CN101210262A - Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique - Google Patents
Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique Download PDFInfo
- Publication number
- CN101210262A CN101210262A CNA2007101449111A CN200710144911A CN101210262A CN 101210262 A CN101210262 A CN 101210262A CN A2007101449111 A CNA2007101449111 A CN A2007101449111A CN 200710144911 A CN200710144911 A CN 200710144911A CN 101210262 A CN101210262 A CN 101210262A
- Authority
- CN
- China
- Prior art keywords
- conformation polymorphism
- concentration
- single strand
- dna
- strand conformation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a method for analyzing microbial community structure and composition using single-strand conformation polymorphism technology, which solves the problem that the existing biological assay and analysis methods are difficult to analyze the composition and structure of microbial community. The method comprises the following steps of: (1) extracting DNA of a microbial community; (2) performing PCR amplification; (3) removing antisense strand with restriction endonuclease; (4) performing gel electrophoresis; (5) purifying DNA; and (6) analyzing the composition and structure of the microbial community. The invention can rapidly and accurately analyze the composition and structure of a complex microbial community in a process system, resolve succession of the community, master the variation of the microbial community in the process system, guide the process, and improve the operating efficiency of the process system.
Description
Technical field
The present invention relates to a kind of method that biological community structure is formed of analyzing.
Background technology
Microflora has species diversity and community succession phenomenon, therefore adopts prior biological detection and analytical procedure to be difficult to analyze the biotic component structure of microflora.
Summary of the invention
The objective of the invention is in order to solve that present prior biological detects and analytical procedure is difficult to analyze the problem of the biotic component structure of microflora, and a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure composition that provides.
The method that adopts single strand conformation polymorphism technical Analysis biological community structure to form is carried out according to the following steps: DNA extraction method (the JIZHONG ZHOU that, adopts people such as Zhou Jizhong, MARY ANNBRUNS, JAMES M.TIEDJE.DNA Recovery from Soils of Diverse Composition.APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 1996,62:316-322) extract the DNA of microflora; Two, pcr amplification: pcr amplification forward primer sequence is AGAGTTTGATCCTGGCTCAG, and pcr amplification reverse primer sequence is TTACCGCGGCTGCTGGCA, and reverse primer 5 ' end adopts the phosphoric acid mark; Three, enzyme cuts except that antisense strand: the endonuclease reaction system is 50 μ L by 5 μ L, 10 * buffer buffered soln, 40 μ L pcr amplification products and 5 μ L concentration is that the lambda exonuclease of 5U/ μ L is formed, the endonuclease reaction system is reacted 3～4h in 37 ℃ environment, purifying enzyme is cut product then, is dissolved in the 20 μ L double distilled waters again; Four, will be dissolved in enzyme in the double distilled water cuts product and mixes the environment thermally denature that places 95 ℃ with isopyknic denaturing agent and handle 10min, ice bath 5min immediately then, afterwards sample in the gel electrophoresis, be electrophoresis 12～18h under the condition of 250～300V at 4～20 ℃, voltage; Five, gel is soaked in 10min in the double distilled water, with the blade of sterilizing the DNA band is downcut respectively then and put into centrifuge tube and grinding, in every centrifuge tube, add 50 μ L lysates again and in 37 ℃ environment, handle 3h, centrifugal then, separation of supernatant, and in supernatant liquor, add the dehydrated alcohol of 2 times of supernatant liquor volumes, place-20 ℃ environment to precipitate 2h, centrifugal 15min under 24000g, 4 ℃ condition again, sediment D NA adds 10 μ L TE solution behind the dry 15min in 37 ℃ environment; Six, the sediment D NA that step 5 is obtained analyzes respectively, promptly draws the composition structure of microflora; In the step 4 gel acrylamide and methene acrylamide account for the gel gross weight 10%～14%, glycerine accounts for 5%～10% of gel gross weight, wherein the mass ratio of acrylamide and methene acrylamide is 49～55: 1; Denaturing agent is made up of deionized formamide and sample-loading buffer in the step 4, wherein sample-loading buffer is made up of NaOH solution, EDTA, tetrabromophenol sulfonphthalein, dimethylbenzene cyanogen FF and deionized water, the concentration of NaOH is that the concentration of 10mM/L, EDTA is that the concentration of 20mM/L, tetrabromophenol sulfonphthalein is that the concentration of 0.02% (weight), dimethylbenzene cyanogen FF is 0.02% (weight) in the sample-loading buffer, and the volume ratio of deionized formamide and sample-loading buffer is 1: 3; The lysate of 50 μ L contains the ammonium acetate of 0.5M/L, the magnesium acetate of 10mM/L in the step 5, and 1mM/L, pH value are the SDS of 8.0 EDTA, 0.1% (weight) and the double distilled water of surplus.
