CN101200758A - Method for detecting COL7A1 gene mutation and uses thereof - Google Patents

Abstract

The invention discloses a method of detecting 26311 Mutation of COL7A1 gene and a usage thereof. The method adopts primers of p87F (TGGGCCTGAAATATGAGGAG) and P87R (TAGGCCACTGGAGAGACAGG) to PCR-amplify COL7A1 gene including the section of 26251-26350, implements the sequence after the purification of products, or uses BslI for the endonuclease detection after using p87Fa (TCCCACGGGGGCCCCTGGACAG) and P87Ra (TCCCCCGCCCCCACCCT GCCA) for the nest amplification of the PCR products. The usage is the application in preparations or gene chips for detecting the diagnosis of dominant dystrophic epidemolysis bullosa genealogy. The invention provides a novel way for the prenatal diagnosis of the bullosa and provides a basis for the gene therapy.

Description

A kind of method that detects the COL7A1 transgenation and uses thereof

Technical field

The invention belongs to the technique of gene detection field, be specifically related to a kind of method of the COL7A1 of detection transgenation, especially the detection method of COL7A1 transgenation G26311T, the present invention also provides the purposes of this method, is promptly detecting the human nutrition not gene chip of good figure epidermolysis bullosa or the application on the preparation.

Background technology

Epidermolysis bullosa hereditaria's disease is made up of the relevant disease of one group of clinical manifestation, according to the Electronic Speculum standard, is standard with blister in the position of skin, it can be divided into the epidermolysis bullosa simplex, junctional epidermolysis bullosa and malnutritive type epidermolysis bullosa.

The VII Collagen Type VI is by isolated a kind of collagens such as Bebtz the earliest, at that time called after long-chain collagen (LC).Ryynanen etc. find that by Northern hybridization the VII collagen mRNA is at keratinocyte and oral cavity epidermal carcinoma expression of cell lines.Indirect immunofluorescence shows that the fetus basilar membrane in 19 weeks has VII Collagen Type VI expression of gene, and perhaps the prompting keratinocyte is the initial cell source of VII Collagen Type VI.Greenspan in 1993 etc. are positioned people 3p21.3 zone by will the encode gene C OL7A1 of VII Collagen Type VI of fluorescence in situ hybridization.Ryynanen etc. and Hovnanian etc. find that respectively DDEB and RDEB are by due to the COL7A1 transgenation.Detections such as Christiano clone's VII Collagen Type VI cDNA sequence finds that it has 118 exons, it is the maximum gene of finding up to now of exon, its first exons coding 5 ' non-translational region signal peptide, the spherical NC-1 of the 2nd to the 27th exons coding amino acid zone, 84 exons coding triple helical districts afterwards, the rest part of 113 to 118 exons coding NC-2.The VII Collagen Type VI is the fibriilar main component of anchor, and when undergoing mutation, glycine is replaced, might change the stability of triple-helix structure, makes VII Collagen Type VI molecule easily by the proteolysis enzyme liberating, the anchor protofibril is attenuated or the quantity minimizing.

COL7A1 genic mutation type and DEB phenotype report in recent years DDEB and RDEB all be undergo mutation by COL7A1 due to.Utilize technology such as single strand conformation polymorphism (SSCP) and dna direct order-checking, DEB patient and family thereof are carried out the detection of transgenation, obtained very big progress.

This amphitypy of the difference of DDEB and topical type RDEB patient is difficult to distinguish clinically with on the pathology.Family history is very important, but because the appearance of the DDEB of big family or spontaneous mutation (de novel) is seldom arranged, more makes both be difficult to distinguish.Utilize transmission electron microscope also to be difficult to both are distinguished, thereby the importance of illustrating both differences on the molecular biology level has been described.Mallipeddi etc. are by directly checking order to four patients of two light moderate DEB of family, the result shows: all there is sudden change in two allelotrope of two patients, two allelic mutants of patient 1 are respectively Arg578 stop (R578X) and Gly2263 Val (G2263V), and its father and mother are heterozygotes; Two allelic mutants of patient 2 are respectively Arg578 stop (R578X) and Gly2674Asp (G2674D), do not have its father and mother's blood sample, and two patients all are diagnosed as RDEB.This has confirmed that further glycine substitutes the DEB that also sees recessive inheritance, this sudden change is dominant negative in heterozygote, when only on another allelotrope, also having sudden change clinical manifestation is arranged, and the severity of clinical manifestation depends on second sudden change.So as long as DDEB finds out a sudden change, RDEB then will find out two sudden changes that come from father and mother respectively could realize gene diagnosis.

