CN101241137A - Pig cysticercosis gold-labelled rapid diagnosis reagent - Google Patents

Abstract

The present invention relates to a rapid diagnose reagent for detecting cysticercosis and preparation thereof. The said reagent is a colloidal gold testing paper bar. The cysticercus cellulosae of present invention employs artificial clone taenia solium recombinant antigen, the anti cysticercus cellulosae immunoglobulin is obtained by artificial clone taenia solium recombinant antigen immune animals.

Description

A kind of pork measles gold-labelled rapid diagnosis reagent

Technical field

The present invention relates to a kind of be used to the detect fast diagnosis reagent of pork measles (Cysticercosis) and the preparation method of this fast diagnosis reagent.This diagnostic reagent of the present invention is a kind of colloidal gold colloidal gold detection test paper strip.

Background technology

Pork measles (Cysticercosis) is that larva one cysticercus cellulosae (Cysticercosis cellulosae) by taeniasis suis (Taenia solium) parasitizes intermediate hosts such as people or pig, wild boar and a kind of food source property people beast of causing suffers from parasitic disease altogether.This disease is ubiquity worldwide, is an important public health problem in the most of area of China.Being listed in meat import and export, slaughtered animals and the Chinese government in this disease of China proposes to allow the people be able to eat the Amphixenosis that " quality-assured meat " must be examined.The sick on-site investigation of finishing in 2004 according to the Ministry of Public Health of national human body important parasite shows, the average infection rate of whole nation band tapeworm is 0.28%, what the national parasite of human of finishing than nineteen ninety distributed that investigation finds 0.18% has risen 52.47%, the number of calculating whole nation band cestode infection is 550,000, wherein cysticercosis has been investigated 96008 people, and positive rate reaches 0.58%.Cysticercus parasitizes the muscle of human body and each histoorgan people's health is produced harm, cause usually epileptic attack, cranium press increase, phrenoblabia, symptom such as blind, tend to make the people to disable even threat to life as untimely treatment or malpractice.Cysticercosis is also restricting the development of pig industry and meat product processing industry in addition.

So far, domestic inspection or the immunological method of cuing open after generally adopt killing detects the quarantine that circulating antibody in the serum is realized pork measles.Wherein serology detects and all derives from capsule liquid or somatic antigen with antigen, the outstanding problem that exists is that the collection of polypide is subjected to the restriction of objective condition (as acquisition approach difficulty, the source shortage, limited amount), the preparation of purifying antigen is loaded down with trivial details, quantity and specificity and susceptibility reduce, and often are easy to occur false positive and false-negative problem in serological test.Utilizing the genetic engineering recombinant antigen to prepare diagnostic reagent is a kind of desirable approach that solves the cysticercosis immunodiagnosis.The cysticercus high molecular weight protein in diagnosis owing to cross reaction is arranged with other tapeworm, specificity is low, thereby mainly lay particular emphasis on the research of low molecular weight protein (LMWP) (usually less than 30ku) cysticercus diagnostic antigen at present, as 8ku albumen, referring to Kathy Hancock, Azra Khan, Fatima B.Williams, et al.Characterization of the 8-Kilodalton Antigens of Taenia soliumMetacestodes and Evaluation of Their Use in an Enzyme-Linked ImmunosorbentAssay for Serodiagnosis[J] .Journal of Clinical Microbiology.2003,41 (6): 2577-2586,10ku albumen, referring to Chung JY, Bahk YY, Huh S, et al.A recombinant 10kDa protein ofTaenia solium metacestodes specific to active neurocysticercosis[J] .The Journal ofInfectious disease, 2000,181 (5): 1870-1872,14ku albumen, referring to Marcia RamosMonteiro da Silva Augusto Mendes Maia, et al.Recombinant expression ofTaenia solium TS14 antigen and its utilization for immunodiagnosis ofneurocysticercosis[J] .Acta Tropica, 2006,100 (3): 192-198,24ku albumen, referring to KathyHancock, Sowmya Pattabhi, Fatima W, et al.Characterization and cloning of T24, aTaenia solium antigen diagnostic for cysticercosis[J] .Molecular and BiochemicalParasitology, 2006,147 (1): 109-117 etc.

The prenatal diagnosis of cysticercosis is very difficult, there are certain deficiency in existing amynologic diagnostic method such as indirect hemagglutination test, enzyme linked immunosorbent assay (ELISA), enzyme linked immunological seal stain methods such as (ELIB) on running program and aspect the adaptability, detection is had relatively high expectations to checkout equipment, environmental baseline, operative skill as ELISA, the restriction that the also examined cycle is long simultaneously, short run detects factors such as cost height also is difficult to apply in pig slaughtering enterprise at present.For this reason, seeking a kind of easy, quick, accurate, the detection method that can implement execute-in-place, is effectively to implement the livestock products security control and guarantee the important technology guarantee that these laws and regulations are implemented.

The colloidal gold immunochromatographimethod technology is a kind of a kind of novel vitro diagnostic techniques that several different methods such as colloidal gold-labeled method, immunoassay technology, chromatographic analysis technology, monoclonal antibody technique and new material technology are organically combined that closely develops rapidly during the last ten years.It has simply fast, the result is clear and definite, need not advantages such as complex operations skill and specific installation, and the title of " ELISA that concentrates " is arranged, and has become a new direction clinical and that the quarantine diagnostic field develops.This technology is to set up to form on the immunity percolation technical foundation, and it just changes original vertical transudation into horizontal chromatography effect, but this improvement has driven the revolution of qualitative diagnostic reagent just.

