CN101246125A - Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product - Google Patents
Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product Download PDFInfo
- Publication number
- CN101246125A CN101246125A CNA2008100268039A CN200810026803A CN101246125A CN 101246125 A CN101246125 A CN 101246125A CN A2008100268039 A CNA2008100268039 A CN A2008100268039A CN 200810026803 A CN200810026803 A CN 200810026803A CN 101246125 A CN101246125 A CN 101246125A
- Authority
- CN
- China
- Prior art keywords
- nano
- dna fragment
- target dna
- probe
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention discloses an electrochemical irradiating method which is based on the nano/micrometer particle amplifying signal and is not PCR-amplified and is used for fast detecting the transgenic product. In the method firstly two appropriate restriction enzymes are selected for acting on the sample genome DNA to obtain the purpose DNA segment comprising the transgenic characteristic sequence; afterwards the DNA segment is hybridized with the biotin-marked probe in order to obtain a function of filtrating the purpose DNA fragment; then the DNA segment is hybridized with the high-efficiency electrochemical irradiating probe for realizing the high-sensitivity electrochemical irradiation detection; and finally the transgenic component in the sample is executed with quantitative analysis according to the calibration curve. The method of the invention realizes the direct detection to the primary sample by leading in the high-efficiency electrochemical irradiating probe which is prepared basing on the principal of the nano/micrometer particle amplifying signal, the method has the advantages of sensitivity, rapidity, easiness, safety, accurate accuracy and the like, and is more suitable to be generalized and applied in the actual detection.
Description
Technical field
The present invention relates to a kind of transgenic product (GMO) detection method of non-PCR amplification, electrochemiluminescence (ECL) method of particularly a kind of fast detecting GMO based on nano/micrometre particle amplified signal.
Background technology
The comprehensive GMO detection technique of countries in the world at present according to detecting the thing difference, mainly is divided into protein detection, RNA detects and three types of DNA detection.For the detection of protein mainly is to adopt serological method, because some GMO not marking protein or expression instability, the gene expression that also has has tissue specificity, so the serology detection method only limits to the detection of indivedual GMO; In addition, because the easy thermal denaturation of protein so be difficult to detect the food that processes with the transgenosis raw material, has certain limitation.RNA detects then owing to be subjected to RNA degraded and to the higher restriction of experimental technique conditional request and difficult popularizing easily.And DNA is the molecule of quite stable, be fit to the detection of most kind samples (starting material, food formula constituent, converted products), therefore, the DNA detection method is present topmost GMO detection method, whether it is by containing the foreign gene composition in the test sample---and generally comprise promoter, reporter gene, genes of interest and terminator (wherein promoter and terminator are essential for expressing genes of interest institute), come whether to contain in the judgement sample transgene component.At present, the promoter that adopts of genetically modified plants is mainly the CaMV35S promoter that derives from cauliflower mosaic virus, the NOS promoter of agrobacterium tumefaciens and the FMV35S promoter of figwort mosaic virus; The terminator of widespread use derives from the NOS terminator of agrobacterium tumefaciens, CaMV terminator and the neomycin phosphotransferase NptII terminator of cauliflower mosaic virus respectively.The needs that can contain 95% existing transgenic plant detection at the detection of said gene.
In the DNA detection method, the detection method of PCR-based amplification is present topmost GMO detection means.Detect although PCR method is highly sensitive dna level, often occur with various spurious results: on the one hand, the various reaction inhibiting factors that produce during DNA extraction may make PCR be false negative; On the other hand, introduce non-specific amplification in the PCR process easily, thereby make PCR be false positive.In addition, the PCR complicated operation, detection time is long, cost is high, also causes a series of problems such as quantitatively inaccurate easily.Therefore, the quick GMO detection method that develops a kind of non-PCR amplification is the target that a lot of scientists pursue.
Summary of the invention
In order to solve above-mentioned the deficiencies in the prior art part, the object of the present invention is to provide the ECL method of a kind of fast detecting GMO of the non-PCR amplification based on nano/micrometre particle amplified signal, it comprises that the target DNA fragment that comprises transgenosis characteristic sequence (as CaMV 35S promoter, NOS terminator, FMV35S promoter, NOS terminator, CaMV terminator and NptII terminator etc.) that contains in most GMO genomic DNAs is carried out enzyme to be cut; Hybridize with the screening target DNA fragment with biotinylated probe; The preparation of efficient ECL probe and hybridize with target DNA fragment; Carry out the ECL detection and whether be higher than whether contain transgene component in the threshold decision sample according to optical signal value; And according to typical curve the transgene component in the transgenosis sample is carried out contents such as quantitative test.
Purpose of the present invention is achieved through the following technical solutions: the electrochemical luminescence method based on the fast detecting transgenic product of the non-PCR amplification of nano/micrometre particle amplified signal specifically comprises the steps:
One) genomic DNA of extraction testing sample.
Two) with genetic analysis software (as Primer 5.0) restriction endonuclease sites in the transgenosis sample gene group dna sequence dna is analyzed, select two kinds of restriction enzymes that can cut out the target DNA fragment that comprises the transgenosis characteristic sequence according to analysis result, do not contain the cleavage site of these two kinds of restriction enzymes in this target DNA fragment; Successively sample gene group DNA is carried out enzyme with these two kinds of restriction enzymes and cut, obtain enzyme and cut product, enzyme is cut and is contained the target DNA fragment that comprises the transgenosis characteristic sequence in the product.
