehybridizations above 2 hours.Cut out the EGFP fragment of section of DNA with Bgl II/Not I (NEB) digestion with restriction enzyme pEGFP-N1 (Clontech), the fragment electrophoretic separation, and with a GFX ^TMPCR DNA and gel strips zone purification test kit (Amersham Pharmacia Biotech) purifying.Use Megaprime dna marker test kit (Amersham), usefulness α- ³²(3000Ci/mmol Amersham) carries out mark to 50ng EGFP fragment to P dCTP.The probe of mark and 100 μ l 10mg/ml salmon sperm dnas are mixed, 95 ℃ of incubations 10 minutes, put on ice, hybridize then.Film washes twice at 65 ℃ with 40mM NaPi pH7.2,1%SDS, each 30 minutes then 65 ℃ of hybridization 16 hours.Radiolabeled film is analyzed it with cyclone storage phosphorus system (Packard) after carrying out the screening of high resolution phosphorus again.

Fluorescent microscopy

The transfectional cell of cultivating in six orifice plates is observed under fluorescence with Zeiss Axiovert S100 inverted microscope, and all shooting operations all use Zeiss MC100 photographic camera and Fujichrome Provia 400ASA film to finish at specific time.

Embodiment 1

The analysis of human TBP locus

The mapping in TBP gene territory

People TBP gene length 20kb (Chalut etc., 1995), it is positioned karyomit(e) 6q27-tel (Heng etc., 1997), and with the proteic gene close linkage of coding C5.C5 albumen forms part ubiquitin body (Figure 1A and C; Trachtulec, Z. etc., 1997).The C5 gene transcription is that the position-reversed from the cap site upstream 1kb of TBP gene begins, so C5 gene and TBP gene may include dual promotor.Because double starting may have different power on different transcriptional orientations, therefore when making up, need consider this serious difference based on the TBP expression carrier.

Sequential analysis shows that the TBP/C5 promoter region contains the CpG island that has or not methylated long 3.4kb, extend between Fsp I site and the HindIII site in first intron of TBP in first intron of C5 gene on this island, and it has comprised major part 5 ' 1kb sequence of two gene 5 ' first introns of end and the 1.4kb zone between two genetic transcription starting points.(Figure 1B)

People TBP locus has comprised three closely linked genes.Transcribing of PSMB1 gene (the C5 gene here is otherwise known as) is that position-reversed from the cap site upstream 1kb of TBP begins.3 of genes identified PDCD2 ' end is positioned 5kb place, TBP gene downstream recently.The long altogether 50kb of these three transcription units.Near on the centric direction, have a length to be at least the zone of 80kb in PSMB1 gene downstream, this zone is made up of a large amount of multiple dna sequence dnas, and does not have discernible structure gene.The PDCD2 upstream region of gene has the repetition non-coding sequence of a long 30kb towards the direction of telomere, and the new transcription unit of a potential is arranged thereafter.The PDCD2 gene has 150kb approximately apart from the initiation site in telomere repeat sequence district, this makes that the TBP locus becomes karyomit(e) 6 long-armed going up apart from the nearest structure gene of telomere bunch.

Genetic expression pattern from TBP gene territory

In order to determine to have used a kind of commercialization dot blotting from the tissue distribution of the expression of TBP gene cluster, its utilization is derived from the Poly (A) of different human body tissue and cell type ⁺-RNA preparation gets (Figure 35 A).The hybridization of this dot blotting and correspondent probe shows that PSMB1 gene (Figure 35 B), PDCD2 gene (Figure 35 C) and TBP gene (Figure 35 D) all have general expression.This data acknowledgement TBP locus only contains the chromatin territory that an omnipresence is expressed.

The transgenosis integrity that carries in the pCP2-TLN mouse is drawn

Derive from the long 90kb of pCP2-TLN (Fig. 1) of pCYPAC-2, it is used to make transgenic mouse.This clone starts from 46kb place, C5 gene downstream (TBP 5 ' end 65kb place), terminates in the 4.5kb place of TBP gene 3 ' end.Therefore, this clone has comprised complete C5 gene and TBP gene.

Utilize pCP2-TLN to make three strain transgenic lines.Carry out the Southern engram analysis with the probe that derives from the pCP2-TLN end, the result show TLN:3 system comprised genetically modified two copies (TLN:3 is for Fig. 2 a, b) to head-to-tail structure (Fig. 3 a, TLN:3 strain).But the genetically deficient of 5 ' end has taken place in one of them copy, and this disappearance extends to the promotor place (Fig. 4, TLN:3 system) of TBP gene always.Utilize the terminal analysis method to show that TLN:8 system has comprised 3 copies of pCP2-TLN (Fig. 2 a, b, TLN-8 system).Analysis revealed TLN:28 strain carries a plurality of copies (Fig. 3 a, TLN:28 system) on many integration sites.

Fig. 3 B has briefly introduced the transgenosis copy number of these TLN mouse and the analysis of integration characteristic.

Further analyses to these transgenic lines that produce with pCP2-TLN are found, contain the copy of two disappearances of pCP2-TLN in the TLN:3 strain, thus single function copy of TBP and PSMB1 gene still complete (Fig. 3 c, TLN:3).The TLN:8 strain carries two of pCP2-TLN vertically to be integrated (Fig. 3 c, TLN:8).The TLN:28 strain contain four of pCP2-TLN vertically arrange copy (Fig. 4, TLN:28).5 ' end and 3 that transgenosis in TLN:28 and TLN:8 is vertically arranged ' disappearance that end takes place has still kept the integrity of PSMB1 gene and TBP gene.

Just as to the observation (as mouse Thy-1, Kolsto etc., 1986) in 5 ' district of other gene of carrying CpG enrichment territory, the transgenic mouse that this operation obtains has also kept the no methylated CpG island (data not shown) of TBP/C5 as scheduled.

The expression analysis of TBP C5 transgenosis on mouse pCP2-TLN

Here we have used the experiment based on RT-PCR, and this experiment can detect the information of the endogenic and people's transgenosis TBP/C5 of mouse simultaneously.Probe (TB-14 and TB-15) in the RT-PCR experiment is selected from people and mouse TBP gene cDNA sequence homologous zone (Fig. 5 b).Like this, use a pair of primer just can from two kinds of different mRNA, amplify the RT-PCR product of length as 284bp.In order to distinguish the TBP gene product of people and mouse, studied the difference of the restriction enzyme cleavage site that the difference of minority base causes.(Fig. 6 a) for the fragment of long 221 Nucleotide of generation when people's PCR product was cut with Bsp1407 I enzyme.Similarly, (Fig. 5 a) can produce the RT-PCR product of 350 Nucleotide of length that are derived from these two sequences to a homologous region of people and mouse C5 cDNA sequence.Cut with Pst I enzyme and can make the product size that is derived from mouse C5 mRNA be reduced to 173nt.

With ³²(Fig. 5 a) makes the reacted product of PCR have radioactivity for P end mark primer TB14 (Fig. 5 b) and C5RTF.These PCR products are separated with denaturing polyacrylamide gel electrophoresis.

The RNA that extracts 1 microgram from each tissue of transgenic mouse TLN:3 system, TLN:8 system and TLN:28 system carries out above-mentioned analysis experiment, and the quantitative employing ProsphorImager of RNA analyzes and finishes (Fig. 8).Experimental data explanation: comprise the TBP gene and the C5 genetic expression that have all detected obvious level in each test organization of each mouse of TLN:3 strain, wherein TLN:3 carries this digenic complete copy.What is more important, the expression level between the different tissue of specifying mouse system can be made carbon copies, especially the C5 gene.This has hinted that all possible TLN clone has omnipresence chromatin open ability.Yet between mouse system, the expression level of each gene copy number there are differences.In addition, between the different tissues of TLN:8 system, TBP genetic expression has the difference of 5-40%.These results show, although TLN has the chromatin open ability, C5 gene, especially TBP promotor are subjected to the interference of transcribing of positive or negative easily.Very weak and so the decisive influence positive findings always of these transcriptional activation potentiality that illustrate that this clone TBP and C5 district itself had.This situation is opposite with the open effect of UCOE chromatin that this zone exists, and the UCOE effect is very strong and can overwhelm positive influence.Above hypothesis has obtained the support of experimental evidence: the easier tendency of more weak TBP promotor changes; Such as C5 gene among the ratio of TBP gene expression level in spleen and muscle and the TLN:8 is compared (Fig. 8).

As previously mentioned, the tissue from the mouse at 2-6 monthly age has been used in the analysis of transgene expression.Simultaneously, in order to analyze the stability of transgene expression, to have used the TLN:3 system at 23 monthly ages and TLN:8 be transgenic mouse and undertaken by mensuration PSMB1 mRNA expression levels.Contrast by result, in this two mouse system, all obtained similar result with young mouse.The result shows that further transgenosis just keeping the open chromatin Structure with transcriptional capability.

The expression analysis of TBP locus 40kb subclone

The expression reproducible, physiological level that obtains from the pCP2-TLN clone in transgenic mouse illustrates that this locus has omnipresence chromatin open ability.For this active DNA section of meticulous definite decision, we have at first studied a 40kb subclone (pCP2-TSN of people TBP locus; Fig. 1 a).This subclone has comprised that 5 of contiguous TBP gene ' end and 3 ' end is about the flanking sequence of 12kb.Therefore it only comprises the C5 gene of a complete TBP gene and one 3 ' end disappearance.

Past studies show that people's beta Globulin LCR's: contain the single stable transfection tissue culture cells cloned genes expression level that copies of a transgenosis by comparison, can tentatively show the active existence of LCR.The LCR primitive is complete more, and the reproducibility of the expression level between the independent cloning is just high more.Utilize this strategy, the expression analysis of pCP2-TSN can be used to detect the active existence of LCR type.PCP2-TSN at first is cloned among the assembling plasmid vector pWE15 (clontech) that contains neomycin resistance gene (Fig. 9).The pWE-TBP construct that obtains is used to produce the stable transfection clone of the former L-cell of mouse fiber.Determined genetically modified copy number (Figure 10) among 23 clones with the Southern engram analysis, selected a plurality of copy number purpose clones of representative then therein, and it has been carried out the research of the transgene expression of transgenic mouse.Result (Figure 11) shows when genetically modified copy number is lower than 8, the expression of each transgenosis copy can both reach or surpass physiological level, but when the goal gene copy number greater than 20 the time, the expression of single transgenosis copy only reaches the 30-40% of wild-type.