The report that domestic application colloidal gold technique detects pork measles mainly contains: (Zhang Honghua such as Zhang Honghua, Wang Changyuan, Ge Lingyun etc. the dyeing of gold mark specific antigen monoclonal antibody spot immune gold is used to detect the Chinese preventing and treating verminosis magazine of research [J] .1994 of cerebral cysticercosis circulating antigen, 7 (1): 35-37.) use golden mark pork measles cyst fluid antigen, utilize the circulating antigen in the monoclonal antibody detection cerebral cysticercosis patient cerebrospinal fluid, positive rate can reach 88.09%.Liu Yubing (Liu Yubing, Xu Hongxiu, Wang Changyuan etc. application [J] the endemic disease circular .2001 of gold-marking immunity percolation in the cerebral cysticercosis diagnosis, 16 (2): 11-13. Liu Yu ice, Zhang Honghua, Xu Hongxiu, Deng. drip the research [J] that golden immunoassay is used to detect cysticercosis patient circulating antigen. Chinese Amphixenosis's magazine .2002,18 (2): 84-86.) 2 strain monoclonal antibodies of the anti-pork measles cyst fluid antigen of application, set up the gold-marking immunity percolation, detect the circulating antigen in the cerebrospinal fluid, positive rate reaches 77.8～93.75%; Set up the gold-marking immunity chromatography afterwards again, detected activity cerebral cysticercosis human serum positive rate reaches 80.77%, and inactivity cerebral cysticercosis human serum positive rate reaches 55%.In the front yard etc. (in the front yard, Liu Sufang, citrine, Deng. dot immunogold filtration assay detects the research [J] of cysticercus antibody in the serum. Chinese public health .2000,16 (12): 1139-1140.) with golden mark method and 57 portions of cysticercus of enzyme linked immunosorbent assay comparison and detection patients serum sample, all positive 54 parts of 2 methods, all negative 1 part of 2 methods, total coincidence rate is 95%.(HuangBing Cheng such as HuangBing Cheng, Li Guiping, Jia Fengju, Deng. the anti-people's monoclonal antibody of gold mark soaks surveys experiment to the research [J] of cerebral cysticercosis diagnosis with therapeutic evaluation. Chinese preventing and treating verminosis magazine .2000,13 (4): 273-275.) with anti-human IgG 4 monoclonal antibody detected activity cerebral cysticercosis patients 80 examples of gold mark, positive rate is 91.3%; Detect inactivity patient 19 examples, 2 examples are positive.(Yuan Jianhua such as Yuan Jianhua, Gan Shaobai, Chen Zhiyong. the development of cysticercus IgG colloidal gold diagnosis kit (chromatography) and examination [J]. Chinese Amphixenosis's magazine .2001,17 (6): 59-61.) take the lead in succeeding in developing IgG gold mark chromatography (single stage method) diagnostic kit that is used for the cysticercosis diagnosis at home and abroad, through its susceptibility of clinical examination is 93.23%, specificity is 97.37%, the cross reacting rate that this kit detects Echinococcus hydatid cyst serum is 45%, with parasitic disease human serum no cross reactions such as blood fluke, liver fluke, lung flukes.(Tang Yude such as Tang Yude, Zhou Dongming, Lu Chengping. the foundation of the golden immunochromatographic method of fast detecting pork measles antibody and application [J]. Chinese Amphixenosis's magazine .2003,19 (5): 77-79.) set up the golden immunochromatographic method of fast detecting pork measles antibody, with ELISA is contrast, and the rate that conforms to that both detect cysticercus antibody reaches 96.8%.Above method all point out immune colloid gold quick diagnosis method easy, quick, be suitable for basic unit and apply, can be used for the diagnosis and the epidemiology survey of cysticercosis.

Chinese invention patent application 200610050841.9 discloses a kind of diagnosis pork measles spot gold-marking immunity diafiltration kit and preparation and application process, this patented claim is to be solid phase carrier with the nitrocellulose filter, the blood sample to be checked of absorption pig, with cysticercosis cellulosae antigen and collaurum bond is liquid phase, and simultaneously as probe and indicator, when antigen combines with the corresponding antibody part, gold grain is assembled in a large number in the antibody ligand site, just forms macroscopic punctation.The kit of this patented claim when using with the dried paper leachate of tested pig blood sample or serum dilution 1 μ L point on nitrocellulose filter, add cleansing solution 100 μ L, drip cysticercosis cellulosae antigen collaurum 100 μ L again, promptly form or do not form punctation in 2-3 minute, its result judges more or less freely, and it is low to detect cost, have sensitivity, special, recall rate is high, the saving of labor, save time, advantage such as blood-sample withdrawal is convenient, use in the fields such as pork measles diagnosis and circulation market quarantine that are applicable to.

But the used diagnostic antigen of above-mentioned report is cyst fluid antigen or somatic antigen, and the outstanding problem of existence is an antigen source difficulty, and purifying is loaded down with trivial details, is easy to occur false positive or false-negative problem.And preparing the monoclonal antibody of anti-pork measles cyst fluid antigen, production cost is higher, and the monoclonal antibody cell line preserves and have relatively high expectations, and is easy to out the active phenomenon.

Summary of the invention

The invention provides a kind of pork measles colloidal gold colloidal gold detection test paper strip that overcomes the prior art deficiency and preparation method thereof.

Test strips of the present invention comprises that tandem array is fixed in the application of sample water accepting layer that constitutes with porous fibrous material on the PVC lining material successively, is positioned at application of sample water accepting layer tail end and the gold-marking binding pad that is adsorbed with pork measles gold mark antigen that links to each other with the application of sample water accepting layer, link to each other with the gold-marking binding pad tail end reacting pad that is made of nitrocellulose filter and the absorption layer that is made of absorbent material that links to each other with the reacting pad tail end, wherein is coated with the detection zone that is made of cysticercosis cellulosae antigen and the Quality Control district that is made of pork measles antibody that is positioned at the detection zone downstream on reacting pad respectively.The used cysticercosis cellulosae antigen of the present invention has adopted the taeniasis suis recombinant antigen of artificial clone's preparation, and used anti-pork measles immunoglobulin (Ig) is to obtain with the taeniasis suis recombinant antigen immune animal that artificial clone prepares.

Can be the TSOL18 recombinant antigen of the taeniasis suis hexacanth embryo of artificial preparation at the employed cysticercosis cellulosae antigen of pork measles gold test strip bar of the present invention.And the TSOL18 recombinant antigen of this taeniasis suis hexacanth embryo to be the 18ku encoding gene that adopts technique for gene engineering will come from the taeniasis suis hexacanth embryo carry out RT-PCR, the PCR product is building up to obtains recombinant plasmid on the carrier for expression of eukaryon, the recombinant plasmid electricity is transformed into the yeast competent cell obtains recombinant bacterial strain, the bacterium abduction delivering of will recombinating again obtains recombinant protein, with this protein Preparation gold mark antigen and the detected district of bag; The 18ku gene that using gene engineering technique will come from the taeniasis suis hexacanth embryo carries out PCR, again the PCR product cloning is arrived the expression vector establishment prokaryotic expression carrier, behind abduction delivering, obtain fusion, use the fusion protein immunization animal, extract the serum of immune animal, therefrom separate obtaining anti-fusion antibody, with this polyclonal antibody bag by the Quality Control district.

In an embodiment of the present invention, used cysticercosis cellulosae antigen is that the 18ku gene that will come from the taeniasis suis hexacanth embryo carries out RT-PCR, products therefrom makes up carrier for expression of eukaryon pPIC9K-TSOL18, and electricity transforms Pichia pastoris GS115 competent cell, the recombinant protein that obtains through abduction delivering; And the 18ku gene that using gene engineering technique will come from the taeniasis suis hexacanth embryo carries out PCR, again the PCR product cloning is arrived expression vector pGEX-4T-1, make up prokaryotic expression carrier pGEX-TSOL18/BL21, behind abduction delivering, obtain fusion, use the fusion protein immunization animal, extract the serum of immune animal, therefrom separate obtaining anti-fusion antibody, with this polyclonal antibody bag by the Quality Control district.

Can also be provided with the whole blood filtration unit at the application of sample water accepting layer on the pork measles gold test strip bar of the present invention.