Three) with step 2) in the enzyme that obtains cut product and DNA Markers (dna molecular amount standard) carries out agarose gel electrophoresis simultaneously; Near the target DNA fragment length gel is downcut, reclaim the kit purifying, reclaim the dna fragmentation of this length with dna gel.
Four) with genetic analysis software (as Primer 5.0) according to target DNA fragment sequences Design and synthetic two sections specific DNA sequences (this specific DNA sequences only with the complementation of target DNA fragment sequence, and not with genomic DNA in other any sequence complementation): wherein, one section is the biotinylated probe sequence, is prepared into biotinylated probe; Another section is a sequence capture probe, and the reactive group that can be connected with nano/micrometre particle on one is terminal modified is prepared into efficient ECL probe.
Five) with step 4) biotinylated probe of preparation and efficient ECL probe respectively with step 3) in the enzyme that includes target DNA fragment that reclaims cut product and hybridize, control temperature 90～95 ℃, 2～10 minutes was cooled to 45～70 ℃, 20～120 minutes then; Obtain hybridizing product.
Six) with step 5) after the magnetic bead of gained hybridization product and Streptavidin bag quilt is connected in PBS damping fluid (pH7～8) or TE (pH 7～8) damping fluid, place magnetic field to clean, collect with above-mentioned damping fluid, subsequently, the magnetic bead of collecting that is connected with the hybridization product is changed in the test sample pond.
Seven) in the test sample pond, add contain can with tris (bipyridine) ruthenium (Ru (bpy)
3 2+, TBR) the ECL analytic liquid of the material of generation ECL reaction, the ECL reaction takes place in given voltage 1～1.5V, TBR and this material, produces light signal; Sensed light signal, and whether be higher than threshold value (the average light signal value of the negative control sample more than 3 adds 2.5 to 10 times standard deviation) according to optical signal value, judge and whether contain transgene component in the testing sample: show that if optical signal value is higher than threshold value this sample is the transgenosis sample, promptly contains transgene component in this sample.
The inventive method not only can be carried out above-mentioned qualitative analysis to the testing sample that contains transgene component, can also carry out quantitative test in a basic enterprising step of qualitative analysis: carry out ECL by standard model and detect, make typical curve to different transgene component mass content; Subsequently, according to typical curve to step 7) in transgene component in the transgenosis sample determined carry out quantitative test.
Described step 2) target DNA fragment that comprises the transgenosis characteristic sequence in can be the target DNA fragment that comprises characteristic sequences such as CaMV35S promoter, NOS terminator, FMV35S promoter, NOS terminator, CaMV terminator or NptII terminator.
Described step 4) efficient ECL probe is to prepare as follows in:
(1) one section oligonucleotide chain not complementary with target DNA fragment of design, the reactive group that can be connected with nano/micrometre particle on one is terminal modified, the other end are modified and are gone up amino group; The N-hydroxy-succinamide ester (TBR-NHS ester) of this oligonucleotide chain and excessive tris (bipyridine) ruthenium is hatched more than 2 hours in 10～60C lucifuge under the alkali condition, so that amino group and TBR-NHS ester carry out coupled reaction, obtain the oligonucleotide chain (TBR-oligonucleotide chain) of TBR on the mark; Subsequently, with 70%～100% (percent by volume) ethanol washing and precipitate this oligonucleotide chain; At last, with pure water or TE (pH7～8) damping fluid dissolving TBR-oligonucleotide chain;
(2) TBR-oligonucleotide chain and capture probe are with the mol ratio mixing greater than 40: 1; Subsequently, utilize the reactive group that can be connected and the nano/micrometre particle reaction of modifying on TBR-oligonucleotide chain and the capture probe with nano/micrometre particle, TBR-oligonucleotide chain and capture probe are modified the nano/micrometre particle surface, prepare efficient ECL probe (because the number of TBR-oligonucleotide chain that is connected the nano/micrometre particle surface is much larger than capture probe, therefore probe that is hunted down target DNA fragment of catching can change into a plurality of light signals).
When the target DNA fragment that comprises the transgenosis characteristic sequence is when comprising the target DNA fragment of CaMV35S promoter sequence, described two kinds of restriction enzymes can be Fok I+BsrD I; Described biotinylated probe sequence: 5 '-TGCTCCTCGTGGGTGGGGGTCCATCTT-3 ' will promptly be prepared into biotinylated probe behind its 3 ' end mark biotin; Described sequence capture probe: 5 '-GCCTTTCCTTTATCGCAATG
GCAATC-3 ', it 3 ' terminal modifiedly has a mercapto groups that can be connected with nano Au particle, wherein, and band underscore base
GCAATCFor being used to connect the part of sulfydryl, it is prepared into efficient ECL probe.
When the target DNA fragment that comprises the transgenosis characteristic sequence is when comprising the target DNA fragment of CaMV35S promoter sequence, the oligonucleotide chain not complementary in the step (1) with target DNA fragment, its sequence is: 5 '-CCAACGGTAA-3 ', at its 3 ' mercapto groups that can be connected with nano Au particle on terminal modified, 5 ' terminal modified on can with the amino group of TBR-NHS ester reaction.
Described step 4) nano/micrometre particle can be respectively nm of gold, silica bead or polystyrene bead of different-grain diameter or the like in.
Described step 4) reactive group that nano/micrometre particle connects in can be respectively mercapto groups (can be connected with nano Au particle), amino group, carboxylic group, biotin or Streptavidin or the like.