Single or a plurality of transgenosis copies that above data declaration makes up with pCP2-TSN are reproducible between can both realizing organizing, the expression of physiological level, and this has proved that fully this genomic clone has omnipresence chromatin open ability.Experiment also shows simultaneously: some clone (as 4,33,6) shows the position effect of " just ", thereby strengthened the expression of single transgenosis copy greatly and surpassed physiological level, this may be that open, activatory chromatin have taken place in genetically modified integration under the certain situation owing to having.Simultaneously, if near these environment, there is strong transcriptional enhancer, may enhancement be arranged to the promotor of more weak TBP gene.

The stability that these constructs are expressed detected by a long cycle of 60 days.The result shows that expression levels keeps stable (Figure 36).And after the selective pressure of removing medicine, that expression levels still keeps is stable (Figure 36 is labeled as the row of G418).In addition, no matter whether the selective pressure of medicine is arranged, through repeatedly freezing with after melting the recovery circulation, express and still keep stable at cell.

The expression analysis of the 25kb subclone of TBP locus

The long sequence (Fig. 1 c) that has covered sequence and 3 ' end 5kb of TBP gene 5 ' end 1kb for the genomic clone of 25kb (TPO), this fragment is cloned into the polymerization crosslinking district in the improved pBluescript carrier with puromycin resistance gene, thereby constructs pBL-TPO-puro.This construct is used to produce the stable transfection clone of mouse fibroblast L cell.

With the pBL-TPO-puro construct genetically modified expression has been drawn the experimental result similar to the research of carrying out with pCP2-TSN (Figure 37), the data declaration that experiment is collected is no matter be with TPO or TSN, to single or a plurality of transgenosiss copies can both realize repeatably, the expression of physiological level.It is consistent that these data and genomic clone have omnipresence chromatin open ability.This hypothesis has obtained the further support of following experimental evidence: be incorporated into centric heterochromatic zone (data as follows) with TPO clone 7 (two copies), 29 (single copy), 34 (two copies), it illustrates that these genomic fragments still have the ability of expressing goal gene in the heterochromatin environment.

In addition, some clone (as Figure 37, clone 11) shows the position effect of " just ", and its expression level is significantly higher than physiology attitude transgenosis copy.This may be because genetically modified clutch is positioned at open activatory chromatin.If have strong transcriptional enhancer in this environment, it may have the enhanced effect to the promotor of more weak TBP gene.

Use Hela clone replaced C HO clone also to obtain same result (data are unlisted).

The drawing of DNase I hypersensitive site

As everyone knows, the LCR element is meant that those have the zone of the supersensitivity of very high tissue specificity DNase I, and the existence of this DNase I supersensitivity has often hinted the existence of the chromatin Structure of high opening.Therefore we analyzed in the middle of people TBP gene and on every side DNase I hypersensitization (HS) site whether exist.Figure 12 brief introduction the leukemia cell of end user's derived from bone marrow be a series of experiments that K562 carries out, wherein DNase I hypersensitization (HS) site is mapped in from TBP gene 5 ' end 12kb to 3 ' end 4.5kb and is about altogether in the zone of 40kb.The result shows that unique tangible DNase I hypersensitization (HS) site is adjacent in C5 gene and TBP gene promoter region (Figure 12, top line, HindIII digestion/HindIII-Xba I probe).These DNase I hypersensitization (HS) sites are associated with aforementioned promoter element, and it utilizes method (Tumara, T. etc., 1994 of transient transfection in the past; Foulds and Hawley, 1997) definite and very important for TBP and C5 genetic expression.Yet if there is LCR type primitive to be present within this locus, they will all have suitable distance apart from TBP gene and C5 gene transcription starting point.Outside the 40kb clone who LCR type element is present in run through the TBP gene, TBP gene has tentatively been indicated omnipresence chromatin open ability in this.

Fish analysis

Always have 34 clones that carried the 1-2 copy of people TBP gene and be used to carry out fish analysis.Use fluorescein and Texas Red (Texas is red) to detect the heterochromatin composition of TBP transgenosis and mouse kinetochore, γ satellite and main satellite respectively.The use of these indicia meanses makes transgenosis wherein be incorporated into clone on the chromosome arm and demonstrates green and red fluorescent signal (Figure 39 A).Yet when transgenosis was integrated into the zone, kinetochore, the mixture that occurs two kinds of color fluorescence of feasible energy quilt owing to two kinds of fluorescence simultaneously was the yellow fluorescence signal.In using resulting 18 clones of pWE-TSN, there are two clone: 344-6 and 344-37 to demonstrate the transgenosis signal in the zone, kinetochore.In clone 344-6, the TBP transgenosis is integrated into place, a chromosomal kinetochore of Robertsonian translocation, and in clone 344-37, the TBP transgenosis is integrated on the typical acrocentric chromosome of mouse.

In using 16 constructed clones of pBL3-TPO-puro, there are three clone 440-7,440-29 and 440-34 to demonstrate and in typical acrocentric chromosome, are integrated into the place, kinetochore.In the clone 440-29 that contains a TBP transgenosis copy, demonstrate the TBP signal and surrounded (Figure 39 B and C) by the satellite DNA sequence of heterochromatinization significantly.Further experiment proves also that under the situation that does not have selective pressure to exist the TBP gene still can reach 12-14 week (data are unlisted) from the physiological level continuous expression among these clones.

Above data declaration, the fragment (TPO) of the 25kb of the TBP locus of single copy is the expression that can guarantee physiological level, even be in (as being integrated into the zone, kinetochore) in the heterochromatic encirclement, thereby for chromatinic open reading provides believable evidence (Sabbattini P, Georgiou A, Sinclair C, Dillon N (1999) analyzes mouse by the transgenosis of single or multiple copies, proves that λ 5-VpreB1 locus regulation and control zone produces a kind of new arrangement.Molecule and cytobiology (Molecular and Cellular Biology) 19:671-679).

Embodiment 2

The analysis of human HNRNP A2 locus

The gene mapping of hnRNP A2 gene regions

HnRNP A2 gene length 10kb, comprise 12 exons, the one-piece construction of its encoding sequence and intron/exon is with hnRNP A1 gene height homology, illustrate that the two may originate from the repetition (Biamonti etc. of gene, 1994), but different with the A1 gene, the A2 gene does not have specific pseudogene (Burd etc., 1989; Biamonti etc., 1994); In addition, A1 and A2 gene are not chain, and they lay respectively at human chromosome 12q13.1 (Saccone etc., 1992) and 7p15 (Biamonti etc., 1994).Figure 13 A has described the collection of illustrative plates of the people hnRNP A2 locus on the clone MA160 that is present in the long 160kb that derives from the pCYPAC-2 carrier, and this genomic fragment has comprised long 5 ' flanking sequence and the 3 long ' flanking sequence of 50kb of 110kb.The dna sequence dna of hnRNP A2 genetic transcription initiation site upstream 4.5kb length is determined, and measured sequence shows that the gene of coding people heterochromatin associated protein HP1 γ is from reverse initial the transcribing (Figure 13 C) of the distance h nRNP A2 gene cap site about 1-2kb in upstream.The whole HP1 γ of the analysis revealed of Southern blot hybridization gene is arranged in the long zone (data are unlisted) of 10kb.

Therefore, the feature of the promotor that the Divergence that TBP and hnRNP A2 locus all have close linkage to arrange is transcribed.

In order to determine HP1 γ gene at each in-house expression of people, used a kind of Dot blot hybridization, this trace is the Poly (A) that utilizes different tissues and cell ⁺The RNA preparation gets.Result's proof is respectively organized in vivo with hnRNP A2 gene has general expression the same, and HP1 γ gene is respectively organized in vivo also general expression (Figure 38).Therefore these two genes can be considered to form a gene regions of generally expressing that is similar to the TBP locus.

The functional analysis of hnRNP A2 locus in transgenic mouse

MA160 (Figure 13 A) is used to make transgenic mouse, by the Southern blot hybridization that carries out to the parental generation mouse that produces the first filial generation of feeding be experiment showed, the transgenosis (data are unlisted) that contains 1-2 copy in these transgenic mouses.

Be similar to the method that detects TBP genetic expression and be used to analyze the genetically modified expression of hnRNPA2 based on RT-PCR, because it is unknown that the cDNA sequence of mouse hnRNP A2 remains, so we can't select the people and the total homologous sequence area of mouse is used for the RT-PCR amplification by the method for sequence alignment.Beginning, we have selected to experimentize and obtained the RT-PCR product of long 270bp corresponding to the probe Hn9 of the 10th and the 12nd exon of people hnRNP A2 gene and Hn11 (Figure 14 A).Yet we find to produce the product of identical size with this a pair of probe from mouse and people's RNA prepared product, have proved that this gene of mouse and people has homologous region (Figure 14 B).Experimental results show that of utilizing that some restriction enzymes the carry out hnRNP A2 gene that HindIII can cut mouse produces the fragment (Figure 14 B, HindIII M swimming lane) of long 170bp, but can not cut people's hnRNPA2 gene (Figure 14 B, HindIII H swimming lane).

From the different tissues of the first filial generation of transgenic mouse strain Hn35 and Hn55, extracted total RNA (1 microgram), and used according to aforesaid method ³²The end-labelled Hn9 of P 5 ' analyzes (Figure 16).Intensity of radioactivity (PhosphorImager) analysis is used to determine the ratio of the RT-PCR product of people and mouse, and the transgenosis that result (Figure 17 A) is presented at single copy in all detected tissues has all realized expression reproducible, physiological level.

In transgenic mouse to the analysis of hnRNP A2 seat 60kb subclone

The data that the research of cloning by the MA160 to the pCYPAC source obtains show that this genomic fragment has the chromatinic ability of general opening, for this active DNA section of Fine Mapping decision, we have cut out the AatII subfragment Aa60 (Figure 13 B) of long 60kb with restriction enzyme AatII from MA160, this fragment has comprised the long and long flanking sequence of 3 ' end 20kb of hnRNP A2 gene 5 ' end 30kb.

For research Aa60 produced in fragments has gone out three transgenic mouse: Aa7, Aa23 and Aa31, two strains have wherein produced transgenic mouse system by selfing, and the transgenosis that each transgenic mouse comprised is copied and seen that number is respectively: Aa7,3; Aa23,1-2; Aa31,1-2.

From the different tissues of transgenic mouse, extract total RNA (1 microgram) and analyze genetically modified expression according to aforesaid method, the result as shown in figure 15, the quantitative assay of intensity of radioactivity is shown in Figure 17 B.The transgenosis of the data presentation that more than obtains each single copy in all detected tissues has all realized expression reproducible, physiological level.This explanation chromatinic ability of observed open omnipresence in MA160 is present on the Aa60 subfragment.