Pork measles gold test strip bar preparation method of the present invention is:

A. collect the taeniasis suis worm's ovum, after chemical method hatching and activating, extract the total RNA of hexacanth embryo,, and design and synthesize the expression primer according to the nucleotide sequence of TSOL18 gene through RT-PCR amplification TSOL18 encoding gene;

B. the pcr amplification product of recycling step a; The pcr amplification product that reclaims is carried out double digestion with restriction enzyme, the PCR product is building up to obtains recombinant plasmid on the carrier for expression of eukaryon, the recombinant plasmid electricity is transformed into the yeast competent cell, obtains recombinant bacterial strain, the bacterium abduction delivering of will recombinating again obtains recombinant antigen protein;

C. reclaim a step gained PCR product, again the PCR product cloning is arrived the expression vector establishment prokaryotic expression carrier, obtain fusion behind the abduction delivering, use the fusion protein immunization animal, extract the serum of immune animal, therefrom separate obtaining anti-fusion polyclonal antibody;

D. prepare collaurum, prepare gold mark antigen with prepared collaurum with by b gained recombinant antigen again;

E. the golden indicated weight group antigen with the d gained fully is adsorbed in the porous water-absorbing material, obtains gold-marking binding pad;

F. on the reacting pad of nitrocellulose filter, set respectively by the detection zone of b gained recombinant antigen bag quilt with by the Quality Control district of c step gained polyclonal antibody bag quilt, and make the zone of leaving one section blank between detection zone on the reacting pad and the Quality Control district by designing requirement;

G. absorbent material, gold-marking binding pad, nitrocellulose filter reacting pad and another section absorbent material are fixed on the substrate of impermeable material successively, make each storeroom keep tandem array, and make the detection zone on the reacting pad be positioned at the application of sample side, by designing requirement the substrate that fixes is cut into required bar, obtains described pork measles gold test strip bar.

Among the embodiment that the present invention provides, pork measles gold test strip bar preparation method is:

A. the total RNA with the taeniasis suis hexacanth embryo is a template, carries out RT-PCR with upstream primer R:5 ' TCT CTC CGAAAC AAT GAG TTA 3 ' and downstream primer F:5 ' TAA TAG ATA CCC ATT TTC ATCACA 3 ', and the products therefrom purifying reclaims;

B. make up cloning vector pGEX-TSOL18 with a gained taeniasis suis hexacanth embryo TSOL18;

C. be template with the pGEX-TSOL18 plasmid, with

Upstream primer P1:5 ' CGA GAATTCGACATTTTCGTTCCATACCTT3 '

EcoRI

Downstream primer P2:5 ' TAG CGGCCGCTCACTACGATCTTCGGACCTTC3 '

NotI

Carry out pcr amplification, the products therefrom purifying reclaims;

D. get C step gained purified product and pPIC9K vector plasmid and use the EcoRI/NotI double digestion respectively, reclaiming the back with Agarose Gel DNA Extraction Kit again connects, connect product and change escherichia coli jm109 competent cell over to, obtain the pPIC9K-TSOL18 plasmid, use the linearization of Sal I single endonuclease digestion again, electricity transforms the Pichia pastoris competent cell, and multi-copy strains pPIC9K-TSOL18/GS115 obtains recombinating;

E. pPIC9K-TSOL18/GS115 is carried out Continuous Cultivation in fermentation tank, obtain the TSOL18 recombinant protein;

F. be template with b step gained pGEX-TSOL18, amplification TSOL18 encoding gene makes up prokaryotic expression carrier pGEX-TSOL18/BL21, behind abduction delivering, collect thalline, immunize rabbit behind the purifying is gathered and the separating immune rabbit anteserum, and purifying obtains the IgG of the anti-TSOL18-GST polyclonal antibody of rabbit;

G. prepare collaurum, prepare gold mark antigen with prepared collaurum with by e gained recombinant antigen again;

H. the golden indicated weight group antigen with the g gained fully is adsorbed in the porous water-absorbing material, obtains gold-marking binding pad;

I. on the reacting pad of nitrocellulose filter, be provided with respectively by the detection zone of e gained recombinant antigen bag quilt with by the Quality Control district of f step gained polyclonal antibody bag quilt, and make the zone of leaving one section blank between detection zone on the reacting pad and the Quality Control district by designing requirement;

J. absorbent material, gold-marking binding pad, nitrocellulose filter reacting pad and another section absorbent material are fixed on the substrate of impermeable material successively, make each storeroom keep tandem array, and make the detection zone on the reacting pad be positioned at the application of sample side, by designing requirement the substrate that fixes is cut into required bar, obtains described pork measles gold test strip bar.

Pork measles gold test strip bar preparation method of the present invention also can also be provided with the whole blood filtration unit on the application of sample water accepting layer.

The present invention has the following advantages compared to existing technology:

1 the present invention adopts artificial clone to prepare reorganization cysticercus antigen, solved antigen source difficulty in the prior art, purifying is loaded down with trivial details, be easy to occur false positive or false-negative problem, it is easy, with low cost to adopt artificial clone's preparation cysticercus antigen not only to originate, the batch process of also can fermenting, quality are easy to control.Particularly the taeniasis suis hexacanth embryo TSOL18 recombinant antigen preparation of the present invention's utilization detects box, its antigen has not only that composition is single, specificity is stronger, with low cost and advantage such as can in the laboratory, prepare in a large number, and can solve the problem in antigen source easily.

2 in specific embodiments of the invention, have made up carrier for expression of eukaryon pPIC9K-TSOL18/GS115, have realized the glycosylation modified of expressing protein, have obtained to have the recombinant protein TSOL18 of native protein characteristic, and have good immunocompetence.Can efficiently express in the fermentation tank level, it is 2.54g/L that every liter of fermentation liquor can obtain TSOL18 recombinant protein amount; Behind the SephacrylS-300HR purifying, obtain the single band of the about 16ku of size, the thin layer scanning purity assay surpasses 90%.This TSOL18 that has the native protein characteristic, can produce in enormous quantities detects that pork measles detects test paper or other pick-up unit all has a good application prospect and promotional value being used for preparing.

The recombinant antigen that is used for immune animal that 3 the present invention are prepared is big than the TSOL18 molecular weight, therefore has better immunogenicity, the anti-TSOL18-GST polyclonal antibody of the rabbit that the height that is easy to get is tired behind immunizing rabbit.

The 4 domestic present reports that have application TSOL18 to detect pork measles as diagnostic antigen of not seeing.Have the recombinant protein of report all to come from the cysticercus cellulosae gene stage, and adopt the escherichia expression system can not glycosylation, influenced the antigen active of recombinant protein, and the carrier part of fusion easily produces cross reaction, cause false positive.Select eukaryotic expression system then can overcome the shortcoming of prior art.

