CN101220091B - Yao horsefly salivary gland immunoregulation peptide, gene and application thereof - Google Patents
Yao horsefly salivary gland immunoregulation peptide, gene and application thereof Download PDFInfo
- Publication number
- CN101220091B CN101220091B CN200810058075XA CN200810058075A CN101220091B CN 101220091 B CN101220091 B CN 101220091B CN 200810058075X A CN200810058075X A CN 200810058075XA CN 200810058075 A CN200810058075 A CN 200810058075A CN 101220091 B CN101220091 B CN 101220091B
- Authority
- CN
- China
- Prior art keywords
- salivary gland
- immunoregulation
- polypeptide
- cell
- aspartic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a salivary gland immunoregulation polypeptide of dieu cleg, the related genes and the application and belongs to the biomedical field. The immunoregulation polypeptide is a linear polypeptide coded with the Chinese Tabanidae salivary gland immunoregulation polypeptide genes, the sequence of which is glycin- glycin- valine- serine- glycin- valine- serine- aspartic acid- phenylalanine- glutamate- praline- isoleucine- glutamate- valine- serine- glycin- glutamate- aspartic acid- tyrosine- aspartic acid- serine- aspartic acid- glutamate- alanine- aspartic acid- glutamate- aspartic acid- glycin- lysine- alanine. The immunoregulation polypeptide gene consists of 362 Nucleotides; wherein, the coding mature code salivary gland immunoregulation polypeptide of the dieu cleg is the 115th to the 204th nucleotide. The dieu cleg salivary gland immunoregulation polypeptide is used for inhibiting the application of a plurality of cytokines. The salivary gland immunoregulation polypeptide of the dieu cleg and the related genes is characterized by simple structure, convenient artificial synthesis and strong antibacterial activity, etc.
Description
Technical field:
The invention provides a kind of Yao horsefly salivary gland immunoregulation peptide and gene thereof and application, belong to field of biomedicine technology.
Background technology:
Immunomodulatory peptides its physiological concentration, have salt and serum to exist condition under have biologic activity widely, be included in the activity relevant in the innate immunity cell (neutrophilic granulocyte, epithelial cell) with inflammatory reaction, innate immunity and adaptive immunity, in monocyte, scavenger cell, dendritic cell as the communication bridge [1 of innate immunity and adaptive immunity, 2,3,4].Antibacterial peptide can in and G
-Bacterium lipopolysaccharides, G
+Bacterium lipoteichoicacid and bacterium be bacterium signaling molecule such as methylated CpG DNA not.These signaling molecules can with host cell surface Toll sample receptors bind, initiating signal cascade amplification and cytokine (as TNF-α, IL-6 etc.) are just regulated [5].Lower concentration bacterium signaling molecule can cause useful inflammatory reaction of body and heating, if but reaction is violent or the time length prolongs, can cause systemic circulation obstacle, organ failure, in addition dead.Antibacterial peptide can suppress lipopolysaccharides and combine with the serum lipopolysaccharide binding protein factor, prevents endotoxemia and death [6,7,8,9].Immunomodulatory peptides also participates in autarcetic other reactions of host, such as, the level that improves the monokaryon chemotactic protein by mitogen activated protein kinase signal path or other signal path stimulates the chemotaxis [10] of monocyte and neutrophil, the release that promotes the mastocyte histamine, inhibition of histone enzyme and promotes wound healing [11].
Cytokine is high reactivity, the multi-functional small molecules protein that a class is mainly produced by immunocyte and relevant cell.The production of cytokines cell is very extensive, and except that lymphocyte, Monocytes can produce the various kinds of cell factor, various kinds of cell such as mucomembranous epithelial cell, vascular endothelial cell, inoblast also can produce.Usually resting stage, cell did not produce or a spot of cytokine of only spontaneous generation, can produce the cytokine of certain kind after activated by antigen, mitogen or other activator in a large number.Cytokine by with the corresponding receptors bind on target cell surface after bring into play biological function.Owing to have very high avidity between cytokine and its acceptor, so the denier cytokine just can produce tangible biological effect.Generally can be divided into interleukin-, the Interferon, rabbit that antivirus action is arranged, the G CFS that can stimulate growth of marrow hemopoiesis precursor cell and differentiation that mainly play immunoregulation effect, certain anti-tumor activity be arranged and the tumour necrosis factor of obvious inflammatory mediator effect, the somatomedin of energy stimulate cell growth and six classes [12] such as chemotactic cytokine that immunocyte had chemotaxis are arranged according to the title of cytokine and biologic activity.
The unconventionality expression of cytokine is often with close related of having of numerous disease clinically.On the one hand, cytokine-expressing is too high, mistake is low or defective, all can cause the generation with the immunity of organism diseases related; On the other hand, be accompanied by numerous disease process clinically, some cytokine expression amount also obvious variation can occur.
