CN101225387A - New 11 x-chromosome STR gene locus and parting method therefor - Google Patents

Abstract

The invention discloses a new kind of eleven STR gene loci for X chromosome and the typing method, which is characterized in that the selected eleven X chromosome STR loci cover the full length of the X chromosome; the loci of DXS6799 and DXS8378 are positioned on the short arm; the others are positioned on the long arm, which are DXS7132, DXS7424, DXS6789, DXS6799, DXS7133, DXS101, DXS6804, HPRTB and DXS7423. The eleven STR gene loci for X chromosome is applied for group genetic data investigation of Chinese nation, and obtains a plurality of typing results of nationality populations; the statistical treatment proves that the eleven STR gene loci for X chromosome can be totally applied on individual identification, paternity testing and gene diagnosis in forensic medicine, anthropology, genetics, disease and other field; the result shows that genetics character of Chinese population has significant differences with foreign population, which has Chinese characteristics. The new kind of eleven STR gene loci for X chromosome and the typing method has the advantages of moderate sizes of all locus segments and suitability for PCR expansion.

Description

A kind of new 11 X chromosome str locus sites and classifying method thereof

Technical field

The present invention relates to a kind of nucleic acid detection method, particularly 11 new X chromosome str locus site and classifying methods thereof.

Background technology

STR (short tandem repeats, be called for short STR) be by 2-7 base pair as core unit, the class microsatellite DNA sequence that series connection repeats to form, its fragment can adopt round pcr to increase.STR has formed the genetic polymorphism in str locus site mainly due to the variation of core repeating unit number, technology somatotype such as its allelotrope available silver is dyed, fluorescent mark and radioautograph.In the human genome, average every 6-10kb just has a str locus site, and the abundant source in high information gene site is provided for legal medical expert's individual identification and paternity test.

STR has following significant advantage in research and in using: good repeatability, and the somatotype result is reliable and stable, and is simple to operate quick; Fragment length by pcr amplification, electropherotyping, is applicable to various samples and the detection of the sample of highly degrading easily generally at 100～400bp; Trinucleotide, tetranucleotide multiple STR site pcr amplification result are stable, and the additional band of generation, shadow band are few, easily somatotype; Be to draw the important tool that human inheritance figure, disease gene linkage analysis, genetic diseases diagnosis, individual recognition etc. are analyzed work.The somatotype of STR, at present the most frequently used is to use pcr amplification STR, and amplified production is carried out polyacrylamide gel electrophoresis, determines genotype and calculates gene frequency and genetic distance and constructing system growth tree according to segmental size.For the available autography technology of the detection of PCR product, PAGE dyes in conjunction with silver, and fluorescent mark sequence instrument automatic analysis system.

X chromosome STR site extensively exists in the gene of eucaryote cell group, highly stable and have a higher genetic polymorphism, but compare with Y chromosome STR with euchromosome, the X-STR site quantity of finding so far and using is considerably less, the information of aspects such as population distribution, mutation rate, linkage equilibrium, gene structure is still abundant inadequately, application in fields such as medical jurisprudence, medical science is limited, and is extensive far away from other DNA genetic markers.But X chromosome STR detects for paternity test, individual recognition, sex identification, X linkage inheritance Disease-causing gene location, tumor susceptibility gene, and there is special advantages aspects such as the molecular genetic mechanism research of the location of disease of multifactorial inheritance Disease-causing gene, morbidity, the design of medicine and use.So the relevant research of X chromosome has important meaning.

The research of X chromosome genetic marker also is in the initial stage at home, and commercialization detection kit in the world only has German Biotype Argus X-8 at present, and there is following problem in such test kit in the forensic application practice:

Meet difficulty when 1) adopting this class test kit to increase genetic marker;

2) colony (the mainly white man colony) data that all is based on beyond the Chinese colony of these X-STR gene locuss is developed, some gene locus wherein, and it is relatively poor to distribute in the gene frequency of Chinese colony, and individual recognition capability is lower.

3) external commercial kit costs an arm and a leg.