5 gold test strip bars of the present invention adopt single stage method when detecting pork measles, have higher specificity and susceptibility, and it detects fast, and the result finishes in judging in 10-15min, need not special Experimental Establishment, experiment condition and special operating personnel.

6 test strips preparation methods of the present invention have simple for production, the characteristics of stability, good reproducibility.Test strips particularly of the present invention is provided with the whole blood filtration unit, can greatly on-the-spot convenient the use.

Description of drawings

Fig. 1 is a process route chart of the present invention

Fig. 2 is a structural representation of the present invention, and wherein: 1 is handheld terminal absorbent filter layer, and 2 is NC film reaction bed course, and 3 is golden indicated weight group antigen bed course, and 4 is test lead glass fibre water accepting layer, and 5 is nature controlling line, and 6 is detection line, and 7 is the PVC liner plate.

Fig. 3 judges synoptic diagram for result of the present invention, wherein :+expression pig standard positive serum reaction result; The suspicious pig anteserum sample reaction result of ± expression;-expression pig standard female seroreaction result; Inefficacy is meant that the Quality Control district does not have any demonstration, and test strips lost efficacy in this case, can not be used for detecting.

Fig. 4 is the design of graphics of carrier for expression of eukaryon pPIC9K-TSOL18/GS115.

Fig. 5 is TSOL18 gene PCR amplification figure, and among the figure: 1 is DL2000 nucleic acid Marker; 2 TSOL18 genes for the RT-PCR acquisition.

Fig. 6 cuts for recombinant expression plasmid pPIC9K-TSOL18 enzyme and identifies and pcr analysis that wherein: 1 is the PCR product of TSOL18; 2 is the PCR product of EcoRI and NotI double digestion pPIC9K-TSOL18; 3 is DL2000 nucleic acid Marker.

Fig. 7 is that the PCR of recombinant bacterial strain identifies, wherein: the 1 PCR product for pPIC9K-TSOL18/GS115 reorganization bacterium; 2 is DL2000 nucleic acid Marker.

Fig. 8 is the SDS-PAGE electrophoretogram behind TSOL18 expressing protein and the purifying, and among the figure: M is the low molecular weight protein (LMWP) standard; The 1st, the expression product TSOL18 of methanol induction 72h in the 5L fermentation tank; The 2nd, the TSOL18 albumen behind the SephacrylS-300HR column chromatography purification.

Fig. 9 is expression product and the purifying SDS-PAGE electrophoretogram of TSOL18-GST, and among the figure: M is the molecular weight of albumen standard; 1 is the TSOL18-GST fusion of affinity purification; 2 for inducing back cellular lysate supernatant; 3 for inducing back cellular lysate precipitation.

Figure 10 is the anti-TSOL18-GST IgG of a purified rabbit SDS-PAGE electrophoretogram, and wherein: M is the low molecular weight protein (LMWP) standard; The 1st, the IgG of the anti-TSOL18-GST albumen of the rabbit of purifying.

Embodiment

The present invention is described in further detail in conjunction with the embodiments:

Embodiment one (the reorganization diagnostic antigen prepares embodiment)

The clone of taeniasis suis hexacanth embryo TSOL18 gene and the structure of carrier for expression of eukaryon pPIC9K-TSOL18/GS115 thereof

The clone of 1 taeniasis suis hexacanth embryo TSOL18 gene

1.1PCR primer design is with synthetic

Go up the taeniasis suis hexacanth embryo TSOL18 nucleotide sequence (AF017788) of login according to GeneBank, with a pair of primer R of DNAStar software design and F.Upstream primer R is from the code area initiation codon, and downstream primer F is 3 ' end non-coding area sequence.Institute's amplified fragments comprises the entire reading frame frame of TSOL18 gene between the primer of upstream and downstream.Primer is synthetic by precious bioengineering (Dalian) company limited.

Upstream primer R:5 ' TCT CTC CGA AAC AAT GAG TTA 3 '

Downstream primer F:5 ' TAA TAG ATA CCC ATT TTC ATC ACA 3 '

1.2 the amplification and the recovery of taeniasis suis hexacanth embryo TSOL18 encoding gene

Collect the taeniasis suis worm's ovum, after the chemical method hatching and activating, extract the total RNA of hexacanth embryo through the Trizol method, through RT-PCR post transcription cloning TSOL18 gene.

The RT-PCR amplification system is: Total RNA suspension 10 μ l, and OligodT primer 1 μ l, 85 ℃ of pre-sex change 5min place ice bath 5min rapidly behind the mixing.Add 5 * reverse transcriptase damping fluid, 4 μ l then, RNasin (50u/ μ l) 0.5 μ l, 2.5mM dNTP Mixture 1 μ l, reverse transcriptase (AMV) is 1 μ l (10u/ul), and sterilization DEPC water adds to 20 μ l, behind the mixing, 42 ℃ of water-bath 1h, 95 ℃ of 5min deactivation reverse transcriptase afterwards.

Double-stranded cDNAPCR amplification system is: reverse transcription product 10 μ l, 10 * PCR buffer (Mg ²⁺Free) 5 μ l, 2.5mM dNTP Mixture 2 μ l, each 1 μ l of upstream and downstream primer (50pmol/ μ l), 25mM MgCl ₂3 μ l, the sterilization distilled water adds to 50 μ l.The PCR reaction conditions is: behind 95 ℃ of pre-sex change 5min, add 1 μ l (5U/ μ l) TaqDNA polymerase, carry out 30 circulations (94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 5min), last 72 ℃ are extended 5min.After amplification is finished, get PCR product 5 μ l and (contain 0.5 μ g/ml ethidium bromide, EB) electrophoretic analysis, the TSOL18 genetic fragment (Fig. 5) of the about 393bp of size that increases with 1.2% Ago-Gel; The PCR product reclaims the kit purifying fast through dna gel and reclaims.

The structure of 2 taeniasis suis hexacanth embryo TSOL18 cloning vector pGEX-TSOL18

After getting pGEM-T easy cloning vector (available from Promega company) 1 μ l (5 μ g/ μ l) and glue recovery purifying purpose fragment 3 μ L mixing, add 2 * rapid ligase buffer, 5 μ l, T ₄Dna ligase 1 μ l (3u/ μ l), the rearmounted 4 ℃ of connections of spending the night of mixing; Transformed into escherichia coli JM109, screening positive clone, alkaline lysis extract plasmid in a small amount, after agarose gel electrophoresis, pcr amplification and digestion with restriction enzyme are identified, confirm that its size conforms to expection, brilliant safe biotech company this fragment of order-checking confirmation does not have the base mispairing through Shanghai.With DNAstar software sequence is analyzed, and carried out homology relatively, confirm that homology is 99.45% with reported sequence.