Hammami-Hauasli etc. find when having studied the numerical example epidermolysis bullosa dystrophic recessive, sudden change G2006D in the generation of 73 exons, G2034R, G2015E is in dominant negative mode, intervened the folding and secretion of VII Collagen Type VI, utilize the research of confocal laser scanning and western blotting method, show the rough surfaced endoplasmic reticulum of the keratinocyte of malnutritive type epidermolysis bullosa, assembled the preceding VII Collagen Type VI of the variation that is higher than control group.Further analysis revealed, these three sudden changes are all near the hinge region in triple helical district.And the more approaching non-collagen hinge region in epidermolysis bullosa dystrophic dominant's sudden change position.

A frontier has been opened up in the discovery of COL7A1 transgenation.For malnutritive type epidermolysis bullosa patient opens the new diagnosis of a fan, the gate of treatment.At present,, help further being familiar with the COL7A1 gene for skin histology physiological function meaning, the relation of more deep understanding itself and disease by finding new mutational site by a plurality of COL7A1 gene mutation sites of having discovered of domestic and international colleague.And might exist mutantional hotspot, this will help carrying out clinically in the future patient's COL7A1 Mutation Screening work, for patient's antenatal diagnosis and treatment provide service.

Summary of the invention

The object of the present invention is to provide a kind of method of the COL7A1 of detection transgenation, this method can detect not good figure epidermolysis bullosa Disease-causing gene sudden change of human nutrition, and the present invention also provides the purposes of this method.

The method of detection COL7A1 provided by the invention transgenation, its step comprises:

(1) adopt primer p87F and P87R that the base sequence (sequence 1 in the sequence table) that comprises COL7A1 (GenBank L23982) gene 26124-26619 position is carried out pcr amplification in inner section;

The base sequence of p87F is: TGGGCCTGAAATATGAGGAG (sequence 2 in the sequence table)

The base sequence of P87R is: TAGGCCACTGGAGAGACAGG (sequence 3 in the sequence table)

(2) the PCR product carries out purifying;

(3) adopt p87F or P87R primer that the PCR product is checked order.

The another kind of method of detection COL7A1 provided by the invention transgenation, its step comprises:

(1) base sequence that adopts p87F and P87R primer the COL7A1 gene to be comprised 26124-26619 carries out pcr amplification in inner section;

(2) adopt p87Fa and P87Ra that above-mentioned PCR product is carried out the nido amplification;

The base sequence of p87Fa is: TCCCACGGGGGCCCCTGGACAG (sequence 4 in the sequence table);

The base sequence of P87Ra is: TCCCCCGCCCCCACCCTGCCA (sequence 5 in the sequence table);

(3) using restriction enzyme BslI to carry out enzyme to the nest-type PRC product cuts;

(4) use 1.5% agarose gel electrophoresis enzyme to cut product, detect the segment size.

Above-mentioned two kinds of methods are detecting the human nutrition not gene chip of good figure epidermolysis bullosa or the application on the preparation.

The contriver chooses the COL7A1 gene as research object, by in 9 patients of malnutritive type epidermolysis bullosa family and 11 normal family members and 200 control groups, carrying out examination, find the new pathogenic mutation point (G26311T) of a malnutritive type epidermolysis bullosa, i.e. 87 the 1st bases that include the subarea).This mutational site in 11 familys in normal people and 200 control groups all less than finding, illustrate that this mutational site can cause malnutritive type epidermolysis bullosa, this mutational site is positioned at one of COL7A1 gene and shears recognition site.The present invention provides a kind of new approach for malnutritive type epidermolysis bullosa patient's antenatal diagnosis, and the foundation that gene therapy is provided for the patient.