The Tabanidae insect is commonly called as the gadfly, belongs to HAEMATOPHAGOUS ARTHROPODS, and its parasitic successful key is to influence host immune response by producing special saliva antagonist.Report according to domestic and foreign literature; there is significant biochemical and pharmacology diversity in these materials; its natural diversity is used in pharmacological agent and the Biochemical Research will fine prospect, simultaneously also for expanding our understanding and the research to acting between saliva product and innate immunity to host's protection mechanism mechanism.
Reference:
[1]Bowdish，D.M.，D.J.Davidson，Y.E.Lau，K.Lee，M.G.Scott，and?R.E.W.Hancock(2005)?Impact?of?LL-37?on?antiinfective?immunity.J.Leukoc.Biol.77，451-459
[2]Gennaro，R.，M.Zanetti，M.Benincasa，E.Podda，and?M.Miani(2002)Pro-rich?antimicrobialpeptides?from?animals：structure，biological?functions?and?mechanism?of?action.Curr.Pharm.Des.8，763-778.
[3]McPhee，J.B.and?R.E.W.Hancock(2005)Function?and?therapeutic?potential?of?host?defencepeptides.J.Pept.Sci.11，677-687
[4]Davidson，D.J.，A.J.Currie，G.S.Reid，D.M.Bowdish，K.L.MacDonald，R.C.Ma，R.E.W.Hancock，and?D.P.Speert(2004)The?cationic?antimicrobial?peptide?LL-37?modulatesdendritic?cell?differentiation?and?dendritic?cell-induced?T?cell?polarization.J.Immunol.172，1146-1156.
[5]Mookherjee?N，BrownK?L，BowdishDM，etal.Modulation?of?the?TLR-mediated?inflammatoryresponse?by?the?endogenous?human?host?defense?poptide?LL-37.J?lmmunol，2006，176(4)：2455-2464
[6]Golec?M.Cathelicidin?LL-37：LPS-neutralifing，pleiotropic?peptide.Ann?AgIic?Environ?Med，2007，14(1)：1-4
[7]Giacometti?A，Cirioni?O，Ghiselli?R，et?al.Potential?therapeutic?role?of?cationic?peptides?inthree?experimental?models?of?septic?shock.Antimicrob.Agents?Chemother，2002，46(7)：2132-2136
[8]Chertov?O，Michiel?D?F，Xu?L，et?al.Identification?of?defensin-1，defensin-2，and?CAP37/azurocidin?as?T-cell?chemoattractant?proteins?released?from?interleukin-8-stimulatedneutrophils.J?Biol?Chem，1996，271(6)：2935-2940
[9]Mookherjee?N，Hancock?R?E.Cationic?host?ddence?peptides：innate?immune?regulatorypeptides?as?a?novel?approach?for?treating?infections.Cel?Mol?Life?Sci，2007，64(7-8)：922-933
[10]Scott，M.G.，C.M.Rosenberger，M.R.Gold，B.B.Finlay，and?R.E.W.Hancock(2000)Analpha- helical?cationic?antimicrobial?peptide?selectively?modulates?macrophage?responsesto?lipopolysacchar
[11]Zanetti?M.Cathelicidins，multifunctional?peptides?of?the?innate?immunity[J]..J?leukoc?Bio，2004，75(1)：39-48
[12] Wu Minyu, the Liu Gongzhi chief editor.Medical Immunology, Hefei: press of China Science ﹠ Technology University, 2002,2.
By literature search, do not see the open report identical with the present invention.
Summary of the invention:
The objective of the invention is based on above-mentioned technology and theoretical basis, provide a kind of immunoregulatory activity that has, as suppressing Yao horsefly salivary gland immunoloregulation polypeptide and the gene and the application of tumour necrosis factor (TNF-α), monokaryon chemotactic protein-1 (MCP-1), interleukin II (IL-2), interleukin 8 (IL-8) and interleukin 10 (IL-10).
In order to realize purpose of the present invention, the invention provides following technical scheme:
The Yao horsefly salivary gland immunoloregulation polypeptide:
Yao horsefly salivary gland immunoregulation peptide is a kind of wire polypeptide of Chinese Tabanidae insect sialisterium immunomodulatory peptides genes encoding, and its total order is classified as: glycine-glycine-Xie Ansuan-Serine-glycine-Xie Ansuan-Serine-aspartic acid-Phe-Glu-proline(Pro)-Isoleucine-L-glutamic acid-Xie Ansuan-Serine-glycine-glutaminic acid-aspartic acid-tyrosine-l-asparagine-Serine-aspartic acid-L-glutamic acid-L-Ala-aspartic acid-L-glutamic acid-aspartic acid-glycine-Methionin-L-Ala
The clone of Yao horsefly salivary gland immunoregulation peptide gene comprises: the total RNA of Yao horsefly salivary gland extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening immunomodulatory peptides gene.Amplimer length is 25 Nucleotide, and its sequence is 5 ' CTCATTGTGGGACTGTTTACATCAT3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCR Primer primer among the cDNA Library ConstructionKit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.The positive monoclonal that obtains carries out gene nucleotide series and measures.