Described step 7) in can with tris (bipyridine) ruthenium produce ECL reaction material can for tripropyl amine (TPA) (tripropylamine, TPA) or the dibutyl monoethanolamine (2-(dibutylamino) ethanol, DBAE) or the like.
Described step 7) containing in can to produce the ECL analytic liquid prescription of tripropyl amine (TPA) of ECL reaction as follows: 112mM KH with tris (bipyridine) ruthenium
2PO
4, 88mM K
2HPO
43H
2O, 50 μ M NaCl, 6.5mMNaN
3, 0.8 μ M Tirton X-100,0.4mM Tween 20,100mM TPA.
Ultimate principle of the present invention is (as shown in Figure 1):
All contain transgenosis characteristic sequence (as all containing CaMV35S promoter, NOS terminator, FMV35S promoter, NOS terminator, CaMV terminator and NptII terminator etc. in most of genetically modified plants) among most GMO, can design two sections specific DNA sequences at this transgenosis characteristic sequence, and it is prepared into biotinylated probe and efficient ECL probe.The GMO genomic DNA that extracts through two kinds of suitable digestion with restriction enzyme after, can produce the target DNA fragment that comprises the transgenosis characteristic sequence (through Fok Is and BsrD I enzyme cut can produce the target DNA segment that comprises portion C aMV35S promoter sequence as most of genetically modified plants genomic DNAs).The enzyme that comprises the target DNA segment that adds biotinylated probe and efficient ECL probe and purifying, recovery is cut product hybridization, biotin is connected with the magnetic bead that is coated with Streptavidin subsequently, further by the magnetic pole selective adsorption, thereby play the effect of screening target DNA segment; Efficient ECL probe can react with TPA, thereby realizes that ECL detects; The target DNA segment of having only hybridization simultaneously to go up biotinylated probe and efficient ECL probe just can be collected in the test sample pond and be detected light signal.Whether be higher than threshold value according to optical signal value and come whether to contain in the judgement sample transgene component.Subsequently, can also carry out quantitative test to the transgene component in the transgenosis sample according to typical curve.
The present invention compared with prior art has following advantage and beneficial effect:
The present invention broken away from present GMO detect in to the dependence of PCR, thereby avoided the spurious results of problem in the round pcr, quantitatively inaccurate, complicated operation, consuming time expensive and need use a series of problems such as objectionable impurities such as radioelement or ethidium bromide when the PCR product carried out electrophoretic analysis.But advantages such as that the present invention has is easy and simple to handle, quick, safety, result are accurate, highly sensitive quantitative test are more suitable for applying in actual detected.
Description of drawings
Fig. 1 is the inventive method principle schematic;
Fig. 2 detects CaMV35S promoter figure as a result in non-transgenic soybean and the genetically engineered soybean with the inventive method among the embodiment one;
Fig. 3 is the typical curve that detects CaMV35S promoter in the genetically engineered soybean of different percentage compositions among the embodiment one with the inventive method;
Fig. 4 detects CaMV35S promoter figure as a result in non-transgenic tobacco and the transgene tobacco with the inventive method among the embodiment two;
Fig. 5 detects CaMV35S promoter figure as a result in non-transgenic papaya and the transgenic papaya with the inventive method among the embodiment three.
Embodiment
Below in conjunction with accompanying drawing the present invention is done further concrete description, but embodiments of the present invention are not limited thereto.
Said method is applied to detect genetically engineered soybean (embodiment one), transgene tobacco (embodiment two), transgenic papaya (embodiment three): all contain the CaMV35S promoter in the above-mentioned transgenosis sample, therefore, with the target DNA fragment of CaMV35S promoter characteristic sequence as detection.
Embodiment one: the inventive method is used to detect genetically engineered soybean, and concrete steps are as follows:
One) extracts the genomic DNA of non-transgenic soybean sample and genetically engineered soybean sample respectively.
Two) analyze with the restriction endonuclease sites in 5.0 pairs of genetically engineered soybean sample gene of genetic analysis software Primer group dna sequence dna, select to cut out---two kinds of restriction enzymes of the target DNA fragment of CaMV35S promoter partial sequence---Fok I and the BsrD I that comprise the transgenosis characteristic sequence according to analysis result, do not contain the cleavage site of these two kinds of restriction enzymes in this target DNA fragment; Successively sample gene group DNA is carried out enzyme with these two kinds of restriction enzymes and cut (the consumption reference reagent instructions of endonuclease reaction condition and enzyme), obtain enzyme and cut product, enzyme is cut and is contained the target DNA fragment that comprises portion C aMV35S promoter sequence in the product, and this target DNA fragment length is 169bp (being that enzyme is cut the target DNA fragment that comprises 169bp in the product).
Three) all enzymes are cut product and DNAMarkers and carried out agarose gel electrophoresis simultaneously; Near the target DNA fragment length (169bp) gel is downcut, reclaim the dna fragmentation of kit purifying, recovery 169bp with dna gel.