The present invention can carry out COMMUNITY STRUCTURE to microflora complicated in the engineering system, has advantage fast and accurately, can resolve community succession, grasp microorganism species changing conditions in the engineering system synchronously, instruct the operational efficiency of technology, raising engineering system.
Description of drawings
Fig. 1 be among embodiment nine contrast experiments in the step 3 acrylamide and methene acrylamide account for 8% gel electrophoresis figure of gel gross weight, Fig. 2 be among embodiment nine contrast experiments in the step 3 acrylamide and methene acrylamide account for 12% gel electrophoresis figure of gel gross weight, Fig. 3 be among embodiment nine contrast experiments in the step 3 acrylamide and methene acrylamide account for 16% gel electrophoresis figure of gel gross weight, Fig. 4 be among embodiment nine contrast experiments in the step 4 volume ratio of deionized formamide and sample-loading buffer be 1: 1 gel electrophoresis figure, Fig. 5 be among embodiment nine contrast experiments in the step 4 volume ratio of deionized formamide and sample-loading buffer be 1: 2 gel electrophoresis figure, Fig. 6 be among embodiment nine contrast experiments in the step 4 volume ratio of deionized formamide and sample-loading buffer be 1: 3 gel electrophoresis figure, Fig. 7 is the SSCP collection of illustrative plates of embodiment nine Synchronization Analysis nitrogen and desulfurization process system microfloras.
Embodiment
Embodiment one: the method that present embodiment adopts single strand conformation polymorphism technical Analysis biological community structure to form is carried out according to the following steps: DNA extraction method (the JIZHONG ZHOU that, adopts people such as Zhou Jizhong, MARY ANN BRUNS, JAMES M.TIEDJE.DNA Recoveryfrom Soils of Diverse Composition.APPLIED AND ENVIRONMENTALMICROBIOLOGY, 1996,62:316-322) extract the DNA of microflora; Two, pcr amplification: pcr amplification forward primer sequence is AGAGTTTGATCCTGGCTCAG, and pcr amplification reverse primer sequence is TTACCGCGGCTGCTGGCA, and reverse primer 5 ' end adopts the phosphoric acid mark; Three, enzyme cuts except that antisense strand: the endonuclease reaction system is 50 μ L by 5 μ L, 10 * buffer buffered soln, 40 μ L pcr amplification products and 5 μ L concentration is that the lambda exonuclease of 5U/ μ L is formed, the endonuclease reaction system is reacted 3～4h in 37 ℃ environment, purifying enzyme is cut product then, is dissolved in the 20 μ L double distilled waters again; Four, will be dissolved in enzyme in the double distilled water cuts product and mixes the environment thermally denature that places 95 ℃ with isopyknic denaturing agent and handle 10min, ice bath 5min immediately then, afterwards sample in the gel electrophoresis, be electrophoresis 12～18h under the condition of 250～300V at 4～20 ℃, voltage; Five, gel is soaked in 10min in the double distilled water, with the blade of sterilizing the DNA band is downcut respectively then and put into centrifuge tube and grinding, in every centrifuge tube, add 50 μ L lysates again and in 37 ℃ environment, handle 3h, centrifugal then, separation of supernatant, and in supernatant liquor, add the dehydrated alcohol of 2 times of supernatant liquor volumes, place-20 ℃ environment to precipitate 2h, centrifugal 15min under 24000g, 4 ℃ condition again, sediment D NA adds 10 μ L TE solution behind the dry 15min in 37 ℃ environment; Six, the sediment D NA that step 5 is obtained analyzes respectively, promptly draws the composition structure of microflora; In the step 4 gel acrylamide and methene acrylamide account for the gel gross weight 10%～14%, glycerine accounts for 5%～10% of gel gross weight, wherein the mass ratio of acrylamide and methene acrylamide is 49～55: 1; Denaturing agent is made up of deionized formamide and sample-loading buffer in the step 4, wherein sample-loading buffer is made up of NaOH solution, EDTA, tetrabromophenol sulfonphthalein, dimethylbenzene cyanogen FF and deionized water, the concentration of NaOH is that the concentration of 10mM/L, EDTA is that the concentration of 20mM/L, tetrabromophenol sulfonphthalein is that the concentration of 0.02% (weight), dimethylbenzene cyanogen FF is 0.02% (weight) in the sample-loading buffer, and the volume ratio of deionized formamide and sample-loading buffer is 1: 3; The lysate of 50 μ L contains the ammonium acetate of 0.5M/L, the magnesium acetate of 10mM/L in the step 5, and 1mM/L, pH value are the SDS of 8.0 EDTA, 0.1% (weight) and the double distilled water of surplus.