The structure of 3 taeniasis suis hexacanth embryo TSOL18 carrier for expression of eukaryon pPIC9K-TSOL18/GS115

3.1 express primer design with synthetic

Nucleotide sequence according to the TSOL18 gene that checks order; read the design of the frame outside with DNA Star software at it and express primer; removing the signal peptide sequence of the 51bp that is positioned at 5 ' end (does so promptly and can too much influence not arranged to the structure and the function of encoding proteins; also can increase solubility expression to a certain extent); and according to the preferences of Pichia pastoris codon (referring to Zhao Xiang; Huo Keke; Li Yuyang. the password usage analysis of Pichia pastoris. the bioengineering journal; 2000; 16 (3): 308-311); under the prerequisite that does not change its amino acid sequence; with poor efficiency codon GAT; GTG same sense mutation is high usage codon GAC and GTT, expresses primer 5 ' end and adds EcoRI and NotI restriction enzyme site and 6 protectiveness bases respectively.Institute's amplified fragments is 342bp between the upstream and downstream primer.Primer is synthetic by precious biological (Dalian) engineering corporation.

The TSOL18 gene

Upstream primer P1:5 ' C GAGAATTCGACATTTTCGTTCCATACCTT3 '

EcoRI

Downstream primer P2:5 ' TAG CGGCCGCTCACTACGATCTTCGGACCTTC3 '

NotI

PPIC9K plasmid vector primer:

5′ AOX 1，5′-GACTGGTTCCAATTGACAAGC-3′

3′ AOX 1，5′-GCAAATGGCATTCTGACATCC-3′

PPIC9K plasmid vector primer is that template is carried out pcr amplification in order to reorganization multi-copy strains genomic DNA, proves whether the TSOL18 gene has been incorporated in the GS115 chromosomal DNA.

3.2 the structure of expression vector pPIC9K-TSOL18/GS115

With the pGEX-TSOL18 plasmid that checks order correct is template, is primer amplification TSOL18 fragment with the P1, the P2 that are with restriction enzyme site.Pcr amplification system 50 μ L include template 1 μ L, 10 * PCR buffer, 5 μ L, P1, each 0.5 μ L of P2 primer (20 μ M), Taq enzyme 1ul, 2.5mMdNTP 4 μ L, 25mM MgCl ₂4 μ L, the sterilization distilled water adds to 50 μ L.Amplification condition: 95 ℃ of pre-sex change, 5min; 35 circulations (94 ℃, 50s; 56 ℃, 40s; 72 ℃, 1min); 72 ℃ are extended 10min again.After amplification is finished, get PCR product 5 μ L and (contain 0.5 μ g/mL ethidium bromide, EB) electrophoresis detection, the DNA fragment specific of acquisition 342bp with 1.0% Ago-Gel; The PCR product reclaims the kit purifying fast through dna gel and reclaims.

PCR purified product and pPIC9K vector plasmid are used the EcoRI/NotI double digestion respectively, reclaim the back with AgaroseGel DNA Extraction Kit and connect, connect product and change escherichia coli jm109 competent cell (CaCl over to ₂The method preparation).Linked system: enzyme is cut purpose fragment 7 μ L, enzyme is cut carrier 1 μ L, 10 * Ligationbuffer, 1 μ L, T ₄DNA (3u/ μ L) ligase 1 μ L, mixing put 16 ℃ and connect 12h, transformed into escherichia coli JM109, and screening positive clone, alkaline lysis extract plasmid in a small amount.Recombinant plasmid pPIC9K-TSOL18 the specific band of 342bp occurs after pcr amplification and the evaluation of restriction enzyme EcoR I/Xho I double digestion, conform to the size of its intended purposes fragment (Fig. 6).Cut the recombinant bacterial strain that is accredited as the positive through enzyme and send the order-checking of Dalian precious bioengineering company limited, result and expection fit like a glove.With pPIC9K-TSOL18 Sal I single endonuclease digestion linearization, electricity transforms the Pichia pastoris competent cell, and the bacterium colony of growing on the MD nutrient culture media is His ⁺Transformant, photolithography step-sizing G418 resistant strain are the high copy of genes of interest recombinant bacterial strain.

With reorganization multi-copy strains genomic DNA is template, the TSOL18 gene that is incorporated in the Pichia pastoris GS115 chromosomal DNA is carried out pcr amplification, and pcr amplification system: 10 * buffer 2.5 μ L, 5 ' AOX1 primer (50pmol/ μ L), 0.5 μ L, 3 ' AOX1 primer (50pmol/ μ L), 0.5 μ L, genomic DNA template 2.5 μ L, Taq enzyme 0.5 μ L, dNTP 2 μ L, aqua sterilisa complement amass to 25 μ L; Amplification condition: 95 ℃ of pre-sex change, 5min; 35 circulations (94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min); 72 ℃ are extended 10min again.Amplification finishes, get 5 μ L reactant liquors obtain the 834bp size with agarose gel electrophoresis specific fragment (blank bacterial strain should be 492bp), show to be integrated with TSOL18 gene (Fig. 7) in the transformant genome really, the building process of expression vector pPIC9K-TSOL18/GS115 is seen Fig. 4.

The abduction delivering and the purifying of 4 taeniasis suis hexacanth embryo TSOL18 recombinant proteins

4.1TSOL18 the abduction delivering of recombinant protein

Recombination yeast pPIC9K-TSOL18/GS115 carries out Continuous Cultivation in the 5L fermentation tank, working volume 3L, and incubation is as follows:

The monoclonal of choosing inoculum is inoculated in the YPD nutrient culture media of 20mL, changes to be inoculated in behind 28 ℃ of shaking tables cultivation 24h and continues in the 200mLYPD nutrient culture media to cultivate about 18h, increases bacterium and reaches 2～5 OD ₆₀₀During unit, change being inoculated in the 5L fermentation tank again.Control each content of material by computer in the incubation, oxygen content is not less than 50%, pH value 5.0.The control methanol concentration is in the whole fermentation process: preceding 2～4h methyl alcohol stream dosage of inducing is 3mL/L/h, and preceding 4～8h methyl alcohol stream dosage of inducing is 6mL/L/h, induces that methyl alcohol stream dosage is 9mL/L/h behind the 8h, the about 72h of coinduction.Induce and finish the centrifugal 30min of back 10000r/min and get supernatant and analyze through SDS-PAGE, the result shows the expression product (Fig. 8) that contains the about 16ku of size in the supernatant of bacterium liquid.Bacterium liquid supernatant is concentrated freeze-dried, indicate lot number, 4 ℃ of preservations are standby.Every batch of fermentation can obtain recombinant protein 2.54g/L.The solubility that has so realized recombinant protein efficiently expresses, for follow-up protein purification technology is laid a good foundation.

