CN101177687B - 1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof - Google Patents
1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof Download PDFInfo
- Publication number
- CN101177687B CN101177687B CN2007101717581A CN200710171758A CN101177687B CN 101177687 B CN101177687 B CN 101177687B CN 2007101717581 A CN2007101717581 A CN 2007101717581A CN 200710171758 A CN200710171758 A CN 200710171758A CN 101177687 B CN101177687 B CN 101177687B
- Authority
- CN
- China
- Prior art keywords
- ammediol
- gene
- isozyme
- mutated
- variant gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a 1, 3-propanediol oxidoreductase isozyme mutated gene and application thereof. By utilizing error-prone PCR technique-mediated random mutation, the1, 3-propanediol oxidoreductase isozyme mutated gene is obtained by screening. The codon GAC of the No. 99 aspartic acid in the gene is mutated as the codon CAA of glutamine; the codon AAC of the No. 147 asparaginate is mutated as histidine CAC; a nucleotide sequence of the mutated gene is SEQ ID No.1, and is capable of being encoded as 1, 3-propanediol oxidoreductase mutated isozyme. The invention creates 1, 3-propanedioloxidoreductase mutated isozyme that has relatively high catalytic activity to 3-Hydroxypropionaldehyde and can catalyze the 3-hydroxypropionaldehyde to produce chemical raw material 1, 3-propanediol.Compared with the 1, 3-propanediol reducase isozyme, the activity of one of the tested cases is increased by 4 to 4.6 times, which provides broad application prospect for bio-transformed production chemical material 1, 3-propanediol.
Description
Technical field
The genetic engineering bacterium that the invention belongs in the biochemical industry produces 1, the technical field of ammediol industrial chemicals, be specifically related to a kind of 1, ammediol oxidoreductase isozyme variant gene and uses thereof.
Background technology
1, ammediol is important solvent and industrial chemicals, can be used to the polycondensates such as polyester, urethane of synthetic excellent property as monomer with it.Recently, because with 1, ammediol and terephthalic acid are that monomer synthetic polytrimethylene terephthalate (PTT) has very unique character, so many research organizations pay much of being gone abroad.At present, chemical method synthesizes 1, and the ammediol patent is had by Dutch shell (Shell) chemical company and German Degussa.And bio-transformation synthesizes 1, and the ammediol patent is then obtained by Dupont (DuPont) company and German national biotechnology center.Unite to have applied for glucose being substrate with genetic engineering bacterium direct production 1, the patent of ammediol as E.I.Du Pont Company in 1999 and second-biggest-in-the-world industrial enzyme manufacturer Genencor company.It is low that biotransformation method has power consumption, can utilize renewable resources, cleaner production, low cost and other advantages, but since in the microbial metabolism approach with synthetic 1, the catalytic efficiency of ammediol involved enzyme is low, up to now, biosynthesizing 1, the output of ammediol still can't be compared with the output of chemical synthesis.At bio-transformation glycerine synthetic 1, in the pathways metabolism of ammediol, need glycerol dehydratase and 1, the ammediol oxydo-reductase, wherein glycerol dehydratase is responsible for transformation of glycerol is become intermediate product 3-hydroxy propanal, and 1, the ammediol oxydo-reductase then is responsible for the 3-hydroxy propanal being converted into 1, ammediol.Because 1, ammediol oxydo-reductase catalytic activity in catalytic process is very poor, has seriously limited bio-transformation and synthesized 1, the scale operation of ammediol.There is one 1 in recent findings in the e. coli k-12 body, the isozyme of ammediol oxydo-reductase (its corresponding gene is yqhD), be to replace 1 in the glycerine pathways metabolism, ammediol redox enzyme catalysis intermediate product 3-hydroxy propanal generates 1, another key enzyme of ammediol, replace 1 by it, the catalytic efficiency of ammediol oxydo-reductase is apparently higher than 1, the catalytic efficiency of ammediol oxydo-reductase.But present 1, the catalytic capability of ammediol oxidoreductase isozyme is high not enough, extensive industrialization biosynthesizing 1, and ammediol also has certain difficulty.
Summary of the invention
The purpose of this invention is to provide a kind of 1, ammediol oxidoreductase isozyme variant gene and uses thereof, overcome existing 1, ammediol oxydo-reductase poor catalytic activity in catalytic process, seriously restrict bio-transformation and synthesized 1, the shortcoming of ammediol scale operation.
1, ammediol oxidoreductase isozyme variant gene and uses thereof, it is characterized in that: the random mutation that utilizes the mediation of fallibility round pcr, obtain 1 by certain screening, the ammediol oxidoreductase isozyme variant gene, this is 1 years old, the codon GAC of the 99th aspartic acid of coding (Asp) sports the codon CAA of glutamine (Gln) and the codon AAC of the 147th l-asparagine of coding (Asn) sports the codon CAC of Histidine (His) in the ammediol oxidoreductase isozyme gene, obtain 1, ammediol oxidoreductase isozyme variant gene Asp
99→ Gln, Asn
147This variant gene nucleotides sequence of → His. is classified SEQID No.1 as, codified 1, and the ammediol oxydo-reductase is with worker's variant enzyme.
Described 1, the ammediol oxidoreductase isozyme variant gene is recombinant expressed 1 by genetic engineering technique, and the ammediol oxydo-reductase can be used for catalysis 3-hydroxy propanal and generates 1, ammediol with worker's variant enzyme.
The present invention adopts fallibility PCR orthogenesis evolution of technology 1, the ammediol reductase isoazyne, according to 1, a pair of primer of the gene design of ammediol reductase isoazyne, the concentration by reducing a kind of or two kinds of dATP dGTP dCTP dTTP among the conventional P CR and add a certain amount of MnCl
2Adopt the TaqDNA polysaccharase of low fidelity simultaneously, make gene when amplification to a certain extent random error introduce and obtain the mutator gene library, and obtain a kind of variant gene by certain screening method, by this design philosophy, with pET28 α (+) yqhD as template DNA, adopt fallibility PCR orthogenesis technology to obtain the fallibility pcr amplification product, behind NheI-BamHI double digestion fallibility pcr amplification product, extracting size is about the gene product of 1164bp and carries out ligation with linear plasmid pET28 α that size behind the same enzyme double digestion is approximately 5300bp, after finishing, connection will connect among the product Transformed E .Coli Novablue, be applied to and contain on the 40 μ g/ml kantlex LB agar plates, 37 ℃ of incubated overnight obtain corresponding mutant library.Picking clone is inoculated into 300 μ L and contains in 96 microwell plates of LB liquid nutrient medium of 40 μ g/mL kantlex from mutant library, 37 ℃ of incubated overnight, get this incubated overnight liquid of 40 μ L and join 800 new μ L and contain in 1.2mL volumetrical 96 microwell plates of LB liquid nutrient medium of 30 μ g/mL kantlex, be cultured to OD at 37 ℃
600It is 0.5～0.7 o'clock, adding IPTG (final concentration 0.5mmol/L) induces and continues to cultivate 28h at 30 ℃, 4000r/min harvested cell of centrifugal half hour, pH7.5 phosphoric acid salt lysis buffer re-suspended cell with 300 μ L, behind 37 ℃ of cultivation 30min, place-80 ℃ of freezing 30min immediately, room temperature is thawed, centrifugal 30 min of 4000 r/min, draw in 300 μ L supernatant liquors to, the 96 new micropore analysis plates, add 2 μ L200mmol/L 3-hydroxy propanal substrates (the 3-hydroxy propanal is dissolved among the DMSO), at room temperature cultivate 10min, the NADPH that adds 20 μ L 2mg/mL then starts reaction, is in the variation 5min of line monitoring absorption value at 340nm, filter out enzyme activity and be higher than the bacterial strain of protoenzyme and extract plasmid and carry out full-automatic dna sequencing, the discovery mutational site is Asp
99→ Gln and Asn
147→ His.
Advantage of the present invention is to have created a kind of the 3-hydroxy propanal to be had 1 of higher catalysis activity, the ammediol oxidoreductase isozyme variant gene, and its mutational site is Asp
99→ Gln and Asn
147→ His, with 1, ammediol reductase isoazyne gene is compared, and activity has improved 4-4.6 doubly in an example of measuring.The acquisition of this variant gene is a biosynthesizing industrial chemicals 1, and ammediol provides wide application prospect.
Embodiment
Be embodiments of the invention below:
1. the acquisition of fallibility PCR primer design and pcr amplification product:
According to 1, the gene design of ammediol reductase isoazyne, later operation is for convenience introduced BamHI and NheI site respectively at 5 of primer ' end.
The dNTPs that in the eppendorf pipe of 500 μ l, adds 100pmol, upstream primer, each 20pmol of downstream primer, about 1ng pET28 α (+) yqhD is as template DNA, and ultimate density is 0.05mM MnCl
2, 2.5uTaqDNA polysaccharase, the PCR damping fluid of 5 μ l, the MgCl of 12.5 μ l 25mM
2, add aseptic distilled water then to cumulative volume 50 μ l.Reaction parameter is by 95 ℃ of sex change after 5 minutes, at 95 ℃ of 1min, and 54 ℃ of 2min, 72 ℃ of 1min, through 35 circulations, 72 ℃ are extended 2min then, obtain pcr amplification product.
The sudden change library structure:
The fallibility pcr amplification product is about the gene product of 1164bp and carries out ligation with linear plasmid pET28 α (+) that size behind the same enzyme double digestion is approximately 5300bp through extracting size behind the NheI-BamHI double digestion, after finishing, connection will connect among the product Transformed E .Coli Novablue, be applied to and contain on the 40 μ g/ml kantlex LB agar plates, 37 ℃ of incubated overnight obtain corresponding mutant library.
The amount ratio of plasmid pET28 α (+) and plasmid pET28 α (+) yqhD and restriction enzyme when enzyme is cut:
Plasmid pET28 α (+) yqhD/ plasmid pET28 α (+) 5 μ l
NheI(10u/μl) 1μl
BamHI(10u/μl) 1μl
Buffer(10X) 5μl
Sterilized water 8 μ l
Cumulative volume 20 μ l
The proportioning of ligase enzyme and plasmid when plasmid pET28 α (+)-yqhD connects:
Plasmid DNA pET28 α (+) segment 2 μ l
Gene yqhD segment 4 μ l
T4DNA ligase enzyme 1 μ l
T4DNA ligase enzyme Buffer (10X) 2 μ l
Sterilized water 11 μ l
Cumulative volume 20 μ l
3. screening that the 3-hydroxy propanal is had the variant gene of high catalytic activity
Picking clone is inoculated into 300 μ L and contains in 96 microwell plates of LB liquid nutrient medium of 40 μ g/mL kantlex from mutant library, 37 ℃ of incubated overnight, get this incubated overnight liquid of 40 μ L and join 800 new μ L and contain in 1.2mL volumetrical 96 microwell plates of LB liquid nutrient medium of 30 μ g/mL kantlex, be cultured to OD at 37 ℃
600It is 0.5～0.7 o'clock, adding IPTG (final concentration 0.5mmol/L) induces and continues to cultivate 28h at 30 ℃, 4000r/min harvested cell of centrifugal half hour, pH7.5 phosphoric acid salt lysis buffer re-suspended cell with 300 μ L, behind 37 ℃ of cultivation 30 min, place-80 ℃ of freezing 30min immediately, room temperature is thawed, the centrifugal 30min of 4000r/min, that draws 300 μ L contains 1, in the supernatant liquor to of the ammediol oxidoreductase isozyme 96 new micropore analysis plates, add 2 μ L200 mmol/L 3-hydroxy propanal substrates (the 3-hydroxy propanal is dissolved among the DMSO), at room temperature cultivate 10min, the NADPH that adds 20 μ L 2mg/mL then starts reaction, be in the variation 5min of line monitoring absorption value at 340nm, filter out enzyme activity and be higher than the bacterial strain of protoenzyme and extract plasmid and carry out full-automatic dna sequencing, the discovery mutational site is Asp
99→ Gln and Asn
147→ His.
By the mensuration of enzyme kinetics curve, with 1, ammediol reductase isoazyne gene is compared, and activity has improved 4-4.6 doubly in an example of measuring.
4. the recombination bacillus coli fermentative production 1, ammediol
A) picking contain this 1, ammediol reductase isoazyne variant gene Asp
99→ Gln, Asn
147The positive colony of → His is linked in the seed culture medium that contains 30 μ g/ml kantlex, 180r/min, 37 ℃ of shaking table incubated overnight 12h.The inoculum size of seed liquor by 2% (v/v) is linked in the fermention medium that contains 40 μ g/mL kantlex, 180r/min, 37 ℃ of shaking tables are cultured to thalline OD
600Be about 0.7-0.9, add IPTG to final concentration 0.4mmol/L, and add 25g/L concentration substrate 3-hydroxy propanal, in 25 ℃, the 120r/min fermentation culture was cultivated 10 hours.
B) collect fermented liquid,, collect supernatant liquor at centrifugal 1 5-30 of 3000-5000r/min minute. add isopyknic organic solvent chloroform, extract 1, ammediol is used for gas chromatographic analysis with rotation additional issue concentrated extracting solution then.
C) 1, ammediol output adopts gas chromatography determination.GC conditions is: fid detector, and 2m * Φ 3m stainless steel packed column, filler is homemade polymer microsphere GDX2401 (110 order), carrier gas is N
2, 250 ℃ of injector temperatures, 220 ℃ of column temperatures, 250 ℃ of detector temperatures.Use product in the quantitative fermented liquid of external standard method, sample size is 2 μ l.Experimental result shows, when the starting point concentration that adds substrate 3-hydroxy propanal is 25g/L, with containing 1, ammediol reductase isoazyne variant gene Asp
99→ Gln, Asn
147→ His recombination bacillus coli carries out fermentative production 1, ammediol, 1, ammediol output can reach 19.5g/L, proved contain this 1, ammediol reductase isoazyne variant gene Asp
99→ Gln, Asn
147→ His recombination bacillus coli can efficiently express 1 really, and the ammediol oxydo-reductase is with worker's variant enzyme, and is used for fermentative production 1, ammediol.
SEQUENCE?LISTING
＜110〉Shanghai University of Science and Technology
＜120〉1, ammediol oxidoreductase isozyme variant gene and uses thereof
<160>1
<170>PatentIn?version?3.3
<210>1
<211>1164
<212>DNA
＜213〉e. coli k12
<220>
＜223〉coding the 99th aspartic acid codon GAC sport glutamine codon CAA and the coding the 147th l-asparagine codon AAC sport Histidine CAC
<400>1
atgaacaactttaatctgcacaccccaacccgcattctgtttggtaaaggcgcaatcgctggtttacgcgaacaaattcc
tcacgatgctcgcgtattgattacctacggcggcggcagcgtgaaaaaaaccggcgttctcgatcaagttctggatgccc
tgaaaggcatggacgtgctggaatttggcggtattgaaccaaacccggcttatgaaacgctgatgaacgccgtgaaactg
gttcgcgaacaaaaagtgacttttctgctggcggttggcggcggttctgtactgcaaggcaccaaatttatcgctgcagc
ggctaactatccggaaaatatcgatccgtggcacattctgcaaacgggcggcaaagagattaaaagcgccatcccgatgg
gctgtgtgctgacgctgccagcaaccggttcagaatcccacgcaggcgcggtgatctcccgtaaaaccacaggcgacaag
caggcgttccattctgcccatgttcagcccgtatttgccgtgctcgatccggtttatacctacaccctgccgtcgcgtca
ggtggctaacggcgtagtggacgcctttgtacacaccgtggaacagtatgttaccaaaccggttgatgccaaaattcagg
accgtttcgcagaaggcattttgctgacgctgatcgaagatggtccgaaagccctgaaagagccagaaaactacgatgtg
cgcgccaacgtcatgtgggcggcgactcaggcgctgaacggtttgatcggcgctggcgtaccgcaggactgggcaacgca
tatgctgggccacgaactgactgcgatgcacggtctggatcacgcgcaaacactggctatcgtcctgcctgcactgtgga
atgaaaaacgcgataccaagcgcgctaagctgctgcaatatgctgaacgcgtctggaacatcactgaaggttcagacgat
gagcgtattgacgccgcgattgccgcaacccgcaatttctttgagcaattaggcgtgccgacccacctctccgactacgg
tctggacggcagctccatcccggctttgctgaaaaaactggaagagcacggcatgacccaactgggcgaaaatcatgaca
ttacgctggatgtcagccgccgtatatacgaagccgcccgctaa
Claims (2)
1.1, the ammediol oxidoreductase isozyme variant gene, it is characterized in that: the random mutation that utilizes the mediation of fallibility round pcr, obtain 1 by certain screening, the ammediol oxidoreductase isozyme variant gene, this is 1 years old, in the ammediol oxidoreductase isozyme gene coding the 99th aspartic acid codon GAC sport glutamine codon CAA and the coding the 147th l-asparagine codon AAC sport Histidine CAC, obtain 1, ammediol oxidoreductase isozyme variant gene Asp
99→ Gln, Asn
147→ His, this variant gene nucleotides sequence is classified SEQ ID No.1 as, codified 1, the ammediol oxydo-reductase is with worker's variant enzyme.
2. according to claim 11, the purposes of ammediol oxidoreductase isozyme variant gene, it is characterized in that: with 1, the ammediol oxidoreductase isozyme variant gene is by genetic engineering technique recombinant expressed 1, the ammediol oxydo-reductase is with worker's variant enzyme, be used for catalysis 3-hydroxy propanal and generate 1, ammediol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101717581A CN101177687B (en) | 2007-12-04 | 2007-12-04 | 1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101717581A CN101177687B (en) | 2007-12-04 | 2007-12-04 | 1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101177687A CN101177687A (en) | 2008-05-14 |
| CN101177687B true CN101177687B (en) | 2010-06-23 |
Family
ID=39404113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101717581A Expired - Fee Related CN101177687B (en) | 2007-12-04 | 2007-12-04 | 1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101177687B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643739B (en) * | 2008-10-22 | 2013-04-10 | 大连理工大学 | Recombined bacterial strain for modifying specificity of 1,3-propanediol redoxase coenzyme and application thereof |
| CN102604903A (en) * | 2012-03-05 | 2012-07-25 | 上海理工大学 | 1,3-propylene glycol oxidoreductase isozyme mutant, and gene and application thereof |
-
2007
- 2007-12-04 CN CN2007101717581A patent/CN101177687B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101177687A (en) | 2008-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Fast conversion of glycerol to 1, 3-propanediol by a new strain of Klebsiella pneumoniae | |
| Chookaew et al. | Fermentative production of hydrogen and soluble metabolites from crude glycerol of biodiesel plant by the newly isolated thermotolerant Klebsiella pneumoniae TR17 | |
| Ying et al. | Characterization of a zinc-containing alcohol dehydrogenase with stereoselectivity from the hyperthermophilic archaeon Thermococcus guaymasensis | |
| CN107849522A (en) | For producing method and the microorganism of 1,3 butanediols | |
| CN101501202A (en) | Process for production of optically active alcohol | |
| CN111269900A (en) | Preparation and application of L-amino acid deaminase mutant | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN106636020A (en) | Mutant short-chain dehydrogenase, recombinant expression vector, genetic engineering bacterium and application | |
| CN109609426B (en) | Method for producing 1, 3-propylene glycol by using methanol/formaldehyde and glucose as cosubstrates | |
| CN109468291B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN106754777B (en) | A kind of glucose dehydrogenase mutant and its preparation method and application | |
| CN112126610A (en) | Engineering bacterium for producing hydroxytyrosol | |
| CN113462677B (en) | Alpha subunit mutated nitrile hydratase mutant and application thereof | |
| CN112410312A (en) | Cyclohexanone monooxygenase and application thereof | |
| CN101173292B (en) | 1,3-propylene glycol redex enzyme isoenzyme variant gene Gln202ala and uses thereof | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| CN101177687B (en) | 1,3-methyl glycol oxidoreductase isozyme variant gene and uses thereof | |
| CN104017795A (en) | Biosynthesis method of 2-deoxy scarce aldose by using aldolase | |
| CN101469318B (en) | Synthesis of (R)-styrene glycol by coupling acceleration of (R)-carbonyl reduction enzyme and formic dehydrogenase | |
| CN101633928B (en) | Recombinant expression of aldehyde reductase and application thereof in bioconversion of glycerol into 1,3-propylene glycol | |
| CN103820506B (en) | A kind of method of gene recombination bacterium fermentation preparation of cozymase Q 10 | |
| Li et al. | Characterization and Application of a Novel Glucose Dehydrogenase with Excellent Organic Solvent Tolerance for Cofactor Regeneration in Carbonyl Reduction | |
| CN101186924A (en) | Gene engineering bacterium for catalyzing citral to produce citronellal and construction method thereof | |
| CN110241095B (en) | CYP119 enzyme, and mutant and application thereof | |
| CN111394396A (en) | Method for producing 1, 3-propylene glycol by using glycerol fermentation by microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20080514 Assignee: Nantong City Wonder Petrochemical Equipment Engineering Co., Ltd. Assignor: University of Shanghai for Science and Technology Contract record no.: 2012320010174 Denomination of invention: Fixed zymological method for production of prostaglandin E* Granted publication date: 20100623 License type: Exclusive License Record date: 20121016 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100623 Termination date: 20141204 |
|
| EXPY | Termination of patent right or utility model |