CN101220088B - Amalgamation protein of human glucagons-like peptide-1 and uses thereof - Google Patents
Amalgamation protein of human glucagons-like peptide-1 and uses thereof Download PDFInfo
- Publication number
- CN101220088B CN101220088B CN2007100187342A CN200710018734A CN101220088B CN 101220088 B CN101220088 B CN 101220088B CN 2007100187342 A CN2007100187342 A CN 2007100187342A CN 200710018734 A CN200710018734 A CN 200710018734A CN 101220088 B CN101220088 B CN 101220088B
- Authority
- CN
- China
- Prior art keywords
- ala
- ser
- gly
- thr
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a fusion protein of a human glucagon-like peptide -1(hGLP-1) analogues and the preparation method for the fusion protein, wherein, the fusion protein is a pro-drug with high biological stability and long half-life in vivo that releases active GLP-1 molecule after being degraded by enzyme in vivo and then brings into playing the pharmacological action. The scope of the invention extends to the treatment application of the products made by the production technique. The fusion protein can be used for treating and preventing the diseases or disorders relating the GLP-1 activity, in particular to the 2 Diabetes Mellitus. The fusion protein of a human glucagon-like peptide -1(hGLP-1) analogues and the preparation method for the fusion protein relates to the biotechnological field, with the fusion protein prepared by the gene engineering method, which has the advantages of much lower production cost than the chemical synthetic method, simple operation, and easy acquisition of raw material, and has possibility for commercial production.
Description
Technical field
The present invention relates to recombinant protein and treatment application thereof; Relate in particular to the recombinant protein of human glucagon-like-peptide-1 (hGLP-1) and analogue thereof and human glucagon-like-peptide-2 (hGLP-2) prodrug form of expression after gene level merges; And such fusion rotein is being used to prevent or treatment and GLP-1 active relevant disease or obstacle, especially diabetes B and the application in the complication thereof.
Background technology
Mellitus are global common disease and frequently-occurring disease, the serious harm human health.2007, the latest data that IDF (IDF) announces showed that the whole world 2.46 hundred million people are suffering the invasion and attack of mellitus at present, and diabetic subject's total number of persons will break through 3.8 hundred million in following 20 years.Among the existing patient, more than 85% diabetes B, i.e. non insulin dependent diabetes (NIDDM), its capillary blood vessel and aorta complication have very high mortality ratio and case fatality rate.The existing at present diabetic subject more than 4,000 ten thousand of China occupies the second in the world, and wherein 95% is 2 types, and the diabetic subject needs lifelong medication.Therefore, exploitation treatment diabetes B new drug efficient, long-acting, at a low price is significant.Diabetes B can be kept glucostasis through measures such as adjustment diet, reinforcement exercise and management of body weight in early days.When these measures were invalid, multiselect was with the treatment of oral hypoglycemics such as traditional sulfonylurea, biguanides, but the most outstanding untoward reaction of these medicines is exactly a hypoglycemia, and possibly bring out weight increase, made its clinical application limited.In addition, because the traditional treatment of diabetes B lays particular emphasis on symptoms such as alleviating hyperglycemia, rather than, cause most of patients all can't reverse the lasting decline of glycemic control ability, the minimizing of β cell quantity and the reduction of function to its positive pathogenic factor.From reducing feed for the treatment repetition of diabetes B clinically; Strengthen taking exercise; To using the single medicine treatment; To combination drug treatment and finally develop into the process that this course of disease of insulinize is increased the weight of gradually, these treatment measures can not be alleviated the process of diabetes B effectively, can not effectively prevent its complication again.It is thus clear that; Current medicine remains in many drawbacks in its therapeutic action of performance, and the onset diabetes rate worldwide climbs up and up in addition, and existing medicine can't satisfy the future market demand; Therefore; Form mechanism to disease, seek and develop safer and more effective newtype drug and be imminent to prevent and to reverse the PD of diabetes B, just to seem.Ideal treatment diabetes medicament is in lowering blood glucose; Should protect islet cell function as far as possible; Reduce the toxic action of hyperglycemia, improve the secretion of endogenous insulin, improve the susceptibility of surrounding tissue Regular Insulin to the β cell; Promote sugar and metabolism of fat and increase glucose dependency insulin secretion, can not occur spinoffs such as hypoglycemia during prolonged application.