Description of drawings

Fig. 1 is the comparison of COL7A1 sequencing result: COL7A1 sudden change sequencing result: (left side figure is a normal sequence, and right figure is a mutant nucleotide sequence)

Fig. 2 is that PCR detects COL7A1 mutational site G26311T in conjunction with restriction enzyme digestion.

Embodiment

The base sequence of coding region (the GenBank/EMBL accession No.L23982) 26124-26619 of normal COL7A1 gene is shown in sequence in the sequence table 1.Its 26311st bit base sports T by G; The mRNA that the 86-88 exon of mutator gene is transcribed lacks 87 exons.

The present invention includes the change of the 26311st bit base (the 1st base of 87 introns) that detects the COL7A1 gene, or the corresponding change of the expression product that causes by this point mutation or the corresponding change of its complementary sequence.

The G that changes into of described the 26311st bit base sports T.

Then extension increasing sequence is checked order and detect to obtain extension increasing sequence by total length or portion C OL7A1 gene in the amplification human body.

In the research that the contriver carries out, the contriver collects the epidermolysis genetic resources, sets up the epidermolysis genetic resource.Under the voluntary prerequisite of patient, signature informed consent postscript is left and taken the 5-10ml blood sample, and is set up the patient medical history database, incidence in detail record conditions of patients, the family and contact method.Use the method extraction genomic dna of phenol chloroform and quantitatively put in storage the back ,-20 ℃ of preservations, every part of DNA sample is all in detail corresponding to the patient clinical data of registering.Use 80 pairs of primers of online primer-design software primer3 design, comprise whole coding region of COL7A1 and exon and intron junction region, use pcr amplification.The PCR product directly checks order; Sequencing primer is identical with the pcr amplification primer, forward and reverse lateral order (for example using ABI company 3100 sequenators).The sequence and the sequence among the Genebank that obtain have relatively been determined the COL7A1 mutational site.The contriver also utilizes a pair of nested primer that above PCR product is created a new restriction enzyme site, cuts the change that rear electrophoresis has been confirmed the catastrophe point base by enzyme.

Sudden change of the present invention can be undertaken by any detection method known in the art, the total length that for example increases in the human body or portion C OL7A1 gene genomic dna or cDNA are to obtain extension increasing sequence, then extension increasing sequence is checked order and detect, or by will be from tissue the COL7A1 gene that separate and COL7A1 gene probe hybridize and detect, or detect the change of described base, or detect the change of described base by restriction fragment length polymorphism by isolated COL7A1 gene and COL7A1 allele-specific probe hybridization from tissue.

Used hybridization probe can be and normal COL7A1 nucleic acid array hybridizing, or with the nucleic acid array hybridizing of sudden change, or with their probe of complementary sequence hybridization.These probes can be used radio isotope, chromonic material or fluorescent substance mark.Before carrying out probe in detecting, preferred pcr amplification target gene.Especially; Utilize the allele specific probe, whether the sudden change that can examination be determined exists.

In addition, can also be by detecting this expression of gene product; Detect the sudden change of this gene as albumen and mRNA.

The present invention also provides a kind of detection to cause the test kit in malnutritive type epidermolysis bullosa gene C OL7A1 (G26311T) mutational site, one or more containers are housed in it, the information of provide medicine that examine through medication management mechanism of government, relevant or biological products manufacturing simultaneously, using and sell is housed in the container in order to detect one or more compositions of COL7A1 (G26311T) sudden change.For example, behind the employing pcr amplification, the test kit in COL7A1 gene G26311T mutational site in the direct test sample.Contain amplimer, dNTP is used for archaeal dna polymerase and damping fluid thereof that PCR reacts.It is known to those skilled in the art that above component only is schematic; For example, described primer can examined acid sequence design according to known, be generally 15-30 base, GC content is about 45-55%, under suitable temperature, combine with template specificity, it can utilize special computer programming, and the archaeal dna polymerase of the described PCR of being used for reaction is the enzyme that can be used in pcr amplification.And the explanation using method is as follows:

Pcr amplification

The PCR reaction conditions is 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, 60 ℃ of annealing temperatures 30 seconds, 72 ℃ were extended 40 seconds, 35 circulations, after reaction finishes again 72 ℃ extended 4 ℃ of preservations 7 minutes.