Gene sequencing result shows that the gene of coding Yao horsefly salivary gland immunoloregulation polypeptide is made up of 362 Nucleotide, holds to 3 ' terminal sequence from 5 ' to be:
atgttgttaa?aaagttacgt?tttcttttta?ttgagcctgc?tcattgtggg?actgtttaca 60
tcatgtgatg?cggatgccca?atatgaggat?ctcgtcacag?gctatttacg?aaaaggaggc 120
gttagtggag?ttagtgactt?tgaacccatc?gaggtctctg?gcgaagacta?taacagtgat 180
gaagcggacg?aagacggaaa?agcgtaattc?taccaccttt?aacccataac?agcaaagcca 240
atgaagcaga?gtgcaattta?gtttgaatag?ttttatgtat?aatcccacca?ttcatatggc 300
attgagtaat?gatatggaaa?aatatatgca?aattaaacaa?aaaaaaaaaa?aaaaaaaaaa 360
aa 362
The coding Yao horsefly salivary gland immunoregulation peptide is a 115-204 position Nucleotide, and its aminoacid sequence is:
Gly?Gly?Val?Ser?Gly?Val?Ser?Asp?Phe?Glu?Pro?Ile?Glu?Val?Ser?Gly?Glu?Asp?Tyr
1 5 10 15
Asn?Ser?Asp?Glu?Ala?Asp?Glu?Asp?Gly?Lys?Ala
20 25 30
Beneficial effect of the present invention is: by Yao horsefly salivary gland immunoregulation peptide encoding gene its amino acid structure of deriving, the synthetic Yao horsefly salivary gland immunoregulation peptide has the effect of significant inhibition tumour necrosis factor (TNF-α), monokaryon chemotactic protein 1 (MCP-1), interleukin 8 (IL-8), interleukin 10 (IL-10), interleukin II (IL-2).This polypeptide can suppress the various kinds of cell factor, can disclose the mechanism of HAEMATOPHAGOUS ARTHROPODS parasitism from the relational angle between Yao horsefly salivary gland product and the innate immunity.Have characteristics simple in structure, that synthetic convenient, anti-microbial activity is strong.
Description of drawings:
Fig. 1 shows the restraining effect of Yao horsefly salivary gland immunoregulation peptide to Wistar rat tumor necrosin (TNF-α).
Fig. 2 shows the restraining effect of Yao horsefly salivary gland immunoregulation peptide to Wistar rat monokaryon chemotactic protein-1 (MCP-1).
Fig. 3 shows the restraining effect of Yao horsefly salivary gland immunoregulation peptide to Wistar rat leukocyte Jie plain-8 (IL-8).
Fig. 4 shows the restraining effect of Yao horsefly salivary gland immunoregulation peptide to Wistar rat leukocyte Jie plain-10 (IL-10).
Fig. 5 shows the effect that Yao horsefly salivary gland immunoregulation peptide suppresses plain-2 (IL-2) of Wistar rat leukocyte Jie.
Embodiment:
Embodiment one: the Yao horsefly salivary gland immunoregulation peptide gene clone:
I, the total RNA of Yao horsefly salivary gland extract:
A. vivisection Yao horsefly, picking sialisterium is put into liquid nitrogen immediately, accumulates about 60, weigh, get 300mg Yao horsefly salivary gland tissue, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer.
B. add equal-volume phenol/chloroformic solution, violent mixing, room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, reject precipitation.
C. supernatant adds isopyknic Virahol, and room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dries, and pipe end throw out is the total RNA of Yao horsefly salivary gland.
The purifying of II, Yao horsefly salivary gland mRNA:
U.S. PROMEGA company is adopted in Yao horsefly salivary gland mRNA separation and purification
MRNAIsolat ion Systems test kit.
A. get the total RNA 500 μ g of Yao horsefly salivary gland and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.
B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.
C. A liquid is added in the B liquid, room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the Yao horsefly salivary gland mRNA of purifying in the supernatant.
D. add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.
III, Yao horsefly salivary gland cDNA library construction: adopt the CLONTECH Creator of company
TMSMART
TMCDNALibrary Construction Kit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription):
1. add 1 μ l Yao horsefly salivary gland mRNA, 1 μ l SMART IV oligonucleotide, 1 μ l CDSIII/3 ' PCR primer at the aseptic centrifuge tube of 0.5ml, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
2. the reagent in the mixing centrifuge tube is also of short duration centrifugal, and 72 ℃ are incubated 2 minutes.