Human glucagon-like-peptide-1 (human glucagon-like peptide-1; HGLP-1) be the hormonelike polypeptide by 30 amino-acid residues formed of back of ingesting by enteron aisle L emiocytosis; Be the product of preceding Proglucagon gene translation post-treatment, the about 3kDa of molecular weight, (glucagon) has 50% homology with hyperglycemic-glycogenolytic factor; Also participate in glucostasis in the control agent, but bringing into play distinct effect.Compare with a line medicine of current treatment mellitus; GLP-1 has 7 aspect advantages: 1. it promotes the insulin secretion effect to depend on glucose level; Thereby the hypoglycemia of having avoided the Regular Insulin excessive secretion to cause takes place; Can long-term safety use (Mojsov S, Weir GC, Habener JF.J ClinInvest 1987; 79:616-19; Kreymann B, Ghatei MA, Williams G, et al.Lancet1987; 2:1300-04; Orskov C, Holst JJ, Nielsen OV.Endocrinology 1988; 123:2009-13.); 2. can improve the insulin receptor susceptibility of perienchyma, help to treat insulin resistance; 3. secretion (Nauck MA, Holst JJ, Willms B.HormMetab Res 1997 that can glucagon suppression; 29 (9): 411-6.); 4. the diabetes B that causes for obesity can be through suppressing the effect of stomach emptying, helps patient keep on a diet or lose weight (Turton MD, O ' Shea D, Gunn I, et al.Nature 1996; 379:60-72.); 5. still effective to the invalid patient of sulfonylureas; 6. can improve patient's medium-term and long-term biochemical indicator (MeeranK, O ' Shea D, Edwards CM, et al.Endocrinology 1999 such as glycolated hemoglobin, fructosamine; 140 (1): 244-50; LarsenPJ, Fledelius C, Knudsen LB, et al.Diabetes 2001; 50:2530-39.); 7. can promote hyperplasia (Byrne MM, Pluntke K, Wank U, the et al.Eur J Clin Invest1998 of beta Cell of islet; 28:72-78.).In addition, (its treatment potential is also very outstanding for insulin-dependent diabetes mellitus, IDDM) patient GLP-1 to be applied to type 1 diabetes.Research shows that similar with NIDDM patient, GLP-1 can be alleviated hunger property hyperglycemia effectively through its stable hyperglycemic-glycogenolytic factor (glucagonostatic) characteristic; Can also reduce IDDM patient's postprandial blood sugar skew through prolonging the gastric emptying time.It is thus clear that GLP-1 all has therapeutic action to IDDM and NIDDM.Just because of these special biological actions of GLP-1, make it to become a kind of antidiabetic thing that potentiality to be exploited is arranged most, be expected to become the new drug growth point in treating diabetes field.Yet; Natural GLP-1 belongs to peptide hormone; Very easily degraded in vivo, and be easy to discharge, so only 2～6 minutes its biological half-life from kidney by DPP IV (DPP IV); The very short time can only be kept in the Plasma Concentration peak that subcutaneous injection people GLP-1 produces, to a great extent limit its clinical application.Therefore, be present tackling key problem emphasis the action time of managing to prolong GLP-1, press for develop biological half-life longer, stability is better, active higher hGLP-1 product application is in clinical.
Be the research of target spot with GLP-1 at present, mainly be devoted to following three aspects: (1) DPP IV suppressor factor:, prolong the transformation period of GLP-1 through the activity that suppresses DPP IV with the GLP-1 drug combination; (2) GLP-1 receptor stimulant: like the Exenatide/Exendin-4 of Amylin company; It is present development progress GLP-1 analogue the most rapidly; Obtained the drugs approved by FDA listing in 2005, injected 2 every day and can improve glucose level, can lose weight simultaneously; (3) GLP-1 molecular modification: like the Albugon of HGS company, being GLP-1 (DDP-IV resistant mutation) and albuminous syzygy, is 3 days in the intravital transformation period of monkey; The DAC:GLP1 (CJC-1131) of Canada ConjuChem company is that GLP-1 is connected with a chemical active radical, and medicine gets in the body and will form complex body with the BSA covalent attachment like this, the intravital transformation period reaches 10～12 days the people; The NN2211 (Liraglutide) that also has Denmark Novo Nordisk company, the C end is for having the GLP-1 verivate of lipid acid, and the transformation period was above 10 hours.These three kinds of medicines all are in the II clinical trial phase stage at present.But these medicines all adopt chemosynthesis, and chemically synthesized polypeptide often technical difficulty is big, production cost is high, purification difficult and can cause environmental pollution, its immunogenicity, stability and security etc. still are in the further investigation.
(human glucagon-like peptide-2 hGLP-2) claims people's intestines tethelin again to human glucagon-like-peptide-2, is the polypeptide of being made up of 33 amino-acid residues of enteron aisle L emiocytosis, has the effect that stimulates the intestines growth.Research finds that also GLP-2 has the effect of ingesting with the similar inhibition of GLP-1, can depress appetite, cause apocleisis; Can also delay stomach emptying, gastric acid inhibitory secretion (Nagell CF, Wettergren A, Pedersen JF, et al.Scand J Gastroenterol 2004; 39:353-8.).In addition, GLP-2 and GLP-1 are that (proglucagon PG) translates the product of post-treatment, and discharges from enteron aisle L cell jointly preceding hyperglycemic-glycogenolytic factor protogene.
Based on above-mentioned theory and practice; We are with hGLP-1 and hGLP-2; Or GLP-1 analogue and GLP-2 analogue are configured to fusion rotein; This fusion rotein will be simulated the secretion process of hormone under the normal physiological state better so, make the two common release, and be expected to give play to even more ideal dual biological effect.Also can the prodrug mentality of designing be introduced the design concept of this fusion rotein; A plurality of hGLP-1 and hGLP-2 are fused to macromolecular prodrug (prodrug); This prodrug is at external no physiologically active, but after getting in the body, progressively decomposes under the specific enzymes effect in vivo; Constantly discharge GLP-1, the long period GLP-1 concentration of remaining valid in vivo behind the single administration with physiologically active.Simultaneously, macromolecular prodrug also is difficult for being discharged by kidney, has prolonged the action time of medicine to a great extent.
Summary of the invention
The purpose of this invention is to provide the fusion rotein and the application thereof of human glucagon-like-peptide-1 analogue, it can prevent and treat the nucleotide sequence of the fusion rotein of 1 type and diabetes B and this fusion rotein of encoding, and such fusion rotein is a prodrug; Action time is longer; Have the DPP-IV resistance, ability glucose dependency insulin secretion accelerating improves the tolerance of body to glucose; Can promote beta Cell of islet propagation, regeneration again and reduce apoptosis, the protection islet function.
The objective of the invention is to realize like this, the fusion rotein of human glucagon-like-peptide-1 analogue and application thereof, this fusion rotein is made up of n polypeptide A and n polypeptide B, wherein,
Polypeptide A is GLP-1 (7-37) [SEQ ID NO.1], and its sequence is:
His-Xaa2-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gl y-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa31
Xaa2 is in the formula: Ala, Ser, Gly, Val, Thr; Xaa31 is: Gly, Ala, Arg, Lys or be removed;
Described polypeptide B is GLP-2 (1-33) [SEQ ID NO.2], and its sequence is:
His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa19-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp
Xaa19 is in the formula: Ala, Ser, Thr, Pro, Gly.