The target gene that small subunit ribosome RNA (SSU rRNA) gene becomes present embodiment because of its conservative property on evolving and operational simplicity.The corresponding E.coli 16SrRNA of present embodiment pcr amplification forward primer gene 8～27bp, the corresponding E.coli 16S of pcr amplification reverse primer rRNA gene 533～515bp, present embodiment is a target sequence with 16S rRNA gene V1～V3 district (being approximately the sequence of 500bp), can reduce the interference of assorted band with respect to existing single strand conformation polymorphism technology (only with the 200bp in V3 district as target sequence) present embodiment, for Phylogenetic Analysis provides more information, analytical results is more accurate.Biological community structure complexity, the interaction of homology or allos chain in addition adopt existing single strand conformation polymorphism technology (SSCP) can produce a large amount of non-specific DNA bands, cause very big difficulty for the analysis of structure of community; Present embodiment step 3 enzyme cuts the DNA band number that can reduce half except that antisense strand at least, forms strand SSCP collection of illustrative plates, for follow-up microbiological analysis provides great convenience, simplifies the operation.
Each microorganism has only a characteristic DNA band in the present embodiment method.
Present embodiment reverse primer 5 ' end adopts the phosphoric acid mark by the synthetic also mark of bio-engineering corporation.
Add sensitivity that glycerine can increase single strand conformation polymorphism technology (SSCP) in the present embodiment step 4 gel and separate the more ability of long segment.
The DNA band of putting into centrifuge tube in the present embodiment step 5 pushes, grinds with the rifle head and the tube wall effect of micropipette rifle.The sediment D NA that obtains with step 5 respectively in the present embodiment step 6 is that template increases, clones, order-checking and phylogenetic systematics analysis.
Because biotin molecule relatively large (MW=244.3Da) can influence PCR result, so reverse primer 5 ' end adopts the phosphoric acid mark.Present embodiment uses lambda exonuclease not need in advance to nucleic acid purification.
People's such as present embodiment step 1 employing Zhou Jizhong DNA extraction method (JIZHONG ZHOU, MARY ANN BRUNS, JAMES M.TIEDJE.DNA Recovery from Soils of DiverseComposition.APPLIED AND ENVIRONMENTALMICROBIOLOGY, 1996,62:316-322) guaranteed the diversity of microbial population gene samples.
The DNA that the present embodiment step 6 can obtain step 5 carries out similarity retrieval and comparison by GenBank, perhaps adopt phylip or ClustalW software package to the alignment of similar sequences and the drafting of systematic evolution tree, by Treeview software evolutionary tree is exported at last, analyzed.
Embodiment two: the difference of present embodiment and embodiment one is: the PCR response procedures is in the step 2: 94 ℃ of preheating 5min, 94 ℃ of sex change 40s of first circulation, 55 ℃ of annealing 40s, 72 ℃ of extension 60s, circulate 30 times, every cycle annealing temperature reduces by 0.1 ℃ successively, and last 72 ℃ are extended 10min.Other step and parameter are identical with embodiment one.
Embodiment three: the difference of present embodiment and embodiment one is: the PCR reaction system is that 50 μ L are that the forward primer of 20 μ mol/L, reverse primer, 0.125U EX Taq archaeal dna polymerase, the DNA of 1～5ng microflora and the balance of deionized water that 1.5 μ L concentration are 20 μ mol/L are formed by 5 μ L, 10 * PCR buffer, 4 μ L dNTP, 1.5 μ L concentration in the step 2; Contain 2.5mmol/L Mg among 10 * PCR buffer
2+The concentration of various deoxynucleoside triphosphates is 2.5 μ mol/L among the dNTP.Other step and parameter are identical with embodiment one.