These drawbacks limit the application at home of X chromosome genetic marker, be unfavorable for further promoting in basic unit.

Summary of the invention

Technical problem to be solved by this invention is exactly to seek more can be applied to the X chromosome STR site in fields such as medical jurisprudence and carry out population genetics research.

The invention provides a kind of new 11 X chromosome str locus sites and classifying method thereof, it is characterized in that 11 X-STR sites selecting for use have covered the X chromosome total length, and DXS7130 (4.15Mb) is arranged in the site of galianconism, DXS8378 (8.78Mb); All the other all be positioned at long-armed on: DXS7132 (60.8Mb), DXS7424 (99.39Mb), DXS6789 (91.95Mb), DXS6799 (92.95Mb), DXS7133 (107.8Mb), DXS101 (100.08Mb), DXS6804 (110.8Mb), HPRTB (123.8Mb), DXS7423 (148.35Mb).Selected 11 the X-STR sites of (table 1) the present invention, the amplified fragments minimum be the DXS7133 site, 102-126bp; The site of amplified fragments maximum is DXS6799 and HPRTB, 271-299bp.The all sites clip size is moderate, all suitable for PCR amplification.

Table 1

The site	Tumor-necrosis factor glycoproteins	The allelotrope number	Clip size (bp)	Chromosome position (Mb)
					DXS7130	TATC	10	168-203	4.15
DXS6799	TATC	6	232-260	92.65
					DXS7424	TAA	12	147-180	99.39
DXS7133	ATAG	7	102-126	107.8
					DXS6804	ATAG	7	189-228	110.8
DXS8378	CATA	7	191-219	8.78
					DXS7132	CATA	8	271-299	60.8
DXS6789	TATC	13	110-162	91.95
					DXS101	CTT-ATT	16	185-233	100.08
HPRTB	AGTA	8	271-299	123.8
					DXS7423	TCCA	6	179-203	148.35

11 X chromosome STR allelic gene typing methods is characterized in that, comprise the following steps:

1. adopt increase the respectively DNA in 11 X chromosome str locus sites of PCR, and the upstream and downstream primer sequence in design site, the upstream and downstream primer is diluted to 100 μ MOL/L, as mother liquor, take out 10 μ l and be diluted to 5 μ MOL/L, as working fluid; The volume of pcr amplification system is 20 μ L, contains 1 * reaction buffer, 1.5mMOL/L Mgcl ₂, 0.5UTaq enzyme, 0.25 μ MOL/L primer, 200 μ MOL/LdNTP, DNA20～200ng.

2.PCR the amplification underlying parameter is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 1min carry out 30 seconds, 72 ℃ according to the different renaturation temperature in site and extend 1min, amount to 28-32 circulation, and last 72 ℃ are extended 15min; (concrete parameter sees Table 3)

3. amplified production uses denaturing polyacrylamide gel electrophoresis to separate, and adopts silver to dye coloration method, carries out the stdn somatotype in conjunction with allelic ladder.

The preparation of above-mentioned allelic ladder comprises the following steps:

1) the homozygote PCR product that will have different genotype carries out ligation with carrier pGEM-T respectively.

2) ligation product transformed into escherichia coli competent cell DH5 α;

3) be coated on the penbritin agar plate incubated overnight;

4) choose bacterium, shake greatly, extract plasmid DNA, standby;

5) be template with the plasmid DNA, make pcr amplification, each allelic ladder is identified; Note comparing with 25bp DNA marker, order-checking sample and standard cell lines strain GM9947A simultaneously, with the clip size that settles the standard;

6) determine amplification in a large number after the clip size, with the big or small segmental allelotrope of difference mix allelic ladder.

Oneself investigates 11 X chromosome str locus sites of the present invention in Chinese nation's population genetic data in applicant's laboratory applications, and obtained the somatotype result of a plurality of Ethnic Populations, learn by statistics and handle proof, these 11 X-STR sites can be applied in the aspects such as individual recognition, paternity test and gene diagnosis in fields such as medical jurisprudence, anthropology, genetics and disease fully, the result shows that population of China and external crowd X-STR genetics characteristics have significant difference, are with Chinese characteristics.

11 X chromosome STR site polyacrylamide gel electrophoresises of the present invention, silver dyes coloration method and filters out, can be applicable to fields such as medical jurisprudence, and prepared each site allelic gene typing marker (Ladder), PCR primer and amplification condition to X chromosome STR site are optimized, and wherein the making of the optimization of PCR primer and amplification condition and somatotype marker makes the present invention can accomplish that stdn and simplification and suitable grass-roots unit are universal.

The technological merit that the present invention brings is, amplified production uses polyacrylamide gel electrophoresis to separate, and dyes the detection somatotype with silver, and required instrument and equipment is simple, and is easy to operate, is adapted at grass-roots unit and popularizes, and can obtain good effect for Chinese present case.The present invention can fill up domestic do not have the X-STR detection technique of practicability and the blank of scheme, and the result of acquisition satisfaction in a plurality of nationalitys of China, utilize the X chromosome section tandem repetitive sequence parting kit of this technology preparation, can commercially produce and be extended to the defective that domestic each laboratory uses this technology to overcome to use external test kit can't reflect Chinese multi-national genetic characteristics, can be applied to paternity test, individual recognition, sex identification, X linkage inheritance Disease-causing gene location, detecting of tumor susceptibility gene, the location of disease of multifactorial inheritance Disease-causing gene, the molecular genetic mechanism research of morbidity, aspects such as the design of medicine and use are with a wide range of applications.

Embodiment

PCR method amplification purpose fragment, polyacrylamide denaturing gel electrophoresis, silver staining method detected result are used in 11 X chromosome str locus sites of the present invention.

1. primer sequence

The design of PCR primer sequence is gone up the STR site sequence with reference to Genebank (http://www.ncbi.nlm.nih.gov), and the upstream and downstream primer sequence sees Table 2.The upstream and downstream primer of 5.0 OD is diluted to 100 μ MOL/L, as mother liquor; Take out 10 μ l and be diluted to 5 μ MOL/L, as working fluid, standby.

Table 2 X chromosome STR site primer sequence

The site	Upstream primer	Downstream primer
			DXS7130	CTGCAAGCCATTTGGAATAT	TCCTAGGACTGGGAAAGGAC
DXS6799	ATGAATTCAGAATCCTCATACC	GAACCAACCTGCTTTTCTGA
			DXS7424	CTGCTTGAGTCCAGGAATTCA	GAACACGCACATTTGAGAACATA
DXS7133	GCTTCCTTAGAGGGCATTCA	CTTCCAAGAATCAGAAGTCTCC
			DXS6804	CCCAGATATTTTGACCACCA	GGCATGTGGTTGCTATAACC
DXS8378	CACAGGAGGTTTGACCTGTT	AACTGAGATGGTGCCACTGA
			DXS7132	AGCCCATTTTCATAATAAATCC	AATCAGTGCTTTCTGTACTATTGG
DXS6789	TTGGTACTTAATAAACCCTCTTTT	CTAGAGGGACAGAACCAATAGG
			DXS101	ACTGACAGCACTAAGCCTTTGTT	AGCTACATCCTATACATTATTCT
HPRTB	ATGCCACAGATAATACACATCCCC	CTCTCCAGAATAGTTAGATGTAGG
			DXS7423	TAGCTTAGCGCCTGGCACATA	GTCTTCCTGTCATCTCCCAAC

2.PCR amplification

1) PCR reaction system cumulative volume 20 μ l contain 1 * reaction buffer, 1.5mMOL/L Mgcl ₂, 0.5UTaq enzyme, 0.25 μ MOL/L primer, 200 μ MOL/L dNTP, DNA20～200ng.Use PE9600 amplification instrument, the PE9700 instrument that increases.The dna profiling of the whole bag of tricks extraction at present all is fit to the amplification of X chromosome STR.