The location of DNase I hypersensitive site

Figure 18 has shown the result who the zone of distance hnRNP A2 gene initiation site 5 ' about 20-25kb is carried out the tentative experiment that the analysis of DNase I hypersensitive site done: the probe of the long 766bp that is obtained with Aat I and Cla I double digestion in the exon 2 has provided a series of three DNase I hypersensitive site (Figure 18, above one group), lay respectively at hnRNP A2 gene-1 .1kb,-0.7kb and the (Figure 18 of 0.1kb place, below one group), we also extend to 12-13kb place, distance h nRNP A2 genetic transcription starting point downstream to the analysis of DNase I hypersensitive site, but do not find new DNase I hypersensitive site.

As the situation in the TBP/C5 seat, these DNase I hypersensitive sites all are about on the zone of 1-2kb between hnRNP A2 gene and HP1 γ gene promoter, do not detect LCR type DNase I hypersensitive site and illustrate that the open ability of the chromatin at this seat and the effect of this class component have nothing to do.

The data that more than provide clearly illustrate that we can utilize two locus (TBP and hnRNP A) to realize expression reproducible, physiological level in each tissue of transgenic mouse, there is the Genetic Control element of the non-LCR of being derived from really in this explanation, and these elements have the ability that makes omnipresence chromatin open.

Here need to stress a bit be function that data provided here disclosed with in the past those be used to from other omnipresence expressing genes such as people β-actin (as Ray, P. etc., 1991; Yamashita etc., 1993; Deprimo etc., 1996), mouse 3-hydroxy-3-methylglutaryl coenzyme A reductase (Mehtali etc., 1990), mADA (Winston etc., 1992 and 1996), people's guanosine decarboxylase (

Deng, 1991) and the promotor of mouse phosphoglycerokinase 1 (McBurney etc., 1994) and the resulting result of combination of enhanser be diverse.Only in portion of tissue, observe in those early stage researchs and efficiently express, but or do not prove or detect open chromatinic ability.

For the TBP gene, the data (Figure 11) that get from the cell of tissue culture illustrate 5 of each 12kb of tool ' end and 3 ' distolateral wing sequence the chromatin section that is about 40kb (pCP2-TSN, Fig. 1 a) be that it had make omnipresence chromatin open ability whereabouts.

From fragment (Aa60 with the long 60kb that comprised hnRNP A2 gene; Figure 13 B) this fragment of the resulting data presentation of the transgenic mouse of Gou Jianing comprises and has the zone (Figure 15-17) that makes omnipresence chromatin open ability.

The unique DNase I hypersensitive site that is positioned at aforementioned region at present is different from the element of LCR type corresponding to the promotor of classics, therefore these DNA zones of working with the open Expression element of omnipresence chromatin (UCOE) do not meet the definition of LCR element, because the LCR element is and its expression specificity or the gene-correlation of expressing with restrictive one in a organized way that therefore UCOE element and their activation can clearly make a distinction with the LCR and the element of deriving thereof.

The structure of expression vector

The UCOE activity of the subfragment in the RNP district that 60kb is long can be used based on the method for reporter gene and measure.

As above with shown in Figure 22, use GFP and NeoR reporter gene, design expression vector, it has comprised the subfragment in the two-way startup subregion between RNP gene and HP 1H-γ gene.They comprise, an expression vector (RNP) that contains RNP promotor (it drives the expression of GFP/Neo); An expression vector (5.5RNP) that has comprised brigade commander 5.5kb section on RNP promotor and the RNP promotor; Utilize acceptor splicing site plan carrier, acceptor splicing site wherein/branch's synonym sequence (deriving from RNP gene extron 2) is cloned (assurance has comprised the whole C pG island of RNP gene intron 1 a part of sequence and can detect) in same experiment based on reporter gene in GFP gene the place ahead, thereby make a part (7.5RNP) that has comprised exons 1 and introne 1 in the upstream of GFP, it had carried 7.5kb RNP gene before the GFP gene; A carrier (1.5RNP) that has comprised the dna fragmentation of brigade commander 1.5kb on RNP promotor and the RNP promotor.

As above and see Figure 23, also made up a series of expression vectors that comprise allogenic CMV promotor, these carriers comprise: driven the expression of GFP/Neo and comprised the expression vector (CMV-EGFP-IRES) of internal ribosome binding site by wherein CMV; Similar but do not have the expression vector (CMV-EGFP) of internal ribosome binding site with a last carrier; Express and comprised the expression vector (5.5CMV) in the zone of brigade commander 5.5kb on the RNP promoter region by CMV driving GFP/Neo wherein; Drive the expression of GFP/Neo and comprise the expression vector (4.0CMV) that starts the long sequence of molecular 4.0kb by CMV, RNP and HP 1H-γ by wherein CMV; Drive the expression of GFP/Neo and comprised an expression vector of the part (long 7.5kb) of RNP gene extron 1 and introne 1 by wherein CMV.

As mentioned above, with the method transfection CHO cell of construct by electroporation.Figure 24 explanation adds the 5.5kb fragment and makes the number of G-418R bacterium colony increase by 3.5 times before the RNP promoter region.Utilize nucleic acid condensation peptide metastasis that the COS7 cell is advanced in same construct transfection, can make the colony number order improve nearly 7 times (data are unlisted).

Figure 24 also illustrates, with CMV base carrier (as CMV, 5.5CMV) transfection CHO cell, can make the number of bacterium colony improve 1.5 times.

Produce the clone of stable G418R from the ring-type clone of the bacterium colony of these transfections, it is used to analyze the expression level of GFP subsequently.Figure 25 has shown the resulting data of facs analysis.When using endogenesis promoter to analyze, the adding of upstream sequence makes the expression level of GFP improve 3.5 times; (RNP and 5.5RNP) also found the raising of GFP expression level before the 5.5kb sequence is added to allos CMV promotor the time.

Contrast 5.5RNP, the expression vector that has comprised whole no methylated CpG island does not demonstrate the increase of G418 resistance bacterium colony, but the average median of GFP fluorescence increases (5.5RNP contrasts 7.5RNP, sees Figure 26).

Individual cells clone and restricted group (about 100 bacterium colonies) express after the GFP, carry out cell cultures under the situation that is with or without the G418 selective pressure.The cell clone that is formed alone by the RNP gene promoter shows great unstable, and along with the prolongation of time, the ratio of expressing the cell of GFP is quick downtrending.And the cell clone of the expression GFP that gets with the 5.5RNP construct, its stability can reach 3 months.Although CMV-GFP clone group shows stability preferably in the early stage, under the situation of long-time no G418, the cell count of expressing GFP is on a declining curve, and 5.5CMV shows long stability in this case.Figure 27 and 28 has provided these clone groups' FAC spectrum, and these data clearly illustrate a kind of migration left, promptly uses the CMV-GFP construct that the ratio of non-fluorocyte is increased, and on the contrary, 5.5CMV-GFP clone group but shows stable expression and unifies the peak.The low percentage ratio of expressing or not having an express cell is estimated by gate group M1.

The research of RNP locus is narrowed down to the zone of the long 5.5kb that has comprised RNP gene and HP1H-γ gene bidirectional promoter.This fragment continues can improve the expression of gene level to the product (as 7.5RNP and 8.5RNP) that 3 ' end extends, and may be related with the integrity that keeps not having the island that methylates.(1.5RNP, Figure 23), when analyzing the number of determining its G418R bacterium colony by FAC and expressing, it is the obvious result (Figure 29) that studies of Impact Report factor transfection not to 1.5kb district product in the downsizing of also finding simultaneously 5.5RNP.But 1.5RNP does not resemble the ability of giving the long-time stably express gene of cell 5.5RNP or the 7.5RNP.As shown in figure 30, the cell count of expressing GFP reduced rapidly after 68 days.

On behalf of CpG, design construction body 4.0CMV do not have to methylate the whole 4.0kb sequence on island to be kept perfectly thereby make.In addition, with (4.0CMV-EGFP-F (forward) before the two-way insertion CMV-EGFP of box; (4.0CMV-EGFP-R oppositely)).Figure 31 shows, in contrast to standard C MV-GFP construct CMV-EGFP, the average intensity of GFP fluorescence be greatly improved (above 10 times) among the 4.0CMV.No matter show also that simultaneously this 4.0kb box forward or reverse insertion can both make GFP express and be greatly improved.

On the stability of genetic expression, the expression vector that has comprised RNP upstream region of gene 5.5kb sequence shows certain superiority behind transfection CHO cell.The more important thing is that this stability is not limited only to endogenous promotor, also given allos and widely used CMV promotor.

Figure 32 has contrasted based on the expression vector 4.0CMV of CMV and 7.5CMV and control vector CMV-EGFP and has been transfected into Chinese hamster ovary celI, and analyzes after 13 days and carry out G18 and select.The result shows, before RNP seat 4.0kb or 7.5kb section adding CMV promotor, the average intensity of fluorescence substantially can be improved (15-20 doubly), this raising and these sections orientation irrelevant (data are unlisted).

Figure 33 has shown a ratio with in the cell mass of the G418 selection cell of expression GFP identical with Figure 32.Can see that 4.0kb or 7.5kb fragment add and improved the percentage of GFP positive cell in this cell mass.In addition, although former description of test CMV-EGFP showed unstable later in nearly 60 days in cultivation, this cell mass shows stability in time.

Figure 34 has shown the bacterium colony that obtains with behind the different construct transfection CHO cells that wait mole number.With respect to control vector CMV-EGFP, the bacterium colony that the 7.5CMV construct obtains has improved nearly 2.5 times.These observations are consistent with 7.5CMV-F, and it has guaranteed to integrate the increase of number and give 7.5kb fragment chromatin open/to keep ability.