Also have joint in the middle of described polypeptide A and the polypeptide B, be selected from: Lys-Arg, Arg-Lys, Arg-Arg or Lys-Lys, this structure is a body internal specific proteolytic enzyme recognition site.
Described polypeptide A and polypeptide B and intermediate head constitute forms [SEQ ID NO.3] by polypeptide A-joint-polypeptide B, and sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp
Xaa5 is in the formula: Ala, Ser, Gly, Val, Thr; Xaa34 is: Gly, Ala, Arg, Lys or be removed; Xaa55 is: Ala, Ser, Thr, Pro, Gly.
Described polypeptide A and polypeptide B and intermediate head constitute forms [SEQ ID NO.4] by polypeptide A-joint-polypeptide B-joint-polypeptide A, and sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa102
Xaa5 in the formula, Xaa73 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102 is: Gly, Ala, Arg, Lys or be removed; Xaa55 is: ' Ala, Ser, Thr, Pro, Gly.
Described polypeptide A and polypeptide B and intermediate head constitute forms [SEQ ID NO.5] by polypeptide A-joint-polypeptide B-joint-polypeptide A-joint-polypeptide B, and sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Ty r-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa102-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa123-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp
Xaa5 in the formula, Xaa73 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102 is: Gly, Ala, Arg, Lys or be removed; Xaa55, Xaa123 is: Ala, Ser, Thr, Pro, Gly.
Described polypeptide A and polypeptide B and intermediate head constitute forms [SEQ ID NO.6] by polypeptide A-joint-polypeptide B-joint-polypeptide A-joint-polypeptide B-joint-polypeptide A, and sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa102-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa123-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa141-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa170
Xaa5 in the formula, Xaa73, Xaa141 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102, Xaa170 is: Gly, Ala, Arg, Lys or be removed; Xaa55, Xaa123 is: Ala, Ser, Thr, Pro, Gly.
The prokaryotic expression carrier of described fusion rotein is pET32a.
Described fusion rotein is by the recombinant expressed generation of escherichia expression system.
Polypeptide A in the described fusion rotein and polypeptide B are released to enteron aisle L cell under physiological status; All be that preceding Proglucagon gene translation post-treatment forms; Therefore polypeptide A and polypeptide B fusion can be simulated the hormone secretion under the physiological status, be beneficial to it and given play to the ideal biological effect better.
Described fusion rotein is used to prepare the purposes of treatment type 1 diabetes, diabetes B, obesity, glucagonoma of pancreas, metabolic disease.
Characteristics of the present invention are: said fusion rotein is a prodrug, behind enzyme liberating, discharges active GLP-1 molecule in vivo, and then the performance pharmacological action, and biologically stable is high, long half time in the body.Scope of the present invention is prolonged and is used the treatment of this production technique products obtained therefrom to use.This fusion rotein can be used for treating or prevention and GLP-1 active relevant disease or obstacle, especially diabetes B.Its advantage is: 1. the using gene engineering method prepares the fusion rotein of human glucagons-like peptide-1, promptly preceding glucagon-like peptide (Pro-GLPs), and production cost is far below chemical synthesis, and is easy and simple to handle, and raw material is easy to get.2. the constructed fusion rotein of the present invention forms non-immunogenicity for humanized's sequence merges.3. fusion rotein Pro-GLPs of the present invention does not have an activity external; But after in the entering body; Progressively decompose under the effect of specific enzymes in vivo; Constantly discharge GLP-1, the long period GLP-1 concentration of remaining valid in vivo behind the single administration, and effective control of diabetes symptom with physiologically active.4. because that merge mutually with it is GLP-2, so this kind release mode successfully simulated the GLP-1 under the physiological status and discharged, and is beneficial to it and brings into play positive biological effect better.5. the macromolecular prodrug that merges the back generation also is difficult for being discharged by kidney, has prolonged the action time of medicine to a great extent.This shows; Fusion rotein Pro-GLPs of the present invention had both kept the hypoglycemic activity of GLP-1; Solved small peptides such as GLP-1 and analogue thereof short problem of transformation period in vivo again; And first the prodrug mentality of designing is introduced the research and development of GLP-1 analogue, and successfully simulate the GLP-1 dispose procedure under the physiological status.
Pharmacodynamic study is the result show; Fusion rotein of the present invention has the ideal hypoglycemic activity; Help alleviating many diabetic complication symptoms of bringing owing to the saccharic metabolism disorder; Therefore, fusion rotein of the present invention can be used for preparing the medicine of treatment mellitus and control diabetic complication, demonstrates broad clinical application prospect.
Description of drawings
Below in conjunction with the embodiment accompanying drawing the present invention is further specified.
Fig. 1 is the synoptic diagram of pET32a carrier;
Fig. 2 is the synoptic diagram of fusion rotein Pro237 recombinant vectors;
Fig. 3 cuts the image behind the agarose gel electrophoresis of evaluation for recombinant plasmid pET32a-Pro237 enzyme;
The image of the SDS-PAGE electrophoresis result that Fig. 4 expresses after IPTG induces for fusion rotein Pro237;
Fig. 5 is the Western-blot result's of fusion rotein Pro237 a image;
Fig. 6 is the image of the SDS-PAGE electrophoresis result of fusion rotein Pro237 behind Ni-NTA Sepharose chromatographic separation purifying;
Fig. 7, Fig. 8, Fig. 9 for subcutaneous injection fusion rotein Pro237 to the oral glucose tolerance test of C57BL/6 mouse statistical graph as a result;
Fig. 7 gives the statistical graph as a result of the hypoglycemic activity behind the glucose load for twice;
Fig. 8 is the hypoglycemic activity of a various dose Pro237 statistical graph as a result during 20min behind the glucose load;
Fig. 9 is the plasma insulin level statistical graph of various dose Pro237 during 20min behind the glucose load;
Figure 10, Figure 11 for subcutaneous injection every day fusion rotein Pro237 to healthy C57BL/6 mouse and spontaneous mellitus db/db mouse ingests and the statistical graph as a result of body weight influence;
Figure 10 is the as a result statistical graph of Pro237 to the influence of ingesting;
Figure 11 is the as a result statistical graph of Pro237 to the body weight influence.
