CN101195824A - Method for representing reteplase in bacillus coli - Google Patents

Abstract

The invention discloses a method for reteplase expression in escherichia coil. The reteplase expression method provided by the invention in the escherichia coli comprises the steps that a reteplase gene is inserted into the multiple cloning sites of a procaryon expression carrier to obtain a recombination expression carrier, then the recombination expression carrier and plasmid pREP4 are converted into the escherichia coil together, to obtain recombination escherichia coil, the recombination escherichia coil is cultivated, and the reteplase is obtained through expression. The invention method can greatly enhance the expression quantity of the reteplase in the escherichia coil, by adopting the method, the recombination escherichia coil is cultivated, and the expression quantity of the reteplase accounts for 48 plus or minus 5 percent of total protein in every liter of culture medium. The invention method is simple and practical, the production cost can be reduced, the solid foundation is established for the popularity and the application of the reteplase, simultaneously the invention has significance to the recombination extraneous sources protein of the large scale industrialization production.

Description

A kind of method at the expression in escherichia coli reteplase

Technical field

The present invention relates to a kind of method at the expression in escherichia coli reteplase.

Background technology

Reteplase (reteplase, r-PA) be human histiotype plasminogen activator (human tissue typeplasminogen activator, t-PA) deletion mutant, be to utilize gene engineering method to make Kringle1, EGF and three structural domain disappearances of Finger of t-PA, only keep a kind of medical protein in its Kringle2 district and serine protease district (P district), thereby kept t-PA and scleroproein bonded ability and the bioactive ability of activation fiber pepsinogen.R-PA contains 355 (1～3 and 176～527) in 527 amino acid of t-PA, molecular weight 39kD, strand, non-glycosylated protein, advantage such as have that the fibrinolytic effect is strong, recanalization rate is high, onset is rapid and side effect is little is to use one of best third generation thrombolytic drug at present clinically.

Existing many in recent years about expressing the report of t-PA and mutant thereof, generally be at expression in escherichia coli, the report of expressing in tobacco, insect cell, yeast, mammalian cell, aspergillus niger and galactophore of transgenic animal etc. is also arranged, and every kind of expression system all has different characteristics.Eukaryotic cell expression system expression amount is often lower, thereby production cost is higher, is mainly used to be expressed in the albumen that needs glycosylation, molecular structure complexity beyond expression of words in the prokaryotic cell prokaryocyte at present.The shortcoming of pichia yeast expression system be the cycle long, cost is high and had the glycosylation phenomenon, and it is not a kind of food microorganisms, will add methyl alcohol during fermentation, so produce medicine or food also is not widely accepted with it.At present to maximum still escherichia expression system of the expression study of r-PA.BoehringerMannheim GmbH has set up the commercial production process of r-PA (Germany) with the mutant BM 06.022 of escherichia coli expression t-PA.But its expression amount and yield are all lower, so cause r-PA production cost height, can't become more patients' Gospel.

Summary of the invention

The purpose of this invention is to provide a kind of method at the expression in escherichia coli reteplase.

Method at the expression in escherichia coli reteplase provided by the present invention, it is the multiple clone site that the reteplase gene is inserted into prokaryotic expression carrier, obtain recombinant expression vector, again with this recombinant expression vector and plasmid pREP4 cotransformation intestinal bacteria, obtain recombination bacillus coli, cultivate this recombination bacillus coli, express obtaining reteplase.

Described prokaryotic expression carrier does not contain the LacI gene.

Described prokaryotic expression carrier can be plasmid pRSETa.

Cultivating needs to add IPTG and carry out abduction delivering in the process of described recombination bacillus coli.

Described intestinal bacteria can be intestinal bacteria TOP10 or e. coli bl21 (DE3).

Described intestinal bacteria are specially e. coli bl21 (DE3).

When described recombination bacillus coli reached logarithmic phase, also can add final concentration was the glucose of 0.1%-2% (quality percentage composition), express with the background that reduces the recombination bacillus coli oneself protein, thus the expression amount of raising external source reteplase.

Because pREP4 continues high expression level LacI in intestinal bacteria, LacI is attached on the promoter sequence of recombinant expression vector, and reteplase is transcribed with higher level, has improved the expression amount of reteplase in intestinal bacteria.

The inventive method can improve the expression amount of reteplase in intestinal bacteria greatly, cultivates above-mentioned recombination bacillus coli with the inventive method, and the expression amount of reteplase accounts for 48 ± 5% of total protein.The inventive method is simple, can reduce production costs, and establishes solid basis for the universal and application of reteplase, simultaneously the large-scale industrial production recombinant exogenous protein is had great importance.