4.2TSOL18 the purifying of recombinant protein

Behind pretreated SephacrylS-300 (Sephacryl gel S-300) dress post, use the abundant balance of 0.01MPBS (pH7.2) damping fluid all stable again to conductivity, uv absorption baseline, pH.Get the product 0.5mL (containing protein content 25mg approximately) behind the recombinant bacterial strain abduction delivering, with same buffer solution elution, flow velocity is 0.7mL/min, and pressure 0.2Mpa collects the peak sample.Utilize ultraviolet spectrophotometer to measure protein content, updating formula is as follows:

Protein content (mg/mL)=(1.45 * OD280-0.74 * OD260) * extension rate

Through the purity of SDS-PAGE analyzing proteins, the result shows that purified target protein presents single band (Fig. 8), and the albumen yield is bigger, and every 1000mL culture supernatant can obtain purifying protein and be about 0.854g.

Embodiment two (preparation of the anti-TSOL18-GST IgG of rabbit and purifying embodiment)

1.TSOL18-GST the preparation of fusion

The clone of destination protein TSOL18 encoding gene and the structure of cloning vector pGEX-TSOL18 are with embodiment one, and its used expression vector design of primers is:

P3：5’ccg gaattcagcggtgaccgtacattcgg3’

EcoRI

P4：5’ccg ctccgagctacgaacggcggaccttcttgt3’

XhoI

The TSOL18 genes of interest is cloned into expression vector pPGEX-4T-1, makes up prokaryotic expression carrier pPGEX-TSOL 18/BL21.IPTG through 0.1mmol/L collects bacterium liquid behind 28 ℃ of abduction delivering 6h; The carrying out ultrasonic bacteria breaking supernatant behind GST-FF affinity column purifying, obtains the TSOL18-GST fusion (Fig. 9) of high-purity, the about 38ku of molecular weight again; This albumen TSOL18 molecular weight of comparing is bigger, has better immunogenicity, the anti-TSOL18-GST polyclonal antibody of the rabbit that the height that is easy to get behind the immunizing rabbit is tired, these many anti-preparations that will be used for nature controlling line.

The anti-TSOL18-GST fusion of 2 rabbits Polyclonal Antibody Preparation

Select 10 of the female livid purple blue rabbits of Healthy Youth, the about 3kg/ of body weight only.With same batch of TSOL18-GST recombinant antigen of purifying according to two times of incremental methods of antigen dose respectively with Freund's complete adjuvant and incomplete Freund compatibility, make vaccine routine immunization rabbit, immunity was spaced apart for 3 weeks, carry out agar double diffusion test in last 1 immunity back 10d, tire and reach 1: 32-1: 64 can take a blood sample separation of serum by heart.

The purifying of the anti-TSOL18-GST fusion of 3 rabbits IgG

The purification employing saturated ammonium sulphate method of hyper-immune serum IgG and Sephacryl S-300HR gel chromatography combine and carry out purifying.Concrete operations are as follows:

Get hyper-immune serum 10mL, after 50% and 33% saturated ammonium sulfate precipitates preliminary purification one by one, adopt Sephacryl S-300HR gel chromatography to be further purified rabbit hyper-immune serum IgG again.The SDS-PAGE analysis is slightly less than the 66ku place in molecular mass only a band, should be gamma Globulin, i.e. the IgG purification band.Reach more than 90% through its purity of thin layer scanning, illustrate that IgG purity satisfies the requirement (Figure 10) of test strips preparation.This antibody is used to wrap the nature controlling line by on the nitrocellulose filter.

Embodiment three (test strips/card assembling preparation example)

Assembling of pork measles gold-labelled rapid diagnosis reagent and preparation method

The assembling of 1 reagent

With reference to Fig. 2, the assembling of pork measles gold-labelled rapid diagnosis reagent is to paste the filter paper of handheld terminal water accepting layer (1) and the glass fibre of test lead water accepting layer (4) respectively at the two ends of PVC liner plate (7), and the nitrocellulose filter of section stickup is therein made NC film reaction bed course (2), between test lead glass fibre water accepting layer (4) and NC film reaction bed course (2), press from both sides the glass fibre of the indicated weight group antigen bed course (3) of gilding, its 4/5 part is clipped in test lead water accepting layer (4), 1/5 part is pressed on the NC film of reaction bed course (2), between handheld terminal water accepting layer (1) and NC film reaction bed course (2), enclose the colored handle paper of adhesive sticker then, enclosing the MAX line adhesive tape of adhesive sticker between test lead glass fibre water accepting layer (4) and NC film reaction bed course (2) fixes, be cut into the wide band of 3mm through cutting machine, or be made into cartridge could, put and deposit in 4 ℃ in the drying.

The preparation of described golden indicated weight group antigen bed course (3) comprising: the preparation of i collaurum, concentration be add in the gold chloride of 0.01%-0.03% its volume 0.6%, concentration is 1% trisodium citrate, boil 5-10min, be reduced into the collaurum atom liquid of 20-40nm, adjust pH 8.0-8.2; The colloid gold label of ii TSOL18 recombinant antigen, in the 100mL colloidal gold solution, add 1.0mg TSOL18 recombinant antigen, in above-mentioned colloidal gold solution, add final concentration again and be 0.05% PEG20000 solution, the last centrifugal 10min of 2000rpm goes precipitation, get supernatant and get sediment through the centrifugal 1h of 10000rpm again, with sediment by 8mL/100mL be dissolved in 0.02M, pH7.4Tris-HCl solution gets antigen colloidal gold solution: wherein contain 0.25% bovine serum albumin(BSA), 0.02% Sodium azide; Iii marks the TSOL18 recombinant antigen with gold and evenly immerses glass fibre with some film machine, obtains golden indicated weight group antigen bed course (3) 37 ℃ of following dryings then.

The preparation of described NC film reaction bed course (2) is to be that the anti-TSOL18-GST IgG of 2mg/mL TSOL18 recombinant protein and rabbit is sprayed on and forms detection zone (6) and Quality Control district (5) on the nitrocellulose filter with some film machine with concentration, is 5mm apart between detection zone and the Quality Control district; Contain 10% calf serum sealing 30min with 0.01M pH7.0PBS liquid again, rinsing, the dry NC film reaction bed course (2) that gets.

Through also the whole blood filtration unit can being set also on the application of sample water accepting layer on the test strips of the above preparation, its concrete way can referring to.

The using method of test strips of the present invention is as follows:

The preparation of 1 blood serum sample

After the pig jugular vein is taken a blood sample, put 37 ℃ of incubation 30min,, serum is fully separated out in 4 ℃ of placement 2h.Porcine blood serum to be checked through the centrifugal 15min of 3000rpm, is avoided residual haemocyte and haemolysis as far as possible.Can when butchering, directly take a blood sample and separation of serum when being used for the pig slaughtering check.If used test strips is provided with the whole blood filtration unit, can directly detect whole blood.

2 methods of operating

Test strips (card) taking-up is lain against desktop; (0.02M PB pH7.4) after 2 times of dilutions of do, slowly adds on the well of colloidal gold strip the 10-15min observations with dropper with sample diluting liquid to get 50 μ L serum to be checked.