Embodiment
How the following example in order to help to describe the various embodiments of embodiment of the present invention.These embodiment explain for example, rather than limit scope of the present invention by any way.
Fusion rotein according to the invention can be n polypeptide A and n the recombinant protein that polypeptide B expresses after gene level merges;
Wherein said polypeptide A is hGLP-1 (7-37) or its analogue; Its aminoacid sequence [SEQID NO.1] is: His-Xaa2-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa31; Xaa2 is in the formula: Ala, Ser, Gly; Val, Thr; Xaa31 is: Gly, Ala, Arg, Lys or be removed; Described polypeptide B is hGLP-2 or its analogue; Its aminoacid sequence [SEQ ID NO.2] is: His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa19-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gi n-Thr-Lys-Ile-Thr-Asp; Xaa19 is in the formula: Ala, Ser, Thr; Pro, Gly; The N-terminal that the C-terminal of polypeptide A can pass through peptide linker (Linker) and polypeptide B merges, and the C-terminal of polypeptide B also can merge through the N-terminal of peptide linker and polypeptide A.
The present invention also provides the method for the above-mentioned fusion rotein of preparation biologically active.
The present invention also provides the joint that polypeptide A and polypeptide B are merged, and this joint is made up of a plurality of amino acid, can be selected from Lys-Arg, Arg-Lys, Arg-Arg or Lys-Lys.This structure is the specific binding site of endogenous protein lytic enzyme in the body, can make to get into intravital fusion rotein by the specificity enzymolysis, discharges active fragments with the performance pharmacological action.
The application that the present invention also provides above-mentioned fusion rotein and dna sequence dna and analogue thereof to be used to prepare prevention and to treat the medicine of mellitus and relative disease thereof.
Be to choose the best Pro-GLPs of experimental result in following examples, promptly Pro237 is an example, and other fusion rotein experimentizes according to following method equally.
The fusion rotein of present embodiment can obtain through recombinant gene.The concrete technical solution of recombination method production fusion rotein of the present invention is following:
The 1st goes on foot, and obtains the goal gene of fusion rotein of the present invention through chemosynthesis.
The 2nd step made up recombinant expression vector pET32a, and the pET32a empty carrier is available from German Novagen company (belong to the commercialization expression vector, anyone all can buy in market).
In the 3rd step, goal gene is recombinated in the expression vector pET32a plasmid, then transformed into escherichia coli B121 (DE3).
The 4th step is at expression in escherichia coli fusion rotein according to the invention.The mono-clonal that will contain competence intestinal bacteria B121 (DE3) cell of pET32a plasmid is inoculated in 5ml LB substratum (containing 100 μ g/ml penbritin Amp), 37 ℃ of shaking culture 10h.Change kind of a new substratum in 1: 100 ratio, continue 37 ℃ of shaking culture 2h, add sec.-propyl-β-D thiogalactoside (IPTG) then and induce the target protein expression, 37 ℃ induce 4h after, centrifugal collection thalline.
In the 5th step, separate the also albumen of purification of Recombinant generation.Utilize the fusion rotein of the expression of solidifying Ni agar chromatography column purification band His-tag.
In the 6th step, the activity of fusion rotein detects: oral glucose tolerance test (OGTT).Healthy C57BL/6J mouse (18～22g), male and female half and half, fasting 16-18 hour, the fusion rotein (0.3nmol/kg of subcutaneous injection various dose; 3nmol/kg 30nmol/kg), hGLP-1 (30nmol/kg) or saline water, irritates stomach behind the injection 15min and gives glucose load (1.5g/kg body weight), and respectively at injection back 0; 10,20,30,60; 90,120, get blood from the tail vein behind the 150min, measure glucose level with blood glucose meter.For the long-time blood sugar reducing function of observing this fusion rotein, give D-glucose (1.5mg/kg) immediately once more after the tail vein is got blood when 150min, by identical time interval determination blood sugar.The result shows that fusion rotein according to the invention is dose-dependently lowering blood glucose concentration, and this fusion rotein of above-mentioned dosage does not have influence to mouse euglycemia concentration.Blood sugar reducing function Deng the dosage fusion rotein is strong than the GLP-1 effect.Experiment shows that the glucose load animal gives back 120 minutes blood sugar recoveries of sugar to normal level at the filling stomach.Glucose load (1.5g/kg) for the second time, this fusion rotein is still brought into play its blood sugar reducing function.The above results shows; Fusion rotein according to the invention can obviously improve the tolerance of mouse to sugar, does not reduce euglycemia, and dose-dependently reduced hyperglycemia; Not only have the normal BA of GLP-1, and its action time, more independent hGLP-1 prolonged obviously.
