CN101245101A

CN101245101A - Antihuman CD146 monoclone antibody, composition containing the same, and method for testing dissolubility CD146

Info

Publication number: CN101245101A
Application number: CNA2008100572607A
Authority: CN
Inventors: 阎锡蕴; 张莹; 郑超固; 杨东玲; 冯静; 卢迪
Original assignee: Institute of Biophysics of CAS
Current assignee: Institute of Biophysics of CAS
Priority date: 2008-01-31
Filing date: 2008-01-31
Publication date: 2008-08-20
Anticipated expiration: 2028-01-31
Also published as: CN101245101B

Abstract

The invention relates to a group of anti-human CD146 molecules which are developed by utilizing the biological technology and an established high-sensitive sandwich ELISA method for detecting the solubility CD146. The invention includes anti-human CD146 mouse monoclonal antibodies of AA1, AA2, AA3, AA4, AA5 and AA7, and the method of utilizing the combination of the antibodies and the sandwich ELISA specificity for detecting the solubility CD146. The group of antibodies can identify the human source CD146 on the molecular, the cellular and the tissue levels, which can be divided into two categories based on the identified different epitopes. The sandwich ELISA method which is combined by the antibody AA1 and another strain of anti-human CD146 mouse monoclonal antibody AA98 can detect the solubility CD146 at each milliliter nano-gram level. The antibodies and the detection means can become the effective detection or diagnosis tools and method in the basic research or the clinical application and provide good carriers for the targeted therapy of the CD146-related diseases at the same time.

Description

The monoclonal antibody of anti-people CD146 comprises its composition, detects the method for soluble cd 14 6

Technical field

The invention belongs to molecular biology and biological technical field.Specifically the present invention relates to the mouse monoclonal antibody of one group of anti-people CD146, this group antibody can and be organized horizontal specific recognition people source CD146 albumen at biochemistry, cell.The invention still further relates to a kind of method of sandwich ELISA detection soluble cd 14 6, capture antibody is the mouse monoclonal antibody that relates among the present invention in this detection method, and detecting antibody is the mouse monoclonal antibody AA98 that relates to among the biotin labeled patent of invention ZL 991075862.

Background technology

CD146 has another name called MUC18, and Mel-CAM/MCAM is a kind of cell adhesion molecule of contactin.CD146 born of the same parents have five immunoglobulin like domain (V-V-C2-C2-C2) (HolnessandSimmons 1994) outward, and by high glycosylation, the iuntercellular of the non-dependence of mediation calcium ion sticks mutually.

CD146 finds it is melanomatous marker molecule the earliest, participates in melanomatous transfer and deterioration (Lehmann, Riethmuller et al.1989; Sers, Kirsch et al.1993).The unusual high expression level of CD146 in the melanochrome tumour strengthened sticking between the tumour cell, and for the invasion and attack of tumour with shift extremely important (Johnson, Rothbacher et al.1993).Studies show that the expression of CD146 is directly related with the transfer ability of melanoma cell, and overexpression CD146 can significantly strengthen invasion by tumor cells and transfer ability (Bani, Rak etal.1996 in the melanoma cell of not expressing CD146; Shih, Speicher et al.1997; Xie, Luca et al.1997).In addition, CD146 also is expressed in a spot of healthy tissues, such as unstriated muscle, (Shih 1999) such as blood vessel endothelium and trophoderms.

Simultaneously, CD146 also is widely regarded as specificity marker molecule (Bardin, the Frances et al.1996 of vascular endothelial cell; Bardin, Anfosso et al.2001).In research before, anti-people CD146 antibody is employed circulation endothelium cell (George, the Poncelet et al.1991 that detects in the blood; Bardin, George et al.1996; Solovey, Gui et al.2001).Because this feature, in some disease with endothelial injury, obscission, CD146 can be used as the reference index of disease process.Other there are some researches show that the CD146 molecule also is expressed in monocyte, and being reported in also has high expression level (Pickl, Majdic et al.1997) on the activated T lymphocyte.As other a lot of adhesion molecules, (soluble CD146 sCD146) exists (Neidhart, Wehrli et al.1999 to the CD146 molecule with cytolemma and soluble form in the body; Bardin, Moal et al.2003).Studies show that sCD146 in the expression of serum level of rheumatic arthritis synovia and patients with chronic renal failure apparently higher than the normal people.

Anti-people CD146 antibody has embodied the result of treatment of very strong inhibition tumor growth in experimentation on animals.The anti-CD146 human antibody of Mills etc. exploitation, ABX-MA1 suppress melanochrome growth of tumor, invasion and attack and significantly to the transfer (Mills, Tellez et al.2002) of lung in nude mice model.Described in the patent of invention ZL 991075862, the anti-CD146 mouse monoclonal antibody AA98 of exploitation has the effect that suppresses tumor-blood-vessel growth, and the obviously growth (Yan, Lin et al.2003) of inhibition tumour (for example liver cancer, carcinoma of the pancreas etc.) in multiple nude mice lotus knurl experiment.The mechanism that further research has also disclosed the inhibition tumor-blood-vessel growth of AA98 realizes (Bu, Gao et al.2006) by suppressing MAPK phosphorylation and NF kB activation.

Though organizing different blood vessel endotheliums, the more existing reports of the antibody of anti-people source CD146, these antibody but have different combinations active.For example S-endol can comprise (George, Poncelet et al.1991) such as artery, arteriole, vein, Venule, capillary vessel, high endothelium venule and lymph vessels systems in conjunction with the endotheliocyte of various types of blood vessels.And the anti-CD146 antibody of another strain MUC18 is only in conjunction with capillary vessel and high endothelium venule (Kuzu, Bicknell et al.1993).S-endol MUC18 debond (Bardin, Frances et al.1996) in conjunction with the umbilical vein endothelial tissue.In addition, P1H12 can be simultaneously in conjunction with the vascular endothelial cell (StCroix, Rago et al.2000) of tumour and healthy tissues, and the specific vascular endothelial cell of AA98 (Yan, Lin et al.2003) in conjunction with tumor tissues.These evidences show, different probably antibodies epi-positions is in different tissues and the exposure situation in microenvironment difference to some extent.Therefore,, and study its binding ability for different tissues at different epi-position exploitation antibody on the CD146 albumen, very necessary for illustrating the function of CD146 on vascular endothelial cell.

Summary of the invention

The present invention utilizes the CD146 protein immunization mouse of natural purifying, obtains hybridoma.Method with ELISA is screened the antibody that strong binding ability is arranged with recombinant expressed CD146 protein extracellular, obtain six strain antibodies, difference called after AA1, AA2, AA3, AA4, AA5 and AA7, obtain the hybridoma of these antibody of secretion simultaneously, be successively 8E8,8F4, A5, G10, H5 1. with H5 2..This six strain antibody all belongs to IgG1, the κ hypotype.The experiment confirm of ELISA and immunoblotting the specificity combination of these antibody and CD146 molecule.

Utilize the outer different structural domain of recombinant expressed CD146 albumen born of the same parents and the method for immunoblotting, confirm that AA1 and AA2 identification epi-position (sequence is the position 24-128 in the people CD146 sequence of SEQ ID NO:1) is positioned at first IgV structural domain, and AA3, AA4, AA5 and AA7 identification epi-position (sequence is the position 335-400 in the people CD146 sequence of SEQ ID NO:1) are positioned at second IgC2 structural domain.Therefore, this six strain antibody is divided into two classes according to different epitopes: V1 class (comprising AA1 and AA2) and C2-2 class (comprising AA3, AA4, AA5 and AA7).

Cellular immunofluorescence, immunoprecipitation and immunohistochemical experiment discovery V1 antibody-like can and organize level to discern the CD146 protein of native conformation and sex change simultaneously at molecule, cell, and the C2-2 antibody-like is only discerned the CD146 protein of sex change.This has confirmed that the exposure of different epitopes under different situations is different.

The present invention utilizes the V1 antibody-like simultaneously, as the mouse monoclonal antibody AA98 that relates among AA1 and the biotin labeled patent of invention ZL991075862, has developed the method for the sandwich ELISA of a cover, is used for detecting solution and body fluid soluble cd 14 6 molecules.Commercialization detection method report (the CyQuant ELISA assay kit that provides before comparing, Bioxytex, Marseille, double antibodies sandwich ELISA France) (sensitivity is 10ng/ml), sandwich ELISA method sensitivity of the present invention has improved an order of magnitude, reaches 1ng/ml.This method can be used in the detection of soluble cd 14 6 in human blood and the cerebrospinal fluid, and has clinical diagnostic applications value in the illness of CD146 abnormal expression.Method among utilization the present invention finds that the CD146 molecule content among the patients serum significantly raises, and has directive significance and using value for clinical diagnosis in autoimmune diseases such as systemic vasculitis.

Particularly, the present invention relates to a kind of people CD146 epitope, its aminoacid sequence is shown in SEQ IDNO:24 or the SEQ ID NO:25.

In one embodiment, the present invention relates to a kind of anti-people CD146 antibody, it is characterized in that it can the above-mentioned people CD146 of specific recognition epitope.

Preferably, described anti-people CD146 antibody is characterised in that and comprises heavy chain of antibody and light chain of antibody, wherein said heavy chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:26 of CDR, CDR2 that is made up of the aminoacid sequence of SEQ ID NO:27 and the CDR3 that is made up of the aminoacid sequence of SEQID NO:28 form

Described light chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:29 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:30 and the CDR3 that is made up of the aminoacid sequence of SEQ IDNO:31 form.

More preferably, the heavy chain of described antibody is made up of the aminoacid sequence of SEQ ID NO:32, and light chain is made up of the aminoacid sequence of SEQ ID NO:33.

In another embodiment, the present invention relates to a kind of anti-people CD146 antibody, be characterised in that to comprise heavy chain of antibody and light chain of antibody,

Wherein said heavy chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:34 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:35 and the CDR3 that is made up of the aminoacid sequence of SEQID NO:36 form,

Described light chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:37 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:38 and the CDR3 that is made up of the aminoacid sequence of SEQ IDNO:39 form.

Preferably, the heavy chain of described antibody is made up of the aminoacid sequence of SEQ ID NO:40, and light chain is made up of the aminoacid sequence of SEQ ID NO:41.

In another aspect of this invention, the antibody that also relates to above-mentioned anti-people CD146 is used for the treatment of application in the pharmaceutical composition of tumour in preparation.Preferably, described tumour is melanoma, liver cancer, carcinoma of the pancreas.

In another aspect of the present invention, the antibody that also relates to above-mentioned anti-people CD146 is used for the application of diagnostic reagent of imaging level diagnosis of the human tumor of target CD146 in preparation.

In yet another aspect, the invention still further relates to a kind of composition, for example be used for the treatment of the pharmaceutical composition of tumour, it comprises the anti-people CD146 antibody of above-mentioned either side, and pharmaceutical carrier.

When being used for this paper, " pharmaceutical carrier " comprise any He all solvents, dispersion medium, Drug coating, antibacterial agent and anti-mycotic agent that physiology is fit to, etc. blend absorption and delay reagent etc.Preferably, described carrier is suitable for the using of intravenous, intramuscular, subcutaneous, parenteral, backbone or epidermis (for example, by injection or inculcate).

Can use composition of the present invention by many methods known in the art.As it will be understood by those skilled in the art that using path and/or pattern will depend on required result and change.

Use The compounds of this invention in order to use the path, wrap combined thing with a kind of material by some, or with the common administered compound of a kind of material may be essential to prevent its inactivation.For example, can be with suitable carrier, for example liposome or thinner come to use described compound to the experimenter.Medicinal diluent comprises salt solution and aqueous buffer.

Pharmaceutical carrier comprises the Injectable solution that is used for instant preparation sterilization or sterile water solution or the dispersion and the sterile powder of dispersion.It is known in the art that these media and reagent are used for being applied as of active medicinal matter.

When being used for this paper, phrase " parenteral using " and " through parenteral administration " expression except that intestines in topical application the common mode of administration of injecting passed through, including, but not limited to, under in intravenous, intramuscular, endarterial, the sheath, in the capsule, the socket of the eye, intracardiac, intracutaneous, endoperitoneal, transtracheal, subcutaneous, subepidermal, IA, the capsule, subarachnoid, intravertebral, peridural, intrasternal injection and inculcating.