The adenovirus carrier that has comprised UCOE

Under existence conditions, adenovirus (Ad) is a class carrier system of gene therapy, and it can be passed to interested cell type with gene is the most effective.Develop into the most promising many gene therapies of clinical level and all use this carrier system, especially be derived from the carrier of adenovirus hypotype 5.Express in following two kinds of main modes by improving therapeutic gene, the use of Ad in gene therapy improved substance.A kind of is to improve genetically modified expression level, so that obtain best result of treatment under few dosage of trying one's best, no matter uses any promotor; Second method is to improve the promotor of tissue specificity or tumour-specific, thereby render transgenic not only has specificity but also can realize strongly expressed in specific cells.Although had been found that many have good tissue or the specific promotors of tumorous type, the expression level that these promotors cause in designated cell is very weak usually, thereby can't really be used for gene therapy.Such as the promotor of mouse α-fetoprotein (AFP) gene, its expression that causes very weak but to liver cancer cell have extraordinary specificity (Bui etc., 1997, Human Gene Therapy, 8,2173-2182).Such tumor-specific promoters is very meaningful for treat cancer by gene targeting enzyme prodrug treatment (GDEPT), wherein studies gene delivery to finish targeted chemotherapy.In GDEPT, the gene of a prodrug saccharase of coding is transported to tumour cell, for example can be by transport vehicle is injected into tumour.Give nontoxic relatively prodrug then, it is converted into potential cytotoxic drug and cell killing, and cell carries out the expression of enzyme in position.For example utilize nitroreductase (NTR) and prodrug CB 1954 (Bridgewater et al., 1995, Eur.J.Cancer, 31A, 2362-2370).Adenovirus carrier gives the most effective transhipment of gene of encoding such enzymes, for example by being injected directly into tumour.

Utilize the adenovirus carrier of an AFP promotor and a UCOE construction expression NTR

The RNP UCOE (sequence shown in Figure 20 is from Nucleotide 4102-8286) that adds 4kb by the front in the AFP promotor has made up the reorganization 5 type adenovirus of expressing NTR.The long UCOE of 4kb at first is cloned into pTXO379 as the Pme1 fragment, and pTXO379 is a mediation carrier, its carried the NTR gene and before this gene, have the AFP promotor (Bui etc., 1997, HumanGene Therapy, 8,2173-2182).Join the side with it with Ad 5 sequences, (1-359,3525-10589), by be connected to the Cla I site that is positioned at AFP promotor 5 ' end with flat end.Restriction Enzyme digestion is used to determine to exist a UCOE singly to copy and be used for determining the orientation of UCOE.Produce reorganization Ad construct with plasmid pTXO3 84 then, wherein pTX0384 contains reverse UCOE fragment and Ad assembling clone Per.C6, and it is by the Introgene exploitation and (Fallaux et al. is provided, 1998, Human Gene Therapy, 9,1909-1917).The method that is provided by Introgene is used to virus rescue.Make the pTXO384 substantially linearization with Swa I, then with the linearizing skeleton carrier pPS1160 of Swa I cotransfection Per.C6 cell, wherein carrier pPS1160 has comprised the right end of 5 type adenovirus and the zone that overlaps with pTXO384, forms reorganization Ad by homologous recombination.The virus of homologous recombination converges and is named and is CTL208 in transfectional cell.

The expression of NTR in body outer cell line

A large amount of preparations of recombinant virus CTL208 are undertaken by the step of standard, and also prepared other two strains recombinant adenovirus simultaneously: a strain is called CTL203, and it carries NTR gene (promotor that AFP is arranged before it) and weak enhanser does not still have the UCOE fragment; Another strain is CTL102, and it carries NTR gene (the CMV promotor is arranged before it).The CMV promotor is widely used in the recombinant adenovirus, to realize strongly expressed in tissue and the tumor type on a large scale.CTL203, CTL102 and CTL208 are by identical framework construction, and their difference only is to be used for the primitive difference of NTR genetic transcription.

Then utilize CTL203, CTL102 and CTL208 at two cancerous cell lines of external transduction, with research NTR expression levels and specificity, this two strains cancerous cell line is respectively: elementary human hepatoma cell line HepG2, and it expresses AFP; Mouse squamous cell cancer clone KLN205, it does not express AFP.The cell that is in exponential phase of growth with tryptic digestion and according to 1.25 * 10 ⁴The density of individual cells/ml is suspended in again and infects in the substratum, be taped against then in six orifice plates and cultivate, then earlier recombinant adenovirus is carried out 50 times dilution, 100 times or 500 extraordinarily go in substratum according to dilution recombinant adenovirus CTL203 again, infect and add foetal calf serum after 90 minutes to make final concentration be 10%, be placed on 37 ℃ of incubators then and cultivated 24 hours.Utilize hypotonic condition lysing cell, split product is centrifugal to remove cell debris, the method that joins adsorption experiment (ELISA) with immunoenzyme is measured the NTR content in the supernatant liquor then: earlier with the NTR bag of reorganization by the Nunc-Immuno Maxisorp Assay Plate of experiment usefulness, adding 50 microlitre cracking supernatant liquors then in each hole spends the night for 4 ℃, then, in each hole, add then according to the anti-NTR polyclonal antibody 100 microlitre room temperatures of goat after the dilution in 1: 2000 and placed 30 minutes with the PBS damping fluid washing that contains 0.5%Tween 3 times.Flush away unnecessary one anti-after, in each hole, add anti-goat two anti-100 microlitres of donkey by the horseradish peroxidase-labeled of dilution in 1: 5000, incubation after 30 minutes with unnecessary two anti-of PBS damping fluid flush away, in each hole, add then 100 microlitre tmb substrates (1M PBS solution, with contain 1 mg/ml in dimethyl sulfoxide (DMSO)+hydrogen peroxide of phosphoric acid-citrate buffer+2 microlitre 30%v/v of 9 milliliters of 0.05M/10ml) be positioned over room temperature 10 minutes.The sulfuric acid stopped reaction that adds 25 microlitres, 2 mol, reading of data under 450 nano wave lengths then.

Figure 46 has provided the result of ELISA: CTL203 produces weak and specificity NTR expression when starting the NTR expression with AFP promotor/enhanser, and it reaches detectability in the AFP positive cell line.When starting the NTR expression with the CMV promotor, CTL102 produces strong but not specific expressed, and wherein NTR has similar level in two kinds of clones that experiment is used.What allow people's excitement is that the NTR of the positive HepG2 clone of AFP that infects with CTL208 (starting the expression of NTR with UCOE and AFP promotor) expresses and is higher than the cell that CTL102 infects, and the NTR of the negative KLN205 clone of AFP that infects with CTL208 expresses and is starkly lower than corresponding C TL102 cells infected.These data declarations UCOE has improved expression in the adenovirus environment significantly keeping the specific while.

NTR expression and anti-tumor activity in vivo

Consider that from safety perspective the tumor-specific promoters that is used for cancer gene therapy is compared with non-specific promotor has superiority, because this promotor makes transgenosis only keep low expression level in normal tissue.This is to being that the gene therapy of means is even more important with the adenovirus, because adenovirus is after injecting tumour, virus might diffuse out tumour and infect its hetero-organization.Adenovirus is invaded liver cell especially easily, so the dose-limiting toxicity of adenoviral gene treatment is generally liver injury.Under the situation of GDEPT, can may cause those normal cells of expressing NTR also to be killed in the strong promoter such as the CMV promotor of normal tissue expression.This class situation can the specific promotor of using-system be avoided or be made it minimizing.These tissue-specific promotors have effectively guaranteed the high level expression in the tumour cell, thereby produce antitumor action.So, by with the NTR genetic expression in CTL208 and CTL102 comparative studies tumour cell and the liver cell, it is injected into the mouse tumour, come their anti-tumor activity of comparison.Here we have used congenital athymic BALB/c nu/nu nude mice, and it is the male mice in specified-pathogens free 8-12 age in week and raises in having the micro-dividing plate box of filtering cover., as tumor inoculum cell is cultivated in shaking bottle with the HepG2 cell that is in exponential phase of growth of vitro culture, come harvested cell in centrifugal 5 minutes by tryptic digestion and 800g then, with Sterile Saline washing and suspension cell.Cell activity expects that with platform blue dyeing exclusive method is identified, has only unicellular ratio just to be used to inoculate nude mice greater than 90% cell suspension.Under general anesthesia, every nude mice flank subcutaneous injection 2-5 * 10 ⁶Individual cell, and xylidine (the Chanelle Animal Health Ltd. of 0.2 milliliter of peritoneal injection, Liverpool, UK) and ketamine (Willows FrancisVeterinary, Crawley, mixture UK) (the two concentration is respectively 1 mg/ml and 10 mg/ml) is induced.In first experiment, CTL102 and CTL208 are injected into the 25-60mm that has produced in the nude mouse ²Subcutaneous HepG2 tumour (surface-area that refers to tumour multiply by the longest diameter of its vertical direction with the longest diameter of tumour horizontal direction, in square millimeter).The single dose of every kind of virus is 7.5 * 10 ⁹Individual virion.After 48 hours mouse is put to death and take out its tumour and liver, be positioned in formalin/PBS buffered soln of 4% and fix 24 hours, carry out paraffin embedding and section according to standard step then.Cut the tissue of a series of 3 micron thickness and carry out immune labeled expression, wherein use indirect immune peroxide to cross thing enzyme labelling, goat-anti NTR antiserum(antisera) (Polyclonal Antibodies Ltd) and VECTASTAIN EliteABC test kit (Vector Labs) with inspection cell NTR.Then tissue slice is placed under the standard microscope equipment and to observe and measure the percentage ratio that whole liver and tumor mass have been expressed the cell of NTR with microscopy.Figure 47 has provided the result of each mouse.Its explanation UCOE and (otherwise weak expression) AFP promotor are united and are caused that NTR has high-caliber expression in the mouse AFP positive tumor, but its NTR expresses similar to in the CTL102 infected tumor of the cell count that is higher than detection level in the tumour that therefore infects with CTL208.Yet, CTL102 is injected directly into after the tumor mass expression that has five liver to detect NTR in six mouse, and serves as zero with six these numerals of mouse of CTL208 inoculation.The result shows that more than in the situation of CTL208, the promotor of UCOE-AFP is combined in the generation expression similar or stronger to the CMV promotor in the AFP positive tumor cell, and in healthy tissues (AFP feminine gender) cell a low expression level.