According to sequence: Pro237 gene-terminator codon TAG, chemosynthesis length are the base sequence of 513bp, as follows:
BamHI
5’-
ggacttATGAAACGTCATAGTGAAGGGGCCTTTACCAGTGAT
Met Lys Arg His Ser Glu Gly Thr Phe Thr Ser Asp
GTGAGTTCTTACTTGGAGGGCCAGGCAGCAAAGGAATTCATT
Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile
GCTTGGCTGCTGAAAGGCCGAGGAAGGCGACATGCTGATGGA
Ala Trp Leu Val Lys Gly Arg Gly Arg Arg His Ala Asp Gly
TGCTTCTCTGATGATATGAACACGATTCTCGATAACCTTGCCGCC
Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala
AGAGACTTCATCAACTGGCTGATTCAAACCAAGATCACTGAC
Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp
AAGAAACATAGTGAAGGGGCCTTTACCAGTGATGTGAGTTCT
Lys Lys His Ser Glu Gly Thr Phe Thr Ser Asp Val Ser Ser
TACTTGGAGGGCCAGGCAGCAAAGGAATTCATTGCTTGGCTG
Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu
CTGAAAGGCCGAGGAAGGCGACATGCTGATGGATGCTTCTCT
Val Lys Gly Arg Gly Arg Arg His Ala Asp Gly Ser Phe Ser
GATGATATGAACACGATTCTCGATAACCTTGCCGCCAGAGAC
Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala Arg Asp
TTCATCAACTGGCTGATTCAAACCAAGATCACTGACAAGAAA
Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp Lys Lys
CATAGTGAAGGGGCCTTTACCAGTGATGTGAGTTCTTACTTG
His Ser Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu
GAGGGCCAGGCAGCAAAGGAATTCATTGCTTGGCTGCTGAAA
Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys
HindIII
GGCCGAGGATAG
aagctt-3’
Gly Arg Gly End
This base sequence is cloned among the pET32a, obtains containing the recombinant plasmid pET32a-Pro237 of the dna sequence dna of Pro237-terminator codon TAG, described base sequence contains the restriction enzyme site of restriction enzyme BamHI and HindIII.(seeing Fig. 1, Fig. 2)
Fig. 1 is pET32a carrier figure.
Fig. 2 is fusion rotein Pro237 recombinant vectors figure.
Fig. 1, Fig. 2 have shown the structure pattern of recombinant plasmid pET32a-Pro237.
The recombinant plasmid pET32a-Pro237 that builds is converted in the competence e. coli bl21 (DE3), and ice bath 30min is warming up in 42 ℃ of water-baths and keeps 90s; Be transferred to fast then in the ice bath, cooling 2～3min adds 500 μ lLB nutrient solutions in transformation mixture; (＜180rpm 30min), gets 200 μ l and is transferred to the LB agar culture plate that contains Amp 37 ℃ of shaking culture behind the mixing; 37 ℃ of incubated overnight filter out the mono-clonal bacterium colony of Amp resistance.Through BamHI and HindIII double digestion, agarose gel electrophoresis is identified positive colony, and dna sequencing is carried out in zone between recombinant plasmid BamHI and HindIII double enzyme site, obtains containing the genetic engineering bacterium of Pro237 gene order with conclusive evidence.(see figure 3)
The agarose gel electrophoresis that Fig. 3 cuts evaluation for recombinant plasmid pET32a-Pro237 enzyme is figure as a result.Among the figure, the 1st, the contrast of pET32a empty carrier, the 2nd, recombinant plasmid pET32a-Pro237, the 3rd, the as a result figure of pET32a-Pro237 behind BamHI and HindIII double digestion, the 4th, DNA marker.
The result of Fig. 3 shows that the plasmid that from the mono-clonal bacterium colony of the Amp resistance that filters out, extracts is recombinant plasmid pET32a-Pro237 really, is the Pro237 of 513bp through obtaining size behind BamHI and the HindIII double digestion.
Extracting recombinant plasmid pET32a-Pro237, further transformed into escherichia coli BL21 (DE3) makes up and obtains the gene engineering expression bacterium.Picking list colony inoculation contains in the LB substratum of 100 μ g/ml Amp in 5ml, and 37 ℃, the 180rpm shaking culture is spent the night.Get the overnight culture commentaries on classics of 50 μ l and plant in 5ml LB substratum, 37 ℃, 210rpm is cultured to logarithmic phase, surveys its OD
600=0.5～0.6 o'clock, the adding final concentration is that the IPTG of 0.1～1mM carried out abduction delivering 2～4 hours, produces and accumulate the Pro237 fusion rotein of solubility expression, and was centrifugal, abandons supernatant, collects wet thallus.(seeing Fig. 4, Fig. 5)
Fig. 4 is the SDS-PAGE electrophoresis result figure of fusion rotein Pro237 expressing protein after IPTG induces.Among the figure, the 1st, LMWP marker; The 2nd, without IPTG inductive protein expression; The 3rd, the protein expression level after 0.5mM IPTG induces; The 4th, the protein expression level after 0.1mM IPTG induces.
Fig. 5 is the Western-blot of fusion rotein Pro237 after anti-Histag detects figure as a result.Among the figure, the 1st, without the IPTG inductive; 2～7th, the Western-blot result behind the different sample size electrophoresis of the albumen after 0.5mM IPTG induces.
The result of Fig. 4 has shown that 0.1mM IPTG promptly can induce fusion rotein Pro237 to express.The fusion rotein that gives expression to is after Western-blot detects, and the result is as shown in Figure 5, shows that the fusion rotein of after IPTG induces, expressing is the Pro237 that has Histag really.This shows that this method has correctly given expression to fusion rotein Pro237.
Centrifugal collection thalline with the resuspended thalline of 0.02M phosphate buffered saline buffer, adds 100mmol/L PMSF to final concentration 1mmol/L; Carrying out ultrasonic bacteria breaking in the ice bath; Add 1%TritonX-100 in the damping fluid and keep 30min, the centrifugal 10min of 12000rpm/min gets supernatant and carries out NTA-Ni resin affinity chromatography; Collect Pro237 fusion rotein component, the use molecular weight cut-off is that the MilliporeAmicon Ultra-15 ultrafiltration pipe of 1～5kD is concentrated into albumen more than 2～5mg/ml.Collection penetrates the peak, and lyophilize obtains product P ro237.(see figure 6)
Fig. 6 is the SDS-PAGE electrophoresis result figure of fusion rotein Pro237 behind Ni-NTA Sepharose chromatographic separation purifying.Among the figure, 12 pipe (1ml/tube) protein samples of collecting behind 1～12 expression supernatant process NTA-Ni resin affinity column.