Embodiment four: the difference of present embodiment and embodiment one is: adopt dense phenol/chloroform nucleic acid purification method purifying nucleic acid in the step 3.Other step and parameter are identical with embodiment one.
Embodiment five: the difference of present embodiment and embodiment one is: acrylamide and methene acrylamide account for 12% of gel gross weight in the step 3.Other step and parameter are identical with embodiment one.
Embodiment six: the difference of present embodiment and embodiment one is: applied sample amount is 15～20 μ L in the step 4.Other step and parameter are identical with embodiment one.
Embodiment seven: the difference of present embodiment and embodiment one is: adopt nucleic acid electrophoresis silver dyeing technique to show the DNA band behind the step 4 electrophoresis.Other step and parameter are identical with embodiment one.
Present embodiment can improve the sensitivity of single strand conformation polymorphism technology, can detect the double-stranded DNA of 1pg (every DNA band).Prior art SYBR Green I (Molecular Probes Inc.) can only detect the above double-stranded DNA of 20pg (every DNA band), and the susceptibility of EB technology is then lower.
Embodiment eight: the difference of present embodiment and embodiment one is: be electrophoresis 18h under the condition of 300V at 4 ℃, voltage in the step 4.Other step and parameter are identical with embodiment one.
Embodiment nine: present embodiment adopts single strand conformation polymorphism technical Analysis nitrogen and desulfurization process system biological community structure, and method is identical with embodiment one.
The present embodiment Synchronization Analysis nitrogen and desulfurization process system SSCP of microflora collection of illustrative plates as shown in Figure 7, " M " swimming lane standard specimen is Marker among Fig. 7, " 0d " swimming lane standard specimen is the 0 day nitrogen and desulfurization process system DNA of microflora sample, " 5d " swimming lane standard specimen is the 5 days nitrogen and desulfurization process system DNA of microflora samples, " 10d " swimming lane standard specimen is the 10 days nitrogen and desulfurization process system DNA of microflora samples, " 15d " swimming lane standard specimen is the 15 days nitrogen and desulfurization process system DNA of microflora samples, " 20d " swimming lane standard specimen is the 20 days nitrogen and desulfurization process system DNA of microflora samples, " 25d " swimming lane standard specimen is the 25 days nitrogen and desulfurization process system DNA of microflora samples, " 30d " swimming lane standard specimen is the 30 days nitrogen and desulfurization process system DNA of microflora samples, and " 35d " swimming lane standard specimen is the 35 days nitrogen and desulfurization process system DNA of microflora samples.
Significance band 1～11 (marking among Fig. 7) among Fig. 7 is reclaimed, after increasing again and cloning, 1～4 transformant of each band picked at random checks order, the about 500bp of length, record 32 transformants altogether, adopt relatively 32 clone's that record of Sequencher 5.0, smallest match 95% is set, minimum overlay 100bp obtains 23 different activity classification unit (OTU); Because the main band in the collection of illustrative plates has all been carried out the cloning and sequencing analysis, its diversity can be represented the microbial species group structure of reactor.23 OTU are as shown in table 1 by the BLASTn comparative result.