3. centrifuge tube was hatched on ice 2 minutes.
4. in centrifuge tube, add following reagent 2.0 μ l 5 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.
5. reagent and of short duration centrifugal in the mixing centrifuge tube is incubated 1 hour at 42 ℃.
6. centrifuge tube is placed and end the synthetic of first chain on ice.
7. it is standby to get the 2 synthetic cDNA of μ l institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. 2 μ l cDNA, first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l, 10 * Advantage 2PCR buffering, 2 μ l, 50 * dNTP mixture, 2 μ l, 5 ' PCR primer, 2 μ l CDSIII/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.
3. in the PCR instrument, increase by following program:
1. 95 ℃ of 20 second
2. 22 circulations:
95 ℃ of 5 second
68 ℃ 6 minutes
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out extracting.
C.PCR product PROMEGA company
SV Gel and PCR Clean-Up System test kit carries out extracting and reclaims, and step is as follows:
1. will put upside down mixing by the isopyknic film binding buffer of the double-stranded adding of the cDNA that PCR obtains, will mix liquid then and change the centrifugal purification post over to, room temperature left standstill 5 minutes, and DNA is fully combined with pellosil.16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
2. the elutriant (containing ethanol) that adds 700 μ l in the centrifugal purification post, 16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
3. repeating step 2.
4.16, centrifugal 5 minutes of 000g.
5. the centrifugal purification post is placed new centrifuge tube.
6. add 30 μ l ultrapure waters, at room temperature left standstill 5 minutes.
7.16, centrifugal 1 minute of 000g, pipe end solution is the cDNA two strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the single DH5 α of picking bacterium colony is inoculated in 3ml and does not contain in the LB substratum of penbritin, and 37 ℃ of overnight incubation are got above-mentioned bacterium liquid next day and are inoculated at 1: 100 in proportion in the 50ml LB nutrient solution, and 37 ℃ vibrated 2 hours.Work as OD
600Value reaches at 0.35 o'clock, the results bacterial cultures.
2. bacterium is transferred in aseptic, disposable, the ice-cold 50ml polypropylene tube, 10min puts in the side on ice, makes culture be cooled to 0 ℃.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
4. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30ml precooling
2-MgCl
2Solution (80mmol/L MgCl
2, 20mmol/L CaCl
2) resuspended every part of cell precipitation.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
7. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
8. every 50ml initial incubation thing ice-cold 0.1mol/L CaCl of 2ml
2Resuspended every part of cell precipitation, standby after the packing.
E. the enzyme conversion cutting, connect and connect product:
1. add 1 μ l Takara pMD18-T carrier, the double-stranded solution of 4 μ l odorranagrahami cDNA in Eppendorf tube, full dose is 5 μ l.
2. the ligase enzyme buffer mixture that adds 5 μ l (equivalent).
3.16 ℃ reaction 2 hours.
4. full dose (10 μ l) is added in the 100 μ l DH5 α competent cells, places 30 minutes in the ice.
5.42 after 90 seconds of ℃ heating, in ice, placed 1 minute again.
6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.
7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA that makes up approximately contains 1 * 10
6Individual independent clone.
IV, Yao horsefly salivary gland immunoregulation peptide gene clone screening:
Amplimer length is 25 Nucleotide, and its sequence is 5 ' CTCATTGTGGGACTGTTTACATCAT3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCR Primer primer among the cDNA Library ConstructionKit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.
The PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 56 ℃ of 30 second and 72 ℃ of 60 second, 30 circulations.
The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (about 5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), on 96 well culture plates by 8 * 8 matrix bed boards (totally 64 holes, every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
V, Yao horsefly salivary gland immunoregulation peptide gene sequencing and result:
Extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument to be the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, sequencing primer is BcaBEST
TMSequencingPrimer RV-M and BcaBEST
TMSequencing Primer M13-47, BcaBEST
TMSequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCACACAGG 3 ', BcaBEST
TMSequencingPrimer M13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '.Gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttgttaa?aaagttacgt?tttcttttta?ttgagcctgc?tcattgtggg?actgtttaca 60
tcatgtgatg?cggatgccca?atatgaggat?ctcgtcacag?gctatttacg?aaaaggaggc 120
gttagtggag?ttagtgactt?tgaacccatc?gaggtctctg?gcgaagacta?taacagtgat 180
gaagcggacg?aagacggaaa?agcgtaattc?taccaccttt?aacccataac?agcaaagcca 240
atgaagcaga?gtgcaattta?gtttgaatag?ttttatgtat?aatcccacca?ttcatatggc 300
attgagtaat?gatatggaaa?aatatatgca?aattaaacaa?aaaaaaaaaa?aaaaaaaaaa 360
aa 362
The sequence table of Yao horsefly salivary gland immunoregulation peptide gene nucleotide is: sequence length is 362 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: Yao horsefly salivary gland.