Four) with genetic analysis software Primer 5.0 according to target DNA fragment sequences Design and synthetic two sections specific DNA sequences (this specific DNA sequences only with the complementation of target DNA fragment sequence, and not with genomic DNA in other any sequence complementation): one section is biotinylated probe sequence: 5 '-TGCTCCTCGTGGGTGGGGGTCCATCTT-3 ', will promptly be prepared into biotinylated probe behind its 3 ' end mark biotin; Another section is sequence capture probe: 5 '-GCCTTTCCTTTATCGCAATG
GCAATC-3 ', it 3 ' terminal modifiedly has a mercapto groups that can be connected with nano Au particle (band underscore base is the part that is used to connect sulfydryl), is used to prepare efficient ECL probe.Wherein, efficient ECL probe preparation may further comprise the steps:
(1) the synthetic TBR-NHSester of list of references " Biophysical Journal 68:342-350 (1995) ";
(2) one section oligonucleotide chain not complementary of design with target DNA fragment, its sequence is: 5 '-CCAACGGTAA-3 ', at its 3 ' mercapto groups that can be connected with nano Au particle on terminal modified, 5 ' terminal modified on can with the amino group of TBR-NHS ester reaction; This oligonucleotide chain and TBR-NHSester are placed NaHCO with 1: 40 mol ratio
3In the solution (0.1M, pH 9), 37 ℃, lucifuge was hatched 8 hours, to allow amino group and TBR-NHS ester carry out coupled reaction, obtained the TBR-oligonucleotide chain; Subsequently, with the washing of 70% ethanol, this oligonucleotide chain of 100% precipitation with alcohol; At last, with pure water dissolving TBR-oligonucleotide chain;
(3) TBR-oligonucleotide chain and capture probe were with 70: 1 mol ratio mixing; Subsequently, utilize mercapto groups and nano Au particle reaction (concrete steps list of references " Nature Protocols 1 (1): 246-252 (2006) ") on TBR-oligonucleotide chain and the capture probe, TBR-oligonucleotide chain and capture probe are modified the nano Au particle surface, prepare efficient ECL probe (because the number of TBR-oligonucleotide chain that is connected the nano Au particle surface is much larger than capture probe, therefore probe that is hunted down target DNA fragment of catching can change into a plurality of light signals).
Five) with biotinylated probe and efficient ECL probe respectively with step 3) in the enzyme that includes target DNA fragment that reclaims cut product and hybridize, 95 ℃ of control temperature 5 minutes, are cooled to 55 ℃, 30 minutes then; Obtain hybridizing product.
Six) will be according to step 5) after the magnetic bead of gained hybridization product and Streptavidin bag quilt hatches in PBS damping fluid (pH 7.4) and is connected, place magnetic field to clean, collect with above-mentioned damping fluid, subsequently, the magnetic bead of collecting that is connected with the hybridization product is changed in the test sample pond.
Seven) in the test sample pond, add ECL analytic liquid (the 112mM KH that contains TPA
2PO
4, 88mM K
2HPO
43H
2O, 50 μ M NaCl, 6.5mM NaN
3, 0.8 μ M Tirton X-100,0.4mMTween 20,100mM TPA), given voltage 1.25V makes TBR and TPA that the ECL reaction take place, and produces light signal.Sensed light signal, and whether be higher than threshold value (the average light signal value of the negative control sample more than 3 (being non-transgenic soybean standard model) adds 3 times standard deviation) according to optical signal value and judge whether contain transgene component in the soybean sample: show that if optical signal value is higher than threshold value this sample is the transgenosis sample, promptly contains transgene component in this sample.
Eight) carry out ECL by soybean sample and detect, make the typical curve (see figure 2) different transgene component mass percentage content (0.1%～100%); According to typical curve to step 7) in transgene component in the transgenosis sample determined carry out quantitative test.
Fig. 2 detects CaMV35S promoter figure as a result in non-transgenic soybean and the genetically engineered soybean with the inventive method.As shown in the figure: the optical signal value of genetically engineered soybean is higher than threshold value, and the optical signal value of non-transgenic soybean is lower than threshold value, and the result can obviously distinguish genetically engineered soybean and non-transgenic soybean.
Fig. 3 is the typical curve with CaMV35S promoter in the genetically engineered soybean of the inventive method detection different quality degree (0.1%～100%).As shown in the figure, it is 0.1% transgene component that the inventive method can detect content in the soybean sample, and this detectability is lower than the restriction (1% and 5%) to gm content in the product of European Union and Japan, therefore, this method has higher sensitivity, is adapted at applying in the actual detected.In addition, this method is that the good linearity is arranged between 0.1%～100% at gm content, can carry out quantitative test to the transgene component in the soybean sample according to this typical curve.
Embodiment two: the inventive method is used to detect transgene tobacco.
One) extracts the genomic DNA of non-transgenic tobacco sample and transgene tobacco sample respectively.
Two) analyze with the restriction endonuclease sites in 5.0 pairs of transgene tobacco sample gene of genetic analysis software Primer group dna sequence dna, select to cut out---two kinds of restriction enzymes of the target DNA fragment of CaMV35S promoter partial sequence---Fok I and the BsrD I that comprise the transgenosis characteristic sequence according to analysis result, do not contain the cleavage site of these two kinds of restriction enzymes in this target DNA fragment; Successively sample gene group DNA is carried out enzyme with these two kinds of restriction enzymes and cut (the consumption reference reagent instructions of endonuclease reaction condition and enzyme), obtain enzyme and cut product, enzyme is cut and is contained the target DNA fragment that comprises portion C aMV35S promoter sequence in the product, and this target DNA fragment length is 169bp (being that enzyme is cut the target DNA fragment that contains 169bp in the product).
Three) all enzymes are cut product and DNA Markers and carried out agarose gel electrophoresis simultaneously; Near the target DNA fragment length (169bp) gel is downcut, reclaim the dna fragmentation of kit purifying, recovery 169bp with dna gel.
