CN101184846A

CN101184846A - Chemically inducible expression of biosynthetic pathways

Info

Publication number: CN101184846A
Application number: CNA2006800169117A
Authority: CN
Inventors: 劳拉林·库尔茨; 奥利弗·P·皮普尔斯; 克里斯蒂·D·斯内尔
Original assignee: Metabolix Inc
Current assignee: Yield10 Bioscience Inc
Priority date: 2005-03-16
Filing date: 2006-03-16
Publication date: 2008-05-21

Abstract

Methods and constructs for the introduction of multiple genes encoding enzymes in a multi-enzyme biosynthetic pathway are provided. In one embodiment, the constructs contain two or more enzyme-encoding genes, each under the control of an inducible promoter and each with a polyadenylation signal. The constructs are used to produce transgenic plants, in which the expression of the enzymes are increased when a chemical inducing agent is applied, and a biosynthetic product of the series of enzymes encoded by the transgenes is produced. Constructs may be used which contain two or more enzyme-encoding genes under the control of one or more promoters activated by activator molecules or complexes expressed from a transgene or transgenes, which are themselves under the control of one or more inducible promoters and switched on following the external application of a chemical. The transgene or transgenes expressing the activator molecules or complexes may be included in the same construct containing multiple genes encoding enzymes in a multi-enzyme biosynthetic pathway. Alternatively, the transgene or transgenes expressing the activator molecules or complexes may be on a different construct from the construct containing multiple genes encoding enzymes in a multi-enzyme biosynthetic pathway. The activator molecule can be expressed using a constitutive promoter in an inactive form which is converted to the active form following application of the chemical inducing agent.

Description

The chemically inducible expression of biosynthetic pathway

Technical field

Present invention relates in general to the structure and the purposes of carrier or construct, described carrier or construct are applicable to the chemical induction that obtains two or more genes of two or more enzymes in the organism pathways metabolism of encoding respectively, with the output of the required product that improves important multienzyme approach.Specifically, the invention discloses the such carrier or the structure of construct, described carrier or construct are used for the chemically inducible expression of two or more enzymes of the poly-hydroxyl alkanoates biosynthetic pathway of plant.The present invention has also described the production of the plant of using these carriers or construct, and the raising of the output of the required product of multienzyme approach.

Background technology

The plant crop is to be used to produce a series of meta-bolitess required host of (comprising the vegetables oil of modification, poly-hydroxyl alkanoates, amino acid, the xylogen of modification, the starch and the nutritional product of modification).Usually, the generation of these new products need be encoded, and two or more have two or more genetically modified expression of the polypeptide of enzymic activity.Needed is two or more transgenosiss are expressed, so that make the formation of required product reach maximum on the certain hour point in development of plants cycle.In other cases, neededly be, can open the expression process of pathways metabolism, with alleviate by the product of polypeptide or pathways metabolism to plant-growth output is made or disadvantageous effect.

Wherein can be in green plants economic and development that prepare the agrosystem of biological plastics constantly not only might reduce the cost of biological plastics significantly, and might completely cut off CO ₂

Poly-hydroxyl alkanoates (PHA) is the biodegradable biological polymer that a class can prepare in plant.The required business goal of PHA output is that 7.5 dry weights (dwt) % to 15 dry weight % is (referring to document: Y.Poirier and KJ.Grays, in Biopolyesters, Y.Doi, A.Steinbuchel Eds. (Wiley-VCH, Weinheim in the plant; 2002), pp.401435).Up to now, in following floristics, successfully produced PHB, described floristics is: Arabidopis thaliana (Arabidopsis thaliana), swede type rape (Brassica napus) and Zea mays (Zea mays) are (referring to document: C.Nawrath et al, Proc.Natl.Acad.Sci.USA 91,12760 (1994); K.Bohmert et al, Planta 211,841 (2000); K.L.Houmiel, et al, Planta 209,547 (1999); Y.Poirier and KJ.Grays, inBiopolyesters, Y.Doi, A.Steinbuchel Eds. (Wiley-VCH, Weinheim; 2002), pp.401-435).Yet the plant that produce to surpass 3dwt%PHB often develops into the yellows phenotype, and/or can not obtain size as common this plant (referring to document: B ohmert, K.et al., in Molecular Biology and Biotechnology of Plant Organelles.H.Daniell, C.D.Chase Eds. (Kluwer Academic Publishers, Netherlands; 2004, pp.5 59-585).These factors cause the ultimate production of polymkeric substance lower, and to have represented be the major obstacle that the basis produces PHA with the plant.It is being high without the output in the inductive plant that the expression of using the individual gene in the inducible promoter regulation and control PHB approach is overcome the polymkeric substance (leaky polymer) that the trial of the lower problem of ultimate production makes the gene seepage be produced, thereby make (referring to the document: Bohmert et.al.Plant Physiol.128 (4): 1282-90, (2002)) that is still dwarfing through the inductive plant.

Therefore, the purpose of this invention is to provide carrier or the construct that is used for two or more genes of two or more enzymic activity things of coded plant crop metabolism approach are carried out abduction delivering.

The present invention also aims to use these carriers or construct that plant is transformed, and when suppressing the harmful effect relevant with the constitutive expression of number of ways transfer gene encoding enzyme (for example can cause the formation of required product increase those), induce two or more genetically modified synchronous expression of two or more enzymic activity things of coding, wherein said two or more enzymic activity things are that effectively the required product of formation (xylogen of biological example polymkeric substance, novel oil, modification, the starch or the nutrition of modification) is necessary in host plant.

The present invention also aims to induce described these genes, thereby make described genetic expression, and guide the circulation of metabolic intermediate, with the output of the product that improves this approach by suitable pathways metabolism by leaf or root are applied chemical inducer.

The present invention also aims to provide the application method of chemical inducer, this application method is by in the suitableeest time leaf or root are applied chemical inducer in the plant-growth periodic process, improve the output of required product, and obtain vegetable material and reclaim the product of being paid close attention to.

Summary of the invention

The invention provides the method and the construct of the enzyme of the polygene coding that is used for introducing the multienzyme biosynthetic pathway.In one embodiment, described construct comprises the encoding gene of two or more enzymes, and each gene all is under the regulation and control of inducible promoter, and each gene all has polyadenylation signal.Described construct is used to produce transgenic plant, and in these transgenic plant, when applying chemical inducer, the expression of described enzyme strengthens, and has produced the biosynthetic products by the coded multienzyme biosynthetic pathway of described transgenosis.

In another embodiment, described method has been used such construct, this construct comprises two or more enzyme coding genes under one or more promoter regulation, wherein said promotor is by expressed activator molecule or the mixture institute activatory that goes out of one or more transgenosis, and described one or more transgenosis itself be under the regulation and control of one or more inducible promoter and apply in the chemicals process in the outside of carrying out subsequently and to be unlocked.One or more transgenosis of expressing activator molecule or mixture can be contained in the same construct of a plurality of genes that contain the enzyme in the coding multienzyme biosynthetic pathway.Alternative alternate manner is that one or more transgenosis of expressing activator molecule or mixture can be on the construct of the construct that is different from a plurality of genes that contain the enzyme in the coding multienzyme biosynthetic pathway.Can use the constitutive promoter that is in inactive form to express the activator molecule, wherein said constitutive promoter changes activity form into after applying chemical inducer.

Biosynthetic pathway can form many products, comprises biological polymer, the vegetables oil and the nutritious cpds of for example poly-hydroxyl alkanoates (PHA), fatty acids.Other biosynthetic pathway comprises the approach that relates to following process: tricarboxylic acid (" TCA ") circulation; The polyketide route of synthesis; Carotenoid is synthetic; Glycolysis-; Glyconeogenesis; Starch is synthetic; Synthesizing of xylogen and related compound; Play the micromolecular generation of sterilant, mycocide or microbiotic effect.The gene transcription of using inducible promoter to activate in a synchronous manner in the encoding human route of synthesis makes metabolic intermediate form required end product on end product cumulative optimum time point.

Brief Description Of Drawings

Fig. 1 shows the PHB biosynthetic pathway.In this approach, acetyl-CoA is converted into acetoacetyl-CoA by β-Tong Liuxiemei.Acetoacetyl-CoA reductase is converted into β-hydroxyl butyryl-coenzyme A with acetoacetyl-CoA.Pha synthesizing enzyme is converted into PHB with β-hydroxyl butyryl-coenzyme A.Fig. 1 shows such plant expression vector, and whole three genes of PHB biosynthetic pathway all place under the regulation and control of inducible promoter in this expression vector.The flank of these genes is 3 ' UTR.Described carrier also comprises and is in 3 ' UTR as the effector under the regulation and control of the constitutive promoter of flank.This multigene carrier also comprise under the regulation and control that are in constitutive promoter, with the selected marker of 3 ' UTR as flank.

Fig. 2 shows the path that generates the PHA of and medium chain long than short chain by lipid acid degraded (being also referred to as the β-Yang Hua into lipid acid) approach.The actives that startup degrades to synthesize PHA by lipid acid can be selected from following material: ethylene reductase (reaction 1a); ACOD (reaction 1b); catalase (reaction 2); (the reaction 3 of α subunit in the β-Yang Hua; 4 and 5); β subunit in the β-Yang Hua (reaction 6); pha synthesizing enzyme (reaction 7) with medium chain substrate specificity; β-Tong Liuxiemei (reaction 8); NADH or NADPH dependency reductase enzyme (reaction 9); have than the long specific pha synthesizing enzyme of short chain (reaction 10) and can be in conjunction with pha synthesizing enzyme (reaction 11) than the reaction of the substrate of long substrate of short chain and medium chain.Can in host plant, produce selected actives by transforming suitable gene construct.

Fig. 3 is by the synthetic synoptic diagram that generates the approach of medium chain PHA of fatty acid biological.Startup can be selected from following material by the actives that fatty acid biological synthesizes to synthesize PHA: 3-hydroxy acyl-acyl carrier protein-thiophorase (reaction 1); thioesterase (reaction 2); acyl-CoA synthetase (reaction 3); thiophorase (reaction 4); medium chain synthetic enzyme (reaction 5); β-Tong Liuxiemei (reaction 6); NADH or NADPH dependency reductase enzyme (reaction 7) and can be in conjunction with pha synthesizing enzyme (reacting 8) than the reaction of the substrate of long substrate of short chain and medium chain.Can in host plant, produce selected actives by transforming suitable gene construct.

Fig. 4 is the schematic approach that is used to generate the oil grain that contains senior laurate.Impel the actives of the content raising of laurate in the oil plant to be selected from following material: the lysophosphatidate acyltransferase (reaction 2) of 12:0-acyl-carrier protein thioesterase (reaction 1) and preferred 12:0-coenzyme A.Can in host plant, produce selected actives by transforming suitable gene construct.

Fig. 5 shows the approach that generates the polyunsaturated fatty acid of overlength chain in the plant.Lipid acid synthetic actives is selected from following material described in the startup plant: Δ ⁹-prolongation enzyme (reaction 1), Δ ⁸-desaturase (reaction 2), Δ ⁵-prolongation enzyme (reaction 3), Δ ⁶-desaturase (reaction 4) and Δ ⁶-prolongation enzyme (reaction 5).Can in host plant, produce selected actives by transforming suitable gene construct.

Fig. 6 is the schematic approach that generates beta-carotene (provitamin A) in transgenic plant.Startup can be selected from following material by the actives that the busy ox ester of the busy ox base of endogenous plant intermediate product bisphosphate generates beta-carotene: phytoene synthetase (reaction 1), the carotene desaturase (reaction 2) that phytoene can be converted into Lyeopene, the unsaturated enzyme of phytoene (reaction 3), ζ-carotene desaturase (reaction 4) and lycopene beta cyclase (reaction 5).Can in host plant, produce selected actives by transforming suitable gene construct.

Fig. 7 shows and makes the third generation (T ₃) Mimic that increases through over-richness of the roots of 31 plants

And Intrepid Dipping or its foliar spray added the Mimic that concentration increases

And Intrepid

PHB productive rate afterwards.Also show the mean error and the standard error of 4 samples among the figure.The Mimic of different concns is used in figure (a) expression

The T of dipping root ₃The productive rate of PHB in 31 plants.The Intrepid of different concns is used in figure (b) expression

The T of dipping root ₃The productive rate of PHB in 31 plants.Figure (c) expression adds Intrepid to its foliar spray

T ₃The productive rate of PHB in 31 plants.

Detailed Description Of The Invention

Be used for transforming polygenic construct

Described construct can comprise two or more induce the type promoter, from code area and two or more poly-adenosine acidifying signals of the gene of two or more coded proteins. The alternate manner that can Gong select is, described construct can comprise one or more promoter that is activated by activator protein molecule or part activator protein molecule, from polygenic code area and one or more poly-adenosine acidifying signal of coded protein. These constructs can with comprise one or more and induce the type promoter, unite use from the code area of the gene of one or more coding activator protein molecule or part activator protein molecule and the construct of one or more poly-adenosine acidifying signal. Described construct can also comprise the sequence of coding guiding peptide, the sequence of the sequence of the plasmid of for example encoding guiding peptide, line of codes plastochondria guiding peptide, the sequence of coding peroxidase guiding peptide or the sequence that coding is organized specific peptide.