3 results judge

As shown in Figure 3, the positive result of red stripes person all appears in detection zone, Quality Control district; Detection zone does not have band, the negative result of red stripes person appears in the Quality Control district; The Quality Control district red stripes person all do not occur and is null result.

Embodiment four (detection of pig anteserum sample)

The detection method of test strips is carried out according to embodiment three described operation stepss in the present embodiment, and wherein specificity test, sensitivity tests and sensitivity test are all carried out every evaluation of indexes in contrast with full cysticercus ELISA detection method.Its testing result sees Table 1, table 2 and table 3.

Attack the worm content of the test: select the long white piglet of 3 monthly ages of health, the ripe worm's ovum of 20000 pieces of taeniasis suis of every disposable peroral infection of pig is grown the cysticercus (cysticercus) for maturation gradually after 90 days.Different time cuts open and kills after attacking insect infection, counts the polypide number of every pig, and blood sampling, separation of serum detect its positive and negative with test strips simultaneously.Wherein 3 pigs were cutd open inspection in 1.5 years after attacking insect infection; 7 pigs were cutd open inspection in 90 days after attacking insect infection; 6 were cutd open inspection in 70 days after attacking insect infection.After inspection is cutd open by all infected pigs, all detected the great-hearted polypide of varying number, calcification has taken place in the polypide of part pig.

Attack worm test pig serum and carry out the coincidence rate evaluation in contrast with full cysticercus ELISA detection method to cut open the inspection counting method after killing.Its testing result sees Table 4.

The specificity of table 1 test strips and sensitivity tests result

Serum specimen	Quantity (part)	Positive rate
				Test strips	ELISA
		The arc worm positive serum of pork measles positive serum pig pig cysticercus tenuicollis positive serum pig negative serum	20 2 12 20			15/20 0/2 4/12 3/20	19/20 0/2 2/12 1/20

The sensitivity result that table 2 test strips and ELISA detect

Serum dilution		1∶1	1∶2	1∶4	1∶8	1∶16	1∶32	1∶64	Negative control (1: 2)
										Positive	ELISA	Do not survey	+	+	+	+	+	-
Test strips	+	+	+	+	+	-	-	-
									Remarks		Positive sample OD450:1: 2,1.012 ± 0.327; 1: 4,0.893 ± 0.326; 1: 8,0.709 ± 0.349; 1: 16,0.555 ± 0.362; 1: 32,0.409 scholar 0.291; 1: 64,0.262 ± 0.121; Negative control: 0.168

The stability test result of table 3 test strips

Detection time (d)	1	3	5	7	11	13	15	30	60	90	120	150
													4 ℃ of positive (15 parts) negative samples (10 parts)	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-
Room temperature positive (15 parts) negative sample (10 parts)	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	5+ 10-	//	//
													37 ℃ of positive (15 parts) negative samples (10 parts)	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	15+ 10-	//
Remarks	4 ℃ when being saved to 180 days, detection line and nature controlling line are all clear, and gold discharges fully, and chromatography speed is fast; During room temperature preservation to 60 day, golden release rate begins to slow down, but chromatography speed is good; 37 ℃ when being saved to 120 days, nature controlling line is fuzzy, and gold discharges slowly, and chromatography speed is good.

Table 4 test strips detects attacks the result of worm test pig serum

Sequence number	0541	0542	0543	0771	0772	0773	0774	0775	0776	0779
											Attack the worm time (moon)	18	24	30	3	3	3	3	3	3	3
Inspection borer population (individual)	2587	2032	1685	1405	0	11	732	30	763	873
											ELISA(OD 492)	1.100	1.264	0.946	1.050	0.855	1.095	1.182	1.308	1.049	1.737
Test strips	+	+	+	±	-	+	+	+	+	+
											Sequence number	0726	0727	0728	0732	0762	0763	Standard negative control 1		Standard negative control 2
Attack the worm time (moon)	2.5	2.5	2.5	2.5	2.5	2.5	/		/
											Inspection borer population (individual)	805	339	47	4	25	290	0		0
ELISA(OD 492)	1.103	0.653	1.073	0.507	0.906	0.842	0.224		0.220
											Test strips	±	+	+		+	+	-		-

Table 1 specificity and sensitivity tests result, the positive coincidence rate that this test strips and ELISA measure 54 part porcine blood serum is 78.9% (15/19), and negative match-rate is 89.5% (17/19), and total coincidence rate is 85.0% (17/20).Intersect (this problem does not still have standard method at home and solves) but all have with the pig cysticercus tenuicollis, its cross reacting rate is 33.3% (4/12).It is close to confirm that this test strips and ELISA method detect specificity.

Table 2 sensitivity test shows that the greatest dilution that this test strips detects the pork measles standard positive serum is 1: 16, and its sensitivity shows that than low 1-2 the titre of ELISA sensitivity this test strips has the sensitivity near the ELISA method when detecting strong positive serum.

The stability test of table 3 test strips shows that under 37 ℃ of conditions, it is effective that test strips can be stablized preservation 120d; The best storage condition of test strips is 4 ℃ of preservations, can obviously extend the expiration date.In addition same batch of test strips of picking at random carried out revision test 3 times, testing result is consistent, and this method good stability is described, degree of variation is little.

Table 4 is the result show, this test strips is 80.0% (12/15) with the positive coincidence rate that kills back inspection worm counting method; With the positive coincidence rate of ELISA kit be 75.0% (12/16), do not comprise that wherein test strips is judged to be 2 suspicious duplicate samples.

By the measurement result of above-mentioned each index as seen, this pork measles fast diagnose test paper bar has good specificity, susceptibility, repeatability and stable, detect effect and be similar to full cysticercus ELISA diagnostic kit, use convenient, quick, safety, be applicable to the quick quarantine of the quick diagnosis of pork measles, particularly pig slaughtering.

Claims (8)

1, pork measles gold test strip bar, comprise that tandem array is fixed in the application of sample water accepting layer with the porous fibrous material formation on the PVC lining material successively, the gold-marking binding pad that is adsorbed with pork measles gold mark antigen that is positioned at application of sample water accepting layer tail end and links to each other with the application of sample water accepting layer, the reacting pad that is made of nitrocellulose membrane and the absorption layer that is made of absorbent material that links to each other with the reacting pad tail end link to each other with the gold-marking binding pad tail end, wherein on reacting pad, be coated with the detection zone that constitutes by cysticercosis cellulosae antigen respectively and be positioned at the Quality Control district that constitutes by pork measles antibody in detection zone downstream, it is characterized in that the taeniasis suis recombinant antigen of the used cysticercosis cellulosae antigen of the present invention for artificial clone's preparation, used anti-pork measles immunoglobulin (Ig) is to use the taeniasis suis recombinant antigen immune animal of artificial clone's preparation to obtain.

2, pork measles gold test strip bar according to claim 1 is characterized in that employed cysticercosis cellulosae antigen is the TSOL18 recombinant antigen of the taeniasis suis hexacanth embryo of artificial preparation.