In order to prove that UCOE has brought up to effective treatment level with the expression intensity of AFP promotor, by CTL102 or CTL208 and prodrug CB1954 associating, than right the two anti-tumor capacity.(dosage is respectively 7.5 * 10 CTL102 and CTL208 ⁹With 2 * 10 ¹⁰Individual virion) single injection advances in the nude mouse that has produced 25-60 square millimeter Subcutaneous tumor respectively.Give CB1954 after 48 hours.At first ((Mo USA) makes the solution of 20 mg/ml for Sigma, St Louis UK) to be dissolved in dimethyl sulfoxide (DMSO) for Oxford Asymmetry, Oxford with CB1954.Face that with Sterile Saline the stoste dilution to be made final concentration for 5 times before using be 4 mg/ml.Under non-narcotization, give the CB1954 of injection same dose in the mouse peritoneum then, every day five times.Replace virus to inject with PBS in the control group and after 48 hours, give prodrug.After 27 days in, measure the size of tumour every day with vernier callipers.Figure 48 has provided its result.Not in the control group of virus inoculation, 7/7 tumor mass is also being grown up fast only giving CB1954; The tumor mass of all observing some mouse in giving all groups that NTR expresses virus and CB1954 diminishes, and concerning CTL102, diminishes in 3/8 mouse of giving low dosage and tumor mass in 4/8 mouse of giving high dosage CB1954.For CTL208, two above numerals are respectively 5/8 and 6/8.These results prove, situation for CTL208, the UCOE element makes the expression level of NTR in the tumour cell that imports that is derived from the AFP promotor be improved and is higher than the expression that strong CMV promotor produces, and shows than high anti-tumor activity in the clinical state mouse model that with GDEPT is purpose.

Above research has illustrated two characteristics important and with practical value of UCOE.The first, it can the substantive expression that improves in the adenovirus environment, and it has very big potentiality as the nonconformity carrier in gene therapy; The second, will remain with the specificity of usefulness simultaneously from weak and more useful level is brought up in expression specificity promoter.

Fish analysis

In mouse Ltk clone, analyze 31 16RNP-EGFP clone's copy number, because the DNA that uses in the transfection measures seldom (about 0.5-1 microgram), therefore single copy clone's ratio higher (83%).And in the clone of these single copies, the difference of the expression level of EGFP can surpass twice, and this explanation transgenosis is subjected to the influence of positive and negative position effect easily.Yet three single copy clones have been integrated into centromeric heterochromatin (Figure 42), and this illustrates that this construct can open chromatin.In clone F1 and G6, the 16RNP-EGFP transgenosis is incorporated on the kinetochore of the isochromosome that is formed by Robertsonian translocation (figure B, C), and in clone I3, integrates on the kinetochore of a typical acrocentric chromosome that betides mouse (scheming D).

Expressing promoting erythropoietin (EPO) in support C ET300 and CET301

The structure of erythropoietin (EPO) expression vector CET300 and CET301

With the cDNA library Quick-Clone of polymerase chain reaction (PCR) from the human fetal liver ^TM(Clontech, Palo Alto, the encoding sequence of the erythropoietin that increased in US.), wherein primer is EP2 (5 '-CAGGTCGCTGAGGGAC-3 ') and EP4 (5 '-CTCGACG GGGTTCAGG-3 ').The 705bp product that obtains has comprised whole open reading-frame (ORF), with Eukaryotic TA Cloning Kit (Invitrogen, Groningen, TheNetherlands) with its subclone to carrier pCR3.1, to obtain carrier pCR-EPO.The automated DNA of EPO sequence by two strands checks order and confirmed.Cut out the long NheI-EcoRV fragment that comprises the EPO encoding sequence of 790bp from pCR-EPO, with its subclone between the Nhe I and PmeI site of support C ET200 and CET201 (having comprised forward and the reverse long RNP fragment of 7.5kb respectively), to construct CET300 and CET301 expression vector respectively.Simultaneously, also the EGFP encoding sequence is excised from pEGFP-N1 as Nhe I-Not I fragment, replace with the Nhe I-Not I fragment that is derived from the pCR-EPO that contains the EPO encoding sequence again, thereby construct control vector pCMV-EPO.

In Chinese hamster ovary celI, express erythropoietin

With restriction enzyme DraIII with plasmid pCMV-EPO, CET300 and CET301 linearizing.By with phenol-chloroform extraction and subsequently ethanol sedimentation come purify DNA, then DNA is suspended in again in the sterilized water and changes the plasmid of equivalent over to Chinese hamster ovary celI with the method for electroporation.Cell after the transfection places 225cm ³Culturing bottle in, substratum after 24 hours, change into contain G418 (0.6mg/ml) complete culture solution to filter out stable transfectional cell.Carry out cell cultures until growing bacterium colony with G418 resistance (behind about electroporation ten days) at this substratum.Then cell is scraped off from culturing bottle and according to each hole 10 ⁶Amount be seeded to six orifice plates that contain 1 milliliter of complete culture solution.After 48 hours, nutrient solution is removed, and used

People EPO immunoassay kits (R﹠amp; D systems, Minneapolis is US) with EPO in enzyme linked immunosorbent assay (ELISA) quantitative culture medium.The result shows that the EPO output of construct CET300, CET301 and pCMV-EPO is respectively 1780 units per ml, 1040 units per ml and 128 units per ml.Therefore, forward and long segmental construct CET300 of RNP and the CET301 of reverse 7.5kb have been comprised, the output of the EPO of the yield increased plasmid pCMV-EPO of EPO has improved 14 times and 8 times respectively, and control plasmid wherein contains strong CMV promotor to drive the expression of EPO.

Involved and do not comprise the expression of GFP in the Hela cell of the segmental EBV reporter gene of hnRNPA2 16kb UCOE construct transfection

In the initial experiment of carrying out with the hygromycin selection cell at first, the construct (p220.RNP16) that has comprised RNP16UCOE can be expressed at the endogenic EGFP of 23 days generation levels, otherwise, but observe more heterology EGFP phraseologies with p220.EGFP (construct of no UCOE).The expression of EGFP in the p220.EGFP cells transfected lost gradually, and the stably express in the p220.RNP16 cells transfected can continue 160 days.

Above-mentioned experimental result has further been proved conclusively in three groups of parallel laboratory tests: the p220.RNP16 cells transfected shows high-caliber homology and expresses, and the p220.EGFP cells transfected shows heterogenous expression.The same with initial experiment, there is EGFP stably express under the situation of RNP 16 UCOE, be not expressed in 30-40 days and significantly descend (Figure 43) and there is under the situation of UCOE it.

In further testing, the selection of removing Totomycin at the 27th day, the result proves, even do not select, comprise the EGFP that has still kept stable under the situation of RNP16 UCOE and express, EGFP still can not stably express (Figure 44) under the situation of UCOE and do not comprise.

Embodiment 3

The plasmid that has comprised a UCOE

Figure 50 shows the construct of generation and is used for endogenous hnRNPA2 locus fragment relatively.

Figure 51 shows the FAC analysis chart that the average fluorescent strength of the Hela cell mass that utilizes transient transfection carries out.Utilize above-mentioned CL22 peptide section agglutinative reporter gene plasmid to carry out cell transfecting.Can see that control group CMV-GFP reporter gene construct can only be kept the continuous expression of short period of time, it is i.e. significantly reduction in 24-48 hour after transfection.

Opposite with control group, the UCOE that comprises plasmid 7.5CMV-F shows the remarkable GFP expression of (at least 9 days) for a long time.Having observed the GFP that reaches 14 days after the transfection in repeated experiments expresses.

Figure 52 shows that the low multiple in the part of representative transient transfection Hela cell amplifies.These data and FAC analyze resulting data consistent, thus can be in same time span observation of cell.Behind transient transfection 24 hours, no matter be GFP positive cells (Figure 52 A and B) in the CMV-GFP control group or in the 7.5CMV experimental group, all obviously to have occurred.In fact, in the time of 24 hours, the GFP positive cell of control group also will be more than 7.5CMV transfectional cell group.This be since in both cases the amount that imports of DNA be not gauged gene dosage, control group obviously contains more plasmid copy when therefore having caused each transfection.Yet, after transfection 6 days, be difficult to find positive fluorocyte (Figure 52 C) in the CMV-EGFP control group.And at this moment the cell (Figure 52 D) of a large amount of expression GFP is still arranged in the Hela cell with the 7.5CMV transfection.In fact, after transfection, still can more easily find positive fluorocyte (data are unlisted) in 14 days.

We have extracted the full DNA of cell on the different time periods in whole experiment, and it is carried out linearizing, gel electrophoresis and Blot experiment (seeing material and method).What is interesting is, be not the not plasmid of integrated state (data are unlisted) even after transfection, had substantially in 6 days still can detect at an easy rate in the control group that GFP expresses.This may hint that observed GFP expresses in the CMV-GFP control plasmid quick forfeiture can not be owing to plasmid template forfeiture in time, but the effect of chromatin genetic expression shutdown mechanism.

With the transient transfection of erythropoietin expression vector to Chinese hamster ovary celI

(975 μ F carry out electroporation transfection to Chinese hamster ovary celI under 250V) in standard conditions with plasmid CET300, the CET301 of superhelix form and CMV-EPO.The cell of survival is by 10 ⁶The amount renewed vaccination of individual cell is in containing six orifice plates of 1 milliliter of complete CHO substratum.Substratum served as to change the fresh substratum of 1ml at interval with 24 hours.Get media samples after 9 days, and use

People EPO immunoassay kits (R﹠amp; D systems, Minneapolis is US) with enzyme linked immunosorbent assay (ELISA) the quantitative assay content of EPO wherein.Additional pictorialization respectively transfection in the cell of CET300, CET301 and CMV-EPO plasmid erythropoietin express over time: being expressed in 48 hours of EPO constantly risen in all cells, after this, EPO in the cell mass of transfection CMV-EPO expresses by day decline, and is expressed in still lasting rise (Figure 45) in 9 days with CET300 or CET301 cells transfected group's EPO.

Reference

1.Altschul, S.F., Madden, T.L.,

J.Z., Zhang, Z., Miller, W., and Lipman, D.J. (1997) .Gapped BLAST and PSI-BLAST: the protein database search program (a new generation of protein database searchprograms) of a new generation. nucleic acids research (Nucleic Acids Res) .25:3389-3402.

2.Antoniou, M. (1991). specific expressed the inducing of red corpuscle in mouse source erythroleukemia (MEL) clone (Induction of erythroid-specific expression in murineerythroleukaemia (MEL) cell lines). molecular biology method (Methods inMolecular Biology), Vol.7: transgenosis and expression handbook (Gene Transfer andExpression Protocols), E.J.Murray edits, Humana Press Inc., Clifton, NJ, U.S.A.pp.421-434.

3.Antoniou, M.and Grosveld, F. (1990). β-hemoglobin gene dominance control region different with the effect of far-end and proximal promoter sub-element (The β-globin gene dominantcontrol region interacts differently with distal and proximal promoterelements). gene progress (Genes Dev.) .4:1007-1012.