Description of drawings

Fig. 1 is the expression of r-PA in intestinal bacteria

Fig. 2 is the result of westernblot

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

The expression in intestinal bacteria of embodiment 1, reteplase

1, from human melanoma cell (the biological company limited of Shanghai wheat Sha, article No.: extract mRNA B01194), RT-PCR increases and obtains the t-PA fragment with primer (5 '-CCACCATGGATGCAATGAAGAG-3 ' and 5 '-CCTCGAGACCATGGGATCTTACC AAGTG-3 ').Again with this t-PA fragment design mutant primer (5 '-CG GGATCCACATGTCTTACCAAGGAAACAGTGACTGCTACTTTG-3 ' and 5 '-CCC GAATTCTTATCACGGTCGCATG TTGTC-3 ', primer line part is respectively HindIII and EcoRI restriction enzyme site) pcr amplification obtains the r-PA sequence, be inserted into plasmid pET32a (NOVAGEN behind HindIII and the EcoRI double digestion, between HindIII Catalog No.69015-3) and EcoRI site, obtain recombinant plasmid pET32-rPA.With pET32-rPA is template, carries out pcr amplification with primer K1 and P2.Primer K1 and P2, its sequence is respectively K1:GGG GGATCCTCTTACCAAGGAAACAGTGAC (the line part is the base sequence of restriction enzyme site BamHI), P2:GGG AAGCTTTTATCACGGTCGCATGTTG (the line part is the base sequence of restriction enzyme site HindIII).The PCR product that amplification is obtained carries out 1% agarose gel electrophoresis, and the result has very bright purpose band at the 1100bp place.Downcut the purpose band, purifying reclaims the back and carries out double digestion with BamHI and HindIII, promptly obtains the r-PA gene fragment.This r-PA gene fragment is carried out sequencing, the sequence 1 in concrete sequence such as the sequence table.

2, the prokaryotic expression carrier pRSETa (Invitrogen company, Catalog No.V351-20) that has the acillin resistance with BamHI and HindIII double digestion, the big fragment of carrier of recovery 2860bp.

3, the big fragment of carrier after cutting with the r-PA gene fragment behind BamHI and the HindIII double digestion with same enzyme is mixed, the T4 dna ligase connects, transformed into escherichia coli BL21 (DE3) competent cell, above-mentioned e. coli bl21 (DE3) competent cell is coated on the LB culture medium flat plate that contains the 100ug/ml acillin, cultivate picking mono-clonal after 12 hours, extract plasmid and cut checking with BamHI and HindIII enzyme, agarose gel electrophoresis detects, with the carrier segments of the 2.86kb that obtains and the recombinant plasmid called after pRSET-rPA of 1.1kb r-PA gene fragment.To the pRSET-rPA evaluation of checking order, the result shows among the pRSET-rPA, and is identical with sequence 1 in the sequence table with the segmental nucleotide sequence of insertion between the HindIII site at BamHI.

4, use calcium chloride transformation, with plasmid pRSET-rPA and plasmid pREP4 (QIAGEN, Catalog No.32149) each 1ul cotransformation e. coli bl21 (DE3), simultaneously in contrast with plasmid pRSETa and each 1ul cotransformation e. coli bl21 (DE3) of plasmid pREP4, with plasmid pRSETa 1ul transformed into escherichia coli BL21 (DE3) in contrast, transform and abduction delivering according to following method.

5, recombination bacillus coli BL21 (DE3) the called after pRSET-rPA/pREP4/BL21 (DE3) that conversion is had plasmid pRSET-rPA and plasmid pREP4, conversion there is recombination bacillus coli BL21 (DE3) the called after pRSETa/pREP4/BL21 (DE3) of plasmid pRSETa and plasmid pREP4, conversion is had recombination bacillus coli BL21 (DE3) the called after pRSETa/BL21 (DE3) of plasmid pRSETa.These three kinds of recombination bacillus colis are inoculated into 10 milliliters respectively contain in the LB liquid nutrient medium of kantlex that final concentration is respectively the acillin of 100ug/ml and 25ug/ml, 37 ℃, the 220rpm overnight incubation.

6, the overnight culture in the step 5 being transferred to 200ml by 1% volume ratio respectively contains in the LB liquid nutrient medium of kantlex that final concentration is respectively the acillin of 100ug/ml and 25ug/ml, 37 ℃, it is 0.6 o'clock adding IPTG that 220rpm is cultured to its OD600, the final concentration that makes IPTG is 1mmol/ml, add glucose simultaneously, the final concentration of glucose is 0.1%～2% (quality percentage composition).

7, above-mentioned three kinds of recombination bacillus coli abduction deliverings were collected bacterium liquid respectively after 5 hours, and centrifugal 5 minutes of 12000rpm gets supernatant liquor, carries out the SDS-PAGE electrophoresis.Electrophoresis result as shown in Figure 1.Wherein, 1 is the electrophoresis detection result of pRSET-rPA/pREP4/BL21 (DE3) expression product, and 2 is the electrophoresis detection result of pRSETa/pREP4/BL21 (DE3) expression product, and 3 is the electrophoresis detection result of pRSETa/BL21 (DE3) expression product.The result shows the expression of having only recombination bacillus coli pRSET-rPA/pREP4/BL21 (DE3) that r-PA albumen (39kDa) arranged.