Which kind of no matter selects use the path,, can be mixed with pharmaceutically acceptable formulation with the compound of the present invention that suitable hydrated form and/or pharmaceutical compositions of the present invention are used by being ordinary method well known by persons skilled in the art.

For particular patient, composition and method of application, the actual dose level of active ingredient in pharmaceutical of the present invention can not change with the therapeutic response that obtains effectively to realize ideal can have the amount of toxic activeconstituents to the patient.Selected dosage level will depend on many pharmacokinetics factors, it comprises the activity of used particular composition of the present invention, the path of using, the time of using, the excretion rate of used specific compound, the time length of treatment, the other medicines, compound and/or the material that are used in combination with used specific compound, patient's age to be treated, sex, body weight, disease condition, general health and former history of disease and the well-known similar factor of medical field.

Described composition must be aseptic and fluidic, to arrive the degree that composition can transmit by syringe.Except water, carrier is the isotonic buffer salts solution preferably.

In yet another aspect, the invention still further relates to the hybridoma cell strain of the anti-people CD146 antibody of secretion, preserving number is respectively CGMCC NO:2310 and CGMCC NO:2311.

In yet another aspect, the invention still further relates to the nucleic acid of the polypeptide that coding can assemble with each the other antibody chain that defines below, wherein said polypeptide is any of following polypeptide

A) heavy chain of antibody, it is one of above-mentioned defined heavy chain of antibody;

B) light chain of antibody, it is one of above-mentioned defined light chain of antibody.

Simultaneously, the invention still further relates to the expression of nucleic acids carrier that comprises according to claim 11, it can express described nucleic acid in protokaryon or eukaryotic host cell.And the protokaryon or the eukaryotic host cell that comprise described expression vector.

In another aspect of the present invention, also relate to the method for a kind of preparation in conjunction with the antibody of people CD146, it is characterized in that in protokaryon or eukaryotic host cell, expressing the nucleic acid of above-mentioned encoding antibody heavy chain and the nucleic acid of encoding antibody light chain, and from described cell, reclaim described polypeptide.

In another aspect of the present invention, relate to the method for a kind of people of detection CD146, it utilizes above-mentioned anti-people CD146 antibody, is undertaken by enzyme-linked immunosorbent assay.Preferably, described enzyme-linked immunosorbent assay is sandwich enzyme-linked immunoabsorption, wherein with one or more of above-mentioned anti-people CD146 antibody as capture antibody, with the mouse monoclonal antibody AA98 among the Chinese patent ZL 991075862 as detecting antibody.More preferably, described people CD146 is present in the body fluid.Even more preferably, described body fluid is tissue juice, serum, lymph liquid or cerebrospinal fluid.Described body fluid can pick up from autoimmune disorder patients such as systemic vasculitis, systemic lupus erythematous, multiple sclerosis and Guillain Barre syndrome or/and the patient of illnesss such as chronic kidney hypofunction.

In another aspect of the present invention, the derivative that also relates to the antibody of described anti-people CD146, wherein said derivative be described antibody and biomarker (as nano materials such as conventional fluorescence dye such as vitamin H, HRP, alkaline phosphatase, FITC, PE, Cy3, Cy5, nanometer magnetic beads), antitumor drug (carboplatin as be known in the art, cis-platinum, five Fluracils etc.), toxin (as Ricin, lymphotoxin etc.), radioactivity agent (as ¹³¹Iodine, ⁹⁰Yttrium, radioactivity copper etc.) the bonded product.

Those of ordinary skill in the art in conjunction with the knowledge of prior art, can obtain said derivative based on the instruction of specification sheets about anti-people CD146 antibody fully without difficulty, and then the effect of definite derivative.

Innovative point of the present invention is: (1) has developed one group at the proteic mouse monoclonal antibody of people CD146; (2) disclosed this and organized the epitope of anti-CD146 antibody recognition, and confirmed to discern the antibody of different epi-positions, at molecule, cell and organize on the level for the proteic marked difference that is combined with of CD146; (3) developed the detection that a kind of highly sensitive sandwich ELISA method is used for soluble cd 14 6 molecules.

Description of drawings

Fig. 1: AA1-AA7 specific recognition recombination human source CD146 molecule extracellular region section albumen.

Fig. 2: the outer recombinant protein synoptic diagram of various CD146 born of the same parents.

The epitope of Fig. 3: AA1-AA5 and AA7 is identified.Last figure is the protein electrophoresis figure of D1-D5.Figure below is to utilize AA1-AA5 and AA7 to carry out the binding ability that immunoblot experiment detects itself and D1-D5 respectively.

Fig. 4: AA1-AA5 and AA7 discern reduction and non-reduced CD146 albumen in immunoblotting.Swimming lane 1-6 is non-reducing A375 cell pyrolysis liquid, and swimming lane 7-12 is a reductive A375 cell pyrolysis liquid.

Fig. 5: AA1-AA5 and AA7 are used for the CD146 Molecular Detection of flow cytometry.MIgG is as negative control among the figure.Has only the CD146 molecule in AA1 and the AA2 identification viable cell.

Fig. 6: AA1-AA5 and AA7 are used for the cellular immunofluorescence experiment and detect CD146 on the cytolemma.AA98 is as the positive control of experiment, and mIgG is as the negative control of experiment.Have only AA1 and AA2 and the AA98 can be in conjunction with CD146 on the cytolemma, arrow only shows one of them.

Fig. 7: AA1-AA5 and AA7 are used for the CD146 that immunoprecipitation experiment is caught cell pyrolysis liquid.Swimming lane 1-7 uses mIgG respectively, and AA1-5 and AA7 carry out the albumen composition that immunoprecipitation is caught, and swimming lane 8 is lysis supernatants, as positive control, carries out immunoblotting with AA98 and detects.

Fig. 8: AA1-AA5 and AA7 carry out the frozen section immunohistochemical experiment and detect the CD146 molecule of organizing level.AA98 is as the positive control of experiment, and CD31 is used for label vascular endotheliocyte (as shown by arrows).As shown by arrows, have only AA1 and the AA2 can be in conjunction with the CD146 molecule of organizing level on the frozen section.

Fig. 9: sandwich ELISA detects the typical curve of 5ng/ml-320ng/ml standard model.

Figure 10: sandwich ELISA detects the typical curve of 5ng/ml-80ng/ml standard model, and fit equation.

Figure 11: the collection of illustrative plates of HMV6g carrier, it contains the MBP-His label.

Hybridoma cell strain 8E8 and G10 (it is secretory antibody AA1 and AA4 respectively) are preserved in the common micro-organisms center (CGMCC of China Committee for Culture Collection of Microorganisms on January 24th, 2008, China, Beijing, No. 13, one in Zhong Guan-cun, Haidian District north), preserving number is respectively CGMCC No.2310 and CGMCC No.2311.

Embodiment

Describe the present invention in detail below by embodiment.Persons of ordinary skill in the art may appreciate that following embodiment only is presented for purposes of illustration.The spirit and scope of the present invention are limited by accompanying Claim.

Embodiment 1: the preparation of monoclonal antibody AA1-AA5 and AA7 and evaluation.

(KohlerandMilstein 1975 to use hybridoma technology; Yeh, Hellstrom et al.1979; Yeh, Hellstrom et al.1982) produce and screening acquisition antibody A A1-AA6 and AA7.Be summarized as follows: (its aminoacid sequence is shown in SEQID NO:1 from separating natural CD146 albumen human umbilical vein's endotheliocyte, nucleotide sequence is shown in SEQ ID NO:2), according to (Yan, Lin et al.2003) the monoclonal antibody AA98 antigen purification method purifying of Miao Shuing, it is carried out immunization as immunogen to BALB/C mice (Beijing Experimental Animal Center), each peritoneal injection 100 μ g albumen/mouse, every fortnight once, totally three times.Before the extracting spleen cell booster immunization once, peritoneal injection 100 μ g albumen/mouse.Booster immunization three days is afterwards got spleen, and splenocyte is suspended in the RPMI substratum.In the presence of polyoxyethylene glycol (PEG), splenocyte and SP2/0-Ag14 rat bone marrow tumour cell (ATCC) are merged, and hybridoma is screened with the HAT selective medium.

The method screening of utilization enzyme linked immunological absorption (ELISA) can produce the hybridoma cell clone of the anti-people CD146 antibody of high-affinity in a large number.Use recombinant expressed CD146 molecule extracellular region protein, rhCD146 (sequence is the position amino acid 24-552 in the people CD146 sequence of SEQ ID NO:1) as envelope antigen, detects the Hybridoma Cell Culture supernatant.Concrete way is, the bag that at first spends the night on elisa plate is by 50 μ l, 1 μ g/ml rhCD146 albumen, gives a baby a bath on the third day after its birth time with PBS.Add 2% bovine serum albumin (Ameresco) sealing 1 hour.The hybridoma culture supernatant, enzyme labelled antibody (the sheep anti mouse HRP of dilution in 1: 5000, Santa Cruz) and substrate (200ng/ml TMB (Ameresco), the 0.03%H that successively add secretory antibody then ₂O ₂(Beijing chemical reagents corporation) pH4.5), carries out the ELISA screening.Hybridoma cell strain 8E8,8F4, A5, G10, the H5 that has obtained six secretion high-affinity antibodies by three-wheel screening 1. with H5 2., its excretory antibody is corresponding called after AA1, AA2, AA3, AA4, AA5 and AA7 respectively.Hybridoma cell strain 8E8 and G10 (it is secretory antibody AA1 and AA4 respectively) are preserved in the common micro-organisms center (CGMCC of China Committee for Culture Collection of Microorganisms on January 24th, 2008, China, Beijing, No. 13, one in Zhong Guan-cun, Haidian District north), preserving number is respectively CGMCC No.2310 and CGMCC No.2311.And hybridoma cell strain AA6 is the ELISA negative hybridoma clone in when screening, and is very weak with the CD146 binding ability.

Respectively a large amount of cultivate amplified hybridization oncocyte 8E8,8F4, A5, G10, H5 1. with H5 2., collect the culture supernatant that contains AA1, AA2, AA3, AA4, AA5 and AA7 antibody respectively and be used for antibody function and identify.Respectively 2. 1. hybridoma 8E8,8F4, A5, G10, H5 are made cell suspension with serum-free RPMI-1640 substratum with H5 in addition, be used to prepare antibody ascites.The preparation method of ascites is summarized as follows: six week BALB/C mice abdominal injection pristane in age (Sigma) 0.5ml/ only.After 10 days, with hybridoma suspension 1 * 10 ⁶Individual/ml is inoculated in the BALB/C mice abdominal cavity, and 0.5ml/ only after about ten days, collects ascites, the centrifuging and taking supernatant.

By the albumin A affinity chromatography, monoclonal antibody purification AA1, AA2, AA3, AA4, AA5 and AA7 from culture supernatant or ascites.With monoclonal antibody purification sterile filtration, and refrigeration or freezing preservation.

Use BD Pharmingen company's murine antibody hypotype identification kit (catalog number (Cat.No.) 550487), with AA98 described in the patent of invention ZL 991075862 (down with) as testing positive control, the ELISA method identifies antibody A A1, AA2, AA3, AA4, AA5 and AA7 and all belongs to the IgG1 hypotype, and is as shown in table 1.

Table 1 antibody A A1, AA2, AA3, AA4, AA5, AA7 and AA98 antibody typing

Antibody	The heavy chain hypotype	Light chain subtype
Antibody	The heavy chain hypotype	Light chain subtype	AA1	IgG1	κ
AA2	IgG1	κ	AA1	IgG1	κ
AA2	IgG1	κ	AA3	IgG1	κ
AA4	IgG1	κ	AA3	IgG1	κ
AA4	IgG1	κ	AA5	IgG1	κ
AA7	IgG1	κ	AA5	IgG1	κ
AA7	IgG1	κ	AA98	IgG2a	κ

Alkaline phosphatase (the Alkaline Phosphatase that the His-rhCD146 that the 6xHis-tag of the former nuclear expression of The ELISA method is used for the AA1-AA5 of purification Identification and six kinds of antibody of AA7 for the proteic binding specificity of CD146. merges (amino acid that by 6xHis-tag and sequence is the position 24-552 in the people CD146 sequence of SEQ ID NO:1 forms) and eucaryon are expressed; Be called for short AP, its sequence is shown in SEQ ID NO:3) sCD146-AP that merges (amino acid and the sequence that by sequence is the position 24-559 in the people CD146 sequence of SEQ ID NO:1 is connected that the AP of SEQ ID NO:3 and connection district that sequence is SEQ ID NO:42 form) is used as respectively envelope antigen (their structure schematic diagram is referring to Fig. 2) in experiment.