Fig. 6 result can obtain the higher fusion rotein Pro237 of purity after showing the fusion rotein Pro237 separation and purification of after IPTG induces, expressing.
The hypoglycemic activity of embodiment 5 Pro237
Experiment material and method:
Healthy kunming mice (cleaning level, The Fourth Military Medical University's Experimental Animal Center provides);
D-glucose (1.5g/kg), 0.9%Nacl solution, Pro237, GLP-1 (U.S. polypeptide company);
Full-automatic blood glucose meter (German Luo Shi diagnostic companies, Luo Kangquan
TMVigor type blood-sugar detecting instrument)
Healthy kunming mice, male and female half and half fasting 16-18 hour, are divided into 5 groups (n=6-12).1. saline water control group; 2. the positive control drug group (GLP-1,30nmol/kg); 3. Pro237 (30nmol/kg) organizes; 4. Pro237 (3nmol/kg) organizes; 5. Pro237 (0.3mol/kg) dose groups.Described Pro237 is the preparation product of embodiment 1.
Each gives glucose load (1.5g/kg) respectively after organizing subcutaneous administration 15min, is designated as 0 when giving sugar constantly.Respectively at 5,10,20,30,60,90,120,150min gets blood from mouse tail vein, measures blood glucose value with blood glucose meter.For the long-time Pro237 hypoglycemic activity of observing, give D-glucose (1.5mg/kg) immediately once more after the tail vein is got blood when 150min, by identical time interval determination blood sugar.(seeing Fig. 7, Fig. 8, Fig. 9)
Fig. 7 for subcutaneous injection Pro237 to the oral glucose tolerance test of C57BL/6 mouse, the hypoglycemic activity that gives the glucose level behind the glucose load for twice is statistical graph as a result; Fig. 8 for subcutaneous injection various dose Pro237 to C57BL/6 mouse oral glucose tolerance test, the hypoglycemic activity of the blood glucose value of various dose statistical graph as a result during 20min behind the glucose load; Fig. 9 for subcutaneous injection various dose Pro237 to C57BL/6 mouse oral glucose tolerance test, the hypoglycemic activity of the plasma insulin value of various dose statistical graph as a result during 20min behind the glucose load.
Result such as Fig. 7, Fig. 8, shown in Figure 9 can find out, Pro237 is dose-dependently lowering blood glucose concentration, stimulates insulin secretion.The Pro237 of above-mentioned dosage does not have influence to mouse euglycemia concentration.Blood sugar reducing function Deng dosage Pro237 is strong than the GLP-1 effect.Experiment shows that the glucose load animal gives back 120 minutes blood sugar recoveries of sugar to normal level at the filling stomach.Glucose load (1.5g/kg) for the second time, Pro237 still brings into play its blood sugar reducing function.The above results shows that Pro237 can obviously improve the tolerance of mouse to sugar, does not reduce euglycemia, and dose-dependently reduced hyperglycemia, stimulated insulin secretion, and its blood sugar reducing function can be kept more than the 3h.
Experiment material and method:
C57BL/6 mouse (SPF level, The Fourth Military Medical University's Experimental Animal Center provides);
Spontaneous mellitus db/db mouse (SPF level, model animal institute of country of Nanjing University provides); 0.9%Nacl solution, Pro237;
Healthy C57BL/6 mouse and spontaneous mellitus db/db mouse respectively are divided into 2 groups (n=6-10).1. saline water control group; 2. Pro237 (3nmol/kg) organizes.Described Pro237 is the preparation product of embodiment 1.
Each organize in every morning 9:00 and afternoon the 6:00 subcutaneous administration, 7 weeks of successive administration. measure the food ration and the body weight of each treated animal during 11:00 respectively at morning every day.(seeing Figure 10, Figure 11).
Figure 10, Figure 11 are influence the as a result figure of fusion rotein Pro237 to food ration and body weight.Wherein, Figure 10 is the statistics figure of subcutaneous injection every day Pro237 to the influence of healthy C57BL/6 mouse and spontaneous mellitus db/db mouse food ration; Figure 11 is the statistics figure of subcutaneous injection Pro237 to the influence of healthy C57BL/6 mouse and spontaneous mellitus db/db mouse body weight.
The result of Figure 10, Figure 11 demonstrates, and Pro237 can obviously reduce the food ration of diabetic mice in the administration process in 7 weeks by a definite date, and reduces the body weight of diabetic mice, but to healthy mice ingest and body weight does not have obvious influence.This shows that Pro237 can be used for the caused obesity symptom of control of diabetes to a certain extent.