The coding Yao horsefly salivary gland immunoregulation peptide is a 115-204 position Nucleotide, and its aminoacid sequence is:
Gly?Gly?Val?Ser?Gly?Val?Ser?Asp?Phe?Glu?Pro?Ile?Glu?Val?Ser?Gly?Glu?Asp?Tyr
1 5 10 15
Asn?Ser?Asp?Glu?Ala?Asp?Glu?Asp?Gly?Lys?Ala
20 25 30
The Yao horsefly salivary gland immunoregulation peptide gene prepares the application of Yao horsefly salivary gland immunoregulation peptide as genetically engineered.
Embodiment two: the preparation Yao horsefly salivary gland immunoregulation peptide:
The preparation method of I, Yao horsefly salivary gland immunoregulation peptide: infer according to the gene of coding Yao horsefly salivary gland immunoregulation peptide and the aminoacid sequence of Yao horsefly salivary gland immunoregulation peptide to synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
II, molecular weight determination adopt the fast atom bombardment mass spectroscopy(FABMS) method, and (Fast atom bombardment massspectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is a substrate, Cs
+As projectile, electric current is 1 μ A, and emission voltage is 25Kv.
The Yao horsefly salivary gland immunoregulation peptide of III, purifying is identified its purity with the high-efficient liquid phase chromatogram HPLC method, and molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Embodiment three: the pharmacological evaluation of Yao horsefly salivary gland immunoregulation peptide:
1, Yao horsefly salivary gland immunoregulation peptide effect (Fig. 1) that tumour necrosis factor (TNF-α) is suppressed:
The preparation of rat spleen cells and cultivation: the disconnected cervical vertebra of rat is put to death, aseptic taking-up spleen is also peeled off fatty tissue, in the RPMI1640 substratum, wash out bloodstain, asepticly be transferred to 200 order copper mesh after shredding spleen, and with the 2ml piston spleen is ground and to be dispersed into individual cells.Centrifugal 10 minutes of 1000rpm/min abandons supernatant, and precipitation is suspended in the RPMI1640 substratum that contains 10% foetal calf serum, 2ug/ml bacteria lipopolysaccharide (LPS), adjusts cell concn to 2 * 10
6Individual/ml.In each hole of 96 orifice plates, add cell suspension 196ul, and to add concentration be the gadfly immunomodulatory peptides 4ul of 1mg/ml, make it final concentration and reach 20ug/ml, establish 2 repeating holes; Being provided with simultaneously with LPS or without LPS stimulates, and the cell that does not add gadfly immunomodulatory peptides is established 2 repeating hole .37 ℃, 5%CO in contrast
2And cultivated 48 hours under the saturated humidity, the collecting cell nutrient solution is in the 1.5ml centrifuge tube, and the centrifugal 10min of 2000rpm/min keeps supernatant, and is stored in-20 ℃, is used for the detection of cytokine.To be stored in-20 ℃, the cell conditioned medium that is used for TNF-α detection adds the blank micropore 50ul/ hole of ELISA test kit, establishes 2 repeating holes; According to ELISA detection kit specification sheets, in sample well, add the biotin labeling liquid of 10ul; The enzyme labelling solution that in sample well, adds 50ul; 37 ℃ of incubation reaction 60 minutes; Washings 5 times leaves standstill 10-20 second at every turn; Every hole adds substrate A, each 50ul of B liquid; 37 ℃ of following lucifuge incubation reaction 15 minutes; Every hole adds 50ul stop buffer, termination reaction; On the microplate reader of wavelength 450nm, read the OD value in each hole; With the OD value is ordinate zou, is X-coordinate with the concentration of standard substance, curve plotting figure; OD value is per sample searched corresponding concentration range, and the concentration of 2 repeating holes is averaged.