In one embodiment, with the nucleotide sequence in the described biosynthesis approach place a plurality of induce construct under the type promoter regulation preferably comprise two or more 5 ' element that is operably connected to 3 ' direction, wherein each element comprises the nucleotide sequence of inducing type promoter, coded protein and 3 that the guiding nucleus acid sequence transcribes ' poly-adenosine acidifying signal sequence.

In another embodiment, place the construct under the regulation and control of a plurality of inducible promoters preferably to comprise first element, second element and three element the nucleotide sequence in the described biosynthetic pathway, wherein said first element 5 ' to 3 ' direction, be operably connected: first inducible promoter that first nucleotide sequence of the poly-hydroxyl alkanoates synthetase protein of guiding coding is transcribed, first nucleotide sequence and one 3 ' polyadenylation signal sequence of the poly-hydroxyl alkanoates synthetase protein of coding; Described second element 5 ' to 3 ' direction, be operably connected: second inducible promoter, coding proteinic second nucleotide sequence of Acetoacetyl-CoA reductase and 23 ' polyadenylation signal sequence that proteinic second nucleotide sequence of guiding coding Acetoacetyl-CoA reductase is transcribed; Described three element 5 ' to 3 ' direction, be operably connected: the 3rd inducible promoter that proteinic the 3rd nucleotide sequence of guiding coding β-Tong Liuxiemei is transcribed, proteinic the 3rd nucleotide sequence of coding β-Tong Liuxiemei, 33 ' polyadenylation signal sequence.

In one embodiment, contain the construct of expressing the gene of a plurality of enzymes in the biosynthetic pathway 5 ' to 3 ' direction, be operably connected: promotor, it is activated and is guided two or more nucleotide sequences to transcribe by activator molecule or mixture; The nucleotide sequence of two or more coded proteins; And 3 ' polyadenylation signal sequence.The alternate manner that can Gong select for use is, described construct can be 5 ' to 3 ' direction, has been operably connected: and two or more elements, wherein each element all comprises: promotor, and it is activated by activator molecule or mixture and the guiding nucleus acid sequence is transcribed; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

Described these constructs can with 5 ' be operably connected to 3 ' direction and unite use with the construct of lower section, described part is: inducible promoter, and it guides the nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence.The alternate manner that can Gong select for use is, described construct can be 5 ' and two or more elements have been operably connected to 3 ' direction, wherein each element all comprises: inducible promoter, and the nucleotide sequence of its guiding coding activator molecule or mixture is transcribed; The nucleotide sequence of coding activator molecule or mixture; And 3 ' polyadenylation signal sequence.

In another embodiment, construct comprises two or more elements, wherein at least one element 5 ' to 3 ' direction, be operably connected: the nucleotide sequence and the 3 ' polyadenylation signal sequence that guide inducible promoter, one or more coding activator molecule or mixture that nucleotide sequence of one or more coding activator molecule or mixture transcribes; And at least one element 5 ' to 3 ' direction, be operably connected: guide that two or more nucleotide sequences are transcribed and by activator molecule or mixture institute activatory promotor, two or more nucleotide sequence and 3 ' polyadenylation signal sequences of coded proteins respectively.

The alternate manner that can Gong select for use is, described construct comprises three or more elements, wherein at least one element 5 ' to 3 ' direction, be operably connected: the nucleotide sequence and the 3 ' polyadenylation signal sequence that guide inducible promoter, one or more coding activator molecule or mixture that nucleotide sequence of one or more coding activator molecule or mixture transcribes; And at least two elements respectively 5 ' to 3 ' direction, be operably connected: the promotor of transcribing by activator molecule or mixture activatory guiding nucleus acid sequence, nucleotide sequence and 3 ' polyadenylation signal sequence of coded protein.

Can transform and use the inducible promoter of the reagent of kind quantity (hereinafter will describe in detail) activation arbitrarily to plant by using above-mentioned construct, in plant, prepare biosynthetic products.Can use several different methods (comprising that spray on the blade face and root floods) that chemical reagent is put on the plant.

A. the regulation and control of inducible promoter and genetic expression

Gene and effector box (effectorcassette) that the inducible promoter system requires to be paid close attention to can be expressed.The gene of being paid close attention to is placed under the regulation and control of inducible promoter.The proteinic gene that described effector box is responsible for the regulation and control inducible promoter by coding constitutes, wherein coded protein is transcription repressor or transcription activating protein, and (referring to the document: C.Gatzand I.Lenk, Trends Plant ScI 3:352 (1998)) that it is normally expressed under the regulation and control of composing type strong promoter.Many chemical inducible promoter that are used for expressing at bacterium, yeast, plant or mammalian cell are known, and are available.

When a plurality of genes are inserted in the suitable conversion carrier (many all commercially available getting), promotor and transcription termination sequence can be joined in the construct.For example, have many plant conversion carriers available (referring to document: Gene Transfer to Plants (1995), Potrykus, I.and Spangenberg, G.eds.Springer-Verlag BerlinHeidelberg New York; " Transgenic Plants:A Production System forIndustrial and Pharmaceutical Proteins " (1996), Owen, M.R.L.and Pen, J.eds.John Wiley﹠amp; Sons Ltd.England and Methods in Plant Molecularbiology-a laboratory course manual (1995), Maliga, P., Klessig, D.F., Cashmore, A.R., Gruissem, W.and Varner, J.E.eds.Cold SpringLaboratory Press, New York).Usually, plant conversion carrier comprises one or more and is in 5 ' and 3 ' regulate the encoding sequence of being paid close attention under the transcriptional control of sequence, this 5 ' and 3 regulate sequences and comprise the marker gene that promotor, transcription terminator and/or polyadenylation signal and selectivity maybe can be screened.Usually 5 ' adjusting the sequence that needs comprises promotor, transcription initiation site and RNA processing signal.

The inducible promoter system that success is used in plant by extensive overview (referring to document: M.Padidam, Curr.Opin.Plant Biol.6,169 (2003); R.Wang et al, Trans.Res.12,529 (2003); C.Gatz and I.Lenk, Trends Plant ScL 3,352 (1998)).These systems of inducing can be by activation such as chemicals, for example tsiklomitsin, Stapyocine (Pristamycin), pathogenic agent, light, glucocorticosteroid, oestrogenic hormon, copper, herbicide-safener, ethanol, IPTG (sec.-propyl-β-D-1-thiogalactoside) and multiple pathogenic agent.

In preferred embodiments, described promotor is by moulting hormone and moulting hormone analogue activatory.The moulting hormone inducible promoter comprises moulting hormone ligand binding domain (document Heliothis virescens Martinez et al. for example, described in the 1999a), this moulting hormone ligand binding domain combines territory (for example be derived from another kind of acceptor (as glucocorticoid receptor) in conjunction with the territory) and trans activation domain (for example VP 16 trans activation domains) combination with DNA.The reagent of activation moulting hormone inducible promoter comprises moulting hormone, non-steroid moulting hormone analogue (bishydrazide molecule RH-5992 (commercially available sterilant Mimic for example

Activeconstituents), methoxyfenozide (commercially available sterilant Intrepid

Activeconstituents)), phytoecdysteroid (for example curtain multitude sterone A and ponasterone A) and insect steroid hormone 20-HE be (referring to document: Lafont, L.﹠amp; Dinan, L.J.Insect Science 3:7-95 (2003)).Can also use the cage that before by photoactivation, is actually non-activity to cover β-moulting hormone (referring to document: Lin et al.Chemistry﹠amp; Biology 9:1347-1353 (2002)).

The moulting hormone inducible promoter has been successfully used in the plant, described plant for example has transgene tobacco (referring to document: Martinez et al, Plant is (1999) J.19:97-106), the corn suspension cell is (referring to document: Martinez et al, MoI.Gen.Genet.261:546-552 (1999)), transgenic corns is (referring to document: Unger et al, Trans.Res.11:455-465 (2002)) and transgenic arabidopsis (referring to document: Padidam et al, CurrentOpinion Plant Biol.6:169-177 (2003); Koo et al, Plant is (2004) J.37:439-448).

Glucocorticoid inducible type promotor comprises glucocorticoid ligands and DNA in conjunction with territory (for example be derived from human glucocorticoid receptor in conjunction with the territory).Inductor comprises sterid, for example dexamethasone, hydrocortisone and prednisone.These promotors have been successfully used in the plant, described plant for example have transgene tobacco (referring to document: Aoyama and Chua, Plant is (1997) J.11:605-612; Bohner et al, Plant is (1999) J.19:87-95; Gremillonetal, Plant be (2004) J.37:218-228); Tobacco suspension cell is (referring to document: Schena et al, Proc.Natl.Acad.Sci.USA 88:10421-10425 (1991)), transgenic arabidopsis is (referring to document: Lloyd et al, Science 266:436-439 (1994)), transgenic paddy rice (Ouwerkerk et al, Planta 213:370-378 (2001)), transgene tobacco (Nicotiana benthamiana) is (referring to document: Mori et al, Plant is (2001) J.27:79-86) and Virginia pine tree (Virginia pine) cell culture (referring to document: Tang and Newton, J Exp.Botany 55:1499-1508 (2004)).

Estrogen-induced type promotor comprises the ligand binding domain of estrogen receptor (being generally human estrogen acceptor).Inductor comprises beta estradiol.Estrogen-induced type promotor has been successfully used in the plant, described plant for example has transgenic arabidopsis (referring to document: Zuo etal, Plant is (2000) J.24:265-273), transgene tobacco is (referring to document: Zuo et al, Plant is (2000) J.24:265-273), transgene tobacco is (referring to document: Guo et al, PlantJ.34:383-392 (2003)) and corn suspension cell (referring to document: Bruce et al, PlantCell Yl:65-79 (2000)).

Alcohol induced type promotor is based on the ale regulon of ditch nest aspergillus (Aspergillus nidulans).Alcohol induced type promotor has been successfully used in the plant, described plant for example has transgene tobacco (referring to document: Caddick et al, Nature Biotechnol.16:177-180 (1998), Sweetman et al, Plant Physiol.129:943-948 (2002)), transgenic Rhizoma Solani tuber osi is (referring to document: Sweetman et al, Plant Physiol.129:943-948 (2002)), transgenosis oil plant seed oil dish is (referring to document: Sweetman et al, PlantPhysiol.129:943-948 (2002)), transgenic arabidopsis (referring to document: Roslan etal, Plant be (2001) J.28:225-235).

The herbicide-safener inducible promoter can comprise corn In2-2 promotor.Typical inductor comprises herbicide-safener, and for example benzsulfamide and sulfonylurea herbicide chlorine sulphur are grand.The herbicide-safener inducible promoter has been successfully used in the plant (referring to document: DeVeylder et al, Plant Cell Physiol.38:568-577 (1997)).

Copper inducible type promotor is based on the controlling element of regulating the expression of copper detoxification genes in the yeast saccharomyces cerevisiae (Saccharomyces cerevisia).Typical inductor is copper sulfate (CuSO ₄).Copper inducible type promotor has been successfully used in the plant, and described plant for example has transgene tobacco (referring to document: Mett et al, Proc.Natl.Acad.Sci.USA 90:4567-4571 (1993)).

The tsiklomitsin inducible promoter can be made of the tetracycline resistance operon element in the intestinal bacteria (E.coli).This type of promotor can be used as activator or repressor, and can unite use with other system of inducing, to carry out dual regulation and control.For example, tet induction type repressor system can combine with the glucocorticoid inducible system, with the On/Off conversion that obtains closely regulation and control (referring to document: Bohner et al, Plant is (1999) J.19:87-95).It is that prior art is known (referring to document: Gossen M and Bujard H, Proc Natl Acad Sci USA89:5547-5551 (1992) that tsiklomitsin is replied type promotor/tsiklomitsin regulation and control type trans-activator (tTA) system; Adams et al, MoI.Pharmacol.55 (6): 1028-1036 (1999)).The tsiklomitsin inducible promoter has been successfully used in the thing, described plant for example has transgene tobacco (referring to document: Bohner et al, Plant is (1999) J.19:87-95) and tobacco protoplast (referring to document: Gatz and Quail, Proc.Natl.Acad.Sd.USA85:1394-1397 (1988)).

The Stapyocine inducible promoter is based on the transcription activating protein (PIT) that is made of PIP protein (repressor of the Stapyocine operon of streptomyces coelicolor (S.coelicolor)).Inductor comprises streptogramine microbiotic Stapyocine.The Stapyocine inducible promoter has been successfully used in the plant, and described plant for example has tobacco suspension cell (referring to document: Frey et al, Biotechnol.﹠amp; Bioengineering 74:154-163 (2001)).

Pathogen-inducible promoter can comprise the Prpl-a promotor from potato.Inductor comprises the pathogenic agent attack, but the chemicals of described promotor response such as diazosulfide (BTH) and Whitfield's ointment.Pathogen-inducible promoter has been successfully used in the plant, and described plant for example has Arabidopis thaliana and tobacco (referring to document: Bohmert et al, PlantPhysiol.128:1282-1290 (2002)).

Sec.-propyl-β-D-1-thiogalactoside (IPIG) is the non-hydrolysis inductor of synthesis type of intestinal bacteria lac repressor.Research shows, IPTG can be used for inducing in the cell by the expression of the host cell gene of lac repressor/operon system regulation and control (referring to document: Wilde et al, EMBOJ.11,1251-1259 (1992); Itzhaki et al.Nat.Genet.15:258-265 (1997)).

Can make by the efficient (by stability and/or the absorption that strengthens inductor, perhaps by strengthening the affinity of inductor) that improves inductor inducing of described promotor reached optimum the ligand binding domain of inducible promoter.The structure of inductor is carried out the solution that chemically modified and/or allotment contain inductor can reach described purpose.

Thereby can improve part and/or DNA by the gene shuffling technology makes inducible promoter reach optimum in conjunction with the territory and/or by the inducibility that MIN promotor improves system.

Can select plant promoter with regulation and control in different plant tissues or organoid transfer expression of gene, for all different plant tissues and organoid, used system of selection is known to those skilled in the art (referring to document: Gasser﹠amp; Fraley, Science 244:1293-99 (1989)).Genetically modified 5 ' end can be transformed into the sequence of the guiding peptide that comprises coding plasmid or other subcellular organelle, for example reads the plasmid targeting signal that frame links to each other with described transgenosis.

B. the enzyme in the biosynthetic pathway

The invention provides the method and the construct of the gene of the enzyme that is used for introducing a plurality of coding multienzyme biosynthetic pathways.

In one embodiment, described construct comprises and causes the inducible promoter that a plurality of gene orders are expressed, wherein each gene order different protein in the encoding human route of synthesis all.Described construct also comprises the effector box, and the proteinic gene that this effector box is responsible for regulating by coding constitutes.This genoid has polyadenylation signal, and is placed in usually under the regulation and control of composing type strong promoter or tissue-specific promoter.Described construct comprises two or more (for example 2-12, be preferably 2-8, more preferably 2-7) enzyme coding genes, each enzyme coding gene all is under the regulation and control of inducible promoter and all has polyadenylation signal, and described construct can be used for producing such transgenosis organism, in this transgenosis organism, when applying chemical inducer, the expression of described enzyme strengthens, and produces a series of enzyme products by described transgenes encoding.Fig. 1 shows the explanation of using the PHB biosynthetic pathway as an example this type of construct to be carried out.

In a preferred embodiment, described genetically modified product is enzyme and other factor that is used to produce biological polymer (for example poly-hydroxyl alkanoates (PHA), contain the vegetables oil or the nutritious cpds of lipid acid (having required industry or nutritive property)).

At product is under the situation of PHA, and it can be the homopolymer or the multipolymer of 3-butyric ester.In this case, described transgenosis can be encoded and is selected from following enzyme: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB (" short chain ") synthetic enzyme, PHA (" long-chain ") synthetic enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.Useful gene is known in the field, and the Metab.Eng.4:29-40 (2002) that is shown at (for example) Snell and Peoples and Bohmert etc. the people showed Molecular Biolosv and Biotechnology of Plant Organelles(H.Daniell, C D.Chase edit (Kluwer Academic Publishers, Netherlands; 2004, the 559-585 pages or leaves)) have in disclosed, and in Fig. 2 and Fig. 3 also to some extent the general introduction.

The example of pha synthesizing enzyme comprises: have the synthetic enzyme of medium chain substrate specificity, for example from the phaCl of Pseudomonas oleovorans (Pseudomonas oleovorans) (referring to patent documentation: WO 91/00917; Huisman et al, J.Biol.Chem.266,2191-2198 (1991)) or from the phaCl of Pseudomonas aeruginosa (Pseudomonas aeruginosa) (referring to document: Timm, A.﹠amp; Steinbuchel, A.Eur.J.Biochem.209:15-30 (1992)); From having than the long specific synthetic enzyme of short chain of alcaligenes eutrophus (Alcaligenes eutrophus) (referring to document: Peoples, O.P.﹠amp; Sinskey, A.J.J.Biol.Chem.264:15298-15303 (1989)); Or two subunit synthetic enzyme, for example from Pu Shi pod sulphur bacterium (Thiocapsapfennigii) by phaE and the coded synthetic enzyme (U.S. Patent No. 6,011,144) of phaC.Other useful pha synthesizing enzyme gene has separated from following species and has obtained, and described species for example have Aeromonas caviae (Aeromonas caviae) (referring to document: Fukui﹠amp; Doi, J.Bacteriol.179:4821-30 (1997)), Crimson rhodospirillum (Rhodospirillum rubrum) (U.S. Patent No. 5,849,894), Rhodococcus ruber (Rhodococcus ruber) are (referring to document: Pieper﹠amp; Steinbuechel, FEMSMicrobiol.Lett.96 (1): 73-80 (1992)) and coral Nocardia bacteria (Nocardiacorallina) (referring to document: Hall et al., Can.J.Microbiol.44:687-91 (1998)).Be used to produce the 3-butyric ester with than the pha synthesizing enzyme with wide in range substrate specificity of the multipolymer of long (6 to 14 carbon atoms) hydroxy acid of long-chain also from pseudomonas A33 (referring to document: Appl.Microbiol.Biotechnol.42:901-909 (1995)) and pseudomonas 61-3 (referring to document: Kato et al, Appl.Microbiol.Biotechnol.45:363-370 (1996)) in separation obtain.

The scope of the gene of encoding in pha synthesizing enzyme gene and other metabolism step in the PHA biosynthesizing is described in document Madison and Huisman.Microbiology andMolecular biology Reviews63:21-53 (1999) to some extent.

α subunit in the β-Yang Hua belongs to multifunctional enzyme, and it is minimum to have the active and dehydrogenase activity (referring to Fig. 2) of hydratase.Described subunit can also have the epimerase activity and Δ 3-is suitable, Δ 2-anteiso-structure enzymic activity.The example of the α subunit of β-Yang Hua is (referring to document: DiRusso from colibacillary FadB, C.C., J.Bacteriol.1990,172,6459-6468), from the FaoA of strawberry pseudomonas (Pseudomonas fragi) (referring to document: Sato, S., Hayashiet al.J.Biochem.1992,111,8-15) with E.coli open reading frame ± 714 (it contains the homologue (Genbank Accession#1788682) of the multi-functional α subunit of β-Yang Hua).The β subunit of β-Yang Hua is meant the polypeptide that can form the multifunctional enzyme mixture with its mating partner α subunit.Described β subunit has thiolase activity (referring to Fig. 2).The example of β subunit is (referring to document: DiRusso from colibacillary FadA, C.C.J.Bacteriol.172:6459-6468 (1990)), from the FaoB of strawberry pseudomonas (referring to document: Sato, S., Hayashi, M., Imamura, S., Ozeki, Y., Kawaguchi, A.J.Biochem.111:8-15 (1992)) and E.coli open reading frame f436 (it contains the homologue (GenbankAccession#AE000322 of the α subunit of β-Yang Hua; Gene b2342)).

Reductase enzyme is meant the enzyme that β-ketoacyl coenzyme A can be reduced to the R-3-OH-acyl-CoA, for example from the NADH dependency reductase enzyme of photosynthetic bacterium (Chromatium vinosum) (referring to document: Liebergesell, M. ， ﹠amp; Steinbuchel, A.Eur.J.Biochem.209:135-150 (1992)), from the NADPH dependency reductase enzyme of alcaligenes eutrophus (referring to document: Peoples, O.P.﹠amp; Sinskey, A.J.J.Biol Chem.264:15293-15297 (1989)), come the NADPH reductase enzyme of the spontaneous moving glue bacterium of branch (Zoogloea ramigera) (referring to document: Peoples, O.P.﹠amp; Sinskey, A.J.MolecularMicrobiology 3:349-357 (1989)) or from the NADPH reductase enzyme (U.S. Patent No. 6,835,820) of bacillus megaterium (Bacillusmegaterium).

β-Tong Liuxiemei be meant can the catalysis acetyl-CoA and acyl-CoA be converted into the enzyme of β-ketoacyl coenzyme A, this conversion reaction is reversible (referring to Fig. 2).The example of this thiolase is that PhaA from alcaligenes eutrophus is (referring to document: Peoples, O.P.﹠amp; Sinskey, A.J.J.Biol.Chem.264:15293-15297 (1989)) with from the BktB of alcaligenes eutrophus (referring to document: Slater et al, J Bacteriol.180 (8): 1979-87 (1998)).ACOD is meant the enzyme (referring to Fig. 2) that saturated acyl-CoA can be converted into Δ 2 unsaturated acyl-CoAs.The example of ACOD is (referring to document: Dmochowska et al from the POX1 of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae); Gene; 1990,88,247-252) with from the ACX1 (Genbank Accession#AF057044) of Arabidopis thaliana.Catalase is meant the enzyme that hydrogen peroxide can be converted into hydrogen and oxygen.Catalatic example be from Pseudomonas aeruginosa KatB (referring to document: Brown et al, J.Bacteriol.Ill:6536-6544 (1995)) and from the KatG of E.coli (referring to document: Triggs-Raine, B.L.﹠amp; Loewen, P.C.Gene 52:121-128 (1987)).

Product at the enzyme of transgenes encoding is under the modification oil condition, and described transgenosis can be encoded and is selected from following enzyme: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and/or triacylglycerol biosynthetic enzyme.These enzymes have disclosed in many reference, and described reference comprises U.S. Patent No. 6,140,486; U.S. Patent No. 5,955,650; U.S. Patent No. 6,433,250; U.S. Patent No. 6,051,754; U.S. Patent No. 6,635,451; Singh et al, Plant Physiol.109:1498 (1995); Tang et al, Plant Physiol.119:364 (1999); And Madiand Prusky, Plant Physiol.121:1057 (1999).For industrial use, the vegetables oil product can have the lipid acid of improvement to be formed, and for example the content of hydroxy acid content height, oleic acid content height or unsaturated fatty acids is higher or lower.Be used for improving the gene of lauric acid content of rapeseed oil and system by people such as Knutzon describe to some extent (referring to document 1999, Plant Physiol.120,739-746), and as shown in Figure 4.Have at the vegetables oil product under the situation of nutrient property of improvement, it can have the unsaturated fatty acid content (for example senior oleic acid or lauric content) of minimizing or have the content of the long chain polyunsaturated fatty acids (PUFA) that increases.Be used for increasing the gene of oil grain PUFA content and system at document Qi et al, describe to some extent among the Nature Biotechnology 22:739-745 (2004), and be summarized among Fig. 5.Other metabolic engineering method that is used for new oil grain crop production is at document Drexler et al, and J Plant Physiol summarizes among the 160:779-802 (2003) to some extent.

The product of the enzyme of transgenes encoding also can be a nutritious cpds, for example beta-carotene (provitamin A).Be used for producing the gene of beta-carotene of transgenic paddy rice and system at document Ye et al, describe to some extent among the Science 287:303-305 (2000), and be summarized among Fig. 6.Can the encode enzymic activity thing of the reaction 1-5 that is selected from Fig. 6 of the transgenosis that is arranged in the inducible expression box.

C. homing sequence

Transgenosis (under the situation of the enzyme of coding in a plurality of enzyme reactions) the spirit with natural poly-enzyme mixture of can encoding (for example microorganism Fatty Acid Oxidation mixture), perhaps (under the situation of the enzymic activity thing of coded amino acid approach) bifunctional enzyme of can encoding (for example Threonine is produced related intestinal bacteria homoserine dehydrogenase-E.C. 2.7.2.4.).The example that this genoid of a lot of multifunctional coded enzymes is arranged in the document.In other cases, can make up transgenosis by the gene fusion technology, so that its multifunctional coded enzyme, in described gene fusion technology, use or do not use joint sequence to merge heterogeneic encoding sequence, to obtain the single proteinic individual gene of coding with independent gene activity.Can also use molecular evolution technique further to optimize the combination of this synthetic fusion gene/enzyme.

In another embodiment, the construct that comprises the gene of the enzyme in a plurality of coding multienzyme biosynthetic pathways is placed under the regulation and control of one or more promotor, described promotor is by one or more transgenosis expressed activator molecule or mixture activatory, described one or more transgenosis is subjected to the regulation and control of one or more inducible promoter, and is unlocked after externally applying chemicals.In this case, use can strengthen the chemical inducer of the expression of activator molecule or part activator molecule and handle the transgenosis organism, and this operation can improve the genetically modified expression of coding multienzyme actives subsequently on the time for production meta-bolites the best.

In above-mentioned two embodiments, it is desirable to, on the certain hour in development of plants cycle, carry out the described output that improves required product of inducing.Although it is that useful selection is (referring to document: Holt et al.Planta.196 (2): 295-302 (1995) that root is soaked into, but preferably, leaf sprayed apply chemical inducer (referring to document: Tominack, JToxicol Clin Toxicol.38 (2): 129-35 (2000)).Meta-bolites can be produced meta-bolites in any part of plant, described any part for example has leaf, stem, flower, seed or their any combination.

Heterologous nucleotide sequence can also comprise the nucleotide sequence that one or more contains homing sequence in coding is waited the zone of the enzyme of being expressed." guiding " sequence be coding as the aminoacid sequence of the part of enzyme or the nucleotide sequence of die body, described aminoacid sequence or die body pilot protein matter enter in the specific cellular compartment, make described protein positioning or compartmentation.The existence of amino acid guiding peptide causes all or part of displacement of passing the organoid film and entering into the inside of organoid of target protein matter usually in the protein.The alternate manner that can Gong select for use is that the guiding peptide can guide the target protein quality guarantee to hold on the film that is embedded in organoid." guiding " peptide of target protein matter or zone can comprise a string successive amino acid or one group of discontinuous amino acid.Can select to guide peptide, so that in target protein matter introduced plant organoid, described vegetable cell device for example has nucleus, microbody (for example peroxysome or specificity peroxysome (as glyoxysome)), endoplasmic reticulum, endosome, vacuole, plasma membrane, cell walls, plastosome, chloroplast(id) or plasmid.

Chloroplast(id) guiding peptide is any peptide sequence that protein can be introduced in chloroplast(id) or the plasmid, and for example (referring to document: Khoudi et al, Gene 1997,197,343-351) for the transit peptides of the small subunit of clover ribulose-bisphosphate carbonylation enzyme.Peroxysome guiding peptide is meant any peptide sequence (it is terminal to be positioned at N-end, centre or C-) that protein can be introduced in the peroxysome, and for example the terminal guiding of plant C-tripeptides SKL is (referring to document: Banjoko, A.﹠amp; Trelease, R.N.Plant Physiol.1995,107,1201-1208; T.P.Wallace etal, " Plant Organellular Targeting Sequences; " in Plant MolecularBiology, Ed.R.Croy, BIOS Scientific Publishers Limited (1993) 287-288), and the peroxysome bootup process in the plant is shown in document M.Volokita The Plant J., among the 361-366 (1991).

D. marker gene

Used selected marker comprises the resistant gene bar (US 5,276,268) of neomycin phosphotransferase gene nptll (US 5,034,322, US 5,530,196), the mould plain gene of moisture resistance (US 5,668,298) and phosphinothricin in the plant.Patent documentation EP 0 530 129 A1 have described a kind of positive selective system, this positive selective system is to look faster thereby can make plant transformed than unconverted strain by making the transgene expression of codase (activation joins the non-active compound in the growth medium).U.S. Patent No. 5,767,378 have described the purposes that seminose or wood sugar are selected for the positive of transgenic plant.The marker gene that can screen comprise the beta-Glucuronidase gene (referring to document: Jefferson et al, 1987, EMBO J.6:3901-3907; US 5,268,463) and the egfp gene of natural or modification (referring to document: Cubitt et al, 1995, Trends Biochem Sci.20:448-455; Pan et al, 1996, Plant Physiol.112:893-900).Some marks in these marks have the extra advantage in the plant that certain specific character (for example antiweed) introducing is paid close attention to, thereby can provide extra agronomical value aspect input.

E. transcription termination sequence

Can transform polyadenylation signal at 3 of transcription ' end.Polyadenylation signal was meant before mRNA is transported to cytosol, any sequence that can cause endonuclear mRNA polyadenylation, for example 3 of the nopaline synthetic enzyme ' zone is (referring to document: Bevan, M., Barnes, W.M., Chilton, M.D.Nucleic Acids Res.1983,11,369-385).

II. use the method for construct

A. transform

The DNA construct that is used for methods described herein comprises can be with the conversion carrier in the transgenosis introduced plant.As used herein, " transgenosis " is meant such organism: in this was organic, the nucleic acid fragment that contains heterologous nucleotide sequence was introduced into.Preferably, the transgenosis in the transgenosis organism is stable and is heritable.Described heterologous nucleic acids fragment can maybe cannot be integrated in the host genome.

Several plant conversion carrier option is an available, these plant conversion carriers comprise those described in the following document, and described document has: " Gene Transfer to Plants " (people such as Potrykus edits) Springer-Verlag Berlin Heidelberg New York (1995); " Transgenic Plants:A Production System for Industrial andPharmaceutical Proteins " (people such as Owen edits) John Wiley﹠amp; The England of Sons company limited (1996); " Methods in Plant Molecular Biology:ALaboratory Course Manual " (people such as Maliga edits) Cold SpringLaboratory press, New York (1995).Plant conversion carrier comprises one or more kinds usually and is in 5 ' and 3 ' regulate the encoding sequence of being paid close attention under the transcriptional control of sequence, and wherein said 5 ' and 3 ' regulate sequence comprise the marker gene that promotor, transcription terminator and/or polyadenylation signal and selectivity maybe can be screened.For two or more polypeptide expression that form by single transcription, other RNA processing signal and ribozyme sequence can be inserted into (U.S. Patent No. 5,519,164) in the described construct through transformation.This method has the advantage that a plurality of transgenosiss is positioned at individual gene seat place, and this is favourable in the plant breeding work of carrying out subsequently.Another kind method is to use carrier to transform the plasmid karyomit(e) (U.S. Patent No. 5 of plant specifically by homologous recombination; 545,818), in this case; the prokaryotic of plasmon can be utilized, and a plurality of transgenosiss can be inserted as operon.

Can use several different methods and various plants to organize and finish the conversion of using described carrier that suitable farm crop host is carried out.The representative plant that is used for method disclosed herein comprises Btassica (comprising swede type rape, turnip, brassicacarinata and leaf mustard), Arabidopis thaliana, corn, soybean, cottonseed, Sunflower Receptacle, palm, coconut, safflower, peanut, mustard seed (comprising sinapsis alba), sugarcane and flax.Crop as the biomass results also can be used in the method disclosed herein, and described crop for example has green fodder corn (silage corn), alfalfa, switchgrass, jowar or tobacco.The representativeness tissue that is used to use described carrier to transform comprises protoplastis, cell, callus, leaf dish, pollen and meristematic tissue.Representational method for transformation comprise agriculture bacillus mediated conversion method, biological projectile method, microinjection, electroporation eh, the conversion method of the protoplast transformation method of polyoxyethylene glycol mediation, liposome-mediated conversion method and silica fibre mediation is (referring to document: U.S. Patent No. 5,464,765; " Gene Transfer toPlants " (people such as Potrykus edits) Springer-Verlag Berlin Heidelberg NewYork (1995); " Transgenic Plants:A Production System for Industrialand Pharmaceutical Proteins " (people such as Owen edits) John Wiley﹠amp; The England of Sons company limited (1996); " Methods in Plant Molecular Biology:ALaboratory Course Manual " (people such as Maliga edits) Cold Spring LaboratoryPress, New York (1995)).

Can transform soybean by many reported method (referring to document: US 5,015,580, US5,015,944, US 5,024,944, US 5,322,783, US 5,416,011, US 5,169,770).

Reported that many method for transformation are used to produce rotaring gene corn plant, described method for transformation comprises the pollen conversion method, and (US 5,629,183), the conversion method (US5,464,765) of silica fibre mediation, (US 5 for the protoplastis electroporation, 231,019, US 5,472,869, US5,384,253), (US 5 for particle bombardment, 538,877, US 5,538, and 880) and agriculture bacillus mediated conversion method (EP 0 604 662 A1 and WO 94/00977).Agrobacterium mediation method is particularly preferred, and this is because make single integration incident of easier in this way acquisition transgenic constructs, greatly helps the plant breeding of carrying out subsequently thus.Can transform (US 5,004,863 and US 5,159,135) to cotton by the particle bombardment method.The combined method of alpha bombardment method and agroinfection can be transformed (EP 0 486233A2 and US 5,030,572) to Sunflower Receptacle.Can transform flax by particle bombardment method or agriculture bacillus mediated conversion method.Use biological projectile mediated method or agrobacterium-mediated transformation can transform switchgrass (referring to document: Richards et al.Plant Cell Rep.20:48-54 (2001); Somleva et al.Crop Science 42:2080-2087 (2002)).The method for transformation of sugarcane has also been described to some extent (referring to document: Franks﹠amp; Birch.Aust.J.PlantPhysiol.18,471-480 (1991); PCT WO 2002/037951).

Be used to implement recombinase technology of the present invention and comprise cre-lox, FLP/FRT and Gin system.These technology can be used for the method that purpose described herein passes through and describe to some extent at following document, described document for example has US 5,527,695; Dale and Ow, 1991, Proc.Natl.Acad.Sci.USA 88:10558-10562; Medberry et al, 1995, NucleicAcids Res.23:485-490.

State in the use after any method transforms, can use following method to obtain the conversion plant that render transgenic is expressed, described method is: select on selective medium by the plant transformed cell; Make by plant transformed cell regeneration so that produce different plants; The conversion plant of selecting transgenosis to obtain expressing, wherein said transgenosis has produced the required polypeptide of desired content in the position of required tissue and cell.

B: the production of biosynthetic products

The expression of plurality of enzymes can be used for changing the metabolism of plant, so that (for example) improve the amino acid whose content of trophicity (referring to document: Falco et al.Biotechnology 13:577 (1995)), the metabolism that changes xylogen is (referring to document: Baucher et al.Crit.Rev.Biochem.MoI.Biol.38:305-350 (2003)), the composition that changes oil is (referring to document: Drexler et al.J.Plant Physiol.160:779-802 (2003)), modify starch or produce poly-hydroxyl alkanoates polymkeric substance (referring to document: Huisman and Madison, Microbioland MoI.Biol.Rev.63:21-53 (1999) and reference wherein).In preferred embodiments, transgene product is a biological polymer, for example poly-hydroxyl alkanoates (PHA), the vegetables oil that contains lipid acid (having required industry or nutritive property) or nourishing compound.

The production of PHA biological polymer

It is preferred example how to use these constructs that plant is changed over generation PHA biological polymer.Described PHA biological polymer comprises that the wider big kind polyester of monomer whose component difference and physical properties scope is (referring to document: Madison and Huisman, 1999; Dudeshetal.Prog.Polym.ScI 25:1503-1555 (2000)).Natural metabolism that can be by controlling plant is so that produce 3-hydroxyl acyl-CoA (substrate of pha synthesizing enzyme) in polymkeric substance generation cumulative organoid, come to produce short chain PHA, medium chain PHA and than the multipolymer of long PHA of short chain and medium chain PHA in plant.This needs the expression of two or more recombinant proteins usually, and the suitable organoid targeting signal of being had.Can express described protein synchronously by the one construct that is incorporated into by single transformation event in the plant.Usually, by making one or more monomeric unit polymerization (for example, enzymatic polymerization) form PHA.The example of this monomeric unit comprises (for example) 3-butyric ester, oxyacetic acid, 3-hydroxy propionate, 3-hydroxyl valerate, 3-hydroxycaproic ester, 3-hydroxyl heptanoate, 3-Hydroxyoctanoic acid ester, 3-hydroxyl pelargonate, 3-hydroxydecanoic acid ester, 3-hydroxy-dodecanoic acid ester, 3-hydroxyl laurylene acid esters, 3-hydroxyl tetradecane acid ester, 3-hydroxyl cetane acid ester, 3-hydroxyl octadecane acid esters, 4 hydroxybutyric acid ester, 4-hydroxyl valerate, 5-hydroxyl valerate, 6 hydroxycaproic acid ester.

In some embodiments, described PHA has at least one chemical formula and is-OCR ₁R ₂(CR ₃R ₄) _nThe monomeric unit of CO.N is zero or integer (for example 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15 etc.).R ₁, R ₂, R ₃And R ₄Respectively do for oneself hydrogen atom, saturated hydrocarbyl or unsaturated alkyl.R ₁With R ₂, R ₃And R ₄Identical or different respectively.R ₂With R ₁, R ₃And R ₄Identical or different respectively, R ₃With R ₂, R ₁And R ₄Identical or different respectively, R ₄With R ₂, R ₃And R ₁Identical or different respectively.

In some embodiments, described PHA is a homopolymer.The example of this homopolymer comprises poly--4 hydroxybutyric acid ester, poly--the 4-hydroxyl valerate, poly--the 3-hydroxy propionate, poly--the 3-butyric ester, poly--the 3-hydroxycaproic ester, poly--3-hydroxyl heptanoate, poly--3-Hydroxyoctanoic acid ester, poly--3-hydroxydecanoic acid ester and poly--3-hydroxy-dodecanoic acid ester.In some embodiments, described PHA comprises the unitary multipolymer of two or more different monomers.The example of this multipolymer comprises poly--3-butyric ester-co-S-hydroxy propionate, poly--S-butyric ester-co-S-hydroxyl valerate, poly--3-butyric ester-co-3-hydroxycaproic ester, poly--3-butyric ester-co-4-butyric ester, poly--3-butyric ester-co-4-hydroxyl valerate, poly--3-butyric ester-co-6-hydroxycaproic ester, poly--3-butyric ester-co-3-hydroxyl heptanoate, poly--3-butyric ester-co-3-Hydroxyoctanoic acid ester, poly--3-butyric ester-co-3-hydroxydecanoic acid ester, poly--3-butyric ester-co-S-hydroxy-dodecanoic acid ester, poly--3-butyric ester-co-3-Hydroxyoctanoic acid ester-co-3-hydroxydecanoic acid ester, poly--3-hydroxydecanoic acid ester-co-3-Hydroxyoctanoic acid ester and poly--3-butyric ester-co-3-hydroxyl octadecane acid esters.

Described PHA can have and at least about 500 dalton (for example is equivalent to, at least about 10,000 dalton, at least about 50,000 dalton) and/or (for example less than about 2,000,000 dalton, less than about 1,000,000 dalton, less than about 800,000 dalton) weight-average molecular weight of polystyrene weight-average molecular weight.As used herein, weight-average molecular weight is to measure by gel permeation chromatography (for example using the eluent and the thinner of chloroform as the PHA sample).Can use the polystyrene molecular weight standard to obtain being used for determining the working curve of molecular weight.

Described therein PHA is poly--3-hydroxybutyric acid ester copolymer (poly 3-hydroxy butyrate-co-3-hydroxy propionate for example, poly--3-butyric ester-co-3-hydroxyl valerate, poly--3-butyric ester-co-3-hydroxycaproic ester and/or poly--3-butyric ester-co-4-butyric ester, poly--S-butyric ester-co-S-Hydroxyoctanoic acid ester-co-S-hydroxydecanoic acid ester-co-3-hydroxy-dodecanoic acid ester) some embodiment in, most of monomeric unit is that the 3-butyric ester (is the 3-butyric ester at least about 50% monomeric unit for example, monomeric unit at least about 60% is the 3-butyric ester).

In bacterium, various PHA monomers are to produce by specific approach.Under the situation of the PHA that lacks side group, relate to three kinds of enzymes: β-Tong Liuxiemei (referring to reacting 8 among Fig. 2), Acetoacetyl-CoA reductase (referring to reacting 9 among Fig. 2) and pha synthesizing enzyme (referring to reacting 10 among Fig. 2).Synthetic enzyme than the long PHA of short chain makes the hydroxy acid monomers generation polymerization that comprises 4-hydroxyl and the unitary C3-C5 of 5-alcohol acid usually.In many bacteriums, found this biosynthetic pathway, described bacterium for example have the Rolls to lead to Salmonella (Ralstoniaeutropha), association's abdomen Alcaligenes (Alcaligenes latus), give birth to the moving glue bacterium of branch etc. (referring to document: Madison, L.L.﹠amp; Huisman, G.W.Microbiology and MolecularBiology Reviews, 1999,63,21-53).Can will promote to be incorporated in the host plant by single transformation event than the long PHA synthetic of short chain actives.If necessary, can be in the dna sequence dna of encoded peptide targeting signal with the gene fusion of codase, wherein said peptide targeting signal is directed to mature protein (forming) in the specific cellular compartment after shearing.

The PHA of medium chain side group produces by many different pseudomonass.Hydroxyl acyl coenzyme A monomeric unit can be derived from lipid acid β-Yang Hua approach (referring to Fig. 2) and fatty acid biosynthetic pathway (referring to Fig. 3).Then, described monomeric unit is converted into polymkeric substance by pha synthesizing enzyme, wherein said pha synthesizing enzyme have the big monomeric unit of preference C6-C14 substrate specificity (referring to react 7 among Fig. 2, reaction 5 and document Madison among Fig. 3, L.L.﹠amp; Huisman, G.W.Microbiology and Molecular BiologyReviews, 1999,63,21-53).By single transformation event, can will promote active body to introduce in the host plant by the synthetic medium chain PHA of lipid acid β-Yang Hua approach, described active body is selected from Fig. 2 and reacts the enzyme described in the 1-7.If necessary, can with the coding described enzyme gene fusion in the dna sequence dna of encoded peptide targeting signal, described peptide targeting signal with protein priming in specific cellular compartment.

Enzyme between the synthetic and fatty acid biological of PHA is synthetic connects (enzymatic link) reporting to some extent in pseudomonas putida (Pseudomonas putida) and Pseudomonas aeruginosa (reacting 1 in referring to Fig. 3).The locus of codase (it is believed that this fermentoid be responsible for shift from fatty acid biological synthetic carbon) is named as phaG (referring to document: Rehm et al, J.Biol.Chem.1998,273,24044-24051; WO 98/06854; U.S.5,750,848; Hoffmann, N, Steinbuchel, A., Rehm, B.H.A.FEMS, MicrobiologyLetters, 2000,184,253-259).U.S. Patent No. 6,586,658 have described other the gene that is used for being produced by fatty acid biosynthetic pathway PHA.By single transformation event, can promote to be incorporated in the host plant with construct by the active body of the synthetic medium chain PHA of fatty acid biosynthetic pathway, wherein enzyme is selected from Fig. 3 and reacts described in the 1-3 those.If necessary, can with the coding described enzyme gene fusion in the dna sequence dna of encoded peptide targeting signal, described peptide targeting signal is directed to mature protein in the specific cellular compartment (for example plasmid).

Can also in bacterium, produce the multipolymer (referring to the reaction among the reaction among Fig. 2 11 and Fig. 3 5) that comprises long side group and medium chain side group than short chain with pha synthesizing enzyme (having wider substrate specificity).For example, pseudomonas A33 is (referring to document: Appl.Microbiol.Biotechnol.1995,42,901-909), pseudomonas 61-3 is (referring to document: Kato et al, Appl.Microbiol.Biotechnol.1996,45,363-370) with Pu Shi pod sulphur bacterium (U.S. Patent No. 6,011,144) all has pha synthesizing enzyme, it is reported that these pha synthesizing enzymes can produce the multipolymer than long monomeric unit of short chain and medium chain monomeric unit.By single transformation event, can be with in the active body introducing host plant that promotes than the formation of the multipolymer of long side group of short chain and medium chain side group, and the polypeptide of the reaction 1-8 (referring to Fig. 3) of reaction 1-11 (referring to Fig. 2) that described active body codified can catalysis lipid acid degradation pathway and fatty acid biosynthetic pathway.If necessary, can with the coding these polypeptide gene fusion in the dna sequence dna of encoded peptide targeting signal, described peptide targeting signal is directed to mature protein in the specific cellular compartment (for example plasmid).

Other approach in conjunction with the 3-hydroxyl valerate is described in patent documentation PCT WO 98/00557 people such as () Grays to some extent.Other approach in conjunction with the 4 hydroxybutyric acid ester describes in detail in patent documentation PCT WO 98/36078 (Dennis and Valentin) and PCT WO 99/14313 people such as () Huisman to some extent.

With technical scale by plant production PHA before, should make the production of polymkeric substance in the crop with agronomical value reach optimum.Some crops with agronomical value have been carried out preliminary study (about summary referring to Bohmert et al, 2004Metabolic Engineering:Plastids as Bioreactors.In Molecular Biology and Biotechnology of Plant OrganellesH.Daniell and C.D.Chase, Editors.KluwerAcademic Publishers:Netherlands, p.559-585), the production that comprises PHB in the corn is (referring to document: Poirier﹠amp; Gruys, 2002, Production ofpolyhydroxyalkanoates in transgenic plants.In Biopolymers, A.Steinb ü chel, Editor; Wiley-VHC Verlag GmbH:Weinheim.p.401-435) production of PHB and in transgene rape and the soybean seeds is (referring to document: people's such as Gruys PCTWO 98/00557).In these researchs, the content of viewed polymkeric substance is too low for the economic production of polymkeric substance.Have PHA produces in the crop of agronomical value optimization and adopted method for screening is carried out in plurality of enzymes, targeting signal and production site, till the high yield approach that obtains at polymkeric substance with required composition.If a plurality of genes are inserted in the mode of single transformation event, then this is can being oversimplified of a task.The structure of multi-gene expression construct is used to reduce the traditional breeding way complicacy of (needing the render transgenic plant to have agricultural use).

By will be further understood that the present invention with reference to following indefiniteness embodiment.

Embodiment

Embodiment 1: the structure of plasmid

All DNA operation (comprising PCR, dna sequencing, conversion and plasmid purification) all uses the standard method described in the Molecular Cloning:A LaboratoryManual that the people showed (Cold Spring Harbor Laboratory press, New York (1989)) such as (for example) Sambrook to carry out.

PUC 18-C4PPDK-AAA-RBS comprises the 35S-C4PPDK promotor (referring to document: Chiu et al.Curr.Biol.6:325 (1996)), coding is from the DNA of 24 initial aa of the signal peptide of the small subunit of the rubisco of pea and mature protein (referring to document: Coruzzi et al.J Biol Chem.258 (3): 1399-1402, (1983)), the DNA of three aa joints of coding (comprising the XbaI restriction site that allows required transgenosis to merge), and 3 ' terminator of nopaline synthase gene is (referring to document: Bevanet al.Nucleic Acids Res.11 (2): 369-85 (1983)).Use the rapid method of following multistep to make up this plasmid.With oligonucleotide BamXbaNot-A and BamXbaNot-B annealing, and be connected in advance on the plasmid pUC 18-35S-C4PPDKsGFPnos that BamH I and Not I enzyme were cut (referring to document: Chiu et al.Curr.Biol.6:325 (1996)).With gained plasmid called after pUC 18-35S-C4PPDK-BXNP-nos.24 initial aa of rubisco chloroplast(id) targeting signal and mature protein are to use primer PEATSC and PEATSR amplification to be obtained by the genomic dna that obtains from the light green leaf of pea (Pisum sativum) Progress#9 expansible.With the 0.34kbp fragment cloning of amplification gained to BamH I and the Xba I site of pUC 18-35S-C4PPDK-BXNP-nos, thereby formation plasmid pUC18-35S-C4PPDK-P.t.s.nos.In order from the pea targeting signal, to remove intron, use Sph I and Mfe I digested plasmid pUC18-35S-C4PPDK-P.t.s.nos.Joint P.ts.nointron A and joint P.t.s.nointron B are annealed, and be connected to Sph I and the Mfe I site of pUC18-35S-C4PPDK-P.t.s.nos, thereby construct pUC18-C4PPDK-rbcs-nos.In order to carry out expression of plants, by using QuikChange

Rite-directed mutagenesis test kit (can derive from the Stratagene company that is positioned at California, USA La Jolla city) becomes AAAATGG with existing TCCATGG sequence, makes initiation site from the signal sequence of plasmid pUC 18-C4PPDK-rbcs-nos for the expression of plants optimization to form plasmid pUC-C4PPDK-AAA-RBS-nos.

PCAM (RBCS-connection) is derived from binary vector pCAMBIA2300 (deriving from the Center for Application of Molecular Biology toInternational Agriculture that is positioned at Australian Canberra city), and this pCAM (RBCS-connection) comprises described promotor, signal sequence and the terminator fragment that is used for plasmid pUC 18-C4PPDK-AAA-RB S before.Use the rapid method of following multistep to make up plasmid pCAM (RBCS-connection).By making oligonucleotide IA and IB and 2A and 2B annealing respectively, prepare double-stranded synthetic linker 1 and 2.Utilize unique EcoR I and XhoI site, from plasmid pUC-C4PPDK-AAA-RBS-nos excision described promotor, signal sequence and terminator.1.1kbp fragment and joint 1 and 2 annealing with gained, thereby preparation contains the dna fragmentation of promotor, signal sequence and terminator, and this 5 ' distolateral wing that contains the dna fragmentation of promotor, signal sequence and terminator is Hind III, BsiB I, Pac I, Xho I restriction site and its 3 ' distolateral wing is EcoR I, Pac I, Asc I, Avr II and Sac I site.With Sac I and the Hind III site of gained fragment cloning, thereby construct pCAM (RBCS-connection) to plant conversion carrier pCAMBIA2300.

Prepare pCAM (A) by the phaA gene (referring to document: Peoples and Sinskey, J Biol Chem.264 (26): 15293-7. (1989)) that uses primer AB-F and A-R amplification to derive from pAeT 10.With Xba I and the Pst I site of gained fragment cloning, thereby construct the translation syzygy of the pea targeting signal of phaA gene to pCAM (RBCS-connection).

Make up pCAM (B) by the following method, described method is: the described method that is used to make up pCAM (A) before using, by using primer B-F and AB-R amplification to derive from the phaB gene of pAeT10 (referring to document: Peoples and Sinskey, J Biol Chem.264 (26): 15293-7. (1989)), and with the dna fragmentation of gained be cloned among the pCAM (RBCS-connection).

Make up pCAM (C) by the following method, described method for by use primer C-F and C-R amplification derive from pCMYS106 (a kind of with pUC19 (referring to document: Yanisch-Perronet al, Gene 33:103-119 (1985)) is the plasmid on basis, this plasmid contains the Pseudomonas oleovorans/moving glue bacterium synthase gene (United States Patent (USP) 6 of life branch of hybridization, 316,262) synthase gene).Use Xba I and Nsi I enzyme to cut the PCR product of gained.With the gained fragment cloning to the Xba I of pCAM (RBCS-is connected) and the sticky end place that is complementary in Pst I site, to obtain pCAM (C).

Use two-step approach to make up pCAM (C+A+B).By using 5 ' BstB I and 3 ' AvrII site from pCAM (A), to downcut phaA box, its BstB I site of passivation and this inset is cloned into the AvrII site of pCAM (B) and the Asc I site of passivation, thereby construct pCAM (A+B).By using 5 ' BstB I and 3 ' Avr II site from pCAM (A+B), to downcut phaA and phaB box, its BstB I site of passivation and this inset is cloned into the Avr II of pCAM (C) and the Asc I site Nei Chu of passivation, thereby construct pCAM (C+A+B).This composing type PHB expression vector is named as CAB.

PNEB (greA)-use AscI and Pme I enzyme are cut, from pCAM (A) (referring to document: Kourtz et al, Plant Biotechnol.3:435-447, (2005)) downcut composing type thiolase expression cassette in, it comprises 35S-C4PPDK promotor, plasmid targeting signal, thiolase gene and polyadenylation signal.With Asc I and the Pme I site of gained fragment cloning, to obtain pNEB (A) to pNEB 193 (deriving from the New England Biolabs company that is positioned at Massachusetts, United States Beverly city).Use the Nco I enzyme of HindIII and passivation to cut, from pBL221.9GRE6, downcut glucocorticoid inducible type minimal promoter 6gre-6035SCaMV (referring to document: Martinez et al, Plant is (1999) J.19:97-106).With SmaI and the Hind III site of gained fragment cloning, thereby construct pNEB (greMP) to pNEB 193.Adopt Seamless Cloning ^TMTechnology (deriving from the Stratagene company that is positioned at California, USA La Jolla city) is changed to the constitutive promoter 35SC4PPDK of pNEB (A) inducible promoter of pNEB (greMP).Use primer LK50 and LK51 unique 3 to contain ' and the mode of 5 ' Eam, 11041 restriction sites obtain the induction type minimal promoter by pNEB (greMP) amplification, described primer LK50 and LK51 are as follows:

LK50

(ATTTC CTCTTCAGAGCAGCTATGACCATGATTACGCCAAGCTTCGACTG)(SEQ ID NO：1)，

LK51

(TCGGT CTCTTCATTTCGATACCCGATCCCCCGTGTTCTCTCCAAATG)(SEQ ID NO：2)。

LK52

(TTGCT CTCTTCAAAAATGGCTTCTATGATATCCTCTTCCGCTGTGACAACAGTCAGCCGTGCCTCTAGG)(SEQ ID NO：3)

LK53

(TGGA GCTCTTCACTCGAGTTAATTAATTCGAAAAGCTTGGCACTGGCCG)SEQ ID NO：4

Use primer LK52 and LK53 with the gained fragment by unique 3 ' and 5 ' Eam, 1,104 1 sites as the mode of flank whole pNEB (A) plasmid (comprise carrier main chain, plasmid targeting signal, thiolase gene and polyadenylation signal, but do not comprise the 35S-C4PPDK constitutive promoter) is almost carried out PCR.The PCR reaction is carried out according to the method that the manufacturer advised basically.Use Eam 11041 enzymes to cut gained PCR product, and connect generation pNEB (greA).Identify correct product by screening BamH I site, described site is arranged in the induction type minimal promoter, but is not present in the constitutive promoter.

Use BstB I and Xba I enzyme to cut pCAM (greA), pCAM (greB) and pCAM (greC)-pNEB (greA), thus produce comprise glucocorticoid responsive element (GRE), from the minimum 35S promoter of cauliflower mosaic virus (60MP) with the GRE-60MP-TS fragment of RBCS targeting signal (TS).Go the constitutive promoter of pCAM (A), pCAM (B) or pCAM (C) and targeting signal (referring to document: Kourtz et al, Plant Biotechnol.3:435-447 (2005)) by the excision of BstB I and Xba I enzyme.The gained carrier is connected on the GRE-60MP-TS fragment, thereby produces pCAM (greA), pCAM (greB) and pCAM (greC).

PCAM (CgreAB)-use BstB I and Avr II enzyme are cut, and downcut the induction type thiolase box greA that comprises minimum inducible promoter, signal sequence and thiolase phbA gene from pCAM (greA).Passivation BstB I site, and with the fragment cloning of the viscosity-passivation of gained to the Avr II of pCAM (C) and the Asc I site of passivation, thereby produce pCAM (CgreA).Use identical method, composing type reductase enzyme box is added among the pCAM (CgreA), thereby produce pCAM (CgreAB), pCAM (C) and pCAM (B).

PUC18-C4PPDK-AAA-RBS comprises the 35S-C4PPDK promotor (referring to document: Chiu et al, Curr.Biol.6:325 (1996)), coding is from the DNA of 24 initial aa of the signal peptide of the small subunit of the rubisco of pea and mature protein (referring to document: Coruzzi et al, J Biol Chem.258 (3): 1399-1402 (1983)), the DNA of three aa joints of coding (comprising the XbaI restriction site that allows required transgenosis to merge), and 3 ' terminator of nopaline synthase gene is (referring to document: Bevanet al.Nucleic Acias Res.11 (2): 369-85 (1983)).Use the rapid method of following multistep to make up this plasmid.Oligonucleotide BamXbaNot-A and BamXbaNot-B are annealed, and be connected among plasmid pUC18-35S-C4PPDKsGFPnos (referring to document: Chiu et al, Curr.Biol.6:325 (1996)), described plasmid was formerly cut by BamH I and Not I enzyme.With gained plasmid called after pUC18-35S-C4PPDK-BXNP-nos.24 initial aa of rubisco chloroplast(id) targeting signal and mature protein are to use primer PEATSC and PEATSR amplification to be obtained by the genomic dna that obtains from the light green leaf of pea Progress#9 expansible.With the 0.34kbp fragment cloning of amplification gained to BamH I and the Xba I site of pUC 18-35S-C4PPDK-BXNP-nos, thereby formation plasmid pUC18-35S-C4PPDK-P.t.s.nos.In order from the pea targeting signal, to remove intron, use Sph I and Mfe I digested plasmid pUC18-35S-C4PPDK-P.t.s.nos.Joint P.t.s.nointron A and joint P.ts.nointron B are annealed, and be connected to Sph I and the Mfe I site of pUC 18-35S-C4PPDK-P.t.s.nos, thereby construct pUC18-C4PPDK-rbcs-nos.In order to carry out expression of plants, by using QuikChange Rite-directed mutagenesis test kit (can derive from the Stratagene company that is positioned at California, USA La Jolla city) becomes AAAATGG with existing TCCATGG sequence, thereby form plasmid pUC-C4PPDK-AAA-RB S-nos, make initiation site optimization from the signal sequence of plasmid pUC18-C4PPDK-rbcs-nos.

PCAM (RBCS-connection) is derived from binary vector pCAMBIA2300 (deriving from the Center for Application of Molecular Biology toInternational Agriculture that is positioned at Australian Canberra city), and this pCAM (RBCS-connection) comprises described promotor, signal sequence and the terminator fragment that is used for plasmid pUC 18-C4PPDK-AAA-RBS before.Use the rapid method of following multistep to make up plasmid pCAM (RBCS-connection).By making oligonucleotide IA and IB and 2A and 2B annealing respectively, prepare double-stranded synthetic linker 1 and 2.Utilize unique EcoR I and XhoI site, from plasmid pUC-C4PPDK-AAA-RBS-nos excision described promotor, signal sequence and terminator.1.1kbp fragment and joint 1 and 2 annealing with gained, thereby preparation contains the dna fragmentation of promotor, signal sequence and terminator, and this 5 ' distolateral wing that contains the dna fragmentation of promotor, signal sequence and terminator is Hind III, BstB I, Pac I, Xho I restriction site and its 3 ' distolateral wing is EcoR I, Pac I, Asc I, Avr II and Sac I site.With Sac I and the Hind III site of gained fragment cloning, thereby construct pCAM (RBCS-connection) to plant conversion carrier pCAMBIA2300.

By using primer AB-F and AB-R amplification to derive from the phaA-phaB fusion gene of pTRC (AB) (a kind of plasmid of the phaA-phaB of comprising fusion gene) (referring to document: WO00/06747; Kourtz et al, Plant Biotechnol.3:435-447, (2005)) make up pCAM (AB).With Xba I and the Pst I site of gained fragment cloning, thereby construct the translation syzygy of phaA-phaB gene and pea targeting signal to pCAM (RBCS-connection).

Prepare pCAM (A) by the phaA gene (referring to document: Peoples and Sinskey, J Biol Chem.264 (26): 15293-7. (1989)) that uses primer AB-F and A-R amplification to derive from pAeT 10.Before using the described method that is used for pCAM (AB) with the gained fragment cloning to pCAM (RBCS-connection).

Make up pCAM (B) by the following method, described method is for by using primer B-F and AB-R amplification to derive from the phaB gene of pAeT 10 (referring to document: Peoples and Sinskey, J Biol Chem.264 (26): 15293-7. (1989)), the described method that is used for making up pCAM (AB) is cloned into pCAM (RBCS-connection) with the dna fragmentation of gained and before using.

Derive from the synthase gene of pCMYS106 (referring to document: Kourtz, et al., (2005) Plant Biotechnol.3:435-447) by using primer C-F and C-R to increase, thereby construct pCAM (C).Use Xba I and Nsi I enzyme to cut this PCR product.With the gained fragment cloning to the sticky end that is complementary in the Xba I of pCAM (RBCS-is connected) and Pst I site on, thereby construct pCAM (C).

Downcut the phaA-phaB box by using 5 ' BstB I and 3 ' Avr II site to go up, thereby construct pCAM (C+AB) by pCAM (AB).The Avr II of pCAM (C) and the Asc I site of passivation also are cloned into the dna fragmentation of gained in passivation BstB I site.

Use two-step approach to make up pCAM (C+A+B).By using 5 ' BstB I and 3 ' Avr II site from pCAM (A), to downcut phaA box, its BstB I site of passivation and the inset of gained is cloned into the Avr II site of pCAM (B) and the Asc I site of passivation, thereby construct pCAM (A+B).By using 5 ' BstB I and 3 ' Avr II site from pCAM (A+B), to downcut phaA and phaB box, its BstB I site of passivation and this inset is cloned into the Avr II of pCAM (C) and the Asc I site Nei Chu of passivation, thereby construct pCAM (C+A+B).

PCAM (greCgreAgreB)-use BstB I and Avr II enzyme are cut, and downcut the induction type thiolase box greA that comprises minimum inducible promoter, signal sequence and thiolase phbA gene from pCAM (greA).Passivation BstB I site and with the fragment cloning of gained viscosity-passivation to the Avr II of pCAM (greC) and the Asc I site of passivation, thereby produce pCAM (greCgreA).Use identical method, induction type reductase enzyme box is added among the pCAM (greCgreA), thereby produce pCAM (greCgreAgreB).

PNEB (e35Sgrvhnos)-use BamH I enzyme is cut, from pMF6GRVP16HEcR, downcut and comprise glucocorticosteroid DNA in conjunction with the territory, the chimeric ecdysone receptor of VP 16 trans activation domains and Heliothis virescens (Heliothis virescens) ecdysone receptor, wherein said pMF6GRVP16HEcR is that a kind of pMF6 that comprises intron of pGRVHEcR plasmid is (referring to document: Goff et al, (1990), EMBO J 9:2517-2522) derivative, as Martinez and as described in working together (referring to document: Martinez et al, (1999b) Plant J " 19:97-106).With the BamH I site of gained fragment cloning, thereby produce pNEB (grvh) to pNEB193.The BstXI enzyme that uses Nco I and be used for passivation is cut, and scales off double enhancing promotor 35S from cauliflower mosaic virus (e35S CaMV) promotor from pCAM2300 (deriving from the GAMBIA company that is arranged in Australian Canberra city).With EcoR V and the Nco I site of gained fragment cloning, thereby construct pNEB (e35Sgrvh) to pNEB (grvh).By using Asc I enzyme 3 ' Asc I site of described carrier down earnestly, re-using dna polymerase i Klenow fragment carries out passivation, then, uses T4DNA ligase enzyme connection carrier again, thereby constructs pNEB (e35Sgrvh Δ AycI).Use oligonucleotide nosF and nosR, remove 3 ' UTR of nopaline synthase gene by PCR from pMF6GRVP16HEcR, described oligonucleotide nosF and nosR are as follows:

nosF

(CCTTAATTAACTCGAGGAATTCATCGATTCCGCGGGTACCGAG)(SEQ ID NO：5)，

nosR

(GCTCTAGACCTAGGGGCGCGCCAGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCG)(SEQ ID NO：6)。These primers are with in 5 ' Pac I site and 3 ' Asc I, Avr II and the Xba I site introducing no fragment.With Pac I and the Xba I site of gained PCR product cloning, thereby construct pNEB (e35Sgrvhnos) to pNEB (e35SgrvhA4M).

PCAM (CgreABgrvh) and pCAM (greCgreAgreB grvh)-cut by the Spe I enzyme of Avr II and passivation, from pNEB (35S-grvh-nos), downcut the effector box that comprises chimeric ecdysone receptor, constitutive promoter and polyadenylation sequence.With the gained fragment cloning in the Asc I site of the Avr II of pCAM (CgreAB) and pCAM (greCgreAgreB) and passivation, thereby produce pCAM (CgreABgrvh) and pCAM (greCgreAgreBgrvh).

Embodiment 2: the conversion of plant and inducing

The needed gene of complete approach that PHB is produced (comprises β-Tong Liuxiemei (thiolase), the gene of NADPH Acetoacetyl-CoA reductase (reductase enzyme) and pha synthesizing enzyme (synthetic enzyme)) places respectively under the regulation and control of 35S moulting hormone induction type minimal promoter, gained gene and plasmid targeting signal are merged, and be cloned into the polygene plasmid that comprises chimeric ecdysone receptor based on pCAMBIA (can derive from the Centre for Application of Molecular Biologyto International Agriculture that is positioned at Australian Canberra city) (referring to document: A.Martinez, C.Sparks, CA.Hart, J.Thompson, I.Jepson, Plant J.19:97, (1999)).This three gene induced type constructs are named as 31.The single-gene induction type construct that is named as II comprises the thiolase under the regulation and control that are in inducible promoter, but it is different with described 31 constructs, it expresses reductase enzyme and synthase gene (referring to document: W.Chiu et al under the regulation and control of composing type 35S-C4PPDK promotor, Curr.Biol.6:325, (1996)).

According to Clough and the described method of Bent (referring to document: SJ.Clough, A.F.Bent, Plant is (1998) J.16:735) conversion of the Arabidopis thaliana that carries out is as follows: use plasmid DNA to transform soil bacillus strain GV3101/pMP90 (referring to document: Koncz and Schell, MoI.Gen.Genetics 204:383-396 (1986)) electroreception attitude cell, and on the LB flat board that contains gentamicin and kantlex, separate single bacterium colony.Under 20 ℃, 70% humidity and illumination in 16 hours and 8 hours dark round-robin conditions, Arabidopis thaliana thalianaColumbia CoI-O (deriving from the LehleSeeds company that is arranged in Texas, USA Round Rock city) is grown at soil.Use Clough and Bent at Plant J.16: the agrobacterium-mediated flower-dipping method described in the 735th page (1998) transforms plant.Results are from the seed of ripe silique, with its sterilization, and place on the selectivity flat board that contains the organic substantially substratum of 1A x Murashige (deriving from the Life Technologies company that is positioned at Maryland, USA Rockville city), 0.7% agar, Ix Gamborg ' s vitamin B5 (deriving from the Sigma company that is positioned at Missouri, USA St.Louis city) and kantlex (50 μ g/mL).Should flat board 4 ℃ of incubations 2 days, then it is transferred under 20 ℃, 70% humidity and illumination in 16 hours and the 8 hours dark cycling conditions.After 7 days, the kalamycin resistance seedling of green is moved in the soil, and at incubation under the identical growth conditions till plant is suitable for analyzing.

Make arabidopsis thaliana growth, till they reach full-size under the conventional growth conditions.When reaching maturation in about 30 days, use inductor to apply this plant of processing through root dipping or blade face.Used inductor comprises RH-5992, Mimic

And Intrepid

Can use commercially available sterilant Mimic

And Intrepid

(can derive from UAP Timberland company that is positioned at U.S. Arkansas State Monticello city and the Polina Chemical Compounds company that is positioned at Massachusetts, United States Hatfield city) as inductor, this is because their activeconstituentss (RH-5992 and methoxyfenozide) separately are non-steroid moulting hormone analogue.The root pickling process is included in 1A x Hoaglands fertilizer solution (deriving from the Sigma company that is arranged in Missouri, USA St.Louis city) inductor is diluted to required concentration, and 10mL gained solution is applied directly in the soil of each strain arabidopsis thaliana.Apply in the method on the blade face, at first use 1A x Hoaglands fertilizer solution washing plant.Inductor after will diluting then directly sprays on the blade face of arabidopsis thaliana, and is saturated and have drop to drip up to the blade face.The root dipping of inductor and blade face apply repeats twice weekly, carries out for three weeks, bears seed up to plant.

Embodiment 3: the analysis of plant PHB and extraction

Implement to use the painted fluorescence microscopy of Nile blue (referring to document: Poirier et al, Science 256:520-523, (1992)) according to described method before, but some modifications are arranged.Use razor blade unfertile land cutting leaf texture as far as possible, and be 8 the 0.1MKH that is at pH ₂PO ₄In 3% paraformaldehyde (deriving from the Electron Microscopy Sciences company that is arranged in Pennsylvania, United States Ft.Washington city) fix 3 hours.Wash fixed sample with water, and at room temperature dyeed 5 minutes through filtering 1% Nile blue (deriving from the Sigma company that is positioned at Missouri, USA St.Louis city) solution before using.Wash sample then with water, and use 8% acetic acid decolouring.Water is twice of washing sample again.By the fluorescence microscopy observation sample, wherein said 2Ox Ph-I lens have used following filtering apparatus: excitor HQ545/30, optical splitter Q5701p, projector D590/20 (deriving from the Chroma Technology company that is positioned at Vermont ,Usa Brattleboro city) on the Zeiss Axiolab opticmicroscope that Zeiss HBO100 fluorescence annex and 2Ox Ph-I lens are housed.By having used the Zeiss MC 80DX photomicroscope document image of Kodak Elite Chrome 100 films.

Basically carry out the analysis of vegetable polymer according to the described method of people such as Kourtz (referring to document: Kourtz et al, Plant Biotechnol.3:435-447 (2005)), but have following modification.Using butanols to decompose to make exsiccant vegetable material derivatize and make before water removing impurity, save the initial step that relates to the vegetable material pre-wash.The Agilent 5973GC/MS of the selected ion monitoring pattern of being in of DB-225MS post and safety guard is equipped with in use, by the organic phase of vapor-phase chromatography/analytical reagent composition gained.The selected ion of 3-hydroxybutyric acid butyl ester is 87amu, 89amu and 43.1amu.

For PHB extracts, induction type T ₄31 arabidopsis thalianas are processed into the Intrepid that the blade face applies 0.5mM

Before the anhydrous scheme of the standard of use is extracted PHB, obtain tissue and make its drying.

Embodiment 4: the productive rate of PHB in treated and undressed Ti II and 31 arabidopsis thalianas

Adopt the blade face to apply 0.5mM Intrepid

Method to the first-generation T of 86 strains, 30 ages in days ₁The T of transgenosis maturation plant and 108 strains, 30 ages in days ₁Whole plant of transgenosis maturation plant are handled or they are not handled, the first-generation T of wherein said 86 strains, 30 ages in days ₁The transgenosis maturation plant is to use one of II construct to transform, and the T of described 108 strains, 30 ages in days ₁The transgenosis maturation plant is to use 31 constructs to transform.

By using inductor to handle, the plant that three gene induced type constructs 31 take place to express has accumulated the PHB up to 10dwt%.What is interesting is, produce the maximum 31 treated plants of PHB yellows takes place in inducing process, but in untreated plant, do not observe this phenotype.Untreated 31 plants can not accumulate the PHB that is higher than 0.37dwt%, and the treated plant that the identical construct of their average specifics takes place to express produces the PHB (referring to Table I) of 6 times of dwt% less.

In contrast be, use II construct plant transformed can not accumulate the PHB of high level, this plant inductor exist or non-existent condition under produce the PHB (referring to Table I) that is less than 0.039dwt%.This result is unexpected, and this is because the induction type thiolase box of II construct has participated in producing the PHB of high level in 31 plants.In addition, show before that under the condition that the composing type thiolase exists, the composing type reductase enzyme of II construct and synthetic enzyme box can catalysis composing type arabidopsis thaliana produce the PHB of 11.5dwt%.By screening 235 other strain T ₁The II plant is to the further analysis revealed of II construct, and under the condition of the foliage applying that carries out and do not carry out the inductor RH-5992, plant can produce the PHB of 2.5dwt% and 2.6dwt% respectively.By T to optimum ₁The 72 strain filial generation T of II plant ₂Analyze, confirmed that described construct has the ability that can promote the PHB generation with the pattern of non-induction type.Inductor exist and the condition of not depositing under, treated and undressed T ₂The II plant has accumulated the PHB of average out to 4.2 ± 2.5dwt% and 4.7 ± 1.4dwt% respectively.In sum, unless these results show that the full gene of PHB generation approach is induced simultaneously, otherwise the production of best induction type PHB can not take place.

Table I. the productive rate of PHB in treated and undressed Ti II and 31 arabidopsis thalianas.Treated plant applies the Intrepid of 0.5mM through the blade face

Table I also shows mean error and standard error.

Transgenic plant strain system	Sample size (n)	Disposition	The average total content (dwt%) of PHB	The mean P HB (dwt%) of three best strain plants	The maximum output of PHB (dwt%)
Transgenic plant strain system	Sample size (n)	Disposition	The average total content (dwt%) of PHB	The mean P HB (dwt%) of three best strain plants	The maximum output of PHB (dwt%)	II	27	Be untreated	0.009±0.005	0.021±0.007	0.025
II	59	Treated	0.019±0.010	0.038±0.001	0.039	II	27	Be untreated	0.009±0.005	0.021±0.007	0.025
II	59	Treated	0.019±0.010	0.038±0.001	0.039
31	27	Be untreated	0.110±0.084	0.288±0.073	0.367
31	27	Be untreated	0.110±0.084	0.288±0.073	0.367	31	81	Treated	0.661±1.487	7.708±2.072	10.055

Embodiment 5: through 0.1mM Mimic

Dipping or the undressed T of root ₂The raising of PHB output in the tender tissue of 31 plants

31 plants are used the Mimic of 0.1mM

Handle (referring to document: E.Unger et al, Trans.Res.11,455 (2002) by root dipping (this technology is considered to promote by root the assimilation of ecdysteroids); Schena et al, Proc.Natl.Acad.Sci.USA 88,10421 (1991)).The plant that selection is used for this research comprises the T of 31

plants

7,11 and 12 ₂Filial generation.Shown when using 1mM Mimic

When spraying, these T ₁31 plants have accumulated the PHB of about 2dwt%.

T ₂The phenotypic analysis of plant shows that undressed strain is that 7 plants keep green and healthy in 18 days process.In contrast be, the strain of root dipping is the yellows phenotype that the leaf in young age of 7 plants shows as dwarfing, and this phenotype has the feature of the high-load PHB of whole leaf texture composition ground generation of plant (referring to document: K.Bohmert et al, Planta211,841, (2000)).At initial application Mimic

12 days in, along with the plant of green and healthy normal size produces unusual less yellow blade, the treated described phenotype that inducible plant showed becomes obviously very soon.Strain be 11 and strain be that 12 plant has also obtained similar result.Phenotypic this variation can not be directly owing to Mimic And the negative reaction of composition, this is because the control plant that uses empty carrier pCAM 2300 to transform is using Mimic

Carry out still remaining green and health in the process of root dipping.In addition, the composing type control plant (CAB) of producing PHB keeps yellows in treating processes, produces children's leaf in age with old leaf texture proportionally, and shows and the similar phenotype of undressed CAB plant.In sum, these data show use Mimic

Carry out root dipping and induced and be used to produce the required expression of gene of PHB, and these data show that also increase that the PHB that caused produces has caused the generation of unusual less yellows leaf.

Aforesaid these plants are carried out the GC/MS quantitative analysis.Undressed strain is that 7,11 and 12 plants contain the PHB that is less than 2dwt%, but has accumulated the PHB (referring to Table II) that surpasses 14dwt% in the leaf in the young age of the treated plant that is from same strain.Average computation, T ₂31 strains are that viewed dwt%PHB content is 12 times of dwt%PHB content detected in the tender tissue from the undressed plant of same strain system in the tender tissues of 7 plants.T ₂31 strains are that 11 and 12 plants have also obtained similar result, and it is 14 times of undressed tender tissue that these plants show as PHB accumulation volume in the leaf in treated young age.To independent strain is that the detection of the polymer content in 7 plants shows that at the root dipping content of the PHB in children's leaf in age is increased to 37 times (referring to Table III) after 21 days.Be to have write down polymer output in 11 and 12 the treated tender tissue to be increased to 179 times and 316 times (referring to Table III) respectively from strain.Average computation is from treated T ₂Strain is 7,11 to have accumulated 1.7 times, 2.8 times and 2.0 times PHB (referring to Table II) than old tissue from identical plant respectively with the tender tissue of 12 plants.For example, best T ₂11 plants of strain system have accumulated in the leaf in treated young age and have surpassed the PHB of 14dwt%, but have only accumulated the PHB (referring to Table II) of 7.0dwt% in than old tissue.

Table II. from using 0.1mM Mimic

Carry out dipping or the undressed T of root ₂31 plants collect young age leaf and Lao Ye in PHB content

Table II shows the productive rate of the PHB of best plant.Table II shows the mean error and the standard error of the PHB content of 10 samples.

Table III. use 0.1mM Mimic

Carry out dipping or the undressed T of root ₂The raising of PHB output in the tender tissue of 31 plants

Embodiment 6: the Mimic that working concentration increases

And Intrepid

Carry out the T that root dipping and blade face apply ₃The yield of PHB in 31 plants

The Mimic that working concentration increases T to the best ₂31 plant strains are that the root dipping is carried out in the filial generation of 7-32,7-39,11-106,11-108,12-113 and 12-119.By adding the such a spot of Mimic of 0.01mM

Induce the generation polymkeric substance, but with the Mimic of 0.1mM (strain is 7-32,7-39 and 11-106) or 1.0mM (strain is 11-108,12-113 and 12-119)

Handle and make the output of PHB increase (referring to Fig. 7 A).For example, when not having inductor, strain is that 11-108 can not produce PHB, but at the Mimic that uses 0.01mM and 1mM respectively

When handling, strain is that 11-108 has on average accumulated 1.94 ± 0.44% and the PHB of 3.13 ± 0.38dwt%.When inductor did not exist, to be that the accumulation content of polymkeric substance among 7-32 and the 7-39 is low showed that these strains systems are producer seepages in strain.

Using Intrepid

Carry out having obtained similar result in the experiment of root dipping.Using 0.01mM Intrepid

The content of the PHB that produces when handling is lower, but is to use the Intrepid of 0.1mM (strain is 11-106), 0.5mM (strain is 12-119) and 1.0mM (strain is 7-32)

Can get the PHB (referring to Fig. 7 B) that productive rate improves.For example, strain is that the mean P HB content of 12-119 plant is increased to respectively by 0.43 ± 0.17dwt%PHB in the undressed plant and uses 0.1mM Intrepid

2.12 ± 0.60dwt%PHB in the plant of flooding and use 0.50mM Intrepid

4.02 ± 0.82dwt%PHB in the plant of flooding.In all cases, using Intrepid

The output of carrying out the polymkeric substance in the plant of root dipping all surpasses through Mimic

The output (referring to Fig. 7 A-B) of observed polymkeric substance in the plant of handling.This discovery, again in conjunction with the precognition of methoxyfenozide than highly water-soluble, can show that the blade face applies Intrepid

Can induction ratio use Intrepid And Mimic

The root dipping technique in viewed more high-load PHB.

Use 0 to 1.0mM Intrepid

Handle T by foliage applying ₃31 strains are 7-32,11-106 and 12-119.Use the Intrepid of 0.5mM

Being enough to the inducing plant strain is that 7-32 and 11-106 reach the highest polymer yield, but needs the Intrepid of 1.0mM

The inducing plant strain is that 12-119 reaches maximum PHB productive rates (referring to Fig. 7 C).For example, strain is that the mean P HB content of 7-32 plant is increased to respectively by 1.65 ± 0.23dwt%PHB in the undressed plant and uses 0.1mM Intrepid

2.59 ± 0.41dwt%PHB in the plant of spraying and use 0.5mM Intrepid

7.57 ± 2.60dwt%PHB in the plant of spraying.Using 0.5mM Intrepid

When spraying, best T ₃The PHB of the tired 11.5dwt% of plant (being named as 31-7-32-5) codeposition.In general, use Intrepid

Carry out the blade face and apply the plant of processing than using Mimic

Perhaps Intrepid

The plant that carries out the root dipping has accumulated more PHB (referring to Fig. 7 A-C).The 31-7-32-5 plant does not show its parent's tangible dwarfing yellows children leaf phenotype in age, but the 31-7-32-5 plant is at the yellows children leaf in age of normal size relatively with accumulated PHB in the leaf middle age.Aged leaf obviously keeps green, but shows some yellows feature of producing PHB really.

In sum, these results show by the careful raising of selecting plant (combining with the optimum mode of concentration, composition and the applying method of inductor) can make the overall yield of polymkeric substance of repeatedly going down to posterity.In addition, these results confirm that applying commercially available sterilant by the blade face can induce the related whole approach of PHB that produces.

Sequence table

＜110〉Metabolix Inc. (Metabolix, Inc.)

＜120〉chemically inducible expression of biosynthetic pathway

<130>VI-071122-59：57

<150>US 60/662,235

<151>2005-03-16

<150>US 60/669,766

<151>2005-04-08

<160>6

<170>Patentln version 3.3

<210>1

<211>49

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide primer thing

<400>1

atttcctctt cagagcagct atgaccatga ttacgccaag cttcgactg 49

<210>2

<211>47

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>2

tcggtctctt catttcgata cccgatcccc cgtgttctct ccaaatg 47

<210>3

<211>69

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>3

ttgctctctt caaaaatggc ttctatgata tcctcttccg ctgtgacaac agtcagccgt 60

gcctctagg 69

<210>4

<211>49

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>4

tggagctctt cactcgagtt aattaattcg aaaagcttgg cactggccg 49

<210>5

<211>43

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>5

ccttaattaa ctcgaggaat tcatcgattc cgcgggtacc gag 43

<210>6

<211>73

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer

<400>6

gctctagacc taggggcgcg ccagatctag taacatagat gacaccgcgc gcgataattt 60

atcctagttt gcg 73

Claims

1. recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises two or more elements, wherein each element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

2. the described recombinant vectors of claim 1, wherein the described inducible promoter in each element is selected from tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter.

3. the described recombinant vectors of claim 2, wherein said promotor is that described compound is selected from by the moulting hormone inducible promoter of compound activating: moulting hormone, RH-5992, methoxyfenozide, curtain multitude sterone A, ponasterone A, insect steroid hormone 20-hydroxyecdysone and cage cover β-moulting hormone.

4. the described recombinant vectors of claim 1, wherein the described promotor in each element is identical promotor.

5. the described recombinant vectors of claim 1, wherein the described promotor in each element is different promotor.

6. the described recombinant vectors of claim 1, wherein said two or more elements comprise the nucleotide sequence of coded protein, and described protein is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

7. the described recombinant vectors of claim 1, wherein said two or more elements comprise the nucleotide sequence of coded protein, and described protein is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

8. recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence.

9. recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises two or more elements, wherein each element 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

10. claim 8 or 9 described recombinant vectorss, wherein said nucleic acid sequence encoding protein, described protein is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

11. claim 8 or 9 described recombinant vectorss, wherein said nucleic acid sequence encoding protein, described protein is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

12. claim 8 or 9 described recombinant vectorss, wherein said promotor are that tsiklomitsin is replied the type promotor.

13. recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises two or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least one described element 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, it is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence.

14. recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises three or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least two described elements respectively 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

15. claim 13 or 14 described recombinant vectorss, wherein said inducible promoter is selected from: tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter; Described activator molecule or mixture are tsiklomitsin regulation and control type trans-activators; And described is that tsiklomitsin is replied the type promotor by activator molecule or mixture activatory promotor.

16. claim 13 or 14 described recombinant vectorss, wherein the described protein by described nucleic acid sequence encoding is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

17. claim 13 or 14 described recombinant vectorss, wherein the described protein by described nucleic acid sequence encoding is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-δ-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

18. one kind is used for any described carrier in the claim 8,9,13 or 14 that plant is expressed.

19. a transformed plant cells, this transformed plant cells comprises two or more elements, wherein each element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

20. the described transformed plant cells of claim 19, wherein the described inducible promoter in each element is selected from: tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter.

21. the described transformed plant cells of claim 20, wherein said promotor is that described compound is selected from by the moulting hormone inducible promoter of compound activating: moulting hormone, RH-5992, methoxyfenozide, curtain multitude sterone A, ponasterone A, insect steroid hormone 20-hydroxyecdysone and cage cover β-moulting hormone.

22. the described transformed plant cells of claim 19, wherein the described promotor in each element is identical promotor.

23. the described transformed plant cells of claim 19, wherein said promotor are the moulting hormone inducible promoters.

24. the described transformed plant cells of claim 19, wherein the described promotor in each element is different.

25. the described transformed plant cells of claim 19, wherein said two or more elements comprise the nucleotide sequence of codase, and described protein is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

26. the described transformed plant cells of claim 19, wherein said two or more elements comprise the nucleotide sequence of codase, and described enzyme is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

27. transformed plant cells, this transformed plant cells comprises the recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence.

28. transformed plant cells, this transformed plant cells comprises the recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises two or more elements, wherein each element 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

29. claim 27 or 28 described transformed plant cells, wherein said nucleic acid sequence encoding protein, this protein is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

30. claim 27 or 28 described transformed plant cells, wherein said nucleic acid sequence encoding protein, this protein is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

31. claim 27 or 28 described transformed plant cells, wherein said promotor are that tsiklomitsin is replied the type promotor.

32. transformed plant cells, this transformed plant cells comprises the recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises two or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, this promotor are used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least one described element 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence.

33. transformed plant cells, this transformed plant cells comprises the recombinant vectors that is used in the expression of the enzyme of biosynthetic pathway, this recombinant vectors comprises three or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least two described elements respectively 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence.

34. claim 32 or 33 described transformed plant cells, wherein said inducible promoter is selected from: tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter; Described activator molecule or mixture are tsiklomitsin regulation and control type trans-activators; And described is that tsiklomitsin is replied the type promotor by activator molecule or mixture activatory promotor.

35. claim 32 or 33 described transformed plant cells, wherein the described protein by described nucleic acid sequence encoding is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

36. claim 32 or 33 described transformed plant cells, wherein the described protein by described nucleic acid sequence encoding is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

37. a method that is used for making plant biosynthetic products, this method comprises:

A) with in the recombinant vectors introduced plant, described recombinant vectors comprises two or more elements, wherein each element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence; And

B) use inductor to activate described inducible promoter.

38. the described method of claim 37, wherein the described inducible promoter in each element is selected from: tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter.

39. the described method of claim 38, wherein said inducible promoter is that described compound is selected from by the moulting hormone inducible promoter of compound activating: moulting hormone, RH-5992, methoxyfenozide, curtain multitude sterone A, ponasterone A, insect steroid hormone 20-hydroxyecdysone and cage cover β-moulting hormone.

40. the described method of claim 37, wherein the described promotor in each element is identical promotor.

41. the described method of claim 37, wherein the described promotor in each element is different promotor.

42. the described method of claim 37, wherein said inducible promoter are by the chemicals activatory that sprays through the blade face or root floods.

43. the described method of claim 37, wherein said biosynthetic products is poly-hydroxyl alkanoates, and described two or more elements comprise the nucleotide sequence of coded protein, and described protein is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

44. the described method of claim 37, wherein said biosynthetic products is the oil through modification, and described two or more elements comprise the nucleotide sequence of coded protein, and described protein is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

45. a method that is used for making plant biosynthetic products, this method comprises:

A) with in two or more recombinant vectors introduced plants, wherein at least one described recombinant vectors 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least one described recombinant vectors 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence; And

B) use inductor to activate described inducible promoter.

46. a method that is used for making plant biosynthetic products, this method comprises:

A) with in two or more recombinant vectors introduced plants, wherein at least one described recombinant vectors 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least one described recombinant vectors comprises two or more elements, wherein each element respectively 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence; And

B) use inductor to activate described inducible promoter.

47. a method that is used for making plant biosynthetic products, this method comprises:

A) with in the single recombinant vectors introduced plant, described single recombinant vectors comprises two or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least one described element 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct two or more nucleotide sequences to transcribe; Two or more are the nucleotide sequence of coded protein respectively; And 3 ' polyadenylation signal sequence; And

B) use inductor to activate described inducible promoter.

48. a method that is used for making plant biosynthetic products, this method comprises:

A) with in the single recombinant vectors introduced plant, described single recombinant vectors comprises three or more elements, wherein at least one described element 5 ' to 3 ' direction, be operably connected: inducible promoter, it is used to instruct nucleotide sequence of one or more coding activator molecule or mixture to transcribe; The nucleotide sequence of one or more coding activator molecule or mixture; And 3 ' polyadenylation signal sequence; And at least two described elements respectively 5 ' to 3 ' direction, be operably connected: by activator molecule or mixture activatory promotor, this promotor is used to instruct nucleotide sequence to transcribe; The nucleotide sequence of coded protein; And 3 ' polyadenylation signal sequence; And

B) use inductor to activate described inducible promoter.

49. any described method among the claim 45-48, wherein said biosynthetic products is poly-hydroxyl alkanoates, and is selected from by the described protein of described nucleic acid sequence encoding: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

50. any described method among the claim 45-48, wherein said biosynthetic products is the oil through modification, and is selected from by the described protein of described nucleic acid sequence encoding: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

51. any described method among the claim 45-48, wherein said inducible promoter are selected from tsiklomitsin inducible promoter, Stapyocine inducible promoter, pathogen-inducible promoter, glucocorticoid inducible type promotor, estrogen-induced type promotor, copper inducible type promotor, herbicide-safener inducible promoter, alcohol induced type promotor, sec.-propyl-β-D-1-thiogalactoside inducible promoter, pathogen-inducible promoter and moulting hormone inducible promoter; Described activator molecule or mixture are tsiklomitsin regulation and control type trans-activators; And describedly be selected from by activator molecule or mixture activatory promotor: tsiklomitsin is replied type promotor, Stapyocine inducible promoter.

52. any described method among the claim 45-47, wherein the described protein by described nucleic acid sequence encoding is selected from: β-Tong Liuxiemei, Acetoacetyl-CoA reductase, PHB synthetic enzyme, pha synthesizing enzyme, threonine dehydra(ta)se, dehydratase, isomerase, propionyl coenzyme A synthetic enzyme, hydroxyl acyl-CoA synthetase, hydroxyl acyl coenzyme A transferring enzyme, thioesterase, fatty acid synthetase and lipid acid tryptophan side-chain alpha.

53. any described method among the claim 45-48, wherein the described protein by described nucleic acid sequence encoding is selected from: thioesterase, δ-9-desaturase, ω-3-desaturase, ω-6-desaturase, fatty acid prolonging enzyme, hydroxylase and triacylglycerol biosynthetic enzyme.

54. any described method among the claim 45-48, wherein said inducible promoter are by the chemicals activatory that sprays through the blade face or root floods.