4.Archer, T.K., Lefebvre, P., Wolford, R.G.and Hager, G.L. (1992) is positioned at the transcription factor on the MMTV promotor: promotor activatory dual model mechanism.(Transcription factor loading on the MMTV promoter:a bimodalmechanism for promoter activation). science (Science) 255:1573-1576.

5.Aronow, B.J., Ebert, C.A., Valerius, M.T., Potter, S.S., Wiginton, D.A., Witte, D.P.and Hutton, the separation of J.J. (1995) locus control area: strengthen the function (Dissecting a Locus ControlRegion:Facilitation of Enhancer Function by Extended Enhancer-FlankingSequences) of enhanser by prolonging enhanser flank series. molecular cytobiology (Mol Cell.Biol) .15:1123-113 5.

6.Auffray, C., and Rougeon, F. (1980). purifying mouse immuning ball protein heavy chain RNA from the total RNA of bone marrow cell carcinoma (Purification of mouse immunoglobulinheavy-chain RNAs from total myeloma tumor RNA). European biochemical magazine (Eur.J Biochem) .107:303-324.

7.Biamonti G, Ruggiu M, Saccone S, Della Valle G, Riva S (1994) is by two homologous genes that repeat to originate from, coding people's hnRNP a-protein 2 and A1 (Twohomologous genes, originated by duplication, encode the human hnRNPproteins A2 and A1). nucleic acids research (Nucl Acids Res) .22:1996-2002.

8.Birnboim, H.C., and Dolly, J. (1979). the quick alkali extraction steps (A rapid alkaline extraction procedure for screeningrecombinant plasmid DNA) of screening recombinant plasmid dna. nucleic acids research (Nucleic Acids Res) .7:1513.

9.Blom van Assendelft, G., Hanscombe, O., Grosveld, F., andGreaves, D.R. (1989). betaglobulin dominance control region activates homology and allogenic promotor (The β-globin dominant control region activateshomologous and heterologous promoters in a tissue-specific manner) in the tissue specificity mode. cell (Cell) 56:969-977.

10.Bonifer C, Vidal M, Grosveld F, tissue specificity and the position dependent/non-dependent of the complete gene territory of Sippel AE (1990) lysozyme of chicken in transgenic mouse expressed (Tissuespecific and position independent expression of the complete gene domainfor chicken lysozyme in transgenic mice) .EMBO J.9:2843-2848.

11.Bonifer, C., Yannoutsos, N., Grosveld, G.and Sippel, A.E. (1994) are arranged in the decomposition (Dissection of the locus control function located on the chicken lysozymegene domain in transgenic mice.) of the locus controlled function in lysozyme of chicken gene territory at transgenic mouse. nucleic acids research (Nucleic Acids Res.) 22:4202-4210.

12.Brines RD and Klaus GG (1993) comes polyclone to activate effect (Polyclonal activation ofimmature B cells by preactivated T cells:the role of IL-4 and CD40ligand.) international immunology (Int.Immunol.) 5:1445-1450. of immature B cells: IL-4 and CD40 part by pre-activating T cell

13.Burd CG, Swanson MS, Gorlach M, Dreyfuss G (1989) allos cell nucleus ribonucleoprotein A2, B1 and the proteic primary structure of C2: diversity (the Primary structures of the heterogeneous nuclearribonucleoprotein A2 that inserts the rna binding protein that causes by little peptide, B1, and C2 proteins:a diversity of RNA bindingproteins is generated by small peptide inserts.).Institute's science journal (Proc.Natl.Acad.Sci.) USA 86:97889792. of country

14.Carson, S.and Wiles, M.V. far field, (1993) .Ea MHCII type upstream is that the dependency of duplicating of the genetically modified position of Ea dependent/non-dependent is expressed necessary (Far upstreamregions of class II MEC Ea are necessary for position-independent, copy-dependent expression of Ea transgene.) nucleic acids research (Nucl.Acids Res.) 21:2065-2072.

15.Chalut, C., Gallois, Y., Poterszman, A., Moncollin, V., and Egly, J.-M. (1995). the genome structure of human TATA-frame-conjugated protein (TBP) (Genomicstructure of the human TATA-box-binding protein (TBP)). gene (Gene) 161:277-282.

16.Chu, G., Hayakawa, H., and Berg, P. (1987) .DNA electroporation are used for effective transfection (Electroporation for the efficient transfection ofmammalian cells with DNA) of mammalian cell. nucleic acids research (Nucleic Acids Res.) 15:1311-1326.

17.Church, G.M., and Gilbert, W. (1984). and gene order-checking (Genomicsequencing.) national institute science journal (Proc.Natl.Acad.Sci.) USA81:1991-1995.

18.Collis, P., Antoniou, M.and Grosveld, F. (1990). the minimum demand (Definition of theminimal requirements within the human β-globin gene and the dominantcontrol region for high level expression.) when definition people's beta globin gene and dominance control region high level expression, EM.BO.J.9:233-240.

19.Cooper, M.J.and Miron, S., 1993, effective episome expression vector of people's cancerous tumor cell (Efficient episomal expression vector for human transitionalcarcinoma cells) human gene therapy (Hum.Gene Ther.) 4:557-566.

20.Dai, Y., Roman, M., Naviaux, R.K.and Verma, 1.M. (1992) are by elementary myoblastic gene therapy: the long-term expression (Gene Therapy via primary myoblasts:long-term expression of factor IXprotein following transplantation in vivo.) of the IX factor protein after transplanting in the body, national institute's science journal (Proc.Natl.Acad.Sci.) USA 89:10892-10895.

21.De Benedetti, A.and Rhoads, R.E., 1991, a kind ofly be used for the novel B K virus basic episome carrier (A novel BKvirus-based episomal vector for expression of foreign genes in mammaliancells) that foreign gene is expressed at mammalian cell, nucleic acids research (Nucl.Acids Res.), 19:1925-1931.

22.Deprimo, S.E., Stambrook, P.J.and Stringer, J.R. (1996) placental alkaline phosphatase is as the group mark (Human placentalalkaline phosphatase as a histochemical marker of gene expression intransgenic mice) of genetic expression in the transgenic mice, transgenic research (Transgenic Res.) 5:459-466.

23.Diaz, P., Cado, D.and Winoto, A. the region of (1994) .T cell receptor α/δ locus (A locus control region in the T cell receptor α/δ locus.), immunity (Immunity) 1:207-217.

24.Dillon, N., and Grosveld, F. (1993). and use transgenic animal to carry out transcription analysis.Genetic transcription: the method for a practicality (Transcriptional analysis usingtransgenic animals.In Gene Transcription:A practical approach), B.D.Hames and S.J.Higgins edits, eds. (Oxford:IRL Press), pp.153-188.

25, Dillon, N.and Grosveld, F. (1994). the chromatin territory is as potential unit (Chromatin domains as potential units of eukaryotic genefunction.) current genetics progress (Curr.Opin.Genet.Develop.) 4:260-264. of eukaryotic gene function

26.Dillon, N., Trimbom, T., Stroubouhs, J., Fraser, P.and Grosveld, F. (1997) distance is for the interactional influence of long-range chromatin (The effect of 30distance on long-range chromatin interactions). molecular cell (Mol Cell) 1:131-139.

27.Earle, W.lt, Schilling, E.L., Stark T.H., Straus, N.P., Brown, M.F., and Shelton, E. (1943). and the generation IV of external malignant tumor.Visible change in mouse fibroblast culture and the viable cell (Production of malignancy in vitro.IV.The mouse fibroblast cultures and changes seen in the living cells.) national cancer association's magazine (J.Nat.Cancer Inst.) 4:165-212.

28.Ellis, J., Tan-Un, K.C., Harper, A., Michalovich, D., Yannoutsos, N., Philipsen, S.and Grosveld, F. (1996). open active (A dominant chromatin-openingactivity in 5 ' hypersensitive site 3 of the human β-globin locus controlregion.) EMBO J 15:562-568. of the dominance chromatin of 5 ' hypersensitive site 3 in people's betaglobulin region

29.Festenstein, R., Tolaini, M., Corbella, P., Mamalaki, C., Parrington, J., Fox, M., Miliou, A., Jones, M and Kioussis, D. (1996). region function and heterochromatin are induced position influence spot (Locus control regionfunction and heterochromatin-induced position effect variegation.) science (Science) 271:1123-1125.

30.Flotte T.R.and Carter, B.J. (1995) adeno-associated virus vector are used for gene therapy (Adeno-associated virus vectors for gene therapy.), gene therapy (GeneTher.) 2:357-362.

31.Foulds, C.E.and Hawley, D.K. the conjugated protein promotor of (1997) analyst TATA and discern one the decision active ets site (Analysis of the human TATAbinding protein promoter and identification of an ets site critical foractivity.) nucleic acids research (Nucl.Acids Res.) 25:2485-2494

32.Forrester, W.C., Takegawa, S., Papayannopouplou, T., Stamatoyannopoulos, G., and Groudine, M. (1987). the proof of locus region of activation: stability is formation (Evidence for a locus activation region:the formation of developmentallystable hypersensitive sites in globin-expressing hybrids.) nucleic acids research (the Nucleic Acids Res.) 15:10159-10177. of high responsive site in sphaeroprotein expression hybrid of development constantly

33.Freshney, R.I. (1994). and animal cell culture: basic fundamental guide (In Cultureof animal cells:a manual of basic techniques) (New York:Wiley-Liss, Inc.), pp.169-171.

34.Gavalas, A.and Zalkin, H. (1995) analyzes the chicken GPAT/AIRC bidirectional promoter (Analysis of the chicken GPAT/AIRCbidirectional promoter for de novo purine nucleotide synthesis) that is used for the purine nucleotides de novo synthesis. journal of biological chemistry (J.Biol.Chem.) 270:2403-2410.

35.Gilliland, G., Perrin, S., Blanchard, K-, and Bunn, H.F. (1990). analysis of cells factor mRNA and DNA: detect and quantitative (Analysis of cytokine mRNA and DNA:Detection and quantitation bycompetitive polymerase chain reaction.) national institute's science journal (Proc.Natl.Acad.Sci.) USA 87:2725-2729. by the competition polymerase chain reaction

36.Greaves, D.R., Wilson, F.D., Lang, G.And Kioussis, D. (1989). human CD2 3 ' flanking sequence produces genetic expression (Human CD2 3 ' flanking sequences confer high-level of high level, T cell-specific, position dependent/non-dependent in transgenic mouse, T cell specific, position-independent gene expression in transgenic mice.) cell (Cell) 56:979-986.