Table 1
| OTU | The band sequence number | Similar bacterial strain, the GenBank accession number | Similarity | The most close Pseudomonas |
| 1 | B1-3，4 | Uncultured Chloroflexi bacterium AY211661 | 95％ | Anaerolinea |
| 2 | B2-1 | Uncultured anaerobic bacterium AY953215 | 99％ | Bizionia |
| 3 | B2-2 | Ochrobactrum anthropi AY776289 | 99％ | Ochrobactrum |
| 4 | B2-3 | Afipiafelis AY548800 | 99％ | Bradyrhizobium |
| 5 | B3-1，2 | Paracoccus yeeii AY014172 | 97％ | Paracoccus |
| 6 | B3-3，4 | Anaerolinea thermophila AB046413 | 90％ | Anaerolinea |
| 7 | B3-5 | Uncultured bacterium DQ443988 | 93％ | Aminobacterium |
| 8 | B4-1 | Pseudomonas sp.DQ219371 | 97％ | Flavimonas |
| 9 | B4-4 | Uncultured anaerobic bacterium AY953210 | 97％ | Bizionia |
| 10 | B4-5 | Uncultured anaerobic bacterium AY953215 | 99％ | Bizionia |
| 11 | B5-1，4，5 | Desulfomicrobium apsheronum DAU64865 | 98％ | Desulfomicrobium |
| 12 | B6-3 | Uncultured anaerobic bacterium AY953215 | 98％ | Bizionia |
| 13 | B7-1，3，4 | Uncultured soil bacterium AY221602 | 98％ | Propionibacterium |
| 14 | B7-2 | Uncultured anaerobic bacterium AY953151 | 99％ | Aminobacterium |
| 15 | B8-1 | Unidentified eubacterium UEA229182 | 97％ | Roseivirga |
| 16 | B8-3 | Uncultured Sulfurospirillum sp.AY780560 | 96％ | Sulfurospirillum |
| 17 | B8-5 | Uncultured bacterium AY548942 | 99％ | Anaerolinea |
| 18 | B9-3 | Brevundimonas sp.DQ406733 | 95％ | Mycoplana |
| 19 | B9-5 | Uncultured anaerobic bacterium AY953151 | 96％ | Synergistes |
| 20 | B10-1，2 | Uncultured bacterium AB240460 | 98％ | Sulfurovum |
| 21 | B10-3，5 | Uncultured epsilon proteobacterium AY261811 | 99％ | Sulfurovum |
| 22 | B11-1，5 | Uncultured Campylobacteraceae bacterium DQ507155 | 95％ | Sulfurovum |
| 23 | B11-4 | Uncultured epsilon proteobacterium DQ295703 | 99％ | Sulfurovum |
Can obviously find to have taken place in the simultaneous denitrification desulphurization reactor start-up course microflora's ecological succession phenomenon in conjunction with Fig. 7 and table 1.
The nitrate removal rate of the 12nd day post-reactor has reached 100%, more preceding 15 days electrophoretogram, group's species diversity is well below original state (the 0th day) when finding the 15th day, and wide variation have also taken place in structure of community, wherein band 1,2,4,10 indicated microbe groups Anaerolinea, Bizionia, Ochrobactrum, Bradyrhizobium, Flavimonas, Roseivirga, Sulfurospirillum begin a large amount of enrichments, and band 8 indicated microbe groups present by not having to the change procedure that has.Especially open population extinctions a large amount of in the beginning mud sample and a large amount of enrichments of some microorganisms with specific functions, microflora is begun to carry out succession to the artificial group of a directed domestication by the stable group of a nature.
Since the 10th day, band 5 indicated Desulfomicrobium sp. began to occur and enrichment gradually, and the removal efficient of vitriol also begins to improve, but clearance is stable inadequately.After the 25th day, along with the vitriol clearance reaches 100%, Desulfomicrobium sp. has become dominant microflora.Compared with the 15th day in the 20th day, band 2 (Bizionia, Ochrobactrum, Bradyrhizobium) is withered away, band 3 (Paracoccus), appearance and enrichment, cloning and sequencing is analyzed, learn that it is the most similar to Paracoccus sp. sequence, similarity is up to 97%, and Paracoccus sp. is a class facultative autotrophy nitrate reduction sulfur bacteria.The nitrate reduction sulfur bacteria is to be electron donor with nitrate, with various types of sulfocompounds, as sulfide, polysulphide, elementary sulfur, thiosulphate and sulphite are autotrophic type denitrifying bacteria (the Nica et al of electron acceptor(EA), 2000), be divided into several different subclass groups: (1) strict chemosynthetic autotroph bacterium (Obligately chemolithoautotrophic bacteria), as Thiobacillusdenitrificans, Thiobacillus thioparus and Thiomicrospira denitrificans; (2) facultative autotrophy type bacterium (acultative autotrophic bacteria), as Paracoccus denitrificans, Thiobacillusdelicatus, Thiobacillus thyasiris and Thiosphaera pantotropha, this quasi-microorganism is except reduced sulphur, can also utilize organic acid (Sorokin et al, 2003; Oh et al, 2001); (3) huge thread fungus (filamentous bacteria), as the member among Beggiatoa and the Thioplaca, be the huge thread fungus that is present in the settling, store a large amount of nitrate with vacuole, the autotrophy oxidation (Sorokinet al, 2003 that are used for sulfide; Schulz and Jorgensen, 2001).The physiological property of Paracoccus sp. is as follows, globoferous cell (diameter is 0.5～0.9 μ m) or tyrothricin (length is 0.9～1.2 μ m), single, paired or heap shape, form the Poly-salt particle, Gram-negative is not moved, aerobic, respiratory metabolism; When nitrate, nitrite or nitrogen oxide exist, can be electron acceptor(EA) battalion anaerobic growth with them; Under anaerobic reduce nitrate to nitrite to nitrogen oxide and N
2Think that in view of the above Paracoccus sp. has played crucial denitrification desulfidation in nitrogen and desulfurization process system reactor.After this, the clearance of vitriol is stabilized in 100% always, illustrates with Desulfomicrobium sp. and Paracoccus sp. to be that the microflora of main desulfurization and denitrification functions flora basically forms.