Sequence table
< 110>The Fourth Military Medical University
< 120>fusion rotein of human glucagon-like-peptide-1 analogue and application thereof
< 130>do not have
<140>200710018734.2
<141>2007-12-10
<160>6
<170>PatentIn version 3.2
<210>1
<211>31
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(2)..(2)
< 223>the 2nd Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(31)..(31)
< 223>the 31st Xaa is Gly, Ala, and Arg, Lys, or be removed
<400>1
His Xaa Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly
1 5 10 15
Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly Arg Xaa
20 25 30
<210>2
<211>33
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(19)..(19)
< 223>the 19th Xaa19 is Ala, Ser, Thr, Pro, or Gly
<400>2
His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn
1 5 10 15
Leu Ala Xaa Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr
20 25 30
Asp
<210>3
<211>69
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(5)..(5)
< 223>the 5th Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(34)..(34)
< 223>the 34th Xaa is Gly, Ala, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(55)..(55)
< 223>the 55th Xaa is Ala, Ser, Thr, Pro, or Gly
<400>3
Met Lys Arg His Xaa Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr
1 5 10 15
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly
20 25 30
Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr
35 40 45
Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn Trp Leu Ile Gln
50 55 60
Thr Lys Ile Thr Asp
65
<210>4
<211>102
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(5)..(5)
< 223>the 5th Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(34)..(34)
< 223>the 34th Xaa is Gly, Al, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(55)..(55)
< 223>the 55th Xaa is Ala, Ser, Thr, Pro, or Gly
<220>
<221>MISC_FEATURE
<222>(73)..(73)
< 223>the 73rd Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(102)..(102)
< 223>the 102nd Xaa is Gly, Ala, and Arg, Lys, or be removed
<400>4
Met Lys Arg His Xaa Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr
1 5 10 15
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly
20 25 30
Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr
35 40 45
Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn Trp Leu Ile Gln
50 55 60
Thr Lys Ile Thr Asp Lys Lys His Xaa Glu Gly Thr Phe Thr Ser Asp
65 70 75 80
Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp
85 90 95
Leu Val Lys Gly Arg Xaa
100
<210>5
<211>137
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(5)..(5)
< 223>the 5th Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(34)..(34)
< 223>the 34th Xaa is Gly, Ala, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(55)..(55)
< 223>the 55th Xaa is Ala, Ser, Thr, Pro, or Gly
<220>
<221>MISC_FEATURE
<222>(73)..(73)
< 223>the 73rd Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(102)..(102)
< 223>the 102nd Xaa is Gly, Ala, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(123)..(123)
< 223>the 123rd Xaa is Ala, Ser, Thr, Pro, or Gly
<400>5
Met Lys Arg His Xaa Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr
1 5 10 15
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly
20 25 30
Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr
35 40 45
Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn Trp Leu Ile Gln
50 55 60
Thr Lys Ile Thr Asp Lys Lys His Xaa Glu Gly Thr Phe Thr Ser Asp
65 70 75 80
Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp
85 90 95
Leu Val Lys Gly Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp
100 105 110
Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn
115 120 125
Trp Leu Ile Gln Thr Lys Ile Thr Asp
130 135
<210>6
<211>170
<212>PRT
< 213>artificial sequence
<220>
<221>misc_feature
< 223>recombinant precursor
<220>
<221>MISC_FEATURE
<222>(5)..(5)
< 223>the 5th Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(34)..(34)
< 223>the 34th Xaa is Gly, Ala, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(55)..(55)
< 223>the 55th Xaa is Ala, Ser, Thr, Pro, or Gly
<220>
<221>MISC_FEATURE
<222>(73)..(73)
< 223>the 73rd Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(102)..(102)
< 223>the 102nd Xaa is Gly, Ala, and Arg, Lys, or be removed
<220>
<221>MISC_FEATURE
<222>(123)..(123)
< 223>the 123rd Xaa is Ala, Ser, Thr, Pro, or Gly
<220>
<221>MISC_FEATURE
<222>(141)..(141)
< 223>the 141st Xaa is Ala, Ser, Gly, Val, or Thr
<220>
<221>MISC_FEATURE
<222>(170)..(170)
< 223>the 170th Xaa is Gly, Ala, and Arg, Lys, or be removed
<400>6
Met Lys Arg His Xaa Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr
1 5 10 15
Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly
20 25 30
Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp Glu Met Asn Thr
35 40 45
Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn Trp Leu Ile Gln
50 55 60
Thr Lys Ile Thr Asp Lys Lys His Xaa Glu Gly Thr Phe Thr Ser Asp
65 70 75 80
Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp
85 90 95
Leu Val Lys Gly Arg Xaa Arg Arg His Ala Asp Gly Ser Phe Ser Asp
100 105 110
Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Xaa Arg Asp Phe Ile Asn
115 120 125
Trp Leu Ile Gln Thr Lys Ile Thr Asp Lys Lys His Xaa Glu Gly Thr
130 135 140
Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu
145 150 155 160
Phe Ile Ala Trp Leu Val Lys Gly Arg Xaa
165 170
Claims (6)
1. the fusion rotein of human glucagon-like-peptide-1 analogue, its sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp
Xaa5 is in the formula: Ala, Ser, Gly, Val, Thr; Xaa34 is: Gly, Ala, Arg, Lys or be removed; Xaa55 is: Ala, Ser, Thr, Pro, Gly.
2. the fusion rotein of human glucagon-like-peptide-1 analogue, its sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa102
Xaa5 in the formula, Xaa73 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102 is: Gly, Ala, Arg, Lys or be removed; Xaa55 is: Ala, Ser, Thr, Pro, Gly.
3. the fusion rotein of human glucagon-like-peptide-1 analogue, its sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa 102-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa123-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp
Xaa5 in the formula, Xaa73 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102 is: Gly, Ala, Arg, Lys or be removed; Xaa55, Xaa123 is: Ala, Ser, Thr, Pro, Gly.
4. the fusion rotein of human glucagon-like-peptide-1 analogue, its sequence is:
Met-Lys-Arg-His-Xaa5-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa34-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa55-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa73-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa102-Arg-Arg-His-Ala-Asp-Gly-Ser-Phe-Ser-Asp-Glu-Met-Asn-Thr-Ile-Leu-Asp-Asn-Leu-Ala-Xaa123-Arg-Asp-Phe-Ile-Asn-Trp-Leu-Ile-Gln-Thr-Lys-Ile-Thr-Asp-Lys-Lys-His-Xaa141-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Val-Ser-Ser-Tyr-Leu-Glu-Gly-Gln-Ala-Ala-Lys-Glu-Phe-Ile-Ala-Trp-Leu-Val-lys-Gly-Arg-Xaa170
Xaa5 in the formula, Xaa73, Xaa141 is: Ala, Ser, Gly, Val, Thr; Xaa34, Xaa102, Xaa170 is: Gly, Ala, Arg, Lys or be removed; Xaa55, Xaa123 is: Ala, Ser, Thr, Pro, Gly.