37.Grosveld, F., Blom van Assendelft, G.B., Greaves, D.R.andKollias, G. (1987). human betaglobulin carries out position dependent/non-dependent high level expression (Positionindependent high level expression of the human β-globingene in transgenic mice.) cell (Cell) 51:975-985. in transgenic mouse

38.Grosveld, F., Dillon, N.and Higgs, the regulation and control of D.R. (1993) human immunoglobulin gene (The regulation of human globin gene expression.) Baillieres Clin.Haematol.6:31-55.

39.

M., Alhonen, L., Wahlfors, J., Sinervirta, R., Janne, A., and Janne, J. (1991). biochemical and biophysical studies communication (Biochem.Biophys.Res.Comm.) 180:262-267. of the position dependent/non-dependent unconventionality expression (Position-independent, abberant expression of the humanornithine decarboxylase gene in transgenic mice.) of people's ornithine decarboxylase in transgenic mouse

40.Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N.and Grosveld, importance (Importance of globin gene order for correct developmentalexpression.) gene progress (Genes Dev.) 5:1387-1394. that F. (1991) globulin gene order is expressed for correct development

41.Hartman, P.S. (1991). and transmission can reduce transformation frequency (Transillumination can profoundly reduce transformation frequencies.) biotechnology (BioTechniques) 11:747-748. greatly

42.Heng HH, Xiao H, Shi XM, Greenblatt J, the encoding gene of the common initiation factor that Tsui LC (1994) rna plymerase ii is transcribed are dispersed in (Genesencoding general initiation factors for RNA polymerase II transcription aredispersed in the human genome.) human molecular genetics (Hum Mol Genet.) 3:61-64. in the people's gene group

43.Hong, N.A., Cado, D., Mitchell, J., Ortiz, B.D., Hsieh, S.N.andWinoto, the purpose sudden change that has in A. (1997) TXi Baoshouti α site destroys development of T cell and the contiguous anti-apoptotic genes expression Dad-1 that exists of announcement.(A targeted mutation at the T cell receptor (x locus impairs T cell development and reveals the presence of the nearbyanti-apoptosis gene Dad-1.) molecular cytobiology (Mol.Cell.Biol.) 17:2151-2157.

44.Ioannou, P.A., Amemiya, C.T., Garner, J., Kroisel, P.M., Shizuya, H., Chen, C., Batzer, M.A., and de Jong, P.J. (1994). a kind of novel carriers that is derived from antibiotic P1 is used for the big segmental growth of people DNA (A new bacteriophageP1-derived vector for the propagation of large human DNA fragments.) natural genetics (Nat.Genet.) 6:84-89.

45.Jarman, A.P., Wood, W.G., Sharpe, J.A., Gourdon, G., Ayyub, H.and Higgs, D.R. (1991) are positioned at feature (Characterization of the major regulatory element upstream of thehuman alpha-globin gene cluster.) molecular cytobiology (Mol.Cell.Biol.) 11:4679-4689. of the main controlling element of people's alpha-globulin gene cluster upstream

46.Jones, B.K., Monks, B.R., Liebhaber, S.A.and Cooke, N.E. (1995) human growth hormone gene is by multielement genes seat control region regulation and control (The Human Growth15 Hormone Gene is Regulated by a Multicomponent Locus ControlRegion.) molecular cytobiology (Mol.Cell.Biol.) 15:7010-7021.

47.Kaufinan, R.J. (1990) Enzymology method (Methods in Enzymology) 185:53 7-566.

48.Kolsto A.-B., Kollias, G., Giguere, V., Isobe, K.-I., Prydz, H.andGrosveld, that does not has the island that methylates in F. (1986) transgenic mouse keeps (The maintenance ofmethylation-free islands in transgenic mice.) nucleic acids research (Nucl.Acids Res.) 14:9667-9678.

49.Kotin RM (1994) adeno associated virus is used for prospect (Prosspects for the use of adeno-associated virus as a vector for humangene therapy.) human gene therapy (Hum.Gene Ther.) 5:793-801. of people's gene treatment as carrier

50.Kozu T, Henrich B, the structure and expression (Structure and expression of thegene (HNRPA2B1) encoding the human hnRNP protein A2/B1.) genome (Genomics) 25:365-371. of the gene (HNRPA2B1) of Schafer KP (1 995) coding people hnRNP albumin A 2/B1

51.Lake, R.A., Wotton, D.and Owen, EMBO J.9:3129-3136. for the tissue specific expression (A 3 ' transcriptional enhancerregulates tissue-specific expression of the human CD2 gene.) of (1990) 3 ' transcriptional enhancer regulation and control of M.J. people CD2 gene

52.Lang, G., Wotton, D., Owen, M.J., Sewell, W.A., Brown, M.H., Mason, D.Y., Crumpton, M.J.and Kioussis, EMBO J.7:1675-1682. for the structure of D. (1988) people CD2 gene and the expression in transgenic mouse thereof (The structure of the human CD2 gene and itsexpression in transgenic mice.)

53.Larsen, F., Gundersen, G., Lopez, R., and Prydz, H. (1992) .CpG island is as the genetic marker in the people's gene group (CpG islands as gene markers in thehuman genome.) genome (Genomics) 13:1095-1107.

54.Lee CC, Pons F, Jones PG, Bies RD, Schlang AM, Leger JJ, Caskey CT (1993) Mdx transgenic mouse: recovery (Mdx transgenic mouse:restoration of recombinant dystrophinto the dystrophic muscle.) human gene therapy (Hum.Gene Ther.) 4:273-287. of reorganization dystrophin in malnutritive muscle

55.Lennon, G.G., Auffray, C., Polymeropoulos, M., and Soares, M.B. (1996) .The I.M.A.G.E.Consortimn: genomic integration analysis of molecules and expression thereof (An intergrated molecular analysis of genomes and their expression.) genome (Genomics) 33:151-152.

56.Lozzio, C.B., and Lozzio, B.B. (1975). people chronic bone marrow leukemia cells system and positive Philadelphia chromosome (Human chronic myelogenous leukemia cell-linewith positive Philadelphia chromosome.) blood (Blood) 45:321-334.

57.McBurney, M.W., Staines, W.A., Boekelheide, K., Parry, D., Jardine, K.and Pickavance, L (1994) mouse PGK-1 promotor starts extensive but inhomogenous expression (Murine PGK-1 promoter drives widespread butnot uniform expression in transgenic mice.) kinetics progress (Devel.Dynam) .200:278-293. in transgenic mouse

58.Mehtali, M., LeMeur, M.and Lathe, house keeper's transgenosis loss high copy number (The methylation-free status of a housekeepingtranssgene is lost at high copy number.) gene (Gene) 91:179-184. of the no methylation state of R. (1990)

59.Yeoman H and Mellor AL (1992) expresses the tolerance and MHC restricted (Tolerance and MHC restriction intransgenic mice expressing a MHC class I gene in erythroid cells.) international immunology (Int Immunol) 4:59-65. of the transgenic mouse of MHC I gene in red corpuscle

60.Michelsen, B.K. (1995). and colibacillary conversion makes the inactivation of T4 dna ligase increase by 260 times of (Transformation of Escherichia coli increases 260-foldupon 30 inactivation of T4 DNA ligase.) biochemical analysis (Anal.Biochem.) 225:172-174.

61.Miller, A.D. (1992) retroviral vector (Retroviral vectors.) contemporary microbial immunology theme (Curr.Top.Microbiol.Immunol.) 158:1-24.

62.Miller, A.D., Miller, D.G., Garcia, J.V.and Lynch, C.M. (1993) retroviral vector are used for transgenosis and expression (Use of retroviral vectors for genetransfer and expression.) Enzymology method (Meth.Enzymol.) 217:581-599.

63.Milot, E., Strouboulis, J., Trimbom, T., Wijgerde, M., de Boer, E., Langeveld, A., Tan-Un, K., Vergeer, W., Yannoutsos, N., Grosveld, F.andFraser, P. (1996). heterochromatin influences the frequency and time length (Heterochromatin effects on the frequency and duration ofLCR-mediated gene transcription.) cell (Cell) 87:105-114. of the genetic transcription of LCR mediation

64.Montoliu, L., Umland, T.and Schiitz, G. (1996). and EMBO is J.15:6026-6034. at the region (A locus control region at-12 kb of thetyrosinase gene.) of tyrosinase cdna-12kb

65.Muzyczka, N. (1992) adeno associated virus is as mammiferous common transduction vector (Use of adeno-associated virus as a general transduction vector formammalian cells,) contemporary microbial immunology theme (Curr.Top.Microbiol.Immunol.) 158:97-129.

66.Needham, M., Egerton, M., Millest, A., Evans, S., Popplewell, M., Cerillo, G., McPheat, J., Monk, A., Jack, A., Johnstone, D.and Hollis, M. (1995). further developing of locuscontrol region/mouse erythroleukemia expression system: the high level expression of recombinant human calcitonin acceptor and characteristic (Further development of the locuscontrol region/murine erythroleukemia expression system:high levelexpression and characterisation of recombinant human calcitonin receptor.) protein expression and purifying (Protein Expression and Purification) 6:124-131.

67.Needham, M., Gooding, C., Hudson, K., Antoniou, M., Grosveld, F.and Hollis, M. (1992) .LCR/MEL: a kind of multipurpose system is used for high level expression (A versatile system for high-level expression ofheterologous proteins in erythroid cells.) nucleic acids research (Nucl.Acids Res.) 20:997-1003. of heterologous protein at red corpuscle

68.Ogilvy, S., Elefanty, A.G., Visvader, J., Bath, M.L., Harris, A.W., and Adains, the transcriptional control of J.M. (1998) .Vav, its expression runs through hematopoiesis district (Transcriptional regulation of Vav, a gene expressed throughout thehematopoietic compartment.) blood (Blood) 91:419-430

69.Ortiz, B.D., Cado, D., Chen, V., Diaz, P.W.and Winoto, EMBO J.16:5037-5045. to particular organization (Adjacent DNA elements dominantly restrict the ubiquitousactivity of a novel chromatin-opening region to specific tissues.) for the omnipresence activity in a kind of new dyeing matter of the remarkable restriction of the DNA element that A. (1997) is adjacent open area

70.Peterson, M.G., Tanese, N., Pugh, B.F., and Tijan, R. (1990). protein-bonded functional domain of people TATA of having cloned and upstream activation characteristic (Functionaldomains and upstream activation properties of cloned human TATAbinding protein.) science (Sicience) 248:1625-1630.