Wherein, the His-rhCD146 preparation method briefly introduces as follows: the Nucleotide of position 70-1656 in the cDNA sequence (SEQ ID NO:2) of people CD146 is cloned on pET28b (Novagen) carrier, utilizes restriction enzyme NdeI and NotI (NEB provides) and primer 5 '-AA C ATA TGG TGC CCG GAG AGG CTG AGC AG-3 ' (SEQ ID NO:4) and 5 '-AAGCGG CCG CCA GCT TTC TCT CTG TGG AG-3 ' (SEQ ID NO:5).In E.ColiBL21 DE3 (Invitrogen) bacterial strain, express, exist, obtain required antigen after washing and the renaturation with the inclusion body form.Protein expression and inclusion body washing methods are stated D1 as follows, D2 and D4 protein expression and inclusion body washing methods.

The renaturing inclusion bodies step is as follows:

1. transfer concentration to 1mg/ml the dissolved inclusion body protein, during 1ml packed dialysis tubing into altogether, outer liquid was with 140ml 6M urea element, the 200mM arginine, 25mM Tris (pH8.0), 150mM NaCl, 2mM reduced glutathion (GSH), 1mM Sleep-promoting factor B (GSSG) leaves standstill dialysed overnight for 4 ℃.

2. pour out above-mentioned 50ml extracellular fluid dialysis, mend 50ml diluent [600mM arginine, 25mM Tris (pH8.0), 150mM NaCl, 2mM GSH, 1mM GSSG.].This moment outer liquid urea concentration be 4M.Dialysed 6 hours for 4 ℃.

3. pour out the 75ml extracellular fluid dialysis, mend the 75ml diluent, the urea final concentration is 2M.Dialysed 6 hours for 4 ℃.

4. join 200ml 400mM arginine, 25mM Tris, 150mM NaCl, 2mM GSH, 1mM GSSG, dialysed overnight.Urea concentration is 0M, and arginine concentration is 400mM.

5. pour out the 100ml extracellular fluid dialysis, mend 100ml 25mM Tris, 150mM NaCl.Whole solution is the 200mM arginine, 25mM Tris, 150mM NaCl, 1mM GSH, 0.5mMGSSG.Dialysed 6 hours for 4 ℃.

6. repeating step 5.

7. with 900ml 25mM Tris 150mM NaCl dialysed overnight.

8. renew bright 1L 25mM Tris 150mM NaCl dialysis 6 hours.

9. mensuration protein content, the SDS-PAGE method detects.Concentration can reach more than the 500 μ g/ml.Can further concentrate by ultrafiltration or Ni-NTA affinity chromatography.Dialysis provides by Sigma company with chemical reagent.)

The preparation process of sCD146-AP is simply as follows: the coding nucleotide sequence of fusion rotein (SEQID NO:6) is cloned on the pCMV-SPORTS6 carrier (OpenBiosystems provides) with XbaI and EcoRI (NEB), containing the segmental plasmid of insertion utilizes Fugene6 (Roche) transfection reagent transient transfection to 293T cell (ATCC), cells and supernatant is according to (Yan, Lin et al.2003) the monoclonal antibody AA98 antigen purification method purifying of Miao Shuing obtains the sCD146-AP fusion rotein.

Utilize ELISA to detect combining of antibody and recombinant protein, simply method is as follows.

1) preparation Trx-His (its aminoacid sequence is shown in SEQ ID NO:7): according among the embodiment 2 about expressing D3 and the proteic method of D5, be about to pET32a (Novagen) and transform B121 (DE3) competent cell, utilize the IPTG abduction delivering, through the Ni column purification.Spend the night with 4 ℃ of enzymolysis of Thrombin proteolytic enzyme (15U enzyme/mg albumen, Sigma provides), use Ni-NTA purifying band the Trx-His of 6xHis label afterwards again, purifying D3 and D5 protein are seemingly among method and the embodiment 2.

2) preparation MBP-His (its aminoacid sequence is shown in SEQ ID NO:8): according among the embodiment 2 about expressing D3 and the proteic method of D5, be about to HMV6g carrier (the carrier collection of illustrative plates as shown in figure 11) and transform B121 (DE3) competent cell, utilize the IPTG abduction delivering, through the Ni column purification.Spend the night with 4 ℃ of enzymolysis of Tev proteolytic enzyme (1 μ g enzyme/mg albumen, Invitrogen provides), use Ni-NTA purifying band the MBP-His of 6xHis label afterwards again, method and embodiment 2 purifying D3 and D5 protein are seemingly.

3) on different holes on the elisa plate, wrap respectively by 1 μ g/ml antigen (His-rhCD146, sCD146-AP, Trx-His and MBP-His), 50 μ l/ holes, 4 ℃ of bags are spent the night; With 2%BSA/PBS (Ameresco) room temperature sealing 2 hours, use antibody (the ascites AA1-5 of preparation and AA7) the 50 μ l/ pore chamber temperature of dilution in 1: 2000 to hatch onboard afterwards 2 hours, then wash 5 times with PBST, PBS washes 1 time.Two anti-PBST washed 5 times with HRP coupling sheep anti-mouse igg (Santa Cruz) incubated at room of diluting at 1: 5,000 1 hour, and PBS washes 1 time.With tmb substrate (200ng/ml TMB (Ameresco), 0.03%H ₂O ₂(Beijing chemical reagents corporation), pH4.5) 100 μ l/ holes colour developing, sulfuric acid stops.The result as shown in Figure 1, AA1-AA5 and AA7 can both be very strong in conjunction with recombinant expressed CD146 protein extracellular: His-rhCD146 and sCD146-AP, yet the but Trx (Trx-His) that merges of debond 6xHis-tag and the mannose-binding protein (MBP-His) of 6xHis-tag fusion.This has confirmed equal specific recognition CD146 albumen of this six strain antibody rather than His-tag.Use therein AA6 is as the negative control of experiment.

Embodiment 2: the epitope of monoclonal antibody AA1-AA5 and AA7 is identified.

Use recombinant expressed respectively five domain proteins of people source CD146 extracellular region and the method for immunoblotting, identified the epitope of six strain antibodies described in the present invention.

As shown in Figure 2, structural domain 1-5 represent respectively CD146 outside born of the same parents to five structural domains of the V-V-C2-C2-C2 that strides the film district.The eclipsed sequence is designed to prevent that possible epi-position from losing.Structural domain 1 (sequence is the amino acid of the position 24-145 in the people CD146 sequence of SEQ ID NO:1, shown in SEQ ID NO:9) is cloned on the pET30a (Novagen), and what express is that His6-Stag merges His6-S-D1 albumen.(sequence is the amino acid of the position 128-248 in the people CD146 sequence of SEQ ID NO:1 to structural domain 2, shown in SEQ ID NO:10), (sequence is the amino acid of the position 233-335 in the people CD146 sequence of SEQ ID NO:1 to structural domain 3, shown in SEQ IDNO:11), (sequence is the amino acid of the position 313-442 in the people CD146 sequence of SEQ ID NO:1 to structural domain 4, shown in SEQ ID NO:12) and structural domain 5 (sequence is the amino acid of the position 400-560 in the people CD146 sequence of SEQ IDNO:1, shown in SEQ ID NO:13) be cloned in respectively on the pET32a (Novagen), that express is respectively the Trx-His6-S-D2 that Trx-His6-S tag merges, Trx-His6-S-D3, Trx-His6-S-D4 and Trx-His6-S-D5.

Clone's process is summarized as follows: with corresponding a pair of primer D1S and D1A (being used for structural domain 1), D2S and D2A (being used for structural domain 2), D3S and D3A (being used for structural domain 3), D4S and D4A (being used for structural domain 4), D5S and D5A (being used for structural domain 5), and template pcDNA3.1 (-) b-CD146 is (by deriving from Johnson with sequence shown in SEQ ID NO:2, the breadboard CD146 cDNA of J.P utilizes restriction enzyme EcoR I and BamH I (NEB) to be cloned into pcDNA3.1 (-) b carrier (Invitrogen) and obtains) do the PCR reaction, condition be 95 ℃ 5 minutes; 95 ℃ 45 seconds, 56 ℃ 40 seconds, 72 ℃ 50 seconds, 30 circulations; 72 ℃ 5 minutes.Amplify the nucleotide sequence of coding structure territory 1-5 respectively.

Primer is listed as follows, and the positive-sense strand primer has Nco I restriction enzyme site (shown in underscore), and the antisense strand primer has Hind III restriction enzyme site (shown in underscore):

The primer title	Primer sequence 5 ' to 3 '
The primer title	Primer sequence 5 ' to 3 '	D1S	5’catg CCATGGTGCCCGGAGAGGCTGAG 3’(SEQ ID

	NO：14)
	NO：14)	D1A	5’AAGCTTttaGGGGTTGACCTGGATGTTTGGC 3’(SEQ ID NO：15)
D2S	5’CCATGGgtATCCAGCTCCGCGTCTACAAAG 3’(SEQ ID NO：16)	D1A	5’AAGCTTttaGGGGTTGACCTGGATGTTTGGC 3’(SEQ ID NO：15)
D2S	5’CCATGGgtATCCAGCTCCGCGTCTACAAAG 3’(SEQ ID NO：16)	D2A	5’AAGCTTttaCGGGTAGAAAACAGGGACGGTG 3’(SEQ ID NO：17)
D3S	5’CCATGGgtAACCACATGAAGGAGTCCAGGGAAG 3’ (SEQ ID NO：18)	D2A	5’AAGCTTttaCGGGTAGAAAACAGGGACGGTG 3’(SEQ ID NO：17)
D3S	5’CCATGGgtAACCACATGAAGGAGTCCAGGGAAG 3’ (SEQ ID NO：18)	D3A	5’AAGCTTttaTGGTTCACTCAGCAGCGATATCATG 3 (SEQ ID NO：19)
D4S	5’CCATGGaaCACAGTGGGCGCTATGAATG 3’(SEQ ID NO：20)	D3A	5’AAGCTTttaTGGTTCACTCAGCAGCGATATCATG 3 (SEQ ID NO：19)
D4S	5’CCATGGaaCACAGTGGGCGCTATGAATG 3’(SEQ ID NO：20)	D4A	5’AAGCTTttaCACCCACACCTTCCTCTCCTTG 3’(SEQ ID NO：21)
D5S	5’CCATGGagGCAGGAGGCGGCTATCG3’(SEQ ID NO：22)	D4A	5’AAGCTTttaCACCCACACCTTCCTCTCCTTG 3’(SEQ ID NO：21)
D5S	5’CCATGGagGCAGGAGGCGGCTATCG3’(SEQ ID NO：22)	D5A	5’AAGCTTttaGACCACGCCCCGGCTCTC 3’(SEQ ID NO：23)

The PCR product separates with 2% sepharose (Biowest Agarose), the sepharose DNA that provides with Tiangen company reclaims test kit (production code member: DP209-03) reclaim the PCR product, the pMD18 T-simple kit that provides with Tara company is connected to fragment on the T carrier (carrier and enzyme are provided in the test kit) then, and transforms Top10 competent cell (Tiangen provides).Be added with the mono-clonal D1-T (having inserted the nucleotide sequence of structural domain 1) that grows on the LB culture plate of penbritin, D2-T (having inserted the nucleotide sequence of structural domain 2), D3-T (having inserted the nucleotide sequence of structural domain 3), D4-T (having inserted the nucleotide sequence of structural domain 4) and D5-T (having inserted the nucleotide sequence of structural domain 5), spend the night for 37 ℃ with the LB culture medium culturing that has penbritin, and the little extraction reagent kit of plasmid that provides with Tiangen (production code member: DP103-03) extracting plasmid, with Nco I and Hind III (NEB) double digestion pET30a, pET32a, the plasmid (promptly having inserted the T carrier of the nucleotide sequence of structural domain 1-5 respectively) that extracts.Use 2% sepharose (Biowest Agarose) to separate afterwards, the sepharose DNA that provides with Tiangen company reclaims test kit, and (production code member: DP209-03) enzyme that reclaims the T carrier is cut the plasmid fragment of small segment (being the nucleotide sequence of structural domain 1-5) and pET30a and the incision of pET32a enzyme.The enzyme of D1-T is cut small segment and is connected with the plasmid fragment that the pET30a enzyme cuts, D2-T, D3-T, the enzyme of D4-T and D5-T cut small segment and are connected with the plasmid fragment that the pET32a enzyme cuts, the T4 dna ligase that provides with the NEB company reaction that connects, 16 ℃ of connections are spent the night.Transform Top10 competent cell (Tiangen), pET30a-D1 screens pET32a-D2, pET32a-D3 with the semi-solid LB culture plate that contains kantlex (50ng/ml), pET32a-D4 and pET32a-D5 screen with the semi-solid LB culture plate that contains ammonia benzyl mycin (100ng/ml).The mono-clonal that incubated overnight obtains is respectively with containing antibiotic LB culture medium culturing, and the extracting plasmid, and the plasmid of acquisition is used to transform B121 (DE3) competent cell (Tiangen).