2) the pcr amplification parameter sees Table 3.This experiment PCR reaction agents useful for same is domestic reagent, and the result has all obtained satisfied effect.Conventional method is adopted in the detection of PCR product.

Table 3 X chromosome STR site PCR condition

The site	Denaturation temperature	Annealing temperature	Elongating temperature	Cycle index
					DXS7130	94℃30s	57℃30s	72℃45s	30

DXS1214	94℃45s	66℃45s	72℃60s	32
					DXS6799	94℃30s	56℃30s	72℃60s	30
DXS7424	94℃45s	64℃45s	94℃50s	30
					DXS7133	94℃30s	58℃45s	72℃45s	28
DXS6804	94℃30s	62℃45s	72℃60s	30
					DXS8378	94℃30s	61℃30s	72℃45s	30
DXS7132	94℃45s	56℃45s	72℃60s	32
					DXS6789	94℃30s	54℃30s	72℃60s	30
DXS101	94℃45s	57℃45s	94℃50s	30
					HPRTB	94℃45s	63℃45s	72℃60s	32
DXS7423	94℃45s	66℃30s	94℃60s	30

3. denaturing polyacrylamide gel electrophoresis separates amplified production:

The preparation of polyacrylamide gel (6%):

1) small beaker with 250ml takes by weighing the hyperpure urea of 42 grams, 1 * TBE the solution, 12ml 40% acrylamide and the methylene-bisacrylamide glue (19: 1) that add 54ml successively, be placed on the magnetic force heating stirrer, 70 ℃ of left and right sides heated and stirred promote that urea dissolves fully.

2) after urea dissolves fully, be cooled to room temperature, begin encapsulating after the TEMED that adds the 10%APS of 350 μ l and 35 μ l shakes up.

3) glue is poured on fast on the long sheet glass of Fang Ping, short sheet glass puts that level promotes on the long sheet glass, irritated glue after, shark tooth comb oppositely inserted between the offset plate seals, note the degree of depth that the sealing comb inserts.With eight dovetail folders two sheet glass are fixed together.It is stand-by to irritate about 2 hours of good glue polymerized at room temperature.Prerunning, last sample and electrophoresis:

1) after the gel polymerisation comb is taken out, water flushing offset plate is removed unnecessary gel pieces, with pure water loading slot is rinsed well.Offset plate is fixed on the electrophoresis chamber, and short slab compresses sponge pad downwards inwards, four spiral buttons is tightened fix offset plate, closes and closes groove electrode solution blow-off cock.(1 * TBE) did not have short slab to pour an amount of electrode solution at last groove, pouring an amount of electrode solution in the electrophoresis chamber down, comb is totally inserted (comb point insertion gel about 1～2mm) in the loading slot with pure water rinsing, close electrophoresis chamber lid up and down, making current, about 1 hour of prerunning reaches more than 30 ℃ gelling temp.Before prerunning, electrode buffer can be placed on preheating on 56 ℃ of shaking tables, can shorten the prerunning time.The prerunning condition: about voltage 1000V, electric current 30-40mA, the about 38W of power.

2) the PCR pipe is carried out mark, every pipe adds 2 * sample-loading buffer (2 * loadingsolution) of 3.0 μ l, add sample (comprising sample to be checked and known GM9947 sample) and allelotrope standard substance (Ladder) that 1.0～3.0 μ l increase then respectively, put into 95 ℃ of sex change of amplification instrument 3～10 minutes behind the mixing, put into ice bath after the taking-up immediately, sample in the preparation.PCR product applied sample amount should be noted adjusting.

3) behind the end prerunning, blow and beat loading slot, remove bubble with suction pipe.Get the sample that 3.0 μ l prepare then and be added in shark tooth comb, the application of sample process should be avoided producing bubble and reduce the application of sample time as far as possible.Note application of sample order and contrast, AL position.

4) after sample adds, the demand working electric current, the permanent power of 40W carries out electrophoresis.Electrophoresis time is decided according to different amplified production sizes, and the time is approximately 2 hours to 4 hours;

4. the silver of gel dyes and develops the color:

1) after electrophoresis finishes, takes out offset plate, comb is taken out, with proper implements separately, the long slab that is stained with glue is put into dyeing dish on the horizontal shaking table two sheet glass.