3, pork measles gold test strip bar according to claim 2 is characterized in that:

A. employed cysticercosis cellulosae antigen is: the 18ku gene that adopts technique for gene engineering will come from the taeniasis suis hexacanth embryo carries out RT-PCR, the PCR product is building up to obtains recombinant plasmid on the carrier for expression of eukaryon, again the recombinant plasmid electricity is transformed into the yeast competent cell, obtain recombinant bacterial strain, the bacterium abduction delivering of will recombinating again obtains recombinant protein, with this protein Preparation gold mark antigen and the detected district of bag;

B. used antibody is: the 18ku gene that will come from the taeniasis suis hexacanth embryo with technique for gene engineering carries out RT-PCR, the PCR product cloning is arrived the expression vector establishment prokaryotic expression carrier, again prokaryotic expression carrier is carried out abduction delivering, obtain fusion, use the fusion protein immunization animal, extract the serum of immune animal, therefrom separate obtaining anti-fusion antibody, with this antibody sandwich Quality Control district.

4, pork measles gold test strip bar according to claim 3 is characterized in that:

A. used cysticercosis cellulosae antigen is that the 18ku gene that will come from the taeniasis suis hexacanth embryo carries out RT-PCR, makes up carrier for expression of eukaryon pPIC9K-TSOL18, and the products therefrom electricity transforms Pichia pastoris GS115 competent cell, the recombinant protein that obtains through abduction delivering;

B. used antibody is: the 18ku gene that will come from the taeniasis suis hexacanth embryo with technique for gene engineering carries out PCR, again the PCR product cloning is arrived expression vector pGEX-4T-1, make up prokaryotic expression carrier pGEX-TSOL18/BL21, obtain fusion through abduction delivering, fusion protein immunization animal with purifying, extract the serum of immune animal, therefrom separate obtaining anti-fusion antibody, with this antibody sandwich Quality Control district.

5, according to the described arbitrary pork measles gold test strip bar of claim 1 to 4, it is characterized in that being provided with the whole blood filtration unit at the application of sample water accepting layer.

6, the described pork measles gold test strip of claim 3 bar preparation method is characterized in that:

A. collect the taeniasis suis worm's ovum, after chemical method hatching and activating, extract the total RNA of hexacanth embryo,, and design and synthesize the expression primer according to the nucleotide sequence of TSOL18 gene through RT-PCR amplification TSOL18 encoding gene;

B. the pcr amplification product of recycling step a; After the pcr amplification product that reclaims carried out double digestion with restriction enzyme, the PCR product is building up to obtains recombinant plasmid on the carrier for expression of eukaryon, the recombinant plasmid electricity is transformed into the yeast competent cell, obtains recombinant bacterial strain, the bacterium abduction delivering of will recombinating again obtains recombinant antigen;

C. reclaim a step gained PCR product, the PCR product cloning to the expression vector establishment prokaryotic expression carrier, is obtained fusion behind abduction delivering, use the fusion protein immunization animal, extract the serum of immune animal, therefrom separate obtaining anti-fusion antibody;

D. prepare collaurum, prepare gold mark antigen with prepared collaurum with by b gained recombinant antigen;

E. the golden indicated weight group antigen with the d gained fully is adsorbed in the porous water-absorbing material, obtains gold-marking binding pad;

F. on the reacting pad of nitrocellulose filter, set respectively by the detection zone of b gained recombinant antigen bag quilt with by the Quality Control district of c step gained antibody sandwich, and make the zone of leaving one section blank between detection zone on the reacting pad and the Quality Control district by designing requirement;

G. absorbent material, gold-marking binding pad, nitrocellulose filter reacting pad and another section absorbent material are fixed on the substrate of impermeable material successively, make each storeroom keep tandem array, and make the detection zone on the reacting pad be positioned at the application of sample side, by designing requirement the substrate that fixes is cut into required bar, obtains described pork measles gold test strip bar.

7, pork measles gold test strip bar preparation method according to claim 4 is characterized in that:

A. the total RNA with the taeniasis suis hexacanth embryo is a template, carries out RT-PCR with upstream primer R:5 ' TCT CTC CGAAAC AAT GAG TTA 3 ' and downstream primer F:5 ' TAA TAG ATA CCC ATT TTC ATCACA 3 ', and the products therefrom purifying reclaims;

B. make up cloning vector pGEX-TSOL18 with a gained taeniasis suis hexacanth embryo TSOL18;

C. be template with the pGEX-TSOL18 plasmid, with

Upstream primer P1:5 ' CGA GAATTCGACATTTTCGTTCCATACCTT3 '

EcoRI

Downstream primer P2:5 ' TA GCGGCCGCTCACTACGATCTTCGGACCTTC3 '

NotI

Pcr amplification, the products therefrom purifying reclaims;

D. get C step gained purified product and pPIC9K vector plasmid and use the EcoRI/NotI double digestion respectively, reclaiming the back with Agarose Gel DNA Extraction Kit again connects, connect product and change escherichia coli jm109 competent cell over to, obtain the pPIC9K-TSOL18 plasmid, use the linearization of Sal I single endonuclease digestion again, electricity transforms the Pichia pastoris competent cell, and multi-copy strains pPIC9K-TSOL18/GS115 obtains recombinating;

E. pPIC9K-TSOL18/GS115 is carried out Continuous Cultivation in fermentation tank, obtain the TSOL18 recombinant protein;

F. be template with b step gained pGEX-TSOL18, amplification TSOL18 encoding gene makes up prokaryotic expression carrier pGEX-TSOL18/BL21, behind abduction delivering, collect thalline, immunize rabbit behind the purifying is gathered and the separating immune rabbit anteserum, and purifying obtains the IgG of the anti-TSOL18-GST polyclonal antibody of rabbit;

G. prepare collaurum, prepare gold mark antigen with prepared collaurum with by e gained recombinant antigen again;

H. the golden indicated weight group antigen with the g gained fully is adsorbed in the porous water-absorbing material, obtains gold-marking binding pad;

I. on the reacting pad of nitrocellulose filter, be provided with respectively by the detection zone of e gained recombinant antigen bag quilt with by the Quality Control district of f step gained polyclonal antibody bag quilt, and make the zone of leaving one section blank between detection zone on the reacting pad and the Quality Control district by designing requirement;

J. absorbent material, gold-marking binding pad, nitrocellulose filter reacting pad and another section absorbent material are fixed on the substrate of impermeable material successively, make each storeroom keep tandem array, and make the detection zone on the reacting pad be positioned at the application of sample side, by designing requirement the substrate that fixes is cut into required bar, obtains described pork measles gold test strip bar.

8, claim 6 or 7 described pork measles gold test strip bar preparation methods is characterized in that also being provided with the whole blood filtration unit on the application of sample water accepting layer.

Images