Recombinant protein His6-S-D1, Trx-His6-S-D2, Trx-His6-S-D3, the abduction delivering of Trx-His6-S-D4 and Trx-His6-S-D5: transformed pET30a-D1, pET32a-D2, pET32a-D3, pET32a-D4, with B121 (DE3) mono-clonal of pET32a-D5,37 ℃ of overnight incubation in containing corresponding antibiotic 5mlLB nutrient solution.The bacterium that spends the night is seeded to 37 ℃ of cultivations in the corresponding fresh substratum at 1: 100, treats that bacterial growth is to OD600 at 0.6 o'clock, and 37 ℃ of abduction deliverings of adding 1mM IPTG (Ameresco) 6 hours or 0.2mM IPTG induce for 16 ℃ and spend the night.

D1, D2 and D4 present the inclusion body state by after the IPTG abduction delivering, and be soluble.Inclusion body purification and washing methods are as follows: thalline is resuspended in 25mM Tris-HCl (pH7.4), ultrasonic 2 * 99 circulations of 300W, and each circulating ultrasonic 4 seconds suspends 8 seconds, totally 12 seconds.Centrifugal 30 minutes of 4 ℃ of 12000g.Inclusion body precipitation is resuspended in the solution 1 (2.5M NaCl), and 4 ℃ were stirred 30 minutes, centrifugal 30 minutes of 4 ℃ of 12000g.Inclusion body precipitation be resuspended in solution 2 (0.5%Triton X-100,10mMEDTA, pH8.0) in, 4 ℃ were stirred 30 minutes, centrifugal 30 minutes of 4 ℃ of 12000g.Inclusion body precipitation be resuspended in solution 3 (2M Urea, 50mM Tris, 1mM EDTA, pH8.0) in, 4 ℃ were stirred 30 minutes, centrifugal 30 minutes of 4 ℃ of 12000g.Subsequently, solubilization of inclusion bodies is in solution 4 (8M Urea, 25mMTris, 150mM NaCl, 25mM DTT pH8.0).

D3 and D5 present solvable state by after the IPTG abduction delivering, use the Ni column purification.Concrete grammar is as follows: thalline is resuspended in 25mM Tris-HCl (pH7.4), ultrasonic 2 * 99 circulations of 300W, and each circulating ultrasonic 4 seconds suspends 8 seconds, totally 12 seconds.Centrifugal 30 minutes of 4 ℃ of 12000g collect supernatant, cross the 0.45mm filter membrane and remove impurity.Ni-NTA sepharose 6 Fast Flow (GE HealthCare) fill out post, after the ultrapure water washing, in 50mM Tris-HCl (pH7.4), balance in the balanced solution of 150mM NaCl.To contain sample hanging column on the proteic centrifugal solvable supernatant of His6-tag then, wash post with washing soln (50mM Tris-HCl, pH7.4,150mM NaCl, 50mM imidazoles).Albumen on last elute soln (50mM Tris-HCl, pH7.4,150mM NaCl, 300mM imidazoles) the wash-out post.

Utilize immunoblot experiment to identify AA1-AA5 and AA7 institute identified epitope.Simple procedure is as follows: with the D1-D5 albumen that 15%SDS-PAGE separates the prokaryotic expression purifying, with the half-dried transfer printing instrument of Bio-rad the albumen on the glue is transferred on the nitrocellulose filter then.Sealed 2 hours with the 5% skimmed milk room temperature that is dissolved among the PBST, use 4 ℃ of overnight incubation of an anti-solution (AA1-AA5 and AA7) of above-mentioned 5% skimmed milk/PBST dilution (1: 2000) then.Then PBST washes 5 times, resists with two of above-mentioned 5% skimmed milk/PBST dilution (1: 2000) that (sheep anti-mouse igg antibody of horseradish peroxidase, Pierce) the solution incubated at room is 1 hour.PBST washes after 5 times, with the chromogenic substrate (production code member: 34076,400 μ l 3%H of Pierce company ₂O ₂+ 400 μ l Luminol solution/miniblot) colour developing.In the experiment, utilize AA1 respectively, AA2, AA3, AA4, AA5 and AA7 are anti-as one, and the sheep anti-mouse igg of horseradish peroxidase (Pierce) is anti-as two, detects the activity that combines of different antibodies and recombinant expressed five structural domain D1-5 of CD146 extracellular region.As shown in Figure 3, AA1 and AA2 be only in conjunction with D1, and the D2 that debond is adjacent has confirmed that its epitope is between the position 24-128 in the people CD146 sequence that sequence is SEQ ID NO:1, and concrete sequence is shown in SEQ ID NO:24.AA3-5 and AA7 be only in conjunction with D4, and D3 that debond is adjacent and D5 have confirmed that its epitope is between the position 335-400 in the people CD146 sequence that sequence is SEQ ID NO:1, and concrete sequence is shown in SEQ ID NO:25.

Based on different epitopes this six strain antibody is divided into two classes, V1 class and C2-2 class.Because the epitope of AA1 and AA2 is positioned at first IgV spline structure territory, be classified as the V1 class, and AA3, AA4, the epitope of AA5 and AA7 are positioned at second IgC2 spline structure territory, so be classified as the C2-2 class.

Embodiment 3: utilize monoclonal antibody AA1-AA5 and AA7 to detect people CD146

Anti-people CD146 mouse monoclonal antibody of the present invention can and be organized level detection people CD146 albumen at molecule, cell.

In the whole-cell protein immunoblot experiment, AA1-AA5 and AA7 all can discern the CD146 albumen of reduction and non-reduced two states.Concrete experimental technique is as follows: the people source melanoma cell A375 (ATCC) that collects high expression level CD146, with twice of the PBS washed cell of precooling, centrifugal 5 minutes of 4 ℃ of 800rpm, cell precipitation lysate (Tris-HCl 50mM pH8.0, NaCl150mM, EDTA 1mM, NP-40 1%, Glycerol 10%, PMSF 100 μ g/ml) lysing cell, centrifugal 15 minutes of 4 ℃ of 12000g collect supernatant, add sample-loading buffer (the 5x sample-loading buffer: 0.313MTris-HCl that contains DTT (final concentration 100mM) (dithiothreitol (DTT)) and do not contain DTT respectively, pH6.8,10%SDS, 0.05% tetrabromophenol sulfonphthalein, 50% glycerine), 100 ℃ are boiled sample.10%SDS-PAGE separates whole-cell protein, and half-dried afterwards electrotransfer is to nitrocellulose filter.After the sealing of 5% skimmed milk, hatching film with AA1-AA5 and AA7 for 4 ℃ as one anti-(usefulness confining liquid 5% skimmed milk/TBST dilution in 1: 10000) respectively spends the night, sheep anti-mouse igg two with horseradish peroxidase resists (Pierce then, confining liquid 5% skimmed milk/TBST dilution in 1: 2000) incubated at room is 1 hour, chromogenic substrate (the production code member: 34076,400 μ l3%H that provides with Pierce company ₂O ₂+ 400 μ l Luminol solution/miniblot) detect.As shown in Figure 4, AA1-AA5 and AA7 can be at the CD146 protein molecular of molecular level in conjunction with the A375 expression.

Utilization Flow cytometry means, confirmation V1 antibody-like can be discerned the CD146 albumen of surface of cell membrane in the viable cell level, and the C2-2 antibody-like can not be discerned.Concrete experimental technique is as follows: collect the people source melanoma cell A375 (the same) of high expression level CD146, and with the PBS washed cell twice that contains 0.3%BSA of precooling, every all over washing centrifugal 5 minutes of 4 ℃ of 800rpm afterwards.With sheep blood serum diluent (usefulness PBS diluted in 1: 20) closing cell, add AA1-AA5 and AA7 afterwards, and positive control AA98 was hatched on ice 40 minutes as one anti-(PBS dilution in 1: 2000).With twice of the PBS washed cell that contains 0.3%BSA of precooling, add FITC link coupled sheep anti-mouse igg as two anti-(Sigma, PBS dilution in 1: 300), incubated at room 20 minutes detects (BD Bioscience) with BD FACSCalibur flow cytometry system.The result as shown in Figure 5, AA1 and AA2 are the CD146 molecule that the V1 antibody-like can be expressed in conjunction with A375, with negative control mIgG (as anti-a use, Sigma provides with mouse IgG) obvious difference be arranged.And AA3-5 and AA7 are the C2-2 antibody-like, can not be in conjunction with the CD146 molecule of the native state on the viable cell A375 film, and possible reason is C2-2 class identified epitope is not exposed to the CD146 protein molecular under native state surface.

Equally, utilize immunofluorescence technique experiment, also have only the CD146 molecule that the V1 antibody-like can the recognizing cells level, and the C2-2 antibody-like can not, AA98 is as the positive control of experiment, mIgG is as negative control, as shown in Figure 6.Experiment has confirmed that also the CD146 molecule mainly is distributed in surface of cell membrane.Experimentation is summarized as follows: fixedly be longer than the A375 cell 1 minute of 24 orifice plates, PBS washed twice afterwards with 1: 1 acetone/methanol of precooling.In 37 ℃ of closing cells 30 minutes, PBS washed twice with 2% sheep blood serum (China fir Golden Bridge in Beijing).Add one anti-(AA1-AA5 and AA7, AA98 and mIgG) of 100 μ l PBS dilution in 1: 2000 then, hatched 2 hours for 37 ℃.After the PBS washing, anti-ly hatched 1 hour for 37 ℃ as two with cell with the FITC link coupled sheep anti-mouse igg (Sigma) of PBS dilution in 1: 300.PBS washes, microscopy.

The V1 antibody-like can be used for the natural CD146 molecule of enrichment solution.Utilize the technology of immunoprecipitation, the V1 antibody-like can in conjunction with and the enrichment of cell lysate in CD146 albumen.Concrete method is as follows: 1 * 10 ⁷The cracking 30 minutes in the above-mentioned lysate of 0.6mL ice precooling of A375 (the same) cell, centrifugal 15 minutes of 4 ℃ of 12000g collect supernatant.Add earlier the proteinA-Agarose (Santa Cruz) of 20 μ l 50%slurry (50% mix with PBS or TE), carry out preclearing.Add 2 μ gAA1-AA5 and AA7 then respectively, 4 ℃ of overnight incubation.The protein A-Agarose capture antigen-antibody complex that adds 20 μ l 50%slurry afterwards with PBS washing precipitation three times, adds 40 μ l 1x sample-loading buffers (with 5 times of above-mentioned 5x sample-loading buffer dilutions), and 100 ℃ of heating were boiled sample 10 minutes.Albumen precipitation detects (experimental technique is same as above) with the method for immunoblotting, and AA98 is anti-as detecting one.As shown in Figure 7, AA1 and AA2 can precipitate the CD146 albumen in the enrichment A375 lysate, and the C2-2 antibody-like can not.