With the software Gel-pro Analyzer scanning analysis that electrophoresis result is taken pictures and afterwards carried with computer, three repetitions are established in experiment altogether.The result shows that the expression amount of r-PA accounts for 48 ± 5% of total protein.Concrete expression amount is as shown in table 1, and table 1 is the mean value of three repeated experiments.In the table 1, swimming lane 1 is the result of pRSET-rPA/pREP4/BL21 (DE3) expression product, and 2 is the result of pRSETa/pREP4/BL21 (DE3) expression product, and 3 is the result of pRSETa/BL21 (DE3) expression product.Wherein, the r3 band is r-PA.

Table 1:Gel-pro Analyzer is to the analytical data of expression of results

Swimming lane	1	2	3
				Band r1 r2 r3 r4 r5 r6 r7 r8 total protein expression amount swimming lane data summation	(％) 3.4356 1.7571 53.455 38.355 2.9972 100 100	(％) 6.7979 5.5939 4.7278 10.137 22.3954 5.5628 18.637 26.148 100 100	(％) 17.251 10.031 9.3 12.646 11.87 13.309 16.766 8.8276 100 100

8, the r-PA albumen that above-mentioned expression is obtained carries out the westernblot detection, is reteplase with the proof expressed proteins.

With t-PA antibody (t-PA (C-16): goat polyclonal antibody, Santa Cruz Biotechnology, Inc.Catalog No.Sc5239) be one anti-, the albumen of above-mentioned three kinds of expression of recombinant e. coli carries out western blot and detects, and the result as shown in Figure 2.The result shows to have only recombination bacillus coli pRSET-rPA/pREP4/BL21 (DE3) expression product can be in conjunction with obtaining the r-PA albumen that molecular weight is 39KDa with t-PA antibody.Among Fig. 2,1 is the detected result of pRSET-rPA/pREP4/BL21 (DE3) expression product, and 2 is the detected result of pRSETa/pREP4/BL21 (DE3) expression product, and 3 is the electrophoresis result of pRSETa/BL21 (DE3) expression product.

Sequence table

<160>1

<210>1

<211>1068

<212>DNA

＜213〉artificial sequence

<400>1

tcttaccaag gaaacagtga ctgctacttt gggaatgggt cagcctaccg tggcacgcac 60

agcctcaccg agtcgggtgc ctcctgcctc ccgtggaatt ccatgatcct gataggcaag 120

gtttacacag cacagaaccc cagtgcccag gcactgggcc tgggcaaaca taattactgc 180

cggaatcctg atggggatgc caagccctgg tgccacgtgc tgaagaaccg caggctgacg 240

tgggagtact gtgatgtgcc ctcctgctcc acctgcggcc tgagacagta cagccagcct 300

cagtttcgca tcaaaggagg gctcttcgcc gacatcgcct cccacccctg gcaggctgcc 360

atctttgcca agcacaggag gtcgcccgga gagcggttcc tgtgcggggg catactcatc 420

agctcctgct ggattctctc tgccgcccac tgcttccagg agaggtttcc gccccaccac 480

ctgacggtga tcttgggcag aacataccgg gtggtccctg gcgaggagga gcagaaattt 540

gaagtcgaaa aatacattgt ccataaggaa ttcgatgatg acacttacga caatgacatt 600

gcgctgctgc agctgaaatc ggattcgtcc cgctgtgccc aggagagcag cgtggtccgc 660

actgtgtgcc ttcccccggc ggacctgcag ctgccggact ggacggagtg tgagctctcc 720

ggctacggca agcatgaggc cttgtctcct ttctattcgg agcggctgaa ggaggctcat 780

gtcagactgt acccatccag ccgctgcaca tcacaacatt tacttaacag aacagtcacc 840

gacaacatgc tgtgtgctgg agacactcgg agcggcgggc cccaggcaaa cttgcacgac 900

gcctgccagg gcgattcggg aggccccctg gtgtgtctga acgatggccg catgactttg 960

gtgggcatca tcagctgggg cctgggctgt ggacagaagg atgtcccggg tgtgtacacc 1020

aaggttacca actacctaga ctggattcgt gacaacatgc gaccgtga 1068

Claims (8)

1. method at the expression in escherichia coli reteplase, it is the multiple clone site that the reteplase gene is inserted into prokaryotic expression carrier, obtain recombinant expression vector, again with this recombinant expression vector and plasmid pREP4 cotransformation intestinal bacteria, obtain recombination bacillus coli, cultivate this recombination bacillus coli, express obtaining reteplase.

2. method according to claim 1 is characterized in that: described prokaryotic expression carrier does not contain the LacI gene.

3. method according to claim 2 is characterized in that: described prokaryotic expression carrier is pRSETa.

4. method according to claim 3 is characterized in that: described expression is induced with IPTG.

5. according to claim 3 or 4 described methods, it is characterized in that: described intestinal bacteria are e. coli bl21 (DE3) or intestinal bacteria TOP10.

6. method according to claim 5 is characterized in that: described intestinal bacteria are e. coli bl21 (DE3).

7. method according to claim 6 is characterized in that: described be expressed in to contain in the substratum of glucose that final concentration is 0.1%-2% carry out; Described percentage composition is the quality percentage composition.

8. method according to claim 7 is characterized in that: sequence 1 in the nucleotide sequence of described reteplase gene such as the sequence table.

Images