The PCR product purification

The Multiscreen-PCR plate that will contain the PCR product vacuumizes, and adds to go to leave standstill from Yu Shui, the Multiscreen-PCR plate is placed on the mixing tank shake subsequently, and the PCR product behind the purifying dissolves the back again to 96 orifice plates of another cleaning.

Sequencing reaction and checking

Carry out sequencing reaction with one of PCR primer as sequencing primer, on the ABI9700 thermal cycler, carry out sequencing reaction.After reaction finished, extension products was splined on the ABIPRISM3100DNA sequenator.Resulting collection of illustrative plates is analyzed.Relatively can find the mutational site with the standard sequence among the Genebank.This test kit can detect COL7A1 (G26311T) mutational site quickly and easily, thereby is applied in the detection and methods of treatment of malnutritive type epidermolysis bullosa gene.For example, detecting to after sudden change has taken place, normal gene can imported the cell and the expression therein of carrying mutator gene, it can be recombinated with the endogenous mutator gene, thereby can carry out gene therapy.

Below in conjunction with specific embodiment, further set forth the present invention, should illustrate that these embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following fact Example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring harbor Labortory Press, 1989), molecular cloning the lab guide: (third edition, Science Press, 2002) condition described in, or the condition of advising according to production firm.

Embodiment 1

Detect the COL7A1 transgenation below by gene sequencing.

One, the pcr amplification of COL7A1 gene coding region

Object: the malnutritive type epidermolysis bullosa family that outpatient service is collected comprises 9 routine patients, 11 healthy people, normal control 200 examples.All participators are carried out a medical examination in detail everyone blood sample collection 5ml after the signature Informed Consent Form.

Extracting genome DNA: adopt the phenol chloroform extraction method.

1, anticoagulation is done 1 times of dilution with PBS.

2, the lymph parting liquid (18 ℃-28 ℃) that adds 2 times of volumes in centrifuge tube is spread the blood of oneself dilution of 1 times of volume of one deck, the centrifugal 1000*g of room temperature 20 minutes above.

3, supernatant is abandoned in suction, and karyocyte layer in the middle of the careful sucking-off changes in the 5ml Ep pipe, and 5000g 10 minutes, washes once with PBS then.5000*g 10 minutes.

4, cell is suspended from the 2ml TE damping fluid, adds 10% SDS to final concentration 0.5% (10 μ l), proteolytic enzyme 100-200 μ l (10mg/ml), 50 ℃ water-bath 3-5 hour.

5, use the phenol chloroform extraction.With isopyknic saturated phenol, add mixing, centrifugal 5000g 10 minutes.

6, suct in the clearly extremely new centrifuge tube, abandon lower sediment, add equal-volume phenol: chloroform mixture, mixing, 5000*g 10 minutes.

7, suct clear liquid to new centrifuge tube, abandon lower sediment, add the equal-volume chloroform: iso pentane alcohol mixture, mixing, 5000*g 10 minutes.

8, suct clear liquid to new centrifuge tube, abandon lower sediment, add the sodium acetate of 1/10 volume, mixing.

9, the dehydrated alcohol that adds 2.5 times of volumes.

10,20 ℃ of deposit D NA spend the night.

11, high speed centrifugation, 10000*g, 10 minutes, 4 ℃.

12, abandon supernatant, add 75% ethanol 2ml, high speed centrifugation 10000*g, 5 minutes.

13, abandon supernatant, dry up.

14, with the dissolving of TE damping fluid, (400 μ l TE/5ml whole bloods, 600-800TE/10ml whole blood)

15, packing.1% agarose electrophoresis and spectrophotometer are quantitative.