Utilize immunohistochemistry technology, the V1 antibody-like can detect the CD146 protein molecular of organizing level.Specific practice is as follows: human umbilical tissue carries out frozen section with OCT (frozen tissue embedding liquid, Sakura provides) embedding.Section is fixed 5 minutes in the acetone of precooling, containing 0.3%H then ₂O ₂Methyl alcohol in the room temperature black out hatch the interference of removing endogenous peroxydase in 30 minutes.After the PBS washing three times, with 5% horse serum (China fir Golden Bridge in Beijing, PBS dilutes horse serum) sealing section, containing AA1-AA5 respectively then, AA7,4 ℃ of overnight incubation in the anti-diluent of AA98 and anti-CD31 antibody (Santa Cruz) (confining liquid dilution in 1: 2000).Afterwards with biotin labeled two anti-(vitamin H link coupled sheep anti-mouse iggs, Vector company, the dilution of 1: 1000 confining liquid) and the streptavidin of horseradish peroxidase resist (Vector as three, PBS dilution in 1: 1000), hatch tissue slice for 37 ℃, use DAB colouring reagents box (China fir Golden Bridge in Beijing, the production code member: ZLI-9033) colour developing of fresh configuration at last.After finishing, colour developing redyes nucleus with Hematorylin.As shown in Figure 8, anti-CD31 antibody labeling vascular endothelial cell (as shown by arrows), AA1 and AA2 can be at the CD146 molecules (as shown by arrows) that organize level identification umbilical vein endotheliocyte and vascular smooth muscle cell to distribute, and the C2-2 antibody-like can not.AA98 is as the positive control (as shown by arrows) of experiment.

Embodiment 4: highly sensitive double antibodies sandwich ELISA detects human soluble CD146 method

Utilize AA98 described in anti-people CD146 antibody A A1 described in the present invention and the patent of invention ZL 991075862, the present invention has developed a kind of highly sensitive double antibodies sandwich ELISA method, detects the soluble cd 14 6 in the serum.Main method is that (experiment about AA2 is identical with AA1, the Therefore, omited) as capture antigen, the AA98 of vitamin H (Biotin) mark is as detecting antigen, and the sCD146-AP of eukaryotic expression detects soluble cd 14 6 albumen among normal people and the autoimmune disease patients serum as standard substance.Experiment confirm, the sandwich ELISA of the present invention's exploitation has the higher sensitivity and the linearity range of broad.Utilize this method also to confirm, the CD146 protein content among autoimmune disease such as the systemic vasculitis patients serum has remarkable rising than the healthy volunteer.

Concrete experimental technique is as follows:

1. sample source and clinical data: healthy volunteer's blood plasma is from BJ Red Cross Blood Center, and vasculitis patient's blood plasma is from the loyal hospital of peace.

2. concrete steps:

1) elisa plate coated antibody: antibody A A1 is diluted to 1 μ g/ml with 0.02M PB (pH 7.25), and the 4 ℃ of bags in 50 μ l/ holes are spent the night.

2) the non-specific combination of sealing site: 200 μ l/ hole 2%BSA/PBS, incubated at room 2 hours.

3) sample is hatched: the sCD146-AP gradient of concentration known is used for the drawing standard curve with confining liquid (2%BSA/PBS) dilution, and the concentration after the dilution is respectively 5,10,20,40,80,160,320ng/ml.20 times of test serum dilutions, applied sample amount 50 μ l, confining liquid replace sample as negative control.Each sample is established twice repetition.Incubated at room 2 hours.

4) PBST is 5 times, 1 flush away non-specific binding of PBS.

5) detect antibody incubation: detect antibody A A98-vitamin H (vitamin H that is used for mark AA98 is provided by Pierce company) and be diluted to 0.5 μ g/ml with 2%BSA/PB, 50 μ l/ pore chamber temperature were hatched 2 hours.

6) PBST is 5 times, 1 flush away non-specific binding of PBS.

7) ELIAS secondary antibody amplifying signal: add the streptavidin-horseradish peroxidase (Vector, 1: 3000) of suitable concn, 50 μ l/ holes, incubated at room 1 hour.

8) PBST is 5 times, 1 flush away non-specific binding of PBS.

9) color reaction: add substrate (200ng/ml TMB (Ameresco), 0.03%H ₂O ₂(Beijing chemical reagents corporation), pH4.5) colour developing, 100 μ l/ holes, 37 ℃ 15 minutes, add 50 μ l/ hole 2M H ₂SO ₄Termination reaction, microplate reader 450nm reading.

10) software statistics result: the software analysis light absorption value, according to standard sCD146-AP concentration drawing standard curve.

11) calculate the concentration of testing sample according to typical curve.

3. interpretation of result:

1) utilizes the concentration production standard curve of known sCD146-AP.The concentration of dilution back sCD146-AP is 5～320ng/ml, and drawing standard curve such as Fig. 9 show.Draw this method sensing range as calculated and in 5～80ng/ml, meet linearity.Get sCD146-AP concentration 5～80ng/ml resulting typical curve (R that maps ²=0.9981), as shown in figure 10.

2) analyze sCD146 content in healthy volunteer and the systemic vasculitis patient blood plasma.SCD146 content is 154.7ng/ml in healthy volunteer's blood plasma, and vasculitis patient blood plasma sCD146 content reaches 383.9ng/ml, and the two obvious difference is as shown in table 2.

Table 2: utilize soluble cd 14 6 content among healthy volunteer that sandwich ELISA detects and the systemic vasculitis patients serum.

Test sample	OD450	Diluent sCD146 concentration (ng/ml)	Stoste sCD146 concentration (ng/ml)
Test sample	OD450	Diluent sCD146 concentration (ng/ml)	Stoste sCD146 concentration (ng/ml)	The healthy volunteer	0.133	7.73191	154.7
The systemic vasculitis patient	0.3175	19.1925	383.9	The healthy volunteer	0.133	7.73191	154.7

Reference

Bani，M.R.，J.Rak，et al.(1996).″Multiple features of advanced melanomarecapitulated in tumorigenic variants of early stage(radial growth phase)human melanoma cell lines：evidence for a dominant phenotype.″ Cancer Res 56(13)：3075-86.

Bardin，N.，F.Anfosso，et al.(2001).″Identification of CD146 as a componentof the endothelial junction involved in the control of cell-cell cohesion.″

Blood 98(13)：3677-84.

Bardin，N.，V．Frances，et al.(1996).″Identification of the S-Endo lendothelial-associated antigen.″ Biochem Biophys Res Commun 218(1)：210-6.

Bardin，N.，F.George，et al.(1996).″S-Endo l，a pan-endothelial monoclonalantibody recognizing a novel human endothelial antigeh.″ Tissue Antigens 48(5)：531-9.

Bardin，N.，V.Moal，et al.(2003).″Soluble CD146，a novel endothelial marker，is increased in physiopathological settings linked to endothelialjunctional alteration.″ Thromb Haemost 90(5)：915-20.

Bu，P，L.Gao，et al.(2006).″Anti-CD146 monoclonal antibody AA98 inhibitsangiogenesis via suppression of nuclear factor-kappaB activation.″ Mol Cancer Ther 5(11)：2872-8.

George，F.，P.Poncelet，et al.(1991).″Cytofluorometric detection of humanendothelial cells in whole blood using S-Endo l monoclonal antibody.″ J Immunol Methods 139(1)：65-75.

Holness，C.L.and D.L.Simmons(1994).″Structural motifs for recognitionand adhesion in members of the immunoglobulin superfamily.″ J Cell Sci 107(Pt8)：2065-70.

Johnson，J.P，U.Rothbacher，et al.(1993).″The progression associatedantigen MUC18：a unique member of the immunoglobulin supergenefamily.″ Melanoma Res3(5)：337-40.

Kohler，G.and C.Milstein(1975).″Continuous cultures of fused cells secretingantibody of predefined specificity.″ Nature256(5517)：495-7.

Kuzu，I.，R.Bicknell，et al.(1993).″Expression of adhesion molecules on theendothelium of normal tissue vessels and vascular tumors.″ Lab Invest69(3)：322-8.

Lehmann，J.M.，G.Riethmuller，et al.(1989).″MUC18，a marker of tumorprogression in human melanoma，shows sequence similarity to theneural cell adhesion molecules of the immunoglobulin superfamily.″ Proc Natl Acad Sci U S A86(24)：9891-5.

Mills，L，C.Tellez，et al.(2002).″Fully human antibodies to MCAM/MUC18inhibit tumor growth and metastasis of human melanoma.″ Cancer Res62(17)：5106-14.

Neidhart，M.，R.Wehrli，et al.(1999).″Synovial fluid CD146(MUC18)，amarkerker for synovial membrane angiogenesis in rheumatoid arthritis.″ Arthritis Rheum 42(4)：622-30.

Pickl，W.F.，O.Majdic，et al.(1997).″MUC18/MCAM(CD146)，an activationantigen of human T lymphocytes.″ J Immunol 158(5)：2107-15.Sers，C.，K.Kirsch，et al.(1993).″Genomic organization of themelanoma-associated glycoprotein MUC18：implications for theevolution of the immunoglobulin domains.″ Proc Natl Acad Sci U S A90(18)：8514-8.

Shih，I.M.(1999).″The role of CD146(Mel-CAM)in biology and pathology.″ J Pathol189(1)：4-11.

Shih，I.M.，D.Speicher，et al.(1997).″Melanoma cell-cell interactions aremediated through heterophilic Mel-CAM/ligand adhesion.″ Cancer Res57(17)：3835-40.

Solovey，A.N.，L.Gui，et al.(2001).″Identification and functional assessmentof endothelial P1H12.″ J Lab Clin Med 138(5)：322-31.

St Croix，B.，C.Rago，et al.(2000).″Genes expressed in human tumorendothelium.″ Science 289(5482)：1197-202.

Xie，S.，M.Luca，et al.(1997).″Expression of MCAM/MUC18 by humanmelanoma cells leads to increased tumor growth and metastasis.″ Cancer Res 57(11)：2295-303.

Yan，X.，Y.Lin，et al.(2003).″A novel anti-CD146 monoclonal antibody，

AA98，inhibits angiogenesis and tumor growth.″ Blood 102(1)：184-91.Yeh，M.Y，I.Hellstrom，et al.(1982).″A cell-surface antigen which is presentin the ganglioside fraction and shared by human melanomas.″ Int J Cancer 29(3)：269-75.

Yeh，M.Y，I.Hellstrom，et al.(1979).″Cell surface antigens of humanmelanoma identified by monoclonal antibody.″ Proc Natl Acad Sci U S A 76(6)：2927-31.