2, Yao horsefly salivary gland immunoregulation peptide effect (Fig. 2) that monokaryon chemotactic protein-1 (MCP-1) is suppressed:
The preparation of rat spleen cells and cultivation: the disconnected cervical vertebra of rat is put to death, aseptic taking-up spleen is also peeled off fatty tissue, in the RPMI1640 substratum, wash out bloodstain, asepticly be transferred to 200 order copper mesh after shredding spleen, and with the 2ml piston spleen is ground and to be dispersed into individual cells.Centrifugal 10 minutes of 1000rpm/min abandons supernatant, and precipitation is suspended in the RPMI1640 substratum that contains 10% foetal calf serum, 2ug/ml bacteria lipopolysaccharide (LPS), adjusts cell concn to 2 * 10
6Individual/ml.In each hole of 96 orifice plates, add cell suspension 196ul, and to add concentration be the gadfly immunomodulatory peptides 4ul of 1mg/ml, make it final concentration and reach 20ug/ml, establish 2 repeating holes; Being provided with simultaneously with LPS or without LPS stimulates, and the cell that does not add gadfly immunomodulatory peptides is established 2 repeating hole .37 ℃, 5%C0 in contrast
2And cultivated 48 hours under the saturated humidity, the collecting cell nutrient solution is in the 1.5ml centrifuge tube, and the centrifugal 10min of 2000rpm/min keeps supernatant, and is stored in-20 ℃, is used for the detection of cytokine.To be stored in-20 ℃, the cell conditioned medium that is used for the MCP-1 detection adds the blank micropore 50ul/ hole of ELISA test kit, establishes 2 repeating holes; According to ELISA detection kit specification sheets, in sample well, add the biotin labeling liquid of 10ul; The enzyme labelling solution that in sample well, adds 100ul; 37 ℃ of incubation reaction 60 minutes; Washings 5 times leaves standstill 10-20 second at every turn; Every hole adds substrate A, each 50ul of B liquid; 37 ℃ of following lucifuge incubation reaction 15 minutes; Every hole adds 50ul stop buffer, termination reaction; On the microplate reader of wavelength 450nm, read the OD value in each hole; With the OD value is ordinate zou, is X-coordinate with the concentration of standard substance, curve plotting figure; OD value is per sample searched corresponding concentration range, and the concentration of 2 repeating holes is averaged.
3, Yao horsefly salivary gland immunoregulation peptide effect (Fig. 3) that interleukin 8 (IL-8) is suppressed:
The preparation of rat spleen cells and cultivation: the disconnected cervical vertebra of rat is put to death, aseptic taking-up spleen is also peeled off fatty tissue, in the RPMI1640 substratum, wash out bloodstain, asepticly be transferred to 200 order copper mesh after shredding spleen, and with the 2ml piston spleen is ground and to be dispersed into individual cells.Centrifugal 10 minutes of 1000rpm/min abandons supernatant, and precipitation is suspended in the RPMI1640 substratum that contains 10% foetal calf serum, 2ug/ml bacteria lipopolysaccharide (LPS), adjusts cell concn to 2 * 10
6Individual/ml.In each hole of 96 orifice plates, add cell suspension 196ul, and to add concentration be the gadfly immunomodulatory peptides 4ul of 1mg/ml, make it final concentration and reach 20ug/ml, establish 2 repeating holes; Being provided with simultaneously with LPS or without LPS stimulates, and the cell that does not add gadfly immunomodulatory peptides is established 2 repeating hole .37 ℃, 5%CO in contrast
2And cultivated 48 hours under the saturated humidity, the collecting cell nutrient solution is in the 1.5ml centrifuge tube, and the centrifugal 10min of 2000rpm/min keeps supernatant, and is stored in-20 ℃, is used for the detection of cytokine.To be stored in-20 ℃, the cell conditioned medium that is used for the IL-8 detection adds the blank micropore 100ul/ hole of ELISA test kit, establishes 2 repeating holes; According to ELISA detection kit specification sheets, in sample well, add the enzyme labelling solution of 50ul; 37 ℃ of incubation reaction 60 minutes; Washings 5 times leaves standstill 10-20 second at every turn; Every hole adds substrate A, each 50ul of B liquid; 37 ℃ of following lucifuge incubation reaction 15 minutes; Every hole adds 50ul stop buffer, termination reaction; On the microplate reader of wavelength 450nm, read the OD value in each hole; With the OD value is ordinate zou, is X-coordinate with the concentration of standard substance, curve plotting figure; OD value is per sample searched corresponding concentration range, and the concentration of 2 repeating holes is averaged.