COL7A1 gene amplification--PCR reaction conditions

Primer sequence: p87F:TGGGCCTGAAATATGAGGAG

P87R：TAGGCCACTGGAGAGACAGG

Reaction system: 25 μ l

Title original liquid concentration application of sample amount (μ l) system final concentration

Buffer 10* 2.5 1*

dNTP 2.5mM 3.0 400μM

Primers 10μM 1.0 7.5pmol

AmpliTaq 5units/μl 1.0 1U/μl

Template 25ng/μl 1.0 10ng/μl

DdHO polishing to 25 μ l.

Wherein Buffer, dNTP, Primers, Taq enzyme are given birth to worker company for Shanghai and are provided.

Reaction conditions: be reflected on ABI company 9700 thermal cyclers and carry out, reaction conditions is 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, 55 ℃ of annealing temperatures 30 seconds, 72 ℃ were extended 40 seconds, 35 circulations, after reaction finishes again 72 ℃ extended 4 ℃ of preservations 7 minutes.

Two, the PCR product directly checks order

At first carry out the PCR product purification

1, in 96 orifice plates that the PCR product is housed, adds 50 microlitre lavation buffer solutions, mixing.

2, it is transferred in the Millipore purifying plate, be put on the vacuum pump suction filtration about 3 minutes, see in the purifying plate not having water to get final product.

3, the lavation buffer solution that adds 50 microlitres in the purifying plate once more continues suction filtration, in the purifying plate, do not have water till.

4, the purifying plate is taken off from vacuum pump, in plate, add the deionized water of 20 microlitres, left standstill 15 minutes.

5, shake 15 minutes again, be drawn onto then in new 96 orifice plates.

The required reagent of sequencing reaction should be fresh preparation, need can use after autoclaved reagent must be sterilized.The required equipment of sequencing reaction (first-class as 384 orifice plates, tip) should be cleaning sterile equally.

6, in order to guarantee the fresh of sample and reaction reagent that check order, should be during application of sample in operation on ice.

7, reaction system is 5 μ l, and all ingredients add-on is as follows: PCR product 3-10ng, BigDyev3.10.25 μ l, 5*BigDye buffer 0.875 μ l, primer p87F 1.6pmol

8, sample is put in and does following reaction on the PCR instrument

Step	Effect
		1	95 ℃, 5 minutes
2	Repeat 95 ℃ of 30 of following programs circulations, 10 seconds 60 ℃, 4 minutes
		3	4 ℃ of maintenances are up to preparing purifying

9, in each hole, add 20 μ l, 80% ethanol, 4, the centrifugal 30min of 000rpm

10, sample panel is placed on the paper handkerchief of rolling well, in whizzer, gets rid of, speed 1000rpm when getting rid of,

11, add 30 μ l, 70% ethanol in every hole, the centrifugal 10min of 4000rpm gets rid of;

12, repeat the 11st operation that goes on foot 2 times:

13, sample panel is put in the clean drawer the dry 30min of lucifuge;

14, add people's 5 μ l methane amides, the envelope film, in the centrifugal being placed on-20 ℃ refrigerator:

15, go up the preceding 95 ℃ of sex change of sequenator 5 minutes, placed 2 minutes on ice, sample is gone up in centrifugal back.

Sequencing result as shown in Figure 1.Sudden change is present in the 26311st bit base G-T.

Embodiment 2

Detect the change of described base below by restriction fragment length polymorphism.

One, the pcr amplification of COL7A1 gene intron 86/ exon 87

1, use primer p87F and p87R and other reagent pcr amplifications 86/ exon 87 for sample DNA, step is seen first part among the embodiment 1.

2, the PCR product is got 1 μ l and is carried out second as template and take turns PCR after diluting 200 times, the following p87Fa:5 ' of primer-TCCCACGGGGGCCCCTGGACAG-3 ' and p87Ra:5 '-TCCCCCGCCCCCACCCTGCCA-3 ', other reagent and step are seen first part among the embodiment 1.

3, PCR product purification, step are seen the second section 1-5 step among the embodiment 1.

4,20 μ l PCR products add Bsl I (NEB company) 1U, and 10*buffer 2.5 μ l add water polishing 25 μ l, and 55 ℃ are incubated 2 hours.