The IB080807-sequence table

SEQUENCE LISTING

＜110〉Institute of Biophysics, Academia Sinica

＜120〉monoclonal antibody of anti-people CD146 comprises its composition, detects the method for soluble cd 14 6

<130>IB080807

<160>42

<170>PatentIn version 3.1

<210>1

<211>645

<212>PRT

＜213〉people

<400>1

Met Gly Leu Pro Arg Leu Val Cys Ala Phe Leu Leu Ala Ala Cys Cys

1 5 10 15

Cys Cys Pro Arg Val Ala Gly Val Pro Gly Glu Ala Glu Gln Pro Ala

20 25 30

Pro Glu Leu Val Glu Val Glu Val Gly Ser Thr Ala Leu Leu Lys Cys

35 40 45

Gly Leu Ser Gln Ser Gln Gly Asn Leu Ser His Val Asp Trp Phe Ser

50 55 60

Val His Lys Glu Lys Arg Thr Leu Ile Phe Arg Val Arg Gln Gly Gln

65 70 75 80

Gly Gln Ser Glu Pro Gly Glu Tyr Glu Gln Arg Leu Ser Leu Gln Asp

85 90 95

Arg Gly Ala Thr Leu Ala Leu Thr Gln Val Thr Pro Gln Asp Glu Arg

100 105 110

Ile Phe Leu Cys Gln Gly Lys Arg Pro Arg Ser Gln Glu Tyr Arg Ile

115 120 125

Gln Leu Arg Val Tyr Lys Ala Pro Glu Glu Pro Asn Ile Gln Val Asn

130 135 140

Pro Leu Gly Ile Pro Val Asn Ser Lys Glu Pro Glu Glu Val Ala Thr

145 150 155 160

Cys Val Gly Arg Asn Gly Tyr Pro Ile Pro Gln Val Ile Trp Tyr Lys

165 170 175

Asn Gly Arg Pro Leu Lys Glu Glu Lys Asn Arg Val His Ile Gln Ser

180 185 190

Ser Gln Thr Val Glu Ser Ser Gly Leu Tyr Thr Leu Gln Ser Ile Leu

195 200 205

Lys Ala Gln Leu Val Lys Glu Asp Lys Asp Ala Gln Phe Tyr Cys Glu

210 215 220

Leu Asn Tyr Arg Leu Pro Ser Gly Asn His Met Lys Glu Ser Arg Glu

225 230 235 240

Val Thr Val Pro Val Phe Tyr Pro Thr Glu Lys Val Trp Leu Glu Val

245 250 255

Glu Pro Val Gly Met Leu Lys Glu Gly Asp Arg Val Glu Ile Arg Cys

260 265 270

Leu Ala Asp Gly Asn Pro Pro Pro His Phe Ser Ile Ser Lys Gln Asn

275 280 285

Pro Ser Thr Arg Glu Ala Glu Glu Glu Thr Thr Asn Asp Asn Gly Val

290 295 300

Leu Val Leu Glu Pro Ala Arg Lys Glu His Ser Gly Arg Tyr Glu Cys

305 310 315 320

Gln Gly Leu Asp Leu Asp Thr Met Ile Ser Leu Leu Ser Glu Pro Gln

325 330 335

Glu Leu Leu Val Asn Tyr Val Ser Asp Val Arg Val Ser Pro Ala Ala

340 345 350

Pro Glu Arg Gln Glu Gly Ser Ser Leu Thr Leu Thr Cys Glu Ala Glu

355 360 365

Ser Ser Gln Asp Leu Glu Phe Gln Trp Leu Arg Glu Glu Thr Gly Gln

370 375 380

Val Leu Glu Arg Gly Pro Val Leu Gln Leu His Asp Leu Lys Arg Glu

385 390 395 400

Ala Gly Gly Gly Tyr Arg Cys Val Ala Ser Val Pro Ser Ile Pro Gly

405 410 415

Leu Asn Arg Thr Gln Leu Val Asn Val Ala Ile Phe Gly Pro Pro Trp

420 425 430

Met Ala Phe Lys Glu Arg Lys Val Trp Val Lys Glu Asn Met Val Leu

435 440 445

Asn Leu Ser Cys Glu Ala Ser Gly His Pro Arg Pro Thr Ile Ser Trp

450 455 460

Asn Val Asn Gly Thr Ala Ser Glu Gln Asp Gln Asp Pro Gln Arg Val

465 470 475 480

Leu Ser Thr Leu Asn Val Leu Val Thr Pro Glu Leu Leu Glu Thr Gly

485 490 495

Val Glu Cys Thr Ala Ser Asn Asp Leu Gly Lys Asn Ser Ile Leu Phe

500 505 510

Leu Glu Leu Val Asn Leu Thr Thr Leu Thr Pro Asp Ser Asn Thr Thr

515 520 525

Thr Gly Leu Ser Thr Ser Thr Ala Ser Pro His Thr Arg Ala Asn Ser

530 535 540

Thr Ser Thr Glu Arg Lys Leu Pro Glu Pro Glu Ser Arg Gly Val Val

545 550 555 560

Ile Val Ala Val Ile Val Cys Ile Leu Val Leu Ala Val Leu Gly Ala

565 570 575

Val Leu Tyr Phe Leu Tyr Lys Lys Gly Lys Leu Pro Cys Arg Arg Ser

580 585 590

Gly Lys Gln Glu Ile Thr Leu Pro Pro Ser Arg Lys Ser Glu Leu Val

595 600 605

Val Glu Val Lys Ser Asp Lys Leu Pro Glu Glu Met Gly Leu Leu Gln

610 615 620

Gly Ser Ser Gly Asp Lys Arg Ala Pro Gly Asp Gln Gly Glu Lys Tys

625 630 635 640

Ile Asp Leu Arg His

645

<210>2

<211>1941

<212>DNA

＜213〉people

<400>2

atggggcttc ccaggctggt ctgcgccttc ttgctcgccg cctgctgctg ctgtcctcgc 60

gtcgcgggtg tgcccggaga ggctgagcag cctgcgcctg agctggtgga ggtggaagtg 120

ggcagcacag cccttctgaa gtgcggcctc tcccagtccc aaggcaacct cagccatgtc 180

gactggtttt ctgtccacaa ggagaagcgg acgctcatct tccgtgtgcg ccagggccag 240

ggccagagcg aacctgggga gtacgagcag cggctcagcc tccaggacag aggggctact 300

ctggccctga ctcaagtcac cccccaagac gagcgcatct tcttgtgcca gggcaagcgc 360

cctcggtccc aggagtaccg catccagctc cgcgtctaca aagctccgga ggagccaaac 420

atccaggtca accccctggg catccctgtg aacagtaagg agcctgagga ggtcgctacc 480

tgtgtaggga ggaacgggta ccccattcct caagtcatct ggtacaagaa tggccggcct 540

ctgaaggagg agaagaaccg ggtccacatt cagtcgtccc agactgtgga gtcgagtggt 600

ttgtacacct tgcagagtat tctgaaggca cagctggtta aagaagacaa agatgcccag 660

ttttactgtg agctcaacta ccggctgccc agtgggaacc acatgaagga gtccagggaa 720

gtcaccgtcc ctgttttcta cccgacagaa aaagtgtggc tggaagtgga gcccgtggga 780

atgctgaagg aaggggaccg cgtggaaatc aggtgtttgg ctgatggcaa ccctccacca 840

cacttcagca tcagcaagca gaaccccagc accagggagg cagaggaaga gacaaccaac 900

gacaacgggg tcctggtgct ggagcctgcc cggaaggaac acagtgggcg ctatgaatgt 960

cagggcctgg acttggacac catgatatcg ctgctgagtg aaccacagga actactggtg 1020

aactatgtgt ctgacgtccg agtgagtccc gcagcccctg agagacagga aggcagcagc 1080

ctcaccctga cctgtgaggc agagagtagc caggacctcg agttccagtg gctgagagaa 1140

gagacaggcc aggtgctgga aagggggcct gtgcttcagt tgcatgacct gaaacgggag 1200

gcaggaggcg gctatcgctg cgtggcgtct gtgcccagca tacccggcct gaaccgcaca 1260

cagctggtca acgtggccat ttttggcccc ccttggatgg cattcaagga gaggaaggtg 1320

tgggtgaaag agaatatggt gttgaatctg tcttgtgaag cgtcagggca cccccggccc 1380

accatctcct ggaacgtcaa cggcacggca agtgaacaag accaagatcc acagcgagtc 1440

ctgagcaccc tgaatgtcct cgtgaccccg gagctgttgg agacaggtgt tgaatgcacg 1500

gcctccaacg acctgggcaa aaacaccagc atcctcttcc tggagctggt caatttaacc 1560

accctcacac cagactccaa cacaaccact ggcctcagca cttccactgc cagtcctcat 1620

accagagcca acagcacctc cacagagaga aagctgccgg agccggagag ccggggcgtg 1680

gtcatcgtgg ctgtgattgt gtgcatcctg gtcctggcgg tgctgggcgc tgtcctctat 1740

ttcctctata agaagggcaa gctgccgtgc aggcgctcag ggaagcagga gatcacgcta 1800

cccccgtctc gtaagagcga acttgtagtt gaagttaagt cagataagct cccagaagag 1860

atgggcctcc tgcagggcag cagcggtgac aagagggctc cgggagacca gggagagaaa 1920

tacatcgatc tgaggcatta g 1941

<210>3

<211>471

<212>PRT

＜213〉artificial sequence

<400>3

Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr

1 5 10 15

Pro Val Thr Lys Ala Arg Thr Pro Glu Met Pro Val Leu Glu Asn Arg

20 25 30

Ala Ala Gln Gly Asp Ile Thr Ala Pro Gly Gly Ala Arg Arg Leu Thr

35 40 45

Gly Asp Gln Thr Ala Ala Leu Arg Asp Ser Leu Ser Asp Lys Pro Ala

50 55 60

Lys Asn Ile Ile Leu Leu Ile Gly Asp Gly Met Gly Asp Ser Glu Ile

65 70 75 80

Thr Ala Ala Arg Asn Tyr Ala Glu Gly Ala Gly Gly Phe Phe Lys Gly

85 90 95

Ile Asp Ala Leu Pro Leu Thr Gly Gln Tyr Thr His Tyr Ala Leu Asn

100 105 110

Lys Lys Thr Gly Lys Pro Asp Tyr Val Thr Asp Ser Ala Ala Ser Ala

115 120 125

Thr Ala Trp Ser Thr Gly Val Lys Thr Tyr Asn Gly Ala Leu Gly Val

130 135 140

Asp Ile His Glu Lys Asp His Pro Thr Ile Leu Glu Met Ala Lys Ala

145 150 155 160

Ala Gly Leu Ala Thr Gly Asn Val Ser Thr Ala Glu Leu Gln Asp Ala

165 170 175

Thr Pro Ala Ala Leu Val Ala His Val Thr Ser Arg Lys Cys Tyr Gly

180 185 190

Pro Ser Ala Thr Ser Glu Lys Cys Pro Gly Asn Ala Leu Glu Lys Gly

195 200 205

Gly Lys Gly Ser Ile Thr Glu Gln Leu Leu Asn Ala Arg Ala Asp Val

210 215 220

Thr Leu Gly Gly Gly Ala Lys Thr Phe Ala Glu Thr Ala Thr Ala Gly

225 230 235 240

Glu Trp Gln Gly Lys Thr Leu Arg Glu Gln Ala Gln Ala Arg Gly Tyr

245 250 255

Gln Leu Val Ser Asp Ala Ala Ser Leu Asn Ser Val Thr Glu Ala Asn

260 265 270

Gln Gln Lys Pro Leu Leu Gly Leu Phe Ala Asp Gly Asn Met Pro Val

275 280 285

Arg Trp Leu Gly Pro Lys Ala Thr Tyr His Gly Asn Ile Asp Lys Pro

290 295 300

Ala Val Thr Cys Thr Pro Asn Pro Gln Arg Asn Asp Ser Val Pro Thr

305 310 315 320

Leu Ala Gln Met Thr Asp Lys Ala Ile Glu Leu Leu Ser Lys Asn Glu

325 330 335

Lys Gly Phe Phe Leu Gln Val Glu Gly Ala Ser Ile Asp Lys Gln Asp

340 345 350

His Ala Ala Asn Pro Cys Gly Gln Ile Gly Glu Thr Val Asp Leu Asp

355 360 365

Glu Ala Val Gln Arg Ala Leu Glu Phe Ala Lys Lys Glu Gly Asn Thr

370 375 380

Leu Val Ile Val Thr Ala Asp His Ala His Ala Ser Gln Ile Val Ala

385 390 395 400

Pro Asp Thr Lys Ala Pro Gly Leu Thr Gln Ala Leu Asn Thr Lys Asp

405 410 415

Gly Ala Val Met Val Met Ser Tyr Gly Asn Ser Glu Glu Asp Ser Gln

420 425 430

Glu His Thr Gly Ser Gln Leu Arg Ile Ala Ala Tyr Gly Pro His Ala

435 440 445

Ala Asn Val Val Gly Leu Thr Asp Gln Thr Asp Leu Phe Tyr Thr Met

450 455 460

Lys Ala Ala Leu Gly Leu Lys

465 470

<210>4

<211>29

<212>DNA

＜213〉artificial sequence

<400>4

aacatatggt gcccggagag gctgagcag 29

<210>5

<211>29

<212>DNA

＜213〉artificial sequence

<400>5

aagcggccgc cagctttctc tctgtggag 29

<210>6

<211>3129

<212>DNA

(213〉artificial sequence

<400>6

atggggcttc ccaggctggt ctgcgccttc ttgctcgccg cctgctgctg ctgtcctcgc 60

gtcgcgggtg tgcccggaga ggctgagcag cctgcgcctg agctggtgga ggtggaagtg 120

ggcagcacag cccttctgaa gtgcggcctc tcccagtccc aaggcaacct cagccatgtc 180

gactggtttt ctgtccacaa ggagaagcgg acgctcatct tccgtgtgcg ccagggccag 240

ggccagagcg aacctgggga gtacgagcag cggctcagcc tccaggacag aggggctact 300

ctggccctga ctcaagtcac cccccaagac gagcgcatct tcttgtgcca gggcaagcgc 360

cctcggtccc aggagtaccg catccagctc cgcgtctaca aagctccgga ggagccaaac 420

atccaggtca accccctggg catccctgtg aacagtaagg agcctgagga ggtcgctacc 480

tgtgtaggga ggaacgggta ccccattcct caagtcatct ggtacaagaa tggccggcct 540

ctgaaggagg agaagaaccg ggtccacatt cagtcgtccc agactgtgga gtcgagtggt 600

ttgtacacct tgcagagtat tctgaaggca cagctggtta aagaagacaa agatgcccag 660

ttttactgtg agctcaacta ccggctgccc agtgggaacc acatgaagga gtccagggaa 720

gtcaccgtcc ctgttttcta cccgacagaa aaagtgtggc tggaagtgga gcccgtggga 780

atgctgaagg aaggggaccg cgtggaaatc aggtgtttgg ctgatggcaa ccctccacca 840

cacttcagca tcagcaagca gaaccccagc accagggagg cagaggaaga gacaaccaac 900

gacaacgggg tcctggtgct ggagcctgcc cggaaggaac acagtgggcg ctatgaatgt 960

cagggcctgg acttggacac catgatatcg ctgctgagtg aaccacagga actactggtg 1020

aactatgtgt ctgacgtccg agtgagtccc gcagcccctg agagacagga aggcagcagc 1080

ctcaccctga cctgtgaggc agagagtagc caggacctcg agttccagtg gctgagagaa 1140

gagacaggcc aggtgctgga aagggggcct gtgcttcagt tgcatgacct gaaacgggag 1200

gcaggaggcg gctatcgctg cgtggcgtct gtgcccagca tacccggcct gaaccgcaca 1260

cagctggtca acgtggccat ttttggcccc ccttggatgg cattcaagga gaggaaggtg 1320

tgggtgaaag agaatatggt gttgaatctg tcttgtgaag cgtcagggca cccccggccc 1380

accatctcct ggaacgtcaa cggcacggca agtgaacaag accaagatcc acagcgagtc 1440

ctgagcaccc tgaatgtcct cgtgaccccg gagctgttgg agacaggtgt tgaatgcacg 1500

gcctccaacg acctgggcaa aaacaccagc atcctcttcc tggagctggt caatttaacc 1560

accctcacac cagactccaa cacaaccact ggcctcagca cttccactgc cagtcctcat 1620

accagagcca acagcacctc cacagagaga aagctgccgg agccggagag ccggggcggc 1680

ggcggcagcg gcggcggcag cggcggcggc agcgtgaaac aaagcactat tgcactggca 1740

ctcttaccgt tactgtttac ccctgtgaca aaagcccgga caccagaaat gcctgttctg 1800

gaaaaccggg ctgctcaggg cgatattact gcacccggcg gtgctcgccg tttaacgggt 1860

gatcagactg ccgctctgcg tgattctctt agcgataaac ctgcaaaaaa tattattttg 1920

ctgattggcg atgggatggg ggactcggaa attactgccg cacgtaatta tgccgaaggt 1980

gcgggcggct tttttaaagg tatagatgcc ttaccgctta ccgggcaata cactcactat 2040

gcgctgaata aaaaaaccgg caaaccggac tacgtcaccg actcggctgc atcagcaacc 2100

gcctggtcaa ccggtgtcaa aacctataac ggcgcgctgg gcgtcgatat tcacgaaaaa 2160

gatcacccaa cgattctgga aatggcaaaa gccgcaggtc tggcgaccgg taacgtttct 2220

accgcagagt tgcaggatgc cacgcccgct gcgctggtgg cacatgtgac ctcgcgcaaa 2280

tgctacggtc cgagcgcgac cagtgaaaaa tgtccgggta acgctctgga aaaaggcgga 2340

aaaggatcga ttaccgaaca gctgcttaac gctcgtgccg acgttacgct tggcggcggc 2400

gcaaaaacct ttgctgaaac ggcaaccgct ggtgaatggc agggaaaaac gctgcgtgaa 2460

caggcacagg cgcgtggtta tcagttggtg agcgatgctg cctcactgaa ttcggtgacg 2520

gaagcgaatc agcaaaaacc cctgcttggc ctgtttgctg acggcaatat gccagtgcgc 2580

tggctaggac cgaaagcaac gtaccatggc aatatcgata agcccgcagt cacctgtacg 2640

ccaaatccgc aacgtaatga cagtgtacca accctggcgc agatgaccga caaagccatt 2700

gaattgttga gtaaaaatga gaaaggcttt ttcctgcaag ttgaaggtgc gtcaatcgat 2760

aaacaggatc atgctgcgaa tccttgtggg caaattggcg agacggtcga tctcgatgaa 2820

gccgtacaac gggcgctgga attcgctaaa aaggagggta acacgctggt catagtcacc 2880

gctgatcacg cccacgccag ccagattgtt gcgccggata ccaaagctcc gggcctcacc 2940

caggcgctaa ataccaaaga tggcgcagtg atggtgatga gttacgggaa ctccgaagag 3000

gattcacaag aacataccgg cagtcagttg cgtattgcgg cgtatggccc gcatgccgcc 3060

aatgttgttg gactgaccga ccagaccgat ctcttctaca ccatgaaagc cgctctgggg 3120

ctgaaataa 3129

<210>7

<211>129

<212>PRT

＜213〉artificial sequence

<400>7

Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp

1 5 10 15

Val Leu Lys Ale Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp

20 25 30

Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp

35 40 45

Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn

50 55 60

Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu

65 70 75 80

Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser

85 90 95

Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly

100 105 110

Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro

115 120 125

Arg

<210>8

<211>386

<212>PRT

＜213〉artificial sequence

<400>8

Met Gly Ser Ser His His His His His His Gly Thr Lys Thr Glu Glu

1 5 10 15

Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys Gly Tyr Asn Gly Leu

20 25 30

Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr Gly Ile Lys Val Thr

35 40 45

Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe Pro Gln Val Ala Ala

50 55 60

Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala His Asp Arg Phe Gly

65 70 75 80

Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile Thr Pro Asp Lys Ala

85 90 95

Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp Ala Val Arg Tyr Asn

100 105 110

Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu Ala Leu Ser Leu Ile

115 120 125

Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys Thr Trp Glu Glu Ile

130 135 140

Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly Lys Ser Ala Leu Met

145 150 155 160

Glu Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro Leu Ile Ala Ala Asp

165 170 175

Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys Tyr Asp Ile Lys Asp

180 185 190

Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly Leu Thr Phe Leu Val

195 200 205

Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp Thr Asp Tyr Ser Ile

210 215 220

Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala Met Thr Ile Asn Gly

225 230 235 240

Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys Val Asn Tyr Gly Val

245 250 255

Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser Lys Pro Phe Val Gly

260 265 270

Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro Asn Lys Glu Leu Ala

275 280 285

Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp Glu Gly Leu Glu Ala

290 295 300

Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala Leu Lys Ser Tyr Glu

305 310 315 320

Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala Thr Met Glu Asn Ala

325 330 335

Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln Met Ser Ala Phe Trp

340 345 350

Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala Ser Gly Arg Gln Thr

355 360 365

Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Gly Thr Asp Tyr Asp Ile

370 375 380

Pro Thr

385

<210>9

<211>122

<212>PRT

＜213〉people

<400>9

Val Pro Gly Glu Ala Glu Gln Pro Ala Pro Glu Leu Val Glu Val Glu

1 5 10 15

Val Gly Ser Thr Ala Leu Leu Lys Cys Gly Leu Ser Gln Ser Gln Gly

20 25 30

Asn Leu Ser His Val Asp Trp Phe Ser Val His Lys Glu Lys Arg Thr

35 40 45

Leu Ile Phe Arg Val Arg Gln Gly Gln Gly Gln Ser Glu Pro Gly Glu

50 55 60

Tyr Glu Gln Arg Leu Ser Leu Gln Asp Arg Gly Ala Thr Leu Ala Leu

65 70 75 80

Thr Gln Val Thr Pro Gln Asp Glu Arg Ile Phe Leu Cys Gln Gly Lys

85 90 95

Arg Pro Arg Ser Gln Glu Tyr Arg Ile Gln Leu Arg Val Tyr Lys Ala

100 105 110

Pro Glu Glu Pro Asn Ile Gln Val Asn Pro

115 120

<210>10

<211>121

<212>PRT

＜213〉people

<400>10

Ile Gln Leu Arg Val Tyr Lys Ala Pro Glu Glu Pro Asn Ile Gln Val

1 5 10 15

Asn Pro Leu Gly Ile Pro Val Asn Ser Lys Glu Pro Glu Glu Val Ala

20 25 30

Thr Cys Val Gly Arg Asn Gly Tyr Pro Ile Pro Gln Val Ile Trp Tyr

35 40 45

Lys Asn Gly Arg Pro Leu Lys Glu Glu Lys Asn Arg Val His Ile Gln

50 55 60

Ser Ser Gln Thr Val Glu Ser Ser Gly Leu Tyr Thr Leu Gln Ser Ile

65 70 75 80

Leu Lys Ala Gln Leu Val Lys Glu Asp Lys Asp Ala Gln Phe Tyr Cys

85 90 95

Glu Leu Asn Tyr Arg Leu Pro Ser Gly Asn His Met Lys Glu Ser Arg

100 105 110

Glu Val Thr Val Pro Val Phe Tyr Pro

115 120

<210>11

<211>103

<212>PRT

＜213〉people

<400>11

Asn His Met Lys Glu Ser Arg Glu Val Thr Val Pro Val Phe Tyr Pro

1 5 10 15

Thr Glu Lys Val Trp Leu Glu Val Glu Pro Val Gly Met Leu Lys Glu

20 25 30

Gly Asp Arg Val Glu Ile Arg Cys Leu Ala Asp Gly Asn Pro Pro Pro

35 40 45

His Phe Ser Ile Ser Lys Gln Asn Pro Ser Thr Arg Glu Ala Glu Glu

50 55 60

Glu Thr Thr Asn Asp Asn Gly Val Leu Val Leu Glu Pro Ala Arg Lys

65 70 75 80

Glu His Ser Gly Arg Tyr Glu Cys Gln Gly Leu Asp Leu Asp Thr Met

85 90 95

Ile Ser Leu Leu Ser Glu Pro

100

<210>12

<211>130

<212>PRT

＜213〉people

<400>12

Glu His Ser Gly Arg Tyr Glu Cys Gly Gly Leu Asp Leu Asp Thr Met

1 5 10 15

Ile Ser Leu Leu Ser Glu Pro Glu Gln Leu Leu Val Asn Tyr Val Ser

20 25 30

Asp Val Arg Val Ser Pro Ala Ala Pro Glu Arg Gln Glu Gly Ser Ser

35 40 45

Leu Thr Leu Thr Cys Glu Ala Glu Ser Ser Gln Asp Leu Glu Phe Gln

50 55 60

Trp Leu Arg Glu Glu Thr Gly Gln Val Leu Glu Arg Gly Pro Val Leu

65 70 75 80

Gln Leu His Asp Leu Lys Arg Glu Ala Gly Gly Gly Tyr Arg Cys Val

85 90 95

Ala Ser Val Pro Ser Ile Pro Gly Leu Asn Arg Thr Gln Leu Val Asn

100 105 100

Val Ala Ile Phe Gly Pro Pro Trp Met Ala Phe Lys Glu Arg Lys Val

115 120 125

Trp Val

130

<210>13

<211>161

<212>PRT

＜213〉people

<400>13

Glu Ala Gly Gly Gly Tyr Arg Cys Val Ala Ser Val Pro Ser Ile Pro

1 5 10 15

Gly Leu Asn Arg Thr Gln Leu Val Asn Val Ala Ile Phe Gly Pro Pro

20 25 30

Trp Met Ala Phe Lys Glu Arg Lys Val Trp Val Lys Glu Asn Met Val

35 40 45

Leu Asn Leu Ser Cys Glu Ala Ser Gly His Pro Arg Pro Thr Ile Ser

50 55 60

Trp Asn Val Asn Gly Thr Ala Ser Glu Gln Asp Gln Asp Pro Gln Arg

65 70 75 80

Val Leu Ser Thr Leu Asn Val Leu Val Thr Pro Glu Leu Leu Glu Thr

85 90 95

Gly Val Glu Cys Thr Ala Ser Asn Asp Leu Gly Lys Asn Ser Ile Leu

100 105 110

Phe Leu Glu Leu Val Asn Leu Thr Thr Leu Thr Pro Asp Ser Asn Thr

115 120 125

Thr Thr Gly Leu Ser Thr Ser Thr Ala Ser Pro His Thr Arg Ala Asn

130 135 140

Ser Thr Ser Thr Glu Arg Lys Leu Pro Glu Pro Glu Ser Arg Gly Val

145 150 155 160

Val

<210>14

<211>27

<212>DNA

＜213〉artificial sequence

<400>14

catgccatgg tgcccggaga ggctgag 27

<210>15

<211>31

<212>DNA

＜213〉artificial sequence

<400>15

aagcttttag gggttgacct ggatgtttgg c 31

<210>16

<211>30

<212>DNA

＜213〉artificial sequence

<400>16

ccatgggtat ccagctccgc gtctacaaag 30

<210>17

<211>31

<212>DNA

＜213〉artificial sequence

<400>17

aagcttttac gggtagaaaa cagggacggt g 31