71.Philipsen, S., Talbot, D., Fraser, P.and Grosveld, F. (1990) betaglobulin dominance control region: hypersensitive site 2 (The β-globin dominant control region:hypersensitive site 2), EMBO J., 9:2159-2167.

72.Piirsoo, M., Ustav, E., Mandel, T., Stenlund, A.and Ustav, M. (I996) stable free gene keep the suitable cross-demand (Cis and transrequirements for stable episomal maintenance of the BPV-I replicator.) of BPV-1 replicon, and EMBO J.15:1-11.

73.Pruzina, S., Hanscombe, O., Whyatt, D., Grosveld, F.andPhilipsen, the hypersensitive site 4 of the human betaglobulin locuscontrol region of S. (1991) (Hypersensitive site 4 of the human β-globin locus control region,) nucleic acids research (Nucl.Acids Res.), 19:1413-1419.

74.Raguz, S., Hobbs, C., Yagiie, E., Ioannou, P.A., Walsh, F.S.andAntoniou, muscle specific locuscontrol region activity (Muscle-specific locus control region activity associated with the humandesmin gene.) biology progress (Develop.Biol.) in press. that M. (1998) and people's desmin gene are followed

75.Ray P, Higgins KM, Tan JC, Chu TY, Yee NS, Nguyen H, LacyE, the ectopic expression of Besmer P (1991) minigene in transgenic mouse: W-phenotype and prove that the C-test kit is to effect (the Ectopic expression of ac-kitW42 minigene in transgenic mice:recapitulation of W phenotypes andevidence for c-kit function in melanoblast progenitors.) gene that becomes to deceive cell primitive factor progress (GenesDev.) 5:2265-2273. explains the main points briefly

76.Reeves, R., Gorinan, C.M.and Howard, B. (1985) are advanced minichromosomes (Minichromosomeassembly of nonintegrated plasmid DNA transfected into mammalian cells.) nucleic acids research (Nucl.Acids Res.) 13:3599-3615. of the nonconformity plasmid DNA assembling of mammalian cell by transfection

77.Reitmann, M., Lee, E., Westphal, H., and Felsenfeld, G. (1993). an enhanser/region is for open chromatin and insufficient (An enhancer/locus control region is not sufficient to open chromatin.) molecular cytobiology (Mol.Cell.Biol.) 13:3990-3998.

78.Saccone S, Biamonti G, Maugeri S, Bassi MT, Bunone G, Riva S, Delia Valle G (1992) is assigned to karyomit(e) 12q 13.1 (Assignment of the humanheterogeneous nuclear ribonucleoprotein A1 gene (HNRPA1) tochromosome 12ql3.1 by CDNA competitive in situ hybridization.) genome (Genomics) 12:171-174. with the competitive in situ hybridization of cDNA with human heterogenous nuclear ribonucleoprotein A1 gene (HNRPA1)

79.Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). molecular cloning: experiment guide (Molecular Cloning:A Laboratory Manual) (Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press).

80.Smith, C.L., Archer, T.K., Hamlin-Green, G.and Hager, G.L. (1993) new PgR of expressing can not activate stable, multiple murine mammary tumour virus template, but can lasting expression (Newly expressed progesterone receptorcannot activate stable, replieated mous mammary tiunor virus templatesbut acquires transactivation potential upon continuous expression.) national institute science journal (Proc.Natl.Acad Sci.) the USA 90:11202-11206. of potential trans-activation

81.Southern, E.M. (1975). measure by the particular sequence in the gel electrophoresis separated DNA fragment (Detection of specific sequences among DNA fragmentsseparated by gel electrophoresis.) molecular biology magazine (J.Mol.Biol.) 98:503-517.

82.Sun, T.Q., Fernstemacher, D.A.and Vos, J.M. (1994) people's human artifical episomal chro-mosome is used at the big fragment of human body cell cloned DNA (Human artificialepisomal chromosomes for cloning large DNA fragments in human cells.) national genetics (Nat.Genet.) 8,33-41.

83.Talbot, D., Philipsen, S., Fraser, P.and Grosveld, the site 3 of F. (1990) detailed analysis people betaglobulin dominance control region (Detailed analysis of the site 3region of the human β-globin dominant control region,) EMBO J., 9:2169-2178.

84.Tamura T, Osaka F, Kawamura Y, Higuti T, Ishida N, NothwangHG, Tsurnmi C, Tanaka K, the separating and characteristic (Isolation and characterization ofalpha-type HC3 and betatype HC5 subunit genes of human proteasomes.) molecular biology magazine (J.MoL BioL) 244:117-124. of the α type HC3 of Ichihara A (1994) human proteasome and β type HC5 subunit gene

85.Tartof, K.D., and Hobbs, C.A. (1987). improved substratum is used for plasmid and cosmid clone's growth (Improved media for growing plasmid andcosmid clones.) Bethesda Res.Lab. focus (Focus) 9:12.

86.Tewari, R., Gillemans, N., Wijerde, M., Nuez, B., von Lindem, M., .Grosveld, F.and Philipsen, S. (1998) EKLF (Erythroid Kr ü ppel-likefactor) have activity and its in original and full grown red corpuscle EMBO J.17:2334-2341. for 5 ' HS3 performance function necessary (Erythroid Kr ü ppel-like factor (EKLF) is active in primitive and definitive erytbroid cells and is required for thefunction of 5 ' HS3 of the b-globin locus control region.) of b-sphaeroprotein locuscontrol region

87.Trachtulec Z, Hwnvas RM, Forejt J, Lehr-ach HR, Vincek V, Klein J (1997) TATA is conjugated protein have been shown the colinearity of guarding between Mammals and invertebrates with proteasome subunit C5 gene being connected in mouse and people (Linkage ofTATA-binding protein and proteasome subunit C5 genes in mice andhumans reveals synteny conserved between mammals and ' is genome (Genomics) 44:1-7. invertebrates.)

88.Vyas P, Vickers MA, Simmons DL, Ayyub H, Craddock CF, Higgs DR (I 992) cis acting sequence regulation and control are arranged in expression (Cis-acting sequences regulating expression of the humanalpha-globin cluster lie within constitutively open chromatin.) cell (Cell) 69:781-793. of people's alpha-globulin bunch of structure opening chromatin

89.Wijgerde, M., Grosveld, F.and Fraser, P. (1995). the stability of transcription complex and chromatin kinetics (Transcription complex stability andchromatin dynamics in vivo.) nature (Nature) 377:209-213. in vivo

90.Winston, J.H., Hanten, G.R., Overbeek, P.A., and Kellems, R.E. (5 ' flanking sequences of the murineadenosine deaxninase gene direct expression of a reporter gene to specificprenatal and postnatal tissues in transgenic mice.) journal of biological chemistry (J.Biol.Chem.) 267,13472-13479. are organized in the 5 ' flanking sequence of (1992) mADA gene direct reporter gene to specific birth back that in utero reaches of expressing in transgenic mouse

91.Winston, J.H., Hong, L., Datta, S.K.and Kellems, the introne 1 control region of R.E. (1996) mADA can activate omnipresence expression (An intron I regulatory region from the murine adenosinedeaminase gene can activate heterologous promoters for ubiquitousexpression in transgenic mice.) human body cell molecular genetics (Som.Cell MolGenet.) 22:261-278. that allogeneic promoter is used for transgenic mouse

92.Yamashita, T., Kasai, N., Miyoshi, I., Sasaki, N., Maki, K., Sakai, M., Nishi, biochemical and biophysical studies communication (Biochem.Biophys.Res.Comm.) 191:715-720. of S.and Nwnioka, S. (1993) people's α-fetoprotein high level expression (High level expression of human alpha-fetoprotein in transgenicmice.) in transgenic mouse

93.Yates, J.L., Warren, N.and Sugden, B. (1985) are derived from the plasmid of EP virus at carefully stable (Stable replication of plasmids derivedfrom Epstein-Barr virus in various mammalian cells.) nature (Nature) 313:812-815. that duplicates of different Mammalss

94.Zhumabekov T, CoThella P, Tolaini M, the improved people CD2 of Kioussis D (1995) minigene base carrier is used for T cell specific expression (Improvedversion of a human CD2 minigene based vector for T cell-specificexpression in transgenic.mice.) immunological method magazine (the J Immunol Methods.) 185:133-140. of transgenic mouse

Claims (9)

1. a method that obtains required gene product comprises and cultivates carrier-containing host cell, and described carrier comprises polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected; With

C. the promotor that can be operatively connected with described gene, wherein said promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

2. a method that obtains required gene product comprises and cultivates carrier-containing host cell, and described carrier comprises polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor, be positioned at the outside on described CpG island, can be operatively connected with described gene, wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

3. a method that obtains required gene product comprises and cultivates carrier-containing host cell, and described carrier comprises polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor is positioned at the outside on described CpG island, can be operatively connected with described gene, and wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes the reproducible transcriptional activation of described gene.

4. the method that can reproduce expressing gene comprises described gene can be operationally connected on the polynucleotide that described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected; With

C. promotor can be operatively connected with described gene, and wherein promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

5. the method that can reproduce expressing gene comprises described gene can be operationally connected on the polynucleotide that described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor, be positioned at the outside on described CpG island, can be operatively connected with described gene, wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

6. the method that can reproduce expressing gene comprises described gene can be operationally connected on the polynucleotide that described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor is positioned at the outside on described CpG island, can be operatively connected with described gene, and wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes the reproducible transcriptional activation of described gene.

7. one kind prepares the reproducibly method of the carrier of expressing gene, comprises being operatively connected polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected; With

C. promotor can be operatively connected with described gene, and wherein said promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

8. one kind prepares the reproducibly method of the carrier of expressing gene, comprises being operatively connected polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor, be positioned at the outside on described CpG island, can be operatively connected with described gene, wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes described gene reproducible transcriptional activation in two or more types of organizations.

9. one kind prepares the reproducibly method of the carrier of expressing gene, comprises being operatively connected polynucleotide, and described polynucleotide comprise:

A. the element that comprises the no methylated CpG island of prolongation, described no methylated CpG island comprises at least one endogenous promotor;

B. expressible gene, wherein said expressible gene and described CpG island can be operatively connected, and wherein said in addition expressible gene is connected natively with described CpG island right and wrong; With

C. another promotor is positioned at the outside on described CpG island, can be operatively connected with described gene, and wherein said another promotor and described CpG island right and wrong can be operatively connected natively, and wherein said element promotes the reproducible transcriptional activation of described gene.

Images