All reached 100% from the vitriol of the 26th day device that reacts and the clearance of nitrate, after this, biological community structure substantially no longer changes, and the succession of group is finished, and has formed the climax community with simultaneous denitrification desulfurizing function.But analytical electrophoresis collection of illustrative plates (among Fig. 3 the 30th day and the 35th day) is not difficult to find, the slight change that the relative populations of different microorganisms population exists still that some cause because of the nutrient concentrations slight change in the every day water inlet in the microflora causes with the artificial distribution, but do not influence analysis to biological community structure and community succession.
Collection of illustrative plates from 35 days, though the community succession rule is obvious, but also as can be seen in the reactor start-up process, band 1,6,7,9,10 stable existence always in active sludge microorganism group, and their relative content is constant substantially, when pH and basicity variation, these band fluctuating ranges are less, are referred to as resident population.According to table 1, resident flora respectively belongs to the similar bigger of bacterial strain to following: Anaerolinea, Bizionia, Propionibacterium, Mycoplana, Synergistes, Sulfurovum.These genus mostly are anaerobion, are present in the various anaerobic environments, and the part kind can be utilized fermenting substrate product acid widely, and they have the fermentation and acid function in reactor, for sulphate reducing bacteria provides organic substrates.
The contrast experiment
1, under 4 ℃ of conditions, carries out gel electrophoresis (other condition is all identical), 8% the gel electrophoresis figure that Fig. 1 is that acrylamide and methene acrylamide account for the gel gross weight in the step 3,16% the gel electrophoresis figure that 12% the gel electrophoresis figure that Fig. 2 is that acrylamide and methene acrylamide account for the gel gross weight in the step 3, Fig. 3 are that acrylamide and methene acrylamide account for the gel gross weight in the step 3.According to Fig. 1,2 and 3 as can be seen acrylamide and methene acrylamide concentration low (8%) band fuzzy, do not have readable; Acrylamide though can separate the microbe groups of some amount, because gum concentration is excessive, causes a lot of bands to separate with methene acrylamide concentration height (16%), causes microflora's diversity not expressed; Acrylamide and methene acrylamide concentration are 12% best results.
2, acrylamide and methene acrylamide account under 12% condition of gel gross weight and carry out gel electrophoresis (other condition is all identical) in 20 ℃, step 3, Fig. 4 is that the volume ratio of deionized formamide and sample-loading buffer is 1: 1 a gel electrophoresis figure in the step 4, Fig. 5 is that the volume ratio of deionized formamide and sample-loading buffer is 1: 2 a gel electrophoresis figure in the step 4, and Fig. 6 is that the volume ratio of deionized formamide and sample-loading buffer is 1: 3 a gel electrophoresis figure in the step 4.
Deionized formamide helps to improve the susceptibility of gel electrophoresis, and deionized formamide can prevent to form invalid annealing between the strand, strengthens the readability of SSCP collection of illustrative plates.But show that according to this experimental result the deionized formamide excessive concentration not only can not strengthen the resolving power of SSCP, also can cause the failure of analyzing; Its major cause is because the deionized formamide of excessive concentrations can cause strand inside can't form the intrachain hydrogen bond, can not form stable three-dimensional structure, and then cause the SSCP collection of illustrative plates to finish.
3, be better than the result of gel electrophoresis under 20 ℃ of conditions by the result of gel electrophoresis under 4 ℃ of conditions more as can be seen of Fig. 2 and Fig. 6, gel electrophoresis strip is neat under 4 ℃ of conditions, and the resolving power height is readable strong.