<210>18

<211>33

<212>DNA

＜213〉artificial sequence

<400>18

ccatgggtaa ccacatgaag gagtccaggg aag 33

<210>19

<211>34

<212>DNA

＜213〉artificial sequence

<400>19

aagcttttat ggttcactca gcagcgatat catg 34

<210>20

<211>28

<212>DNA

＜213〉artificial sequence

<400>20

ccatggaaca cagtgggcgc tatgaatg 28

<210>21

<211>31

<212>DNA

＜213〉artificial sequence

<400>21

aagcttttac acccacacct tcctctcctt g 31

<210>22

<211>25

<212>DNA

＜213〉artificial sequence

<400>22

ccatggaggc aggaggcggc tatcg 25

<210>23

<211>27

<212>DNA

＜213〉artificial sequence

<400>23

aagcttttag accacgcccc ggctctc 27

<210>24

<211>105

<212>PRT

＜213〉people

<400>24

Val Pro Gly Glu Ala Glu Gln Pro Ala Pro Leu Leu Val Glu Val Glu

1 5 10 15

Val Gly Ser Thr Ala Leu Leu Lys Cys Gly Leu Ser Gln Ser Gln Gly

20 25 30

Asn Leu Ser His Val Asp Trp Phe Ser Val His Lys Glu Lys Arg Thr

35 40 45

Leu Ile Phe Arg Val Arg Gln Gly Gln Gly Gln Ser Glu Pro Gly Glu

50 55 60

Tyr Glu Gln Arg Leu Ser Leu Gln Asp Arg Gly Ala Thr Leu Ala Leu

65 70 75 80

Thr Gln Val Thr Pro Gln Asp Glu Arg Ile Phe Leu Cys Gln Gly Lys

85 90 95

Arg Pro Arg Ser Gln Glu Tyr Arg Ile

100 105

<210>25

<211>66

<212>PRT

＜213〉people

<400>25

Pro Gln Glu Leu Leu Val Asn Tyr Val Ser Asp Val Arg Val Ser Pro

1 5 10 15

Ala Ala Pro Glu Arg Gln Glu Gly Ser Ser Leu Thr Leu Thr Cys Glu

20 25 30

Ala Glu Ser Ser Gln Asp Leu Glu Phe Gln Trp Leu Arg Glu Glu Thr

35 40 45

Gly Gln Val Leu Glu Arg Gly Pro Val Leu Gln Leu His Asp Leu Lys

50 55 60

Arg Glu

65

<210>26

<211>8

<212>PRT

＜213〉artificial sequence

<400>26

Gly Leu Thr Phe Thr Glu Tyr Thr

1 5

<210>27

<211>8

<212>PRT

＜213〉artificial sequence

<400>27

Ile Asn Pro Asn Asn Gly Gly Pro

1 5

<210>28

<211>9

<212>PRT

＜213〉artificial sequence

<400>28

Ala Arg Asn Gly Gly Asp Phe Ala Tyr

1 5

<210>29

<211>12

<212>PRT

＜213〉artificial sequence

<400>29

Gln Ser Leu Leu Tyr Ser Ser Asn Gln Glu Asn Tyr

1 5 10

<210>30

<211>3

<212>PRT

＜213〉artificial sequence

<400>30

Trp Ala Ser

1

<210>31

<211>9

<212>PRT

＜213〉artificial sequence

<400>31

Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr

1 5

<210>32

<211>116

<212>PRT

＜213〉artificial sequence

<400>32

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Thr Ser Gly Leu Thr Phe Thr Glu Tyr

20 25 30

Thr Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Thr Ile Asn Pro Asn Asn Gly Gly Pro Ser Tyr Asn Gln Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Asn Gly Gly Asp Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ala

115

<210>33

<211>113

<212>PRT

＜213〉artificial sequence

<400>33

Thr Leu Val Leu Thr Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly

1 5 10 15

Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser

20 25 30

Ser Asn Gln Glu Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln

35 40 45

Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val

50 55 60

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ala Leu Thr

65 70 75 80

Ile Ser Thr Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln

85 90 95

Tyr Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Glu Leu Glu Leu

100 105 110

Lys

<210>34

<211>8

<212>PRT

＜213〉artificial sequence

<400>34

Gly Phe Thr Phe Ser Thr Tyr Ala

1 5

<210>35

<211>7

<212>PRT

＜213〉artificial sequence

<400>35

Ile Ser Ser Gly Ser Arg Thr

1 5

<210>36

<211>8

<212>PRT

＜213〉artificial sequence

<400>36

Val Arg Gly Pro Ala Phe Ala His

1 5

<210>37

<211>11

<212>PRT

＜213〉artificial sequence

<400>37

Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr

1 5 10

<210>38

<211>3

<212>PRT

＜213〉artificial sequence

<400>38

Leu Val Ser

1

<210>39

<211>8

<212>PRT

＜213〉artificial sequence

<400>39

Cys Gln Gly Thr His Phe Ser Thr

1 5

<210>40

<211>114

<212>PRT

＜213〉artificial sequence

<400>40

Glu Val Lys Leu Glu Glu Ser Gly Glu Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Thr Pro Asp Lys Arg Leu Glu Trp Val

35 40 45

Ala Ser Ile Ser Ser Gly Ser Arg Thr Tyr Tyr Ser Asp Ser Val Lys

50 55 60

Gly Arg Ser Thr Ile Ser Arg Asp Asn Ala Arg Asn Asn Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Val

85 90 95

Arg Gly Pro Ala Phe Ala His Trp Gly Gln Gly Thr Leu Val Thr Val

100 105 110

Ser Ala

<210>41

<211>111

<212>PRT

＜213〉artificial sequence

<400>41

Asp Ile Val Met Thr Gln Ser Pro Leu Thr Leu Ser Val Thr Ile Gly

1 5 10 15

Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser

20 25 30

Asp Gly Lys Thr Tyr Leu Asn Trp Phe Leu Gln Arg Pro Gly Gln Ser

35 40 45

Pro Lys Arg Leu Ile Tyr Leu Val Ser Thr Leu Asp Ser Gly Val Pro

50 55 60

Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Cys Gln Gly

85 90 95

Thr His Phe Ser Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105 110

<210>42

<211>12

<212>PRT

＜213〉artificial sequence

<400>42

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser

1 5 10

Claims

1. people CD146 epitope, its aminoacid sequence is shown in SEQ ID NO:24 or the SEQID NO:25.

2. anti-people CD146 antibody is characterized in that the people CD146 epitope that it can specific recognition claim 1.

3. the anti-people CD146 antibody of claim 2 is characterized in that described antibody comprises heavy chain of antibody and light chain of antibody,

Wherein said heavy chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:26 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:27 and the CDR3 that is made up of the aminoacid sequence of SEQ IDNO:28 form,

Described light chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:29 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:30 and the CDR3 that is made up of the aminoacid sequence of SEQ ID NO:31 form.

4. the anti-people CD146 antibody of claim 3 is characterized in that the heavy chain of described antibody is made up of the aminoacid sequence of SEQID NO:32, and light chain is made up of the aminoacid sequence of SEQ ID NO:33.

5. the anti-people CD146 antibody of claim 2 is characterized in that described antibody comprises heavy chain of antibody and light chain of antibody,

Wherein said heavy chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:34 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:35 and the CDR3 that is made up of the aminoacid sequence of SEQ ID NO:36 form,

Described light chain of antibody comprises the CDR1 that forms as the aminoacid sequence by SEQ ID NO:37 of CDR, and CDR2 that is made up of the aminoacid sequence of SEQ ID NO:38 and the CDR3 that is made up of the aminoacid sequence of SEQ ID NO:39 form.

6. the anti-people CD146 antibody of claim 5 is characterized in that the heavy chain of described antibody is made up of the aminoacid sequence of SEQID NO:40, and light chain is made up of the aminoacid sequence of SEQ ID NO:41.

7. each the antibody of anti-people CD146 of claim 2-6 is used for the treatment of application in the pharmaceutical composition of tumour in preparation.

8. the application of claim 7, wherein said tumour are melanoma, liver cancer, carcinoma of the pancreas.

9. each the antibody of anti-people CD146 of claim 2-6 is used for the application of diagnostic reagent of imaging level diagnosis of the human tumor of target CD146 in preparation.

10. pharmaceutical composition that is used for the treatment of tumour, it comprises each anti-people CD146 antibody and pharmaceutical carrier of claim 2-6.

11. secrete the hybridoma cell strain of anti-people CD146 antibody, preserving number is respectively CGMCC NO:2310 and CGMCC NO:2311.

12. the nucleic acid of the polypeptide that can assemble with each the other antibody chain that defines below of encoding, wherein said polypeptide is any of following polypeptide

A) heavy chain of antibody, it is selected from claim 3 or 5 defined heavy chain of antibody;

B) light chain of antibody, it is selected from claim 3 or 5 defined light chain of antibody.

13. one kind comprises the expression of nucleic acids carrier according to claim 12, it can express described nucleic acid in protokaryon or eukaryotic host cell.

14. protokaryon or eukaryotic host cell, it comprises the carrier according to claim 13.

15. a method for preparing in conjunction with the antibody of people CD146 is characterized in that in protokaryon or eukaryotic host cell expressing according to the nucleic acid of the encoding antibody heavy chain of claim 12 and the nucleic acid of encoding antibody light chain, and reclaim described polypeptide from described cell.

16. a method that detects people CD146, it utilizes each anti-people CD146 antibody of claim 2-6, is undertaken by enzyme-linked immunosorbent assay.

17. the method for claim 16, wherein said enzyme-linked immunosorbent assay is sandwich enzyme-linked immunoabsorption, wherein with each one or more of anti-people CD146 antibody of claim 2-4 as capture antibody, with the mouse monoclonal antibody AA98 among the Chinese patent ZL 991075862 as detecting antibody.

18. the method for claim 16 or 17, wherein said people CD146 is present in people's body fluid.

19. the method for claim 17, wherein said body fluid is tissue juice, serum, lymph liquid or cerebrospinal fluid.

20. each the derivative of antibody of anti-people CD146 of claim 2-6, wherein said derivative are described antibody and biomarker, antitumor drug, toxin, radioactivity agent bonded product.