Four) with genetic analysis software such as Primer 5.0 according to target DNA fragment sequences Design and synthetic two sections specific DNA sequences (this specific DNA sequences only with the complementation of target DNA fragment sequence, and not with genome in other any sequence complementation): one section is biotinylated probe sequence: 5 '-TGCTCCTCGTGGGTGGGGGTCCATCTT-3 ', will promptly be prepared into biotinylated probe behind its 3 ' end mark biotin; Another section is sequence capture probe: 5 '-GCCTTTCCTTTATCGCAATG
GCAATC-3 ', it 3 ' terminal modifiedly has a mercapto groups that can be connected with nano Au particle (band underscore base is the part that is used to connect sulfydryl), is used to prepare efficient ECL probe.Wherein, efficient ECL probe preparation may further comprise the steps:
(1) the synthetic TBR-NHSester of list of references " Biophysical Journal 68:342-350 (1995) ";
(2) one section oligonucleotide chain not complementary of design with target DNA fragment, its sequence is: 5 '-CCAACGGTAA-3 ', at its 3 ' mercapto groups that can be connected with nano Au particle on terminal modified, 5 ' terminal modified on can with the amino group of TBR-NHS ester reaction; This oligonucleotide chain and TBR-NHSester are placed NaHCO with 1: 10 mol ratio
3In the solution (0.1M, pH 9), 37 ℃, lucifuge was hatched 4 hours, to allow amino group and TBR-NHS ester carry out coupled reaction, obtained the TBR-oligonucleotide chain; Subsequently, with the washing of 80% ethanol, this oligonucleotide chain of 95% precipitation with alcohol; At last, with pure water dissolving TBR-oligonucleotide chain;
(3) TBR-oligonucleotide chain and capture probe were with 100: 1 mol ratio mixing; Subsequently, utilize mercapto groups and nano Au particle reaction (concrete steps list of references " Nature Protocols 1 (1): 246-252 (2006) ") on TBR-oligonucleotide chain and the capture probe, TBR-oligonucleotide chain and capture probe are modified the nano Au particle surface, prepare efficient ECL probe (because the number of TBR-oligonucleotide chain that is connected the nano Au particle surface is much larger than capture probe, therefore probe that is hunted down target DNA fragment of catching can change into a plurality of light signals).
Five) with biotinylated probe and efficient ECL probe respectively with step 3) in the enzyme that includes target DNA fragment that reclaims cut product and hybridize, control temperature 90 ℃, 10 minutes was cooled to 45 ℃, 120 minutes then; Obtain hybridizing product.
Six) will be according to step 5) after the magnetic bead of gained hybridization product and Streptavidin bag quilt hatches in TE (pH7～8) damping fluid and is connected, place magnetic field to clean, collect with above-mentioned damping fluid, subsequently, the magnetic bead of collecting that is connected with the hybridization product is changed in the test sample pond.
Seven) in the test sample pond, add ECL analytic liquid (the 112mM KH that contains TPA
2PO
4, 88mM K
2HPO
43H
2O, 50 μ M NaCl, 6.5mM NaN
3, 0.8 μ M Tirton X-100,0.4mMTween 20,100mM TPA), given voltage 1.25V makes TBR and TPA that the ECL reaction take place, and produces light signal.Sensed light signal, and whether be higher than threshold value (the average light signal value of the negative control sample more than 3 (being non-transgenic tobacco standard model) adds 3 times standard deviation) according to optical signal value and judge whether contain transgene component in the tobacco sample: show that if optical signal value is higher than threshold value this sample is the transgenosis sample, promptly contains transgene component in this sample.
Fig. 4 detects CaMV35S promoter figure as a result in non-transgenic tobacco and the transgene tobacco with the inventive method.As shown in the figure: the optical signal value of transgene tobacco is higher than threshold value, and the optical signal value of non-transgenic tobacco is lower than threshold value, and the result can obviously distinguish transgene tobacco and non-transgenic tobacco.
Embodiment three: the inventive method is used to detect transgenic papaya.
One) extracts the genomic DNA of non-transgenic papaya sample and transgenic papaya sample respectively.
Two) analyze with the restriction endonuclease sites in 5.0 pairs of transgenic papaya sample gene of genetic analysis software Primer group dna sequence dna, select to cut out---two kinds of restriction enzymes of the target DNA fragment of CaMV35S promoter partial sequence---Fok I and the BsrD I that comprise the transgenosis characteristic sequence according to analysis result, do not contain the cleavage site of these two kinds of restriction enzymes in this target DNA fragment; Successively sample gene group DNA is carried out enzyme with these two kinds of restriction enzymes and cut (the consumption reference reagent instructions of endonuclease reaction condition and enzyme), obtain enzyme and cut product, enzyme is cut the target DNA fragment that comprises portion C aMV35S promoter sequence in the product, and this target DNA fragment length is 169bp (being that enzyme is cut the target DNA fragment that comprises 169bp in the product).
Three) all enzymes after will comprising all enzymes and cutting are cut product and DNA Markers carries out agarose gel electrophoresis simultaneously.Near the target DNA fragment length (169bp) gel is downcut, reclaim the dna fragmentation of kit purifying, recovery 169bp with dna gel.