Sequence table
Claims (8)
1. a method that adopts single strand conformation polymorphism technical Analysis biological community structure to form is characterized in that adopting the method for single strand conformation polymorphism technical Analysis biological community structure composition to carry out according to the following steps: one, to adopt people's such as Zhou Jizhong DNA extraction method to extract the DNA of microflora; Two, pcr amplification: pcr amplification forward primer sequence is AGAGTTTGATCCTGGCTCAG, and pcr amplification reverse primer sequence is TTACCGCGGCTGCTGGCA, and reverse primer 5 ' end adopts the phosphoric acid mark; Three, enzyme cuts except that antisense strand: the endonuclease reaction system is 50 μ L by 5 μ L, 10 * buffer buffered soln, 40 μ LPCR amplified productions and 5 μ L concentration is that the lambda exonuclease of 5U/ μ L is formed, the endonuclease reaction system is reacted 3～4h in 37 ℃ environment, purifying enzyme is cut product then, is dissolved in the 20 μ L double distilled waters again; Four, will be dissolved in enzyme in the double distilled water cuts product and mixes the environment thermally denature that places 95 ℃ with isopyknic denaturing agent and handle 10min, ice bath 5min immediately then, afterwards sample in the gel electrophoresis, be electrophoresis 12～18h under the condition of 250～300V at 4～20 ℃, voltage; Five, gel is soaked in 10min in the double distilled water, with the blade of sterilizing the DNA band is downcut respectively then and put into centrifuge tube and grinding, in every centrifuge tube, add 50 μ L lysates again and in 37 ℃ environment, handle 3h, centrifugal then, separation of supernatant, and in supernatant liquor, add the dehydrated alcohol of 2 times of supernatant liquor volumes, place-20 ℃ environment to precipitate 2h, centrifugal 15min under 24000g, 4 ℃ condition again, sediment D NA adds 10 μ L TE solution behind the dry 15min in 37 ℃ environment; Six, the sediment D NA that step 5 is obtained analyzes respectively, promptly draws the composition structure of microflora; In the step 4 gel acrylamide and methene acrylamide account for the gel gross weight 10%～14%, glycerine accounts for 5%～10% of gel gross weight, wherein the mass ratio of acrylamide and methene acrylamide is 49～55: 1; Denaturing agent is made up of deionized formamide and sample-loading buffer in the step 4, wherein sample-loading buffer is made up of NaOH solution, EDTA, tetrabromophenol sulfonphthalein, dimethylbenzene cyanogen FF and deionized water, the concentration of NaOH is that the concentration of 10mM/L, EDTA is that the concentration of 20mM/L, tetrabromophenol sulfonphthalein is that the concentration of 0.02% (weight), dimethylbenzene cyanogen FF is 0.02% (weight) in the sample-loading buffer, and the volume ratio of deionized formamide and sample-loading buffer is 1: 3; The lysate of 50 μ L contains the ammonium acetate of 0.5M/L, the magnesium acetate of 10mM/L in the step 5, and 1mM/L, pH value are the SDS of 8.0 EDTA, 0.1% (weight) and the double distilled water of surplus.
2. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1, it is characterized in that the PCR response procedures is in the step 2: 94 ℃ of preheating 5min, 94 ℃ of sex change 40s of first circulation, 55 ℃ of annealing 40s, 72 ℃ of extension 60s, circulate 30 times, every cycle annealing temperature reduces by 0.1 ℃ successively, and last 72 ℃ are extended 10min.
3. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that the PCR reaction system is that 50 μ L are that the forward primer of 20 μ mol/L, reverse primer, 0.125U EX Taq archaeal dna polymerase, the DNA of 1～5ng microflora and the balance of deionized water that 1.5 μ L concentration are 20 μ mol/L are formed by 5 μ L, 10 * PCRbuffer, 4 μ L dNTP, 1.5 μ L concentration in the step 2; Contain 2.5mmol/L Mg among 10 * PCR buffer
2+The concentration of various deoxynucleoside triphosphates is 2.5 μ mol/L among the dNTP.
4. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that adopting in the step 3 dense phenol/chloroform nucleic acid purification method purifying nucleic acid.
5. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that acrylamide and methene acrylamide account for 12% of gel gross weight in the step 3.
6. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that applied sample amount is 15～20 μ L in the step 4.
7. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that adopting nucleic acid electrophoresis silver dyeing technique to show the DNA band behind the step 4 electrophoresis.
8. a kind of method that adopts single strand conformation polymorphism technical Analysis biological community structure to form according to claim 1 is characterized in that in the step 4 that at 4 ℃, voltage be electrophoresis 18h under the condition of 300V.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101449111A CN101210262A (en) | 2007-12-24 | 2007-12-24 | Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101449111A CN101210262A (en) | 2007-12-24 | 2007-12-24 | Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101210262A true CN101210262A (en) | 2008-07-02 |
Family
ID=39610517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101449111A Pending CN101210262A (en) | 2007-12-24 | 2007-12-24 | Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101210262A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016193846A3 (en) * | 2015-05-29 | 2017-02-02 | Koninklijke Philips N.V. | Degenerate primer sets |
-
2007
- 2007-12-24 CN CNA2007101449111A patent/CN101210262A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016193846A3 (en) * | 2015-05-29 | 2017-02-02 | Koninklijke Philips N.V. | Degenerate primer sets |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Niu et al. | Effects of dissolved oxygen on performance and microbial community structure in a micro-aerobic hydrolysis sludge in situ reduction process | |
| Zhong et al. | Bacterial community analysis by PCR-DGGE and 454-pyrosequencing of horizontal subsurface flow constructed wetlands with front aeration | |
| Hallberg et al. | Macroscopic streamer growths in acidic, metal-rich mine waters in North Wales consist of novel and remarkably simple bacterial communities | |
| Xia et al. | Nitrogen removal performance and microbial community structure dynamics response to carbon nitrogen ratio in a compact suspended carrier biofilm reactor | |
| Johnson et al. | Techniques for detecting and identifying acidophilic mineral-oxidizing microorganisms | |
| Van den Berg et al. | Role of nitrite in the competition between denitrification and DNRA in a chemostat enrichment culture | |
| Wagner et al. | Combining fluorescent in situ hybridization (FISH) with cultivation and mathematical modeling to study population structure and function of ammonia-oxidizing bacteria in activated sludge | |
| Ding et al. | Investigation of microbial structure and composition involved in membrane fouling in the forward osmosis membrane bioreactor treating anaerobic bioreactor effluent | |
| Ji et al. | Insights into the bacterial species and communities of a full-scale anaerobic/anoxic/oxic wastewater treatment plant by using third-generation sequencing | |
| Chernyh et al. | Microbial life in Bourlyashchy, the hottest thermal pool of Uzon Caldera, Kamchatka | |
| González-Martínez et al. | Biological and technical study of a partial-SHARON reactor at laboratory scale: effect of hydraulic retention time | |
| Dabert et al. | Contribution of molecular microbiology to the study in water pollution removal of microbial community dynamics | |
| Tominski et al. | Insights into carbon metabolism provided by fluorescence in situ hybridization-secondary ion mass spectrometry imaging of an autotrophic, nitrate-reducing, Fe (II)-oxidizing enrichment culture | |
| Baptista et al. | The microbial diversity of laboratory-scale wetlands appears to be randomly assembled | |
| Mielcarek et al. | Citric acid application for denitrification process support in biofilm reactor | |
| Ikenaga et al. | Bacterial communities associated with nodal roots of rice plants along with the growth stages: estimation by PCR-DGGE and sequence analyses | |
| Ding et al. | The total and functional bacterial community of nitrogen removal in the SND ditches | |
| Abe et al. | A rapid collection of yet unknown ammonia oxidizers in pure culture from activated sludge | |
| CN101407835B (en) | Genetic marker and method for detecting rhamnose bacterium lacticum | |
| Kim et al. | Identification of bacterial communities in conventional wastewater treatment sludge to inform inoculation of the anammox process | |
| Kalyuzhnyi et al. | Phylogenetic analysis of a microbial community involved in anaerobic oxidation of ammonium nitrogen | |
| CN105238867B (en) | Methane/ammonia oxidizing bacteria COMMUNITY STRUCTURE method based on two-step method PCR | |
| CN101210262A (en) | Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique | |
| CN101033490A (en) | Genome chip for analyzing microbial community structure in acidic environment | |
| CN113528614B (en) | Plant phyllosphere surface microorganism metagenome detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080702 |