5, electrophoresis uses 1.5% sepharose, the 1*TAE electrophoretic buffer, and voltage 5V/cm, electrophoresis 30 minutes is observed under ultraviolet lamp, and patient's sample can present 123bp and 104bp two bands, and normal control has only 104bp one band.(as shown in Figure 2)

Embodiment 3

Malnutritive type epidermolysis bullosa Disease-causing gene COL7A1 point mutation position G26311T test kit of inspection side and application thereof

1 test kit contains:

Amplification primers: p87F:TGGGCCTGAAATATGAGGAG

P87R：TAGGCCACTGGAGAGACAGG

Pcr amplification Taq enzyme 5u/ul

The 10* damping fluid (contains 15ml MgCl ₂)

dNTP2mM

BigDyemix

2 using method:

Mainly comprise the steps:

A. extract DNA, utilize above-mentioned primer, carry out the PCR reaction;

Directly order-checking behind the B:PCR reaction product purifying is with the sequence of gained and the existence in the relatively more definite mutational site of the standard sequence among the Genebank.

Concrete grammar is referring to embodiment 1.

Can also visit the change that assorted hybridization detects described base by isolated COL7A1 gene and COL7A1 allele-specific from tissue.

Should be understood that after having read foregoing of the present invention those skilled in the art can make various changes or modification to the present invention, but the equivalent form of value of changing or revising drops on equally in the institute of the present invention restricted portion.

Sequence table

＜110〉Central China University of Science and Technology

＜120〉a kind of method that detects the COL7A1 transgenation and uses thereof

<160>5

<170>PatentIn Version 3.1

<210>1

<211>496

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>1

tgggcctgaa atatgaggag tggggcagca ggggtggtgg tggagaggca ctgagttcct 60

cacgctgctc tgccataggg gtcaccaggt ctgcctggcc ctgtcggacc taaaggagaa 120

cctggcccca cgggggcccc tggacaggtg atctttgacc ctgacttcca ccccctgcag 180

caactcctct gcctcaccca caagcctgtt tccaaatgcc atgggggtgg cagggtgggg 240

gcgggggagg aggaggaaac tcactagcat tccccacagg ctgtggtcgg gctccctgga 300

gcaaagggag agaaggtgag tgtgtgtggg gctgccagtg agggggggtc aactggtggg 360

ggccaaggaa tcccactgac ctctccccct taccagggag cccctggagg ccttgctgga 420

gacctggtgg gtgagccggt aagtagggaa cttctgacag cagatgttct gggggtcctg 480

tctctccagt ggccta 496

<210>2

<211>20

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>2

tgggcctgaa atatgaggag

<210>3

<211>20

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>3

taggccactg gagagacagg

<210>4

<211>20

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>4

tcccacgggg gcccctggac ag

<210>5

<211>20

<212>DNA

＜213〉homo sapiens (Homo Sapiens)

<400>5

tcccccgccc ccaccctgcc a

Claims (3)

1. method that detects the COL7A1 transgenation, its step comprises:

(1) base sequence that adopts primer p87F and P87R the COL7A1 gene to be comprised 26124-26619 carries out pcr amplification in inner section;

The base sequence of p87F is: TGGGCCTGAAATATGAGGAG

The base sequence of P87R is: TAGGCCACTGGAGAGACAGG

(2) the PCR product carries out purifying;

(3) adopt p87F or P87R primer that the PCR product is checked order.

2. method that detects the COL7A1 transgenation, its step comprises:

(1) base sequence that adopts p87F and P87R primer the COL7A1 gene to be comprised 26124-26619 carries out pcr amplification in inner section;

(2) adopt p87Fa and P87Ra that above-mentioned PCR product is carried out the nido amplification;

The base sequence of p87Fa is: TCCCACGGGGGCCCCTGGACAG;

The base sequence of P87Ra is: TCCCCCGCCCCCACCCTGCCA;

(3) using restriction enzyme Bsl I to carry out enzyme to the nest-type PRC product cuts;

(4) use 1.5% agarose gel electrophoresis enzyme to cut product, detect the segment size.

3. aforesaid right requires the purposes of 1 or 2 described methods, it is characterized in that: detecting the human nutrition not preparation of good figure epidermolysis bullosa or the application on the gene chip.

Images