Four) with genetic analysis software such as Primer 5.0 according to target DNA fragment sequences Design and synthetic two sections specific DNA sequences (this specific DNA sequences only with the complementation of target DNA fragment sequence, and not with genome in other any sequence complementation): one section is biotinylated probe sequence: 5 '-TGCTCCTCGTGGGTGGGGGTCCATCTT-3 ', will promptly be prepared into biotinylated probe behind its 3 ' end mark biotin; Another section is sequence capture probe: 5 '-GCCTTTCCTTTATCGCAATG
GCAATC-3 ', it 3 ' terminal modifiedly has a mercapto groups that can be connected with nano Au particle (band underscore base is the part that is used to connect sulfydryl), is used to prepare efficient ECL probe.Wherein, efficient ECL probe preparation may further comprise the steps:
(1) one section oligonucleotide chain not complementary of design with target DNA fragment, its sequence is: 5 '-CCAACGGTAA-3 ', at its 3 ' mercapto groups that can be connected with nano Au particle on terminal modified, 5 ' terminal modified on can with the amino group of TBR-NHS ester reaction; This oligonucleotide chain and TBR-NHSester are placed NaHCO with 1: 30 mol ratio
3In the solution (0.1M, pH 9), 37 ℃, lucifuge was hatched 8 hours, to allow amino group and TBR-NHS ester carry out coupled reaction, obtained the TBR-oligonucleotide chain; Subsequently, with the washing of 70% ethanol, this oligonucleotide chain of 100% precipitation with alcohol; At last, with pure water dissolving TBR-oligonucleotide chain;
(2) TBR-oligonucleotide chain and capture probe were with 120: 1 mol ratio mixing; Subsequently, utilize mercapto groups and nano Au particle reaction on TBR-oligonucleotide chain and the capture probe, TBR-oligonucleotide chain and capture probe are modified the nano Au particle surface, thereby prepare efficient ECL probe (because the number of TBR-oligonucleotide chain that is connected the nano Au particle surface is much larger than capture probe, therefore probe that is hunted down target DNA fragment of catching can change into a plurality of light signals).
Five) with biotinylated probe and efficient ECL probe respectively with step 3) in the enzyme that includes target DNA fragment that reclaims cut product and hybridize, control temperature 95 ℃, 2 minutes was cooled to 60 ℃, 20 minutes then; Obtain hybridizing product.
Six) will be according to step 5) after the magnetic bead of gained hybridization product and Streptavidin bag quilt hatches in PBS damping fluid (pH 7～8) and is connected, place magnetic field to clean, collect with above-mentioned damping fluid, subsequently, the magnetic bead of collecting that is connected with the hybridization product is changed in the test sample pond.
Seven) in the test sample pond, add ECL analytic liquid (the 112mM KH that contains TPA
2PO
4, 88mM K
2HPO
43H
2O, 50 μ M NaCl, 6.5mM NaN
3, 0.8 μ M Tirton X-100,0.4mMTween 20,100mM TPA), given voltage 1.25V makes TBR and TPA that the ECL reaction take place, and produces light signal.Sensed light signal, and whether be higher than threshold value (the average light signal value of the negative control sample more than 3 (being non-transgenic papaya standard model) adds 3 times standard deviation) according to optical signal value and judge whether contain transgene component in the papaya sample: show that if optical signal value is higher than threshold value this sample is the transgenosis sample, promptly contains transgene component in this sample.
Fig. 5 detects CaMV35S promoter figure as a result in non-transgenic papaya and the transgenic papaya with the inventive method.As shown in the figure: the optical signal value of transgenic papaya is higher than threshold value, and the optical signal value of non-transgenic papaya is lower than threshold value, and the result can obviously distinguish transgenic papaya and non-transgenic papaya.
The foregoing description is a preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
SEQUENCE?LISTING
Claims (10)
1, a kind of electrochemical luminescence method of fast detecting transgenic product of the non-PCR amplification based on nano/micrometre particle amplified signal is characterized in that comprising the steps:
One) genomic DNA of extraction testing sample;
Two) with genetic analysis software the restriction endonuclease sites in the transgenosis sample gene group dna sequence dna is analyzed, select two kinds of restriction enzymes that can cut out the target DNA fragment that comprises the transgenosis characteristic sequence according to analysis result, do not contain the cleavage site of these two kinds of restriction enzymes in this target DNA fragment; Successively sample gene group DNA is carried out enzyme with these two kinds of restriction enzymes and cut, obtain enzyme and cut product, enzyme is cut and is contained the target DNA fragment that comprises the transgenosis characteristic sequence in the product;
Three) with step 2) in the enzyme that obtains cut product and DNA Markers carries out agarose gel electrophoresis simultaneously; Near the target DNA fragment length gel is downcut, reclaim the kit purifying, reclaim the dna fragmentation of this length with dna gel;
Four) also synthesize two sections specific DNA sequences with genetic analysis software according to the target DNA fragment sequences Design, described specific DNA sequences only with the complementation of target DNA fragment sequence, and not with genome in other any sequence complementation: wherein, one section is the biotinylated probe sequence, is prepared into biotinylated probe; Another section is a sequence capture probe, and the terminal modified reactive group that is connected with nano/micrometre particle of going up of one is prepared into the high-efficiency electrochemical luminescence probe;
Five) with step 4) biotinylated probe of preparation and high-efficiency electrochemical luminescence probe respectively with step 3) in the enzyme that includes target DNA fragment that reclaims cut product and hybridize, control temperature 90～95 ℃, 2～10 minutes was cooled to 45～70 ℃, 20～120 minutes then; Obtain hybridizing product;
Six) with step 5) after the magnetic bead of gained hybridization product and Streptavidin bag quilt hatches in the TE damping fluid of the PBS of pH 7～8 damping fluid or pH 7～8 and is connected, place magnetic field to clean, collect with above-mentioned damping fluid, subsequently, the magnetic bead of collecting that is connected with the hybridization product is changed in the test sample pond;
Seven) add in the test sample pond that to contain to be the electrochemiluminescence analysis liquid that TBR produces the material of electrochemiluminescence reaction with tris (bipyridine) ruthenium, given voltage 1～1.5V, TBR and the reaction of this material generation electrochemiluminescence, generation light signal; Sensed light signal, and whether be higher than threshold value according to optical signal value, judge whether contain transgene component in the testing sample: show that if optical signal value is higher than threshold value this sample is the transgenosis sample, promptly contains transgene component in this sample.
2, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1, it is characterized in that: in judgement contains the testing sample of transgene component, carry out following quantitative test: carry out electrochemiluminescence by standard model and detect, make typical curve different transgene component mass content; Subsequently, can be according to typical curve to step 7) in transgene component in the transgenosis sample determined carry out quantitative test.
3, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1, it is characterized in that: the target DNA fragment that comprises the transgenosis characteristic sequence described step 2) is the target DNA fragment that comprises CaMV35S promoter, NOS terminator, FMV35S promoter, NOS terminator, CaMV terminator or NptII terminator characteristic sequence.
4, according to the electrochemical luminescence method of the fast detecting transgenic product of claim 1 or 2 or 3 described a kind of non-PCR amplifications based on nano/micrometre particle amplified signal, it is characterized in that: the high-efficiency electrochemical luminescence probe is to prepare as follows described step 4):
(1) one section oligonucleotide chain not complementary with target DNA fragment of design, the reactive group that can be connected with nano/micrometre particle on one is terminal modified, the other end are modified and are gone up amino group; With the N-hydroxy-succinamide ester of this oligonucleotide chain and excessive tris (bipyridine) ruthenium is that TBR-NHS ester is hatched more than 2 hours in 10～60 ℃ of lucifuges under the alkali condition, make amino group and TBR-NHS ester carry out coupled reaction, obtain the TBR-oligonucleotide chain; Subsequently, with 70%～100% ethanol washing and precipitate this oligonucleotide chain; At last, the TE damping fluid with pure water or pH 7～8 dissolves the TBR-oligonucleotide chain;
(2) TBR-oligonucleotide chain and capture probe are with the mol ratio mixing greater than 40: 1; Subsequently, utilize reactive group that can be connected and nano/micrometre particle reaction on TBR-oligonucleotide chain and the capture probe with nano/micrometre particle, TBR-oligonucleotide chain and capture probe are modified the nano/micrometre particle surface, prepare the high-efficiency electrochemical luminescence probe.
5, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 3, it is characterized in that: when the target DNA fragment that comprises the transgenosis characteristic sequence is when comprising the target DNA fragment of CaMV35S promoter sequence, described two kinds of restriction enzymes are Fok I+BsrD I;
Described biotinylated probe sequence: 5 '-TGCTCCTCGTGGGTGGGGGTCCATCTT-3 ' will promptly be prepared into biotinylated probe behind its 3 ' end mark biotin;
Described sequence capture probe: 5 ' GCCTTTCCTTTATCGCAATG
GCAATC-3 ', it 3 ' terminal modifiedly has a mercapto groups that is connected with nano Au particle, wherein, and band underscore base
GCAATCFor being used to connect the part of sulfydryl, it is prepared into the high-efficiency electrochemical luminescence probe.
6, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 4, it is characterized in that: when the target DNA fragment that comprises the transgenosis characteristic sequence is when comprising the target DNA fragment of CaMV35S promoter sequence, the oligonucleotide chain not complementary in the step (1) with target DNA fragment, its sequence is: 5 '-CCAACGGTAA-3 ', at its 3 ' the terminal modified mercapto groups is connected with nano Au particle of going up, 5 ' terminal modified last and the amino group that TBR-NHS ester reacts.
7, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1 is characterized in that: nano/micrometre particle is nm of gold, silica bead or polystyrene bead described step 4).
8, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1 is characterized in that: the reactive group that nano/micrometre particle connects described step 4) is mercapto groups, amino group, carboxylic group, biotin or Streptavidin.
9, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1 is characterized in that: the material that can produce the electrochemiluminescence reaction with tris (bipyridine) ruthenium described step 7) is tripropyl amine (TPA) or dibutyl monoethanolamine.