2) add 1000ml stationary liquid (10% acetate) in the dyeing dish, do not have gel, room temperature was shaken 20 minutes.Stationary liquid is poured out and reclaimed, add pure water then, do not have gel, it is inferior to give a baby a bath on the third day after its birth, each 2～5 minutes.

3) add the 1000ml staining fluid, lucifuge was shaken 30 minutes under the room temperature.Staining fluid is poured out, added and after pure water washed for 10 seconds offset plate is taken out,, outwell pure water, offset plate is reentered in the dyeing dish with the back side of pure water rinsing offset plate.

Add 1000ml colour developing liquid (being chilled to 4 ℃～10 ℃ in advance), with the naked eye observe, after electrophoretic band is clear, remove the liquid that develops the color, add 1000ml stop bath (10% acetate), take out offset plate after 10 minutes,, dry with distilled water flushing a little while, the result is saved in the computer with scanner.

5. the allelic ladder system sets up:

1) the homozygote PCR product that will have different genotype carries out ligation with carrier pGEM-T respectively.

2) ligation product transformed into escherichia coli competent cell DH5 α;

3) be coated on the penbritin agar plate incubated overnight;

4) choose bacterium, shake greatly, extract plasmid DNA, standby;

5) be template with the plasmid DNA, make pcr amplification, each allelic ladder is identified; Note comparing with 25bp DNA marker, order-checking sample and standard cell lines strain GM9947A simultaneously, with the clip size that settles the standard;

6) determine amplification in a large number after the clip size, with the big or small segmental allelotrope of difference mix allelic ladder.

Claims (3)

1. 11 new X chromosome str locus sites is characterized in that, these 11 X chromosome STR sites have covered the X chromosome total length, in the site of galianconism DXS7130 are arranged, DXS8378; All the other all be positioned at long-armed on, they are DXS7132, DXS7424, DXS6789, DXS6799, DXS7133, DXS101, DXS6804, HPRTB, DXS7423; The all sites clip size is moderate, all suitable for PCR amplification.

2. described 11 the X chromosome STR allelic gene typing methods of claim 1 is characterized in that, comprise the following steps:

Adopt increase the respectively DNA in 11 X chromosome str locus sites of PCR, and the upstream and downstream primer sequence in design site, the upstream and downstream primer is diluted to 100 μ MOL/L, as mother liquor, take out 10 μ 1 and be diluted to 5 μ MOL/L, as working fluid; The volume of pcr amplification system is 20 μ L, contains 1 * reaction buffer, 1.5mMOL/L Mgcl ₂, 0.5UTaq enzyme, 0.25 μ MOL/L primer, 200 μ MOL/LdNTP, DNA20～200ng.

The pcr amplification underlying parameter is: 94 ℃ of pre-sex change 3min, and 94 ℃ of sex change 1min carry out 30 seconds, 72 ℃ according to the different renaturation temperature in site and extend 1min, amount to 28-32 circulation, and last 72 ℃ are extended 15min;

Amplified production uses denaturing polyacrylamide gel electrophoresis to separate, and adopts silver to dye coloration method, carries out the stdn somatotype in conjunction with allelic ladder.

3. method as claimed in claim 2 is characterized in that the preparation of described allelic ladder comprises the following steps:

1) the homozygote PCR product that will have different genotype carries out ligation with carrier pGEM-T respectively.

2) ligation product transformed into escherichia coli competent cell DH5 α;

3) be coated on the penbritin agar plate incubated overnight;

4) choose bacterium, shake greatly, extract plasmid DNA, standby;

5) be template with the plasmid DNA, make pcr amplification, each allelic ladder is identified; Note comparing with 25bp DNA marker, order-checking sample and standard cell lines strain GM9947A simultaneously, with the clip size that settles the standard;

6) determine amplification in a large number after the clip size, with the big or small segmental allelotrope of difference mix allelic ladder.