5. the fusion rotein of each described human glucagon-like-peptide-1 analogue of claim 1-4 is used for preventing or treat the application of the medicine of mellitus, diabetic complication, obesity, glucagonoma of pancreas in preparation.
6. application according to claim 5, wherein said mellitus are type 1 diabetes or diabetes B.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100187342A CN101220088B (en) | 2007-09-24 | 2007-09-24 | Amalgamation protein of human glucagons-like peptide-1 and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100187342A CN101220088B (en) | 2007-09-24 | 2007-09-24 | Amalgamation protein of human glucagons-like peptide-1 and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101220088A CN101220088A (en) | 2008-07-16 |
| CN101220088B true CN101220088B (en) | 2012-01-25 |
Family
ID=39630189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100187342A Expired - Fee Related CN101220088B (en) | 2007-09-24 | 2007-09-24 | Amalgamation protein of human glucagons-like peptide-1 and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101220088B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103087174B (en) * | 2011-11-03 | 2015-11-18 | 华东师范大学 | A kind of GLP-1 derivative DLG3312 and solid-state chemical reaction method method thereof |
| ES2810153T3 (en) * | 2012-03-01 | 2021-03-08 | Novo Nordisk As | GLP-1 prodrugs |
| CN112142855A (en) | 2012-05-18 | 2020-12-29 | 爱德迪安（北京）生物技术有限公司 | Protein for diabetes treatment, protein conjugate and application thereof |
| CN108341880B (en) * | 2017-01-23 | 2023-07-04 | 天津药物研究院有限公司 | Chimeric polypeptides comprising glucagon-like peptide-1 and fragment analogs of glucagon and uses thereof |
| CN114908064A (en) * | 2021-02-09 | 2022-08-16 | 南京惟亚德生物医药有限公司 | Replicative oncolytic adenovirus capable of inhibiting tumor progression and prolonging survival time of tumor-bearing individual and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1363654A (en) * | 2001-07-19 | 2002-08-14 | 上海华谊生物技术有限公司 | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) |
-
2007
- 2007-09-24 CN CN2007100187342A patent/CN101220088B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1363654A (en) * | 2001-07-19 | 2002-08-14 | 上海华谊生物技术有限公司 | Genetically engineered bacteria and process for preparing insulinotropic hormone secretion peptide GLP-1 (7-36) |
Non-Patent Citations (1)
| Title |
|---|
| 左翼等.人胰高血糖素样肽-1串联体的克隆及其表达.华东师范大学学报自然科学版.2006,(4),110-114，122. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101220088A (en) | 2008-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101891823B (en) | Exendin-4 and analog fusion protein thereof | |
| CN101993496B (en) | Dual blood sugar and blood fat adjusting fusion protein and preparation method and application thereof | |
| CN101993485A (en) | Peptide analog homologous dimer capable of accelerating insulin secretion and application thereof | |
| EP1970072A1 (en) | Use of GLP-2 peptides for the treatment of hyperparathyroidism | |
| CN103491975A (en) | Combination of acylated glucagon analogues with insulin analogues | |
| CN104271588A (en) | Engineered polypeptides having enhanced duration of action with reduced immunogenicity | |
| CN106559984A (en) | For treating the compositionss comprising Recent Development of Long-acting Insulin Analogs conjugate and long lasting insulinotropic element peptide conjugate of diabetes | |
| CA2856967A1 (en) | Therapeutic agents comprising insulin amino acid sequences | |
| CN101220088B (en) | Amalgamation protein of human glucagons-like peptide-1 and uses thereof | |
| CN102766204A (en) | Glucagon-like peptide-1 mutant polypeptide, its preparation method and application thereof | |
| CN105025919A (en) | Therapeutic agents, compositions, and methods for glycemic control | |
| CN109836504A (en) | A kind of Multidomain activated protein for treating metabolic disease | |
| CN111793126A (en) | Preparation method of GLP-1 analogue polypeptide and application thereof in type II diabetes | |
| CN105254763B (en) | A kind of Exendin-4 fusion protein, preparation method and applications | |
| CN113105561B (en) | Preparation method and application of double-target fusion protein | |
| CN110386975A (en) | Acylated GLP-1 derivative | |
| US20170360949A1 (en) | Polypeptide complex as polypeptide or protein drug carrier, method of using the polypeptide complex, and fusion protein complex thereof | |
| CN1982336A (en) | Human pancreas glucagon sample peptide-1-derivative, its production and use | |
| CN106519016A (en) | Design and application of blood glucose reducing and lipid regulating peptide Progly | |
| CN109248323A (en) | Acylated GLP-1 derivative | |
| Ma et al. | Expression and purification of optimized rolGLP-1, a novel GLP-1 analog, in Escherichia coli BL21 (DE3) and its good glucoregulatory effect on type 2 diabetic mice | |
| CN101665799A (en) | Recombination preparation method and application of Exendin-4 derivative | |
| CN101698681B (en) | Chimeric polypeptide with dual-targeting function and applications thereof | |
| KR101229610B1 (en) | Fusion molecule of GLP-1 analogue, and composition comprising the same for preventing or treating diabetes mellitus | |
| CN103204944B (en) | Long-acting immune fusion protein for treating diabetes mellitus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120125 Termination date: 20140924 |
|
| EXPY | Termination of patent right or utility model |