10, the electrochemical luminescence method of the fast detecting transgenic product of a kind of non-PCR amplification based on nano/micrometre particle amplified signal according to claim 1, it is characterized in that: contain described step 7) in the time of can being tripropyl amine (TPA) with the material that tris (bipyridine) ruthenium produces electrochemiluminescence reaction, the electrochemiluminescence analysis formula of liquid of tripropyl amine (TPA) is as follows: 112mM KH
2PO
4, 88mM K
2HPO
43H
2O, 50 μ M NaCl, 6.5mMNaN
3, 0.8 μ M Tirton X-100,0.4mM Tween 20,100mM tripropyl amine (TPA).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100268039A CN101246125A (en) | 2008-03-14 | 2008-03-14 | Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100268039A CN101246125A (en) | 2008-03-14 | 2008-03-14 | Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101246125A true CN101246125A (en) | 2008-08-20 |
Family
ID=39946702
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100268039A Pending CN101246125A (en) | 2008-03-14 | 2008-03-14 | Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101246125A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101760527A (en) * | 2008-12-26 | 2010-06-30 | 上海透景生命科技有限公司 | PCR amplification-free and detecting instrument-free nucleic acid analysis method |
| WO2012122929A1 (en) * | 2011-03-16 | 2012-09-20 | 北京联众泰克科技有限公司 | Electrochemiluminescence immunoassay method |
| CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
| CN103443626A (en) * | 2011-02-15 | 2013-12-11 | 协和梅迪克斯株式会社 | Streptavidin-bonded magnetic particles and manufacturing method for same |
| CN103443614A (en) * | 2010-10-25 | 2013-12-11 | 霍夫曼-拉罗奇有限公司 | Use of signal enhancing compounds in electrochemiluminescence detection |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
| CN106701984A (en) * | 2017-02-07 | 2017-05-24 | 华南师范大学 | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal |
| CN107058585A (en) * | 2017-06-07 | 2017-08-18 | 浙江殷欣生物技术有限公司 | A kind of detection method of nucleic acid hybridization |
-
2008
- 2008-03-14 CN CNA2008100268039A patent/CN101246125A/en active Pending
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101760527B (en) * | 2008-12-26 | 2014-04-16 | 上海透景生命科技有限公司 | PCR amplification-free and detecting instrument-free nucleic acid analysis method |
| CN101760527A (en) * | 2008-12-26 | 2010-06-30 | 上海透景生命科技有限公司 | PCR amplification-free and detecting instrument-free nucleic acid analysis method |
| US9341575B2 (en) | 2010-10-25 | 2016-05-17 | Roche Diagnostics Operations, Inc. | Use of signal enhancing compounds in electrochemiluminescence detection |
| CN103443614B (en) * | 2010-10-25 | 2015-07-22 | 霍夫曼-拉罗奇有限公司 | Use of signal enhancing compounds in electrochemiluminescence detection |
| CN103443614A (en) * | 2010-10-25 | 2013-12-11 | 霍夫曼-拉罗奇有限公司 | Use of signal enhancing compounds in electrochemiluminescence detection |
| CN103443626A (en) * | 2011-02-15 | 2013-12-11 | 协和梅迪克斯株式会社 | Streptavidin-bonded magnetic particles and manufacturing method for same |
| WO2012122929A1 (en) * | 2011-03-16 | 2012-09-20 | 北京联众泰克科技有限公司 | Electrochemiluminescence immunoassay method |
| US10024861B2 (en) | 2011-03-16 | 2018-07-17 | Beijing Unidiag Technology Inc | Electrochemiluminescence immunoassay method |
| CN103383355A (en) * | 2013-07-12 | 2013-11-06 | 华南师范大学 | MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles |
| CN103383355B (en) * | 2013-07-12 | 2015-09-30 | 华南师范大学 | Based on the MicroRNA detection method of non-enzymatic amplification and electrochemiluminescence principle |
| CN104450920A (en) * | 2014-12-11 | 2015-03-25 | 华南师范大学 | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle |
| CN104450920B (en) * | 2014-12-11 | 2016-09-21 | 华南师范大学 | MicroRNA trace detection method based on exponential non-enzymatic amplification and electrochemiluminescence principle |
| CN106701984A (en) * | 2017-02-07 | 2017-05-24 | 华南师范大学 | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal |
| CN107058585A (en) * | 2017-06-07 | 2017-08-18 | 浙江殷欣生物技术有限公司 | A kind of detection method of nucleic acid hybridization |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101246125A (en) | Nano/micrometre particle amplified signal-based non-PCR amplification electrochemical luminescence method for fast detecting transgene product | |
| Robbins et al. | A comparative genomics approach identifies a PPR-DYW protein that is essential for C-to-U editing of the Arabidopsis chloroplast accD transcript | |
| US20110015084A1 (en) | Methods for Identifying Genetic Linkage | |
| CN107574226B (en) | Gene detection probe and gene detection method | |
| CN101260431A (en) | Method for detecting transgene species based on rolling ring amplification technique | |
| Sánchez-Paniagua López et al. | Biosensors for GMO testing: nearly 25 years of research | |
| Takenaka et al. | RNA editing in plant mitochondria: assays and biochemical approaches | |
| CN101078028B (en) | Twice bio-bar-code nucleic acid detecting technique | |
| KR101291609B1 (en) | Chloroplast CAPS marker for discriminating Porphyra species | |
| CN112458198B (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof | |
| Chaisomchit et al. | A simple method for extraction and purification of genomic DNA from dried blood spots on filter paper | |
| CN108411030A (en) | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 | |
| JP4755974B2 (en) | Method for producing DNA fragment by selective fragmentation of nucleic acid and its application | |
| CN113774165A (en) | HBV genotyping detection method and kit | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN112592997A (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application | |
| CN103882128A (en) | Method for signal amplification and detection on target deoxyribonucleic acid (DNA) sequence at normal temperature | |
| KR102393484B1 (en) | Molecular marker based on nuclear genome sequence for discriminating genotype of Peucedanum japonicum resources and uses thereof | |
| CN100569955C (en) | Method for detecting transgene through probe of multielement genes and device thereof | |
| CN109161606B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi9 | |
| CN106906280B (en) | Glucocerebrosidase gene detection kit and detection method thereof | |
| CN111560458A (en) | Molecular marker primer for rapidly and efficiently identifying rice phytochrome gene PHYB and application thereof | |
| CN110438212B (en) | Enzyme digestion PCR kit and method for enrichment detection of specific gene fragment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080820 |