4, Yao horsefly salivary gland immunoregulation peptide effect (Fig. 4) that interleukin 10 (IL-10) is suppressed:
The preparation of rat spleen cells and cultivation: the disconnected cervical vertebra of rat is put to death, aseptic taking-up spleen is also peeled off fatty tissue, in the RPMI1640 substratum, wash out bloodstain, asepticly be transferred to 200 order copper mesh after shredding spleen, and with the 2ml piston spleen is ground and to be dispersed into individual cells.Centrifugal 10 minutes of 1000rpm/min abandons supernatant, and precipitation is suspended in the RPMI1640 substratum that contains 10% foetal calf serum, 5ug/ml concanavalin A (ConA), adjusts cell concn to 2 * 10
6Individual/ml.In each hole of 96 orifice plates, add cell suspension 196ul, and to add concentration be the gadfly immunomodulatory peptides 4ul of 1mg/ml, make it final concentration and reach 20ug/ml, establish 2 repeating holes; Being provided with simultaneously with ConA or without ConA stimulates, and the cell that does not add gadfly immunomodulatory peptides is established 2 repeating hole .37 ℃, 5%CO in contrast
2And cultivated 48 hours under the saturated humidity, the collecting cell nutrient solution is in the 1.5ml centrifuge tube, and the centrifugal 10min of 2000rpm/min keeps supernatant, and is stored in-20 ℃, is used for the detection of cytokine.To be stored in-20 ℃, the cell conditioned medium that is used for the IL-10 detection adds the blank micropore 50ul/ hole of ELISA test kit, establishes 2 repeating holes; According to ELISA detection kit specification sheets, in sample well, add the biotin labeling liquid of 10ul; The enzyme labelling solution that in sample well, adds 50ul; 37 ℃ of incubation reaction 60 minutes; Washings 5 times leaves standstill 10-20 second at every turn; Every hole adds substrate A, each 50ul of B liquid; 37 ℃ of following lucifuge incubation reaction 15 minutes; Every hole adds 50ul stop buffer, termination reaction; On the microplate reader of wavelength 450nm, read the OD value in each hole; With the OD value is ordinate zou, is X-coordinate with the concentration of standard substance, curve plotting figure; OD value is per sample searched corresponding concentration range, and the concentration of 2 repeating holes is averaged.
5, Yao horsefly salivary gland immunoregulation peptide effect (Fig. 5) that interleukin II (IL-2) is suppressed:
The preparation of rat spleen cells and cultivation: the disconnected cervical vertebra of rat is put to death, aseptic taking-up spleen is also peeled off fatty tissue, in the RPMI1640 substratum, wash out bloodstain, asepticly be transferred to 200 order copper mesh after shredding spleen, and with the 2ml piston spleen is ground and to be dispersed into individual cells.Centrifugal 10 minutes of 1000rpm/min abandons supernatant, and precipitation is suspended in the RPMI1640 substratum that contains 10% foetal calf serum, 5ug/ml concanavalin A (ConA), adjusts cell concn to 2 * 10
6Individual/ml.In each hole of 96 orifice plates, add cell suspension 196ul, and to add concentration be the gadfly immunomodulatory peptides 4ul of 1mg/ml, make it final concentration and reach 20ug/ml, establish 2 repeating holes; Being provided with simultaneously with ConA or without ConA stimulates, and the cell that does not add gadfly immunomodulatory peptides is established 2 repeating holes in contrast.37 ℃, 5%CO
2And cultivated 48 hours under the saturated humidity, the collecting cell nutrient solution is in the 1.5ml centrifuge tube, and the centrifugal 10min of 2000rpm/min keeps supernatant, and is stored in-20 ℃, is used for the detection of cytokine.To be stored in-20 ℃, the cell conditioned medium that is used for the IL-2 detection adds the blank micropore 100ul/ hole of ELISA test kit, establishes 2 repeating holes; According to ELISA detection kit specification sheets, in sample well, add the enzyme labelling solution of 50ul; 37 ℃ of incubation reaction 60 minutes; Washings 5 times leaves standstill 10-20 second at every turn; Every hole adds substrate A, each 50ul of B liquid; 37 ℃ of following lucifuge incubation reaction 15 minutes; Every hole adds 50ul stop buffer, termination reaction; On the microplate reader of wavelength 450nm, read the OD value in each hole; With the OD value is ordinate zou, is X-coordinate with the concentration of standard substance, curve plotting figure; OD value is per sample searched corresponding concentration range, and the concentration of 2 repeating holes is averaged.
SEQUENCE?LISTING
Claims (4)
1. Yao horsefly salivary gland immunoregulation peptide is characterized in that being made up of the aminoacid sequence shown in the SEQ ID NO:2.
2. the gene of coding Yao horsefly salivary gland immunoregulation peptide is characterized in that being made up of the nucleotide sequence shown in the SEQ ID NO:1.
The coding Yao horsefly salivary gland immunoregulation peptide gene, its 115-204 position nucleotide sequence by SEQ ID NO:1 is formed.
4. the application of the described Yao horsefly salivary gland immunoregulation peptide of claim 1 in the preparation immunoregulation druge.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810058075XA CN101220091B (en) | 2008-01-31 | 2008-01-31 | Yao horsefly salivary gland immunoregulation peptide, gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810058075XA CN101220091B (en) | 2008-01-31 | 2008-01-31 | Yao horsefly salivary gland immunoregulation peptide, gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101220091A CN101220091A (en) | 2008-07-16 |
| CN101220091B true CN101220091B (en) | 2011-08-24 |
Family
ID=39630191
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810058075XA Active CN101220091B (en) | 2008-01-31 | 2008-01-31 | Yao horsefly salivary gland immunoregulation peptide, gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101220091B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101381404B (en) * | 2008-09-24 | 2011-05-11 | 武汉摩尔生物科技有限公司 | Targeting tumor protein KCT-W2, preparation method and application |
| CN101608176A (en) * | 2009-07-02 | 2009-12-23 | 中国科学院昆明动物研究所 | Tabanus yao fibrinogen hydrolase tabfiblysin and gene thereof and application |
| CN105061573B (en) * | 2015-07-20 | 2018-08-21 | 苏州大学 | The natural anti-inflammatory polypeptide cecropin-TY1 of Yao horsefly and its application |
| CN105153291A (en) * | 2015-10-13 | 2015-12-16 | 南京农业大学 | Hybomitra-atriperoides-derived immunosuppressive peptide HA, and coding gene and application thereof |
| CN112759636B (en) * | 2021-01-21 | 2022-05-31 | 浙江辉肽生命健康科技有限公司 | Bioactive peptide with amino acid structure ESLKGVDPKFLR, and preparation method and application thereof |
-
2008
- 2008-01-31 CN CN200810058075XA patent/CN101220091B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| AHN M. Y.等.Purification and characterization of anticoagulant protein from the tabanus, tabanus bivittatus.Arch Pham Res第29卷 第5期.2006,第418-423页,见全文. * |
| AHNM.Y.等.Purificationandcharacterizationofanticoagulantproteinfromthetabanus tabanus bivittatus.Arch Pham Res第29卷 第5期.2006 |
| KOPECKY J.等.Suppressive effect of Ixodes ricinus salivary gland extract on mechanisms of natural immunity in vitro.Parasite Immunol第20卷 第4期.1998,第169-174页，见全文. |
| KOPECKY J.等.Suppressive effect of Ixodes ricinus salivary gland extract on mechanisms of natural immunity in vitro.Parasite Immunol第20卷 第4期.1998,第169-174页,见全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101220091A (en) | 2008-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Boismenu et al. | Chemokine expression by intraepithelial gamma delta T cells. Implications for the recruitment of inflammatory cells to damaged epithelia. | |
| Yoshie et al. | Chemokines in immunity | |
| Bayne et al. | The acute phase response and innate immunity of fish | |
| Aggarwal et al. | IL-17: prototype member of an emerging cytokine family | |
| Willimann et al. | The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7 | |
| Wolpe et al. | Macrophage inflammatory proteins 1 and 2: members of a novel superfamily of cytokines | |
| CN101220091B (en) | Yao horsefly salivary gland immunoregulation peptide, gene and application thereof | |
| US7585937B2 (en) | GAG binding proteins | |
| WO2004053057A2 (en) | Gene expression systems and recombinant cell lines | |
| DK0808367T3 (en) | Vascular mucosal dressings and their use | |
| Vuadens et al. | Identification of swiprosin 1 in human lymphocytes | |
| CN101638432B (en) | Rana pleuraden antioxidant peptide and genes | |
| BRPI0711607A2 (en) | multimeric molecule for modulating human or animal immune system activity, combination agent, kit, pharmaceutical agent, molecule and use thereof | |
| EA003942B1 (en) | Amino-terminally truncated mcp-2 and methods of use therefor | |
| KR100780255B1 (en) | - Deletion forms of IgE-dependent histamine releasing factor having histamine releasing activity HRF-binding peptides and the uses thereof | |
| DeForge et al. | Interleukin-1 receptor antagonist protein inhibits interleukin-8 expression in lipopolysaccharide-stimulated human whole blood. | |
| Musumeci et al. | DNA-based strategies for blocking HMGB1 cytokine activity: design, synthesis and preliminary in vitro/in vivo assays of DNA and DNA-like duplexes | |
| KR20040077669A (en) | Effectors of innate immunity | |
| Svenson et al. | Interleukin-1 receptors on human thyroid cells and on the rat thyroid cell line FRTL-5 | |
| Cosman et al. | Interleukin 15 and its receptor | |
| CA2152210C (en) | Modified epimorphin | |
| CN100581584C (en) | Serine protease inhibitor of Rana grahami, and its application | |
| AU2004309111B2 (en) | CC-chemokine-binding tick proteins | |
| US7365171B2 (en) | Chemokine-like factors (CKLFs) with chemotactic and hematopoietic stimulating activities | |
| Hwang et al. | A 20 amino acid synthetic peptide of a region from the 55 kDa human TNF receptor inhibits cytolytic and binding activities of recombinant human tumour necrosis factor in vitro |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |