CN101173922A - Gpr54 knock-out mammals and screening methods using them - Google Patents

Abstract

The present invention relates to the use of a galanin-like receptor and/or ligands thereof in the manipulation of the pituitary hormonal axis and reproductive systems.

Description

GPR54 knock-out mammals and the screening technique that utilizes them

The application is that application number is the dividing an application for the application of " GPR54 knock-out mammals and the screening technique that utilizes them " that 200380101998.4 (international application no PCT/GB03/04479), the applying date be on October 17th, 2003, denomination of invention.

The present invention relates to the new function of known receptor.Particularly, the present invention relates to sweet third element (galanin)-sample acceptor or its part purposes in handling pituitrin axle and reproductive system.

The Harry potter of coding GPR54 is positioned at human chromosome 19pl3.3.

The cDNA of GPR54 is 1197bp.Studies show that GPR54 and the rat sweet third plain acceptor GalRl, GalR2 has 45% homogeneity, and has 44% homogeneity with GalR3.

Gan Bingsu is a neuropeptide, and it does not belong to any known neuropeptide family.It expresses and regulates various physiological processes in maincenter and peripheral nervous system, comprise learning and memory, pain, feed, the release of neurotransmitter and hormone and sexual behaviour, and be considered to participate in the morbidity (1999FEBS lett 446:103-107 such as Lee) of Alzheimer's disease (Alzheimers).Yet, it is reported that Gan Bingsu or sweet third element-sample peptide does not activate GPR54 (1999FEBS lett 446:103-107 such as Lee; 2001Nature 411:613-617 such as Ohtaki).

The relevant peptide (FaRP) of report prompting FMRF acid amides is the poor efficiency activator (micro-molar range) (2001 Biochem Biophys Res Commun 284:1189-83 such as Clements) of GPR54.FaRP is the neuropeptide that extensively distributes in invertabrate, and its function is neurotransmitter and neuromodulator.

Other studies show that the native ligand of GPR54 is kisspeptin (also claiming metastin), and it is the product of Kiss-1 gene.Three kinds of peptides with common RF-acid amides C end are from Kiss-1.54,14 and 13 amino acid whose kisspeptin are arranged.They all combine with GPR54 with low nanomole affinity.Kisspeptin 54 also claims metastin.These GPR54 parts combine (2001 J Biol Chem 276:28969-75 such as Muir with low nanomole affinity with GPR54; 2001J Biol Chem 276:34631-36 such as Kotani).

The GPR54 of some report prompting part combinations has multiple function.For example, reported that Kiss-1 is the transfer suppressor gene of melanoma and breast cancer cell.Yet research prompting Kiss-1 gene does not influence tumorigenicity (tumorigenicity).Infer metastin and reduce the cell movability by inducing excessive cell adhesion phenotype.In foot pad, injecting melanomatous mouse, can significantly reduce transfer 2001Nature 411:613-617 such as () Ohtaki by infusion administration metastin.Similarly, metastin suppresses the movability of the B16-L16 melanoma cells of GPR54 acceptor transfection, but does not influence the cell of vacation-transfection (mock-transfected).

Other research shows that also GPR54 (also claiming the metastin acceptor) activation can stimulate the PIP2 hydrolysis, calcium mobilization (mobilization), arachidonic acid discharges, ERK1/2 and p38MAP tyrosine phosphorylation, and stress fibre forms, but suppresses cell proliferation 2001J Biol Chem 276:34631-3 such as () Kotani.What is interesting is that injecting kisspeptin-10 to the female rats intravenous stimulates oxytocins secretion 2001J Biol Chem 276:34631-3 such as () Kotani.Oxytocins property of participation behavior/testicular function; Oxytocin antagonist suppresses male mating behavior (1988Eur J Pharmacol149:389-92 such as Argiolas).Yet oxytocins KO mouse shows normal sexual behavior and is fertile 1996Proc Natl Acad Sci USA 93:11699-704 such as () Nishimori.

Rat with undertissue in detect GPR54 by the northern Western blot: brain (pon (pons), midbrain (midbrain), thalamus (thalamus), hypothalamus (hypothalamus), hippocampus (hippocampus), amygdaloid nucleus (amygdale), cortex (cortex), frontal lobe (frontal) cortex and corpus straitum (striatum)), and peripheral organ's (liver and intestines) (1999 FEBS lett 446:103-107 such as Lee).

Original position analysis in the rat brain shows that the expression in hypothalamus and amygdaloid nucleus district is the highest.These acceptors are with the lower area high expressed: incertitude zone (zona incerta), veutro back of the body lid district (ventral tegmental area), dentate fascia (dentate gyrus), arcuate nucleus (arcuate nucleus), dorsal part intercalated nucleus (dorsomedialnucleus), smell (olfactory) cortex, lateral habenular nucleus (lateral habenular hucleus), lateral hypothalamus (lateral hypothalamus), locus coeruleus (locus coeruleus), the cortex of amygdaloid nucleus and intercalated nucleus (cortical and medial nuclei of amygdala), superior colliculus (superior colliculus), NPO (preoptic), AH and rear portion (anterior and posteriorhypothalamus), the all grey matters (periaqueducal gray) of aqueduct, nucleus of thalamus (parafascicular thalamic hucleus), parabrachial nuclei (parabrachial nucleus) and veutro corpora mammillare (ventral mamillary body).GPR54 expresses and the sweet third plain receptor-similar 1999FEBS lett 446:103-107 such as () Lee.

In people's tissue, northem analyzes and is presented at brain/nervous system (cortex, shell nuclear (putamen), oblongata (medulla), spinal cord, the expression in hippocampus and thalamus is lower) and hypophysis, the heart, skeletal muscle, kidney, liver, stomach, small intestine, thymus gland, lung, (the 2001BiochemBiophys Res Commun 284:1189-93 such as Clements of the expression in testis and the placenta; 2001 J Biol Chem 276:34631-36 such as Kotani).

GPR54 also by immunocytochemistry (ICC) human brain with inferior segment in detect: cerebral cortex (in cones (pyramidal cell) and the III layer (laminar layer III) thereof up prominent (ascending process)) at sensorimotor cortex, thalamus, pons-oblongata (pons-medulla) (nuclei of median raphe (raphe), inferior olivary nucleus (inferior olive), hypoglossal nucleus (hypoglossal nuclei)), cerebellum (purkinje cell (purkinje cell) pericaryon (perikarya) and up apical dendrite thereof (ascending apicaldendrite).

Yet, this area not about GPR54 mammiferous overall function with and the concrete understanding of the effect in brain.

Report shows, the vertebrate acceptor of FaRP (the poor efficiency activator of GPR54, it works at micro-molar range) closely similar with neuropeptide tyrosine (NPY) acceptor on amino acid levels (2001 Biochem Biophys Res Commun 284:1189-93 such as Clements).Other studies show that, FaRP and gonadotropin-releasing hormone (GRH) (GnRH) be location (colocalise) altogether, locatees altogether with spermatheca (spermatheca) in the spike (locusta) and the salivary gland of food blood insect (blood feeding bug).

Fruit bat (Drosophila) FMRF amide group is because of identifying by its homology with the gene that at first checks order in extra large snail blackspot sea hare (marine snail Aplysia).The FMRF amide group is because of the cardiovascular system modulability tetrapeptide purifying of initial conduct from the central nervous system of clam (clam).In mollusc (molluscs), it regulates heart output and neuronic effect, and regulates (evoked) muscle tone of inducing.In ox (cattle), relevant lobster hormone is had immunoreactive two kinds of peptides identify; Described bovine protein has anti-analgesic activity.

Although the effect of FMRF-amidated peptide is mainly studied in invertabrate, 3 pieces of document descriptions the have been arranged immunoreactivity of FmRF acid amides in mammal brain: a kind of in rabbit, rat and cavy (1995Gaoxiong Yi Xue Ke Xue Za Zhi.11:142-9 such as Duann), a kind of in tree Wu (treeshrew) (Malz and Kuhn 2002Dev Brain Res 135:39-44), also have a kind of in big brown bat (big brown bat) 1998Brain Behav Evol 52:139-47 such as () Oelschlager.What is interesting is that all these documents have all been described FmRF acid amides-sample and the immunoreactive coexpression of GnRH.In bat and tree Wu, this expression sees terminal nerve (terminal nerve).Described terminal nerve is preceding cranial nerve (anterior cranial nerve), the chemosensitivity epithelium of its domination nasal cavity.The Unknown Function that this is neural, but it has the nerve regulation effect according to prompting.Destroying this nerve causes the mating behavior of male hamster (hamster) impaired (Wirsig, and Leonard 1987 Brain Res 417:293-303).

According to Raffa (Raffa and Stone 1988 Peptides 19:1171-75), FMRF acid amides or FMRF acid amides-related peptides (FaRP) are present in mammalian central nervous system and intestines and stomach, and mammal had heart agonism (cardioexcitatory), suppress the anti-pain effect of morphine-induce, and blocking-up morphine-, defeat (defeat)-and deprive the feed (feeding) that (deprivation) induces.It also suppresses the motion (colonic propulsive motility) of colon propelling property, induces the influence to behavior when intrathecal injection, and it is reported that rodent is had memory loss of causing (amnesic) effect.Particularly, the anti-pain effect (Raffa and Stone 1998 Peptides19:1171-75,1999 Peptides 20:471-78 such as Gupta) of FMRF acid amides generation maincenter mediation in the mouse body.

Studies show that in the past, the sweet third plain knock-out mice (not removing the description of (receptorknock-out) so far about receptor knockout) can get, but its normal growth is also bred but can not lactation.Their sensory neuron is destroyed to the reaction of damage, and peripheral nerve regeneration reduces, and the appearance of neuropathic pain obviously reduces.The neuronic subgroup of DRG lacks in mutant mice, show Gan Bingsu in cell survival, have effect (1998Ann NY Acad Sci such as Wynick, 863:22-47).

Studies show that GPR54 and multistep are rapid shifts also relevantly, comprises the disengaging of cancer cell from primary carcinoma, invades surrounding tissue, by the circulation diffusion, reenters and invades organ and propagation at a distance therein.Yet, when the application submits to, do not find other effect of GPR54.

Therefore, the GPR54 that still needs to identify the part combination treats or other purposes thereby use it in brain and other in-house function.

Summary of the invention

The inventor makes GPR54 (Harry Potter) and knocks out the interior effect of body that (knockout) mouse is studied GPR54.The inventor shows that also the reproduction form and the physiology of described knock-out mice and not mutated body is variant, and prompting GPR54 has at controlled hormone axle and genital area such as the effect in control fertility and the sexual desire.In addition, the physiology of this mutant and form prompting GPR54 is in for example effect in muscle deeline (muscle wasting) and the inflammation of some sacred diseases and other disease.

Harry Potter knock-out mice can be used as GPR54 antagonist and the activator that disease model and evaluation are used for the treatment of.

Therefore, a first aspect of the present invention provides GPR54 knock-out mammals, and it comprises one or more cell, and the GPR54 polypeptide is a functionally inactive in the described cell.

The inventor finds that also the GPR54 knock-out mice of the aforementioned aspect of the present invention shows many limited character, comprise: the contact righting reflex reduces and Barnes maze performance reduces, levels of reproductive hormones and/or pattern (comprising the cycle) change, the form of reproductive organs and relevant organ changes, and property/reproductive behavio(u)r changes.

As mentioned above, the reproductive organs form change comprise the following stated one or more: genitals (genital) and relevant organ atrophy, stomach and salivary gland (sub maxillary salivary glands) atrophy, muscle and brown fat atrophy.

The generation of knock-out mammals is that those skilled in the art are familiar with and can utilizes the standard laboratory technology that relates to homologous recombination described herein.

Preferably, described transgenic animals are one of mammals that are selected from down group: mouse, rat, suslik (shrew), gerbil jird (gerbil), cavy, monkey, hamster, cat or dog.It is not limit that those skilled in the art understand cited animal.Most preferably, described mammal is a mouse.

This paper term " functionally inactive " (GPR54, pass through homologous recombination) meaning is or not that the contrast of functionally inactive is compared with wherein GPR54, obviously suppressed by GPR54 polypeptide one or more function usually in its natural surroundings (promptly environment in) in vivo performance down.Preferably, term " functionally inactive " refers to that with wherein GPR54 be not that the contrast of functionally inactive is compared, and the function of more than one that GPR54 shows usually at its natural surroundings (in the internal milieu) is obviously suppressed.More preferably, this paper term " functionally inactive " refers to that with wherein GPR54 be not that the contrast of functionally inactive is compared, and GPR54 is obviously suppressed in all functions that its natural surroundings (in the internal milieu) shows usually.

Equally, the GPR54 of the functionally inactive of " (the functionally inactivated) of functionally inactive " GPR54 nucleic acid coding this paper of this paper.

As mentioned above, term " obviously suppress " (GPR54 function) refer to described inhibition (as above-mentioned by homologous recombination at least a GPR54 function in the mammalian cell) compare with suitable contrast and to be suppressed at least 20%.The example of suitable contrast is the same or similar cell in the same or similar internal milieu, and wherein GPR54 does not have as described herein because homologous recombination and functionally inactive.Preferably, term " obviously suppress " (as above-mentioned by homologous recombination for the GPR54 function in the mammalian cell) refer to that at least a GPR54 function is compared with suitable contrast and be suppressed at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%.Most preferably, term " obviously suppress " (as above-mentioned by homologous recombination for the GPR54 function in the mammalian cell) refer to that at least a GPR54 function is compared with suitable contrast and be suppressed 100%.

On the other hand, the invention provides the method that produces one or more mammalian cell, described cell comprises the GPR54 gene of one or more functionally inactive, and described method comprises:

Select one or more to comprise the cell of the endogenous GPR54 gene of one or more functional activity.

Utilize one or more cell of the GPR54 nucleic acid transfection step (a) of functionally inactive, the GPR54 nucleic acid of described functionally inactive can be by homologous recombination and one or more endogenous GPR54 assortment of genes.

Select one or more cell, the endogenous GPR54 gene of wherein one or more has carried out homologous recombination with the GPR54 nucleic acid of functionally inactive.

Preferably, said method produces mammalian cell of the present invention according to the present invention.Aspect this in embodiment preferred, described mammalian cell is included in the mammal in the present invention.Promptly the cell of above-mentioned aspect will preferably constitute " knocking out " mammal according to the present invention.Preferably, the knock-out mammals of this paper is a mouse.

Method with one or more cell of GPR54 transfection of functionally inactive relates to standard molecule biotechnology and the technology described herein utilized.Equally, select the method for one or more cell to utilize standard laboratory technology (describing at this paper) to carry out, the GPR54 nucleic acid of endogenous GPR54 gene of one or more in the described cell and functionally inactive has carried out homologous recombination.

On the other hand, the invention provides nucleic acid construct, it is suitable for one or more endogenous GPR54 gene of functionally inactive in the host cell, and described construct comprises:

(a) A non--homology displacement zone (replacement region),

(b) be positioned at described non--first homologous region of homology displacement zone upstream,

(c) Tu Bian GPR54 gene, the active GPR54 of encoding function not when it is expressed,

(d) be positioned at described non--homology puts second homologous region of portion downstream, described second homologous region is positioned at the downstream of this non--homology displacement zone, and has the nucleotide sequence identical with the 2nd GPR54 gene at least 90%.

The inventor has identified the several functionalities relevant with GPR54, and they think the GPR54 polypeptide thus, or its one or more in conjunction with albumen or their nucleic acid of encoding the treatment meaning is arranged.

Therefore, on the other hand, the invention provides the composition that comprises the GPR54 polypeptide or its one or more in conjunction with albumen or their nucleic acid of encoding, and pharmaceutically useful carrier, thinning agent or excipient.

The above-mentioned aspect according to the present invention, preferred described composition comprise one or more GPR54 polypeptide in conjunction with albumen.Preferred described one or more GPR54 is antagonist or the activator of GPR54 in conjunction with albumen.

GPR54 can be naturally occurring or synthetic in conjunction with albumen.Naturally occurringly can be polypeptide such as antibody as herein described or nucleic acid in conjunction with albumen.Synthetic GPR54 preferably can be less molecule in conjunction with albumen and can select by screening technique, and described screening technique is that those skilled in the art are familiar with and describes at this paper.

In another optional embodiment of the present invention, preferred described composition comprises the nucleic acid of coding protein-bonded nucleic acid of GPR54 or coding GPR54 polypeptide.

The inventor finds that amazedly the GPR54 knock-out mice compares the neuronal function with change and the reproductive system of change with the normal control mouse.In addition, the GPR54 knock-out mice has other morphology and anatomical abnormalities.The promoting sexual gland hormone of GPR54 knock-out mice hypophysis hypothalamus axle produces defectiveness.Therefore the GPR54 acceptor it is believed that by control hypophysis-hypothalamic gonadotrophin secretion and participates in this axle of control.The inventor also is presented in the GPR54 knock-out mice:

(a) promoting sexual gland hormone is lower;

(b) ovary responds to giving exogenous promoting sexual gland hormone at least, shows their hold acknowledge abilities; With

(c) the exogenous GnRH of giving brings out to the reaction of small part FSH and LH secretion, shows that GPR54 may participate in the upstream control of GnRH secretion in hypothalamus-hypophysis.

Therefore, the inventor think activator and/or the antagonist of GPR54 or the composition that comprises them specifically can be used for treating reproductive hormone (reproductive hormone) relevant, nerve and some other disease.Described neurogenic disease includes but not limited to one or more in the following disease: Alzheimer's disease, sensory neuron disease (sensory neuropathy) and epilepsy (epilepsy).

The disease that this reproductive hormone is relevant comprises that one or more is selected from down the disease of group: the adjusting of fertility (fertility), birth control (contracteption), sexual desire and pubarche (libido and the onset ofpubety), lactation (lactation), osteoporosis (osteoporosis)/osteopetrosis (osteopetrosisi) or menelipsis (menopause).In addition, GPR54 activator or antagonist can be used for hormone replacement therapy (HRT).

Other disease comprises the muscle deeline, pain (pain), hormonal dependent cancer (hormonedependent cancer) and fat (obesity).

Therefore, the present invention provides on the other hand and has identified one or the method for one or more molecule of the functional activity of how exciting GPR54 polypeptide, may further comprise the steps:

Select one or more mammal, it comprises the GPR54 polypeptide of functionally inactive;

(b) with described one or more mammal of one or more possible GPR54 analog (mimic) treatment, the GPR54 activity of the exciting at least one aspect of described analog possibility;

(c) detect one or more mammal according to step (b) treatment, with determine these mammals through treatment compare with the mammal of selecting according to step (a) character that whether has one or more recovery with

(d) select one or more GPR54-ligand analogs, described analog makes the mammal of selecting according to step (a) recover mammiferous one or more character of wild type.

The present invention also provides the method for one or more molecule that functional activity is arranged of identifying antagonism GPR54 polypeptide, and may further comprise the steps:

(a) select one or more mammal, it comprises functional activity GPR54 polypeptide;

(b) with described one or more mammal of one or more possible GPR54 antagonist for treating, the GPR54 activity of at least one aspect of described antagonist possibility antagonism;

(c) detect one or more mammal for the treatment of according to step (b), compare whether have one or more character with the mammal of selecting according to step (a) through overregulating to determine these mammals through treatment.

In addition, the invention provides the purposes of transgenosis GPR54 knock-out mammals in the experiment of the biological effect that is used for measuring one or more compound.

The above-mentioned aspect according to the present invention, " antagonist " refers to compare with suitable contrast, significantly suppresses the molecule of one or more function of (as the present invention's definition) GPR54 term.

The present invention utilizes GPR54 itself, its activator and antagonist, and the instrumentality of GPR54 activity.It will be understood by those skilled in the art that plurality of reagents can increase or reduce the effect of GPR54, and realize that the approach that above-mentioned effect changes has multiple; Therefore described activator can be simulated the GPR54 of activation, or combines with GPR54 and increase its activity; The exciting type instrumentality of GPR54 activity is also like this, or increases the endogenous activator of GPR54 or the generation of endogenous GPR54 itself.The effect of antagonist and antagonism type instrumentality can identical (likewise), but all reduces the biological effect of GPR54.

" mammal " refers to any mammal to this paper term.Preferred described mammal is inhuman mammal.Preferred described mammal is selected from: mouse, rat, cavy, rabbit, hamster, gerbil jird, cat, dog and monkey.It will be understood by those skilled in the art that listed animal is not limit.

This respect according to the present invention, term " treatment " (with possible GPR54 antagonist for treating mammal) is instigated to such an extent that described mammiferous one or more cell contacts with one or more possible GPR54 antagonist.

The above-mentioned aspect according to the present invention, the indication of unusual neural character comprise that the contact righting reflex reduces and Barnes maze performance reduces.

The above-mentioned aspect according to the present invention, term " unusual reproductive system and/or form " comprises ' any change that levels of reproductive hormones and/or pattern (comprising the cycle) are compared with suitable contrast, any change that reproductive organs and relevant organ morphology are compared with suitable contrast, and the change compared with suitable contrast of property/reproductive behavio(u)r.

Preferably, the above-mentioned aspect according to the present invention, the reproductive organs form comprises one or more change that is selected from down group with the change that suitable contrast is compared: genitals and relevant organ atrophy, stomach and salivary gland atrophy, muscle and brown fat atrophy.

Unusual nervous function, the detection of unusual reproductive system and unusual reproduction form utilizes the standard laboratory technology and is that those skilled in the art are familiar with.

Preferably, the step of the above-mentioned aspect of the present invention (c) relates to one or more mammal of detection, whether shows one or more by the character that the GPR54 knock-out mice shows to determine described mammal, and described character is unusual reproductive system and/or form.

The above-mentioned aspect according to the present invention, one or more mammal of selecting according to step (a) is preferably the GPR54 knock-out mice.Preferably, they produce according to methods described herein.

It is that GPR54 with is not wherein compared by the contrast of functionally inactive that this paper term " functionally inactive " (GPR54) looks like, and is obviously suppressed in one or more function that its natural surroundings (promptly environment in) in vivo shows by the GPR54 polypeptide usually.Preferably, term " functionally inactive " refers to do not compared by the contrast of functionally inactive with wherein GPR54, and the function of more than one that GPR54 shows usually at its natural surroundings (in the internal milieu) is obviously suppressed.More preferably, this paper term " functionally inactive " refers to do not compared by the contrast of functionally inactive with wherein GPR54, and GPR54 is obviously suppressed in all functions that its natural surroundings (in the internal milieu) shows usually.

Equally, the GPR54 of this paper " functionally inactive " GPR54 nucleic acid coding this paper functionally inactive.

As mentioned above, term " obviously suppress " (GPR54 function) refer to described inhibition (as above-mentioned by homologous recombination at least a GPR54 function in the mammalian cell) compare with suitable contrast and to be suppressed at least 20%.The example of suitable contrast is the same or similar cell in the same or similar internal milieu, and wherein GPR54 does not have as described herein owing to homologous recombination and by functionally inactive.Preferably, term " obviously suppress " (as above-mentioned by homologous recombination for the GPR54 function in the mammalian cell) refer to that at least a GPR54 function is compared with suitable contrast and be suppressed at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%.Most preferably, term " obviously suppress " (as above-mentioned by homologous recombination for the GPR54 function in the mammalian cell) refer to that at least a GPR54 function is compared with suitable contrast and be suppressed 100%.

This respect according to the present invention, term " treatment " (with possible GPR54 antagonist for treating mammal) is instigated to such an extent that described mammiferous one or more cell contacts with one or more possible GPR54 antagonist.

The above-mentioned aspect according to the present invention, term " mammiferous one or more activity through overregulating of wild type " refers to regulate one or more activity that the wild type mammal is compared with the mammal of the GPR54 polypeptide that comprises functionally inactive described herein.Preferred described adjusting is the function that recovery is lost.

The GPR54 analog of this paper duplicates at least a activity or the function of wild type GPR54.Described analog can be simulated the GPR54 of activation, or the GPR54 of simulation inactivation, makes its further inhibit feature, and this is suppressed described function when lacking the GPR54 of natural inactivation.

The inventor thinks that GPR54 nucleic acid or one or more activator of coding GPR54 or the nucleic acid of antagonist can insert mammal to produce one or more result of treatment.

On the other hand, the invention provides transgenic animals, wherein the part cell comprises coding one or more is selected from down the exogenous nucleic acid of organizing material: GPR54 polypeptide, one or more activator of GPR54 polypeptide and one or more antagonist of GPR54 polypeptide at least.

Preferably, described transgenic animals are selected from mouse, people, pig, goat, deer, monkey and cow.It is not limit that those skilled in the art understand listed animal.

The above-mentioned aspect according to the present invention, term " exogenous nucleic acid " refers to not be derived from the nucleic acid of described concrete animal.Yet it can be from same animals kind or strain.For example, transgenic mice can comprise the GPR activator nucleic acid of bacterial origin.

Preferably, the part cell of transgenic animals comprises exogenous DNA, one or more activator of described exogenous dna encoding GPR54 or one or more antagonist.

The non-human transgenic animal of this paper can be one or more animal that is selected from down group: mouse, rat, monkey, dog, cat and pig.It will be understood by those skilled in the art that listed animal is not limit.

Utilize GPR54 knock-out mice prepared in accordance with the present invention studies show that, GPR54 polypeptide and neuronal function and reproductive function (comprising the cyclostage) and other disease are relevant.This sacred disease includes, but are not limited to one or more of following disease: Alzheimer's disease, sensory neuron disease or epilepsy.Described reproductive hormone relevant disease comprises one or more that organize disease down: the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis or menelipsis.In addition, GPR54 activator or antagonist can be used for hormone replacement therapy (HRT).Other disease comprises the muscle deeline, pain, hormonal dependent cancer and obesity.

Therefore, the present invention provides diagnosis to be selected from down the method for the disease of group on the other hand: Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer or obesity said method comprising the steps of:

From patient to be diagnosed, select cell sample,

More described cell sample and GPR54 expression of polypeptides level and/or functional activity from one or more control sample of healthy individual.

In another embodiment, the polymorphism of Harry Potter or its native ligand can be used for diagnosing the illness.Therefore, the invention provides the method that diagnosis is selected from following disease: Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer or obesity may further comprise the steps:

From patient to be diagnosed, select cell sample,

Analyze the endogenous nucleic acid in the described cell, to detect one or more polymorphism of one or more natural GPR54 part of endogenous GPR54 gene.

The above-mentioned aspect according to the present invention, wherein the expression of GPR54 and/or functional activity increase, reduce or change, or wherein the nucleic acid of GPR54 nucleic acid or coding GPR54 part comprises the sample of one or more polymorphism, with compare from one or more control sample of healthy individual can show before a kind of sample individuality of originating have above-mentioned one or more disease.

The above-mentioned aspect according to the present invention utilizes the sample cell of the standard laboratory choice of technology from the patient, and described technology is that those skilled in the art are familiar with.

Above " functional activity " of term GPR54 polypeptide refers to the function that GPR54 carries out usually in its natural surroundings is promptly in its cell.

Therefore, on the other hand, the invention provides the disease that is selected from down group among the treatment patient: the muscle deeline, pain, inflammation, hormonal dependent cancer, lactation, osteoporosis/osteopetrosis, hormone imbalances relevant or obesity with menelipsis, described treatment comprises one or more antagonist or the described patient of agonist treatment with the GPR54 of treatment effective dose.

On the other hand, the invention provides one or more antagonist of GPR54 or activator is used for preventing or treating the medicine of disease in preparation purposes, described disease is selected from down group: the muscle deeline, pain, inflammation, hormonal dependent cancer, lactation, osteoporosis/osteopetrosis, hormone imbalances relevant or obesity with menelipsis.

On the other hand, the invention provides the method for handling patient's sex hormone axle, comprise one or more antagonist or agonist treatment patient with the GPR54 of treatment effective dose.

On the other hand, the invention provides the antagonist of GPR54 or activator are used for operating the medicine of animality hormone axle in preparation purposes.

Above-mentioned two aspects according to the present invention, preferably to causing of handling of sex hormone axle to being selected from down any one or more influence (effect) organized or the manipulation of disease: fertility, sexual desire, birth control and puberty precocity (precocious puberty).

The accompanying drawing summary

Before Fig. 1 shows that GPR54 knocks out, the structure of mouse GPR54 genomic gene seat.

After Fig. 2 shows that GPR54 knocks out, the structure of the genomic gene seat of mouse GPR54.

Fig. 3 shows the structure of the targeting type carrier (targeting vector) that is used for the GPR54 homologous recombination, comprises the relevant limit site.

Fig. 4 a shows that knock-out mice brain section and Fig. 4 b show the detection to heterozygote and wild type.

Fig. 5 a shows the detection to wild type and mutant mouse.Fig. 5 b shows the preputial gland (preputial gland) of wild-type mice, and Fig. 5 c shows the preputial gland of mutant mouse.

Fig. 6 shows the ovary of wild type (last figure) and knock-out mice (figure below).

Fig. 7 illustrates with Barnes maze experiment and compares the result of the behavior of wild type and knock-out mice.

Fig. 8 shows the photo of knock-out mice vaginal smear.

Fig. 9 illustrates the average testicular weight of wild type and knock-out mice.

Figure 10 shows the average muscle weight of wild type and knock-out mice.

Figure 11 shows the average adrenal gland weight of wild type and knock-out mice, and (Figure 11 a) and salivary gland weight (Figure 11 b).

Figure 12 shows the testosterone levels that male and female GPR54 knock-out mice is compared with wild-type mice.

Figure 13 illustrates the estradiol level of female knock-out mice.

That Figure 14 illustrates is female, and (Figure 14 a) and the FSH level of male (Figure 14 b) knock-out mice.

Figure 15 illustrates serum, and (Figure 15 a) and the LH level of hypophysis (Figure 15 b).

Figure 16 shows electric Northern (electronic Northern).

Summary of the invention

Unless stated otherwise, traditional chemistry, molecular biology, microbiology, recombinant DNA and immunological technique are adopted in practice of the present invention, and it is in those skilled in the art's limit of power. Described technology has description in the literature. For example see J.Sambrook, E.F.Fritsch, and T.Maniatis, 1989, Molecular Cloning:A Laboratory Manual, second edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, (the 1995and periodic supplements such as F.M.; CurrentProtocols in Molecular Biology, ch.9,13, and 16, john wiley ﹠ sons, New York, N.Y.); B.Roe, J.Crabtree, and A.Kahn, 1996, DNA Isolation andSequencing:Essential Techniques, John Wiley﹠Sons; J.M.Polak and James O ' D.McGee, 1990, In Situ Hybridization:Principles and Practice; Oxford University Press; M.J.Gait (Editor), 1984, Oligonucleotide Synthesis:A Practical Approach, Irl Press; And, D.M.J.Lilley and J.E.Dahlberg, 1992, Methods ofEnzymology:DNA StructurePart A:Synthesis and Physical analyze of. DNA Methods in Enzymology, Academic Press. The content of described document is included in this paper as a reference.

GPR54

For avoiding query, this paper term " GPR54 " refers to any following sequence of identifying by relevant GenBank accession number:

NT011255 people (Homo sapiens) chromosome 19 genomic fragment groups (contig); The acceptor 54 (Gpr54) of NM～053244 house mouse (Mus musculus) G albumen-coupling, mRNA; The acceptor 54 of BC016531 house mouse G albumen-coupling, mRNA (cDNA clone MGC:27839 IMAGE:3488082), fully cds; The acceptor 54 (GPR54) of M 032551 human g-protein-coupling, mRNA; The acceptor 54 (Gpr54) of NM023992 Rattus noruegicsu (Berkenhout) (Rattus norvegicus) G albumen-coupling, mRNA; The super slice groups of NW047773 Rattus noruegicsu (Berkenhout) chromosome 7WGS (supercontig); AK039628 bull house mouse spinal cord cDNA, (enriched) library of RIKEN total length enrichment, clone: A330075J02 product: the acceptor GPR54 of G-albumen-coupling (G PROTEIN C OUPLED acceptor 54), whole (full) insetion sequence; NT039496 house mouse chromosome 10 genomic fragment groups, strain (strain) C57BL/6J; The receptor mrna of G albumen-coupling that AY029541 people infers, complete (complete) cds; Acceptor GPR54 (Gpr54) mRNA of AF343726 house mouse G-albumen coupling, complete cds; Acceptor GPR54 (GPR54) mRNA of AF343725 human g-protein-coupling, complete cds; The smooth Xenopus laevis of BE506644db65fO8.yl Wellcome CRC pSK ovum (Xenopus laevis) cDNA clone IMAGE:33778955 ' is similar to the acceptor GPR54. of TR:Q9ZOT7 Q9ZOT7 ORPHAN G albumen-coupling; , the MRNA sequence; The enrichment of BB261471BB261471RIKEN total length, 7 age in days newborn rat cerebellum house mouse cDNA clone A730098N233 ' is similar to acceptor GPR54 (GPR54) mRNA of AF115516 Rattus noruegicsu (Berkenhout) orphan (orphan) G albumen-coupling, MRNA sequence; Acceptor GPR54 (GPR54) mRNA of AF115516 Rattus noruegicsu (Berkenhout) orphan G albumen-coupling, complete cds

The GPR54 polypeptide

This paper term " polypeptide " refers to that any peptide bond that comprises mutually by peptide bond or modification is continuous two or more amino acid whose any peptide or albumen of the same part of peptide (isostere). " polypeptide " refers to short chain (being commonly referred to peptide, oligopeptides or oligomer) and long-chain (being commonly referred to albumen). Polypeptide can comprise the amino acid amino acid in addition of 20 kinds of coded by said gene.

" polypeptide " comprises the amino acid sequence of modifying by natural process (such as translating rear processing etc.) and chemical modification technology known in the art. This being modified at described in the textbook and more specifically described in monograph and a large amount of Research Literature. Modification can appear at any position of polypeptide, comprises the peptide main chain, amino acid side chain and amino or carboxyl terminal. Can understand the modification of the same type in several sites of given polypeptide can be identical or have in various degree and change. Equally, given polypeptide can comprise and permitted eurypalynous modification.

Because extensive (ubiqitination) polypeptide can be branch or has or branchiess ring-type. Ring-type, branch and branch ring type polypeptide can be that the result who transcribes rear natural process maybe can prepare by synthetic method. Modification comprises acetylation; acidylate; the ADP-ribosylation; amidatioon; with flavine covalent bond (convalent attachement offlavin); with the heme moiety covalent bond; with nucleotides or nucleotide derivative covalent bond; with lipid or lipid derivate covalent bond; with the phosphatidylinositols covalent bond, Cross-linked (cross-inkings), cyclisation (clyclization); disulfide bond forms; demethylation, covalent cross-linking forms, and cysteine forms; pyroglutamate/ester (pyroglutamate) forms; formylated, gamma-carboxylation, glycosylation; GPI anchor (anchor) forms; hydroxylation, iodate methylates; myristoylation; oxidation, proteolysis processing, phosphorylation; prenylation (prenylation); racemization (racemization), selenium acidylate (selenoylation), sulfuration; the amino acid of transhipment-RNA mediation adds albumen to, such as arginine (arginylation) and extensive (ubiquitination). For example see, Proteins-Structure and Molecular Properties, 2nd Ed., T.E.Creighton, W.H.Freeman and Company, New York, 1993and Wold, F., Posttranslational Protein Modifications:Perspectives and Prospects, pgs.1-12inPosttransl ational Covalent Modification ofProteins, B.C.Johnson, Ed., Academic Press, New York, 1983; Seifter etc., " Analysis for Protein modifications and nonprotein cofactors ", Meth Enzymol (1990) 182:626-646and Rattan etc., " Protein Synthesis:Posttranslational Modifications and Aging ", AnnNYAcad Sci (1992) 663:48-62

Term of the present invention " variant ", " homologue ", " derivative " or " fragment " comprise from or to any replacement of sequence, variation is modified, and replaces, and lack or add one (or a plurality of) amino acid. Unless specify, " GPR54 " comprises described variant, homologue, derivative and the fragment of GPR54.

Refer to metabolism or the physiological function of GPR54 acceptor comprise similar activity or improved activity or those activity relevant with reducing adverse side effect such as " receptor active " or " biologically active " of the acceptor of GPR54. The antigenicity and the immunogen activity that also comprise the GPR54 acceptor. The example of GPCR activity is measured and the method for quantitative described activity is known in the art, and this paper other parts of describing.

" disappearance " of this paper refers to that nucleotides or amino acid sequence change, and wherein one or more nucleotide amino acid lacks respectively. This paper term " insertion " or " interpolation " are that nucleotides or amino acid sequence change, and it causes respectively comparing with natural materials the interpolation of one or more nucleotides or amino acid residue. " replacement " of this paper is that different IPs thuja acid or amino acid replace respectively one or more nucleotides or amino acid whose result.

GPR54 polypeptide of the present invention can have amino acid deletions, inserts or replacement, and it causes reticent type (silent) to change and produce the amino acid sequence of functional equivalence. Polarity, electric charge, dissolubility, hydrophobicity based on described residue. hydrophily and/or amphipathic similitude can be carried out autotelic 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor. For example, electronegative amino acid comprises aspartic acid and glutamic acid; The amino acid of positively charged comprises lysine and arginine; Hydrophobicity value amino acid similar, that have uncharged polar head group comprises leucine, isoleucine, valine, glycine, alanine, arginine, glutamine, serine, threonine, phenylalanine and tyrosine.

GPR54 nucleotides and polynucleotides

" polynucleotides " are often referred to any poly-polyribonucleotide or poly-polydeoxyribonucleotide, and it can be RNA and/or the DNA of unmodified or modification. " polynucleotides " comprise, but be not limited to single-and double-stranded DNA, list-and the mixture D NA of double stranded region, single-and double-stranded RNA, single-with the mixture RNA of double stranded region, hybrid molecule comprises strand or double-stranded DNA and RNA, or more common be double-stranded or single-and double stranded region mixture. In addition, " polynucleotides " refer to three sequences, comprise RNA and/or DNA. The term polynucleotides also comprise DNA or the RNA of the group that contains one or more modification, and have and be stability or other DNA or the RNA former thereby main chain modified. " modification " group comprises that for example the group of tritylation and uncommon group are such as inosine. DNA and RNA are carried out multiple modification, therefore " polynucleotides " comprise the form that chemistry, enzyme or the metabolism of the polynucleotides that usually see natural surroundings are modified, and virus and the DNA of cell and the chemical modification form of RNA. " polynucleotides " also comprise relatively short polynucleotides, are commonly referred to oligonucleotides.

It will be understood by those skilled in the art that because the identical polypeptide of the multiple nucleotide sequence codified of degeneracy of genetic code.

" nucleotide sequence " described herein refers to nucleotide sequence, oligonucleotide sequence, polynucleotide sequence and variant thereof, homologue, fragment and derivative (such as its part). Described nucleotide sequence can be two strands or single stranded DNA or the RNA of genome or synthetic or recombinant sources, represents sense strand or antisense strand or its combination. The term nucleotide sequence can be by utilizing recombinant DNA technology (for example recombinant DNA) preparation.

Preferably, term " nucleotide sequence " refers to DNA.

Term of the present invention " variant ", " homologue ", " derivative " or " fragment " comprise from or to any replacement of GPR54 nucleotide sequence, variation is modified, and displacement lacks or adds one (or a plurality of) amino acid. Unless specify, " GPR54 " comprises described variant, homologue, derivative and the fragment of GPR54.

The expression analysis of GPR54

For being designed for the therapeutic agent for the treatment of GPR54 relevant disease, can measure the expression map of GPR54 (wild type or concrete mutant). Therefore methods known in the art can be used for measuring organ, and tissue and cell type (and stage of development) wherein have GPR54 to express. Can carry out for example tradition or " electricity " Northern. Reverse transcriptase PCR (RT-PCR) also can be used for measuring the expression of GPR54 gene or mutant. The more responsive method of measuring the GPR54 expression map comprises RNAse Protection (protection assay), and this is known in the art.

It is laboratory technique that Northern analyzes, and can be used for detecting the existence of genetic transcription thing, and relates to the hybridization of nucleotide sequence and the film of mark, and wherein the RNA from concrete cell type or tissue is fixed on the described film. (Sambrook, supra, ch.7and Ausubel, F.M. wait supra, ch.4and 16.) similarly computer technology (" electric Northern ") utilize BLAST, be used for the identical or correlation molecule of search RiboaptDB such as GenBank or LIFESEQ database (Incyte Pharmaceuticals). The advantage of this analysis type be they than multiple film hybridize (multiple memebrane-based hybridization) faster. In addition, no matter any concrete pairing is classified as (homologous) of accurately (exact) or homology, and the sensitiveness of described computer search can be modified.

Polynucleotides of the present invention and polypeptide comprise above-mentioned probe, can be used as research reagent and material to find the disease for the treatment of and diagnosis animal and human class, and the following part of this paper will describe in detail.

The expression of GPR54 polypeptide

The expression of GPR54 polypeptide is that generation GPR54 antibody is required, and the function of described antibody is activator or the antagonist of GPR54 described herein.

For expressing biologically active GPR54 polypeptide, the nucleotide sequence of coding GPR54 or its homologue, variant or derivative is inserted into suitable expression vector, namely contains the carrier that is useful on the required element of coded sequence of transcribing and translate insertion.

Use the method known to those skilled in the art construction of expression vector, described carrier contains the sequence of the GPR54 that encodes and the control element that suits to transcribe and translate. These methods comprise the extracorporeal recombinant DNA technology, synthetic technology and vivo gene restructuring. Described technical description is in Sambrook, and J. etc. (1989; Molecular Cloning, A Laboratory Manual, ch.4,8, and 16-17, Cold Spring Harbor Press, Plainview, N.Y.) and Ausubel, (the 1995and periodic supplements such as F.M.; Current Protocols in Molecular Biology, ch.9,13, and 16, John Wiley﹠Sons, New York, N.Y.).

Multiple expression vector/host system can be used for comprising and expressing the sequence of coding GPR54. These include, but are not limited to such as using recombinant phage, plasmid, the bacterium that the cosmid DNA expression vector transforms; Yeast with the Yeast expression carrier conversion; Insect cell system with virus expression carrier (such as baculoviral) conversion; The plant cell system that transforms with virus expression carrier (for example cauliflower embedded virus (cauliflower mosaic virus) (CaMV) or tobacco embedded virus (TMV)) or virus expression carrier (for example, Ti or pBR322 plasmid); Or zooblast system. The invention is not restricted to used host cell.

" control element " or " adjusting sequence " be carrier non-translational region (enhancer for example, promoter and 5 ' and 3 ' untranslated district), its with the host cell proteins interaction in order to transcribe and translate. The intensity of described element (strength) is different with specificity. According to used carrier system and host, that can use any number suitablely transcribes and translates element, comprises continuously and inducible promoter. For example, when in bacterial system, cloning, can use inducible promoter such as BLUESCRIPT phasmid (phagemid) (Stratagene, La Jolla, Calif.), perhaps heterozygosis lacZ promoter of PSP or Tl plasmid (GIBCO/BRL) etc. Baculovirus polyhedrin body protein (polyhedrin) promoter can be used for insect cell. From the plant cell genome (for example, heat shock (heat shock), RUBISCO and storage protein gene (storage protein gene)) or can be cloned into described carrier from promoter or the enhancer of plant virus (for example, viral promotors or targeting sequencing). In mammalian cell system, be preferred from mammalian genes or from the promoter of mammalian virus. If need to produce the clone that contains a plurality of copy GPR54 polypeptid coding sequences, can use with suitable selected marker based on the carrier of SV40 or EBV.

In bacterial system, many expression vectors can be selected according to the use intention of GPR54 polypeptide. For example, when a large amount of GPR54 polypeptid induction of needs antibody, but the carrier of the easy purified fusion protein high level expression of instruction. Described carrier comprises, but be not limited to multi-functional escherichia coli cloning and expression vector, (sequence of the GPR54 polypeptide of wherein encoding can link to each other in frame with the sequence of coding amino terminal Met in the described carrier and 7 residues of beta galactosidase subsequently such as BLUESCRIPT (Stratagene), thereby produce hybrid protein), pIN carriers (Van Heeke, G.and S.M.Schuster (1989) J.Biol. Chem.264:5503-5509) etc. are like that. PGEX carrier (Pr ω, Madison, Wis.) also available glutathione S-transferase (GST) is expressed as fusion with foreign protein. Usually, described fusion is soluble, and can be easily by being adsorbed onto glutathione-sepharose 4B, then in the presence of free glutathione, carrying out wash-out and the cell purification of dissolving certainly. The albumen for preparing in described system can be designed to comprise heparin, and fibrin ferment, or factor XA protease cutting site are so that interested clone's polypeptide can partly discharge from GST arbitrarily.

In saccharomyces cerevisiae (Saccharomyces cerevisiae), can use many carriers that contain continuous or inducible promoter such as the α factor, alcohol oxidase and PGH. Summary is referring to Ausubel (supra) and Grant etc. (1987; Methods Enzymol.153:516-544).

If the use plant expression vector, the expression of the sequence of coding GPR54 polypeptide can drive by one of multiple promoter. For example, the 35S of viral promotors such as CaMV and 19S promoter can be united use separately or with the ω targeting sequencing of TMV. (Takamatsu, N. (1987) EMBO are J.6:307-311.) is optional, can use plant promoter such as RUBISCO small subunit or heat shock promoter. (Coruzzi, G. etc. (1984) EMBO is J.3:1671-1680; Broglie, R. etc. (1984) Science 224:838-843; Winter, J. etc. (1991) Results Probl.Cell Differ.17:85-105.) these constructs can be by the transfection importing plant cell of directly delivered DNA or pathogen-mediated. Described technology is described in many common available summaries. (see, for example, Hobbs, S.or Murry, L.E.in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N.Y.; Pp. 191-196.)

The insect system can be used for expressing the GPR54 polypeptide. For example, in a kind of such system, autographa california nuclear polyhedrosis virus (Autographa californica nuclear polyhedrosis virus) is (AcNPV) as the carrier of expressing alien gene in Spodopterafrugiperda cell or noctuid (Trichoplusia) larva. The sequence of coding GPR54 can be cloned into inessential district such as the polyhedron gene of this virus etc., and is under the control of polyhedrin promoter. The GPR54 polypeptide is successfully inserted so that polyhedron gene inactivation and produce to lack the recombinant virus of coat protein. Described recombinant virus can be used for for example infecting S.fiugEperda cell or exigua larvae (but GPR54 polypeptide z expresses therein). (Engelhard, E.K. etc. (1994) Proc.Nat.Acad.Sci.91:3224-3227.)

In the mammalian host cell, many expression systems based on virus can utilize. If as expression vector, the sequence of coding GPR54 polypeptide can be connected into adenovirus and transcribe/translate compound with adenovirus, described compound is comprised of late promoter and three minutes (tripartite) targeting sequencings. Insert virus genomic inessential E1 or E3 district and can be used for obtaining great-hearted virus, described virus can be expressed the GPR54 polypeptide in the host cell that infects. (Logan, J.and T.Shenk (1984) Proc.Natl.Acad. Sci.81:3655-3659.) in addition, transcriptional enhancer such as Louth (Rous) sarcoma virus (RSV) enhancer can be used for being increased in the expression in the mammalian host cell.

People's artificial chromosome (HAC) also can be used for sending the dna fragmentation greater than the dna fragmentation that can comprise and express in plasmid. Make up and be used for the treatment of by the HAC that conventional delivering method is sent (liposome, polycation amino polymer or vesica) about 6kb-10Mb.

Concrete initial signal also can be more effective the sequence of translation coding GPR54 polypeptide. Sort signal comprises ATG initiation codon and contiguous sequence. If the sequence of coding GPR54 polypeptide and initiation codon thereof and upstream sequence are inserted into suitable expression vector, need not other and transcribe or translate control signal. Yet, if only insert coded sequence or its part, should provide the external source translation that comprises ATG initiation codon control signal. In addition, initiation codon should be to guarantee that whole insetion sequence is translated in correct reading frame. External source translation element and initiation codon can be various sources, and be natural and synthetic. The efficient of expressing can be improved by the enhancer that will be fit to used concrete cell system, and described enhancer is as described in the document. (Scharf, D. etc. (1994) Results Probl.Cell Differ.20:125-162.).

In addition, the host cell bacterial strain can be regulated the expression of insetion sequence and selects according to the ability of required mode machining expressing protein according to it. This modification of polypeptide includes, but not limited to acetylation, carboxylation, glycosylation, phosphorylation, esterified and acidylate. The translation of " front former (prepro) " form of scinderin is processed afterwards and be can be used for promoting correct insertion, folding and/or function. Different hosts cell (the CHO for example that has specific cells structure (machinery) and feature mechanism (mechanism) for translating rear activity, HeLa, MDCK, HEK293 and WI38) can derive from American type culture collection (ATCC, Bethesda, and can be selected to guarantee correct modification and the processing of described foreign protein Md.).

Be the extended high rate recombinant protein, preferred stably express. For example, the clone of energy stably express GPR54 GPCR can utilize expression vector to transform, and described expression vector can comprise virus replication starting point and/or heterogenous expression element and the selected marker that is positioned on identical or the carrier of separating. After importing described carrier, cell can be grown in the culture medium of enrichment about 1-2 days, then transferred to and selected in the culture medium. The purpose of selected marker is to give the selection resistance, and there be growth and the recovery that allows to express the cell that is imported into sequence in it. The resistance clone of the cell of stable conversion can utilize the tissue culture technique that is fit to described cell type to breed.

Can utilize any amount of selective system to reclaim the clone of conversion. Described system includes but not limited to, herpes simplex virus (herpes simplex virus) thymidine kinase gene (Wigler, (1977) the Cell 11:223-32 such as M.) and adenine phosphoribosyl transferase gene (Lowy, (1980) the Cell 22:817-23 such as I.), described system can be used for respectively tk^-Or apr^-Cell. In addition, antimetabolite, antibiotic or herbicide resistance can be used as selects the basis. For example, dhfr gives the resistance to methotrexate (MTX) (Wigler, M. etc. (1980) Proc.Natl.Acad.Sci.77:3567-70); Npt gives the resistance of aminoglycoside neomycin and G-418 (Colbere-Garapin, F. etc. (1981) J.Mol.Biol.150:1-14); Als or pat give respectively the resistance (Murry sees above) to chlorine sulphur grand (chlorsulfuron) and careless fourth phosphine (phosphinotricin) transacetylase. Other suitable gene also has description, trpB (its allow cell utilize the indoles substituted tryptophan) or hisD (it allows cell to utilize histidinol (histinol) to replace histidine) (Hartman for example, S.C.and R.C.Mulligan (1988) Proc.Natl.Acad.Sci.85:8047-51.) nearest, can utilize such as anthocyanidin (anthocyanin), p-glycuronidase and substrate GUS thereof, and luciferase and substrate fluorescein thereof are as witness marking (visible marker). These marks not only can be used for identifying transformant, also can be used for the instantaneous or stable protein expression amount of quantitatively concrete carrier system. (Rhodes, C.A. etc. (1995) Methods Mol.Biol.55:121-131.)

Although the existence that marker gene is expressed/disappearance prompting genes of interest also exists, the existence of described gene and expression need to confirm. For example, if the sequence of coding GPR54 polypeptide is inserted into the marker gene sequence, the transformant that contains the GPR54 polypeptid coding sequence can be identified by the disappearance of marker gene function. Optional, marker gene can in series be positioned under the single promoter control with the GPR54 polypeptid coding sequence. Marker gene is to inducing or selecting to react and express the gene that usually shows described series connection and also express.

Optional, can identify the host cell that contains GPR54 peptide coding nucleotide sequence and express GPR54 by several different methods known in the art. These methods comprise, but be not limited to DNA--DNA or DNA-RNA hybridization and protein bioassay (protein bioassay) and immunoassay (immunoassay) technology, comprise that based on film the technology of solution or chip detects and/or quantitative nucleic acid or protein sequence.

The existence of the polynucleotide sequence of coding GPR54 polypeptide can utilize the polynucleotide passage of probe or fragment or coding GPR54GPCR to hybridize by DNA-DNA or DNA-RNA or amplification detects. Comprise the transformant of utilizing oligonucleotides or oligomer based on the GPR54 polypeptid coding sequence to detect the DNA or the RNA that contain the GPR54 that encodes based on the experiment of nucleic acid amplification.

It is known in the art that multiple utilization detects and measure the scheme that GPR54 expresses to the special polyclone of described albumen or monoclonal antibody. The example of described technology comprises enzyme-linked immunosorbent assay (ELISA), the cell sorting (FACS) of radioimmunoassay experiment (RIA) and fluorescence-activation. Preferred two sites, based on monoclonal immunization experiment, the monoclonal antibody that described experiment utilization responds to two kinds of non-interferings (non-interfering) epi-position on the GPR54, but can adopt competion experiment. These and other experiment is known in the art, for example sees Hampton, and R. etc. (1990; Serological Methods, a Laboratory Manual, Section IV, APS Press, StPaul, Minn.) and in Maddox, D. E. etc. (1983; J.Exp.Med.158:1211-1216).

Multiple mark and combination technology are known in the art, and are used for multiple nucleic acids and amino acid experiment. The preparation hybridization of mark or PCR probe comprise that for detection of the method with the coded polynucleotide correlated series of GPR54 the polynucleotides that utilize mark carry out oligolabeling, nick translation (nick translation), end mark (end-labeling), or pcr amplification. Optional, the sequence of coding GPR54 or its fragment can be cloned into carrier with preparation mRNA probe. Described carrier be known in the art, can buy and can be used for by adding suitable RNA polymerase such as T7, the nucleotides of T3 or SP6 etc. and mark is at the vitro synthesized RNA probe. These methods can utilize multiple commercially available kit to carry out, for example Pharmacia﹠Upjohn (Kalamazoo, Mich.), Promega (Madison, Wis.), and U.S.Biochemical Corp (Cleveland, Ohio) provide those. Suitable reporter molecule or mark can be used for simplifying detection, and it comprises radionuclide (radionuclide), enzyme, and fluorescence, chemiluminescence or the preparation that adds lustre to, and substrate, co-factor, mortifier, magnetic-particles etc. are like that.

The host cell that is transformed by the nucleotide sequence of coding GPR54 can be expressed and reclaims from cell culture under the condition of described albumen and cultivate suitable. The albumen that the cell that transforms produces can be positioned at cell membrane, according to used sequence and/or carrier secretion or be included in the cell. The expression vector that it will be understood by those skilled in the art that the polynucleotides that contain the GPR54 that encodes can be designed to comprise burst, and described burst instructs the GPR54 secretion by protokaryon or eukaryotic cell membrane. Other construct can be used for connecting the GPR54 coded sequence and the nucleotide sequence of the peptide zone that the promotion soluble protein of encoding reclaims. Described purifying promotes district (purification facilitating domain) to comprise, but be not limited to, metal chelating peptide carries out the histidine of purifying-tryptophan assembly (module) such as allowing at fixing metal, and the albumin A district that allows purifying on fixing immunoglobulin (Ig), and (the Immunex Corp. of FLAGS extension/protein affinity purification system, Seattle, Wash.) in used district. Between zone purification and GPR54GPCR coded sequence, comprise the joint sequence that can cut, such as to factor XA or the specific joint of enterokinase (Invitrogen, San Diego, Calif.), can be used for promoting purifying. A kind of such carrier is so that fusion is expressed, and described fusion contains GPR54 and then coding 6 histidine residues are thioredoxin or enterokinase cleavage site. Described histidine residues can promote the purifying (IMIAC on fixing metal ion affinity chromatography; Described in Porath, J. etc. (1992) Prot.Exp.Purif.3:263-281), and the enterokinase cleavage site provides from the method for described fusion protein purification GPR54. Kroll is seen in the description that contains the carrier of fusion, and D.J. etc. (1993; DNA Cell Biol.12:441-453).

The fragment of GPR54 not only can produce by the preparation of recombinating, and also can synthesize and can be undertaken by artificial or automatic technology by synthetic (Merrifield J. (1963) J.Am.Chem.Soc.85:2149-2154.) albumen that produces of the direct peptide that utilizes solid phase technique. The synthetic of automation can be undertaken by for example using the Applied Bio 431A of system peptide synthesizer (Perkin Elmer). The various fragments of GPR54 can be synthesized separately and then combined the generation full-length molecule.

Transgenic animals

Knock out

The present invention provides the GPR54 knock-out mammals on the other hand, and it comprises one or more cell, and GPR54 polypeptide wherein is functionally inactive.

GPR54 of the present invention knocks out the result of the function destruction that can be GPR54 gene or any part of this gene, comprises the sudden change that makes the GPR54 gene lose one or more function, comprises disappearance or replacement. Described mutant comprises simple point mutation, and the coding of target GPR54 or noncoding region.

Preferably, described knock-out animal is inhuman mammal, such as pig, and sheep or rodent. Most preferably described knock-out animal is mouse or rat. Described knock-out animal can be used in the screening technique identifying activator and/or the antagonist of GPR54, and detects the effectiveness that it treats disease in vivo.

For example, the knock-out animal through transforming GPR54 generation defective can be used for testing to identify activator and/or the antagonist of GPR54. Whether a kind of experimental design produces physiological reaction for the possible medicine (candidate ligand or compound) of assessment to measure it when lacking the GPR54 acceptor. This can be by giving medicine above-mentioned knock-out animal, and the specific reaction that detects described animal is carried out. Any physiological parameter can be measured in this experiment.

From the tissue of GPR54 knock-out animal can be used for receptors bind test to measure described possible medicine (candidate ligand or compound) whether with the GPR54 receptors bind. Described experiment can be by obtaining the first acceptor prepared product from the knock-out animal that generates defective through transforming GPR54, and obtain the second acceptor from known source of being combined with the GPR54 of any evaluation part or compound and carry out. Usually, described the first and second acceptor prepared products are all similar aspect except the source that obtains them all. For example, if the brain tissue of knock-out animal (as mentioned and hereinafter described) is used for experiment, can be used as the source of the second acceptor prepared product from comparable (comparable) brain tissue of normal (wild type) animal. Every kind of acceptor prepared product is all with the part of known and GPR54 receptors bind, be incubated under the condition that has or do not exist candidate ligand or compound. Preferred described candidate ligand or compound can detect at variable concentrations.

The combination of measuring the first and second acceptor prepared products and known ligand is verified the degree that compound replaces. Tissue from knock-out animal can be directly used in experiment, or described tissue can be through film or the memebrane protein (itself can be used for experiment) that is processed into separation. Preferred knock-out animal is mouse. Part can be tested compatible method mark with combination with any. This can include, but not limited to radioactivity, enzyme, fluorescence or chemiluminescent labeling (and hereinafter described other labelling technique).

In addition, the antagonist of GPR54 acceptor can be by with the wild type animal of the administration expressive function GPR54 such as candidate compound, and the animal that is accredited as the phenotypic characteristic that shows that reduction that any and GPR54 function of receptors are expressed or elimination are relevant is identified.

The method detailed that produces inhuman knock-out animal is described hereinafter. The kind that transgenic constructs can import animal is to produce knock-out mammals. For example, one or the construct of several copies can mix in the mammal embryo genome by the standard transgenic technology.

In the exemplary, the present invention knocks out the non-human animal by transgenosis being imported non-human animal's kind system preparation. The embryo target cell of each stage of development can be used for importing transgenosis. Stage of development according to the embryo target cell is utilized distinct methods. Being used for putting into practice the concrete of any animal of the present invention is that (line) can be good according to general health, and embryo production is good, and nuclear observability good and Reproductive Health in embryo Central Plains is well selected. In addition, monoploid is obvious factor.

Transgenosis is imported the embryo can be undertaken by any method known in the art, such as micro-injection (microinjection), electroporation, or lipofection. For example, GPR54 acceptor transgenosis can be passed through described construct trace is injected the protokaryon of the mammalian ovum of fertilization, thereby the construct of one or more copy is remained in the cell of growing animal. After importing described transgenic constructs in the embryonated egg, described ovum can be at external insulation different time, and/or replants into agent host (surrogate host). External insulation is known in the art to maturation. A kind of common method be with the embryo the about 1-7 of external insulation days (according to kind and difference), then described embryo is replanted into agent host.

Can be by tissue part be carried out the Southern engram analysis, detect the existence of the described construct in the embryo's of transgeneic procedure offspring. If the external source of one or more copy clone's construct keeps stable integration in the described genome that knocks out the embryo, can set up the permanent knock-out mammals system of carrying the construct that adds in the transgenosis mode.

Knock out change mammiferous brood young baby's birth after, can measure described construct and mix situation in described offspring's genome. Preferably, this experiment hybridizes to carry out by the probe of the dna sequence dna of correspondence is encoded desired recombinant protein product or its fragment and described offspring's chromosomal material. Make the mammal offspring of the construct that contains at least one copy in the genome grow to maturation.

Be purpose of the present invention, zygote (zygote) is the diploid cell that forms basically, and it can develop into complete organism. Usually, described zygote includes the ovum of nuclear, described endorsing by merging and natural or artificial formation from two haploid nucleuses of identical or different gamete. Therefore, the nuclear of described gamete must be natural compatible, i.e. its generation can be through breaking up and develop into the survived zygote of the organism of meritorious energy. Usually, preferred euploid zygote. If obtain the aneuploid zygote, according to the euploid number of organism that gamete is originated, chromosome number changes can not be above one.

In addition, similarly biological consideration, physical factor also affects the amount (volume) of (govern) exogenous genetic material, and described exogenous genetic material can add the nuclear of this zygote or form the inhereditary material of the part of this syncaryon. If there is not inhereditary material to be removed, the exogenous genetic material amount that can add is subject to being absorbed and the quantitative limitation that can not destroyed by physical factor. Usually be no more than about 10 skin liters (picoliter) exogenous genetic material day. The physical influence that adds is not so large as to the viability of the described zygote of physical damage. The number of dna sequence dna is examined multifarious biological limits and can be changed according to the function of concrete zygote and exogenous genetic material, and be apparent to those skilled in the art, this be since the inhereditary material (comprising described exogenous inhereditary material) of gained zygote must biologically can be initial and keep described zygote differentiation and develop into meritorious can organism.

The transgenic constructs copy number that adds zygote depends on the exogenous genetic material total amount of adding, and will be to make genetic transformation become possible amount. In theory, only need a copy; Yet usually utilize a plurality of copies, for example, 1,000-20, the transgenic constructs of 000 copy has function to guarantee a copy. For the present invention, it is normally favourable that the exogenous DNA array of each insertion has an above functional form to copy to improve the phenotypic expression of exogenous DNA array.

Any permission is all available with the technology that exogenous genetic material joins in the Mesoplast heredity material, as long as it does not destroy cell, nuclear membrane or existing cell or genetic structure. Exogenous genetic material preferably enters nucleic acid genetic material by micro-injection. Cell and cyto-architectural microinjection are known in the art.

Implant again by standard method and realize. Usually, agent host is anaesthetized, and the embryo is inserted its fallopian tubal. Embryo's number of implanting concrete host is according to kind and difference, but usually similar to the spontaneous rear algebraically of this host.

Can be by genetically modified existence and/or the expression among the offspring of knocking out of any proper method screening agent host. Screening usually utilizes with the probe of at least part of transgenosis complementation, is undertaken by Southern trace or Northern engram analysis. The Western engram analysis that utilizes the antibody of the coded albumen of transgenosis to carry out can be used as optional or other method that the screening transgenic product exists. Usually DNA is from the tail tissue preparation, and analyzes or the described transgenosis of pcr analysis by Southern. Optional, utilize Southern analysis or PCR to detect and it is believed that existence and the expression of expressing high-level genetically modified tissue or transit cell gene, but any tissue or cell type all can be used for this analysis.

The assessment transgenosis exists optional or biochemical test that other method includes, but are not limited to suit, such as enzyme and/or immunization experiment, the tissue staining of concrete label or enzymatic activity, flow cytometry etc. Blood analysis also can be used for detecting the existence of transgene product in blood, and estimates described transgenosis to the impact of the level of all kinds haemocyte and other blood constituent.

Retroviral infection also can be used for transgenosis is imported the non-human animal. The non-human embryo of growing also can be in vitro culture to blastocyst (blastocyst) stage. In this process, blastomere is the target (Jaenich, R. (1976) PNAS 73:1260-1264) of retroviral infection. Effective infection of blastomere is processed by enzyme and is removed oolemma (zona pellucida) realization (Manipulating the mice Embryo, Hogan eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986). Being used for importing genetically modified Retroviral Vector system is generally and carries this genetically modified replication defect type retrovirus (Jahner etc. (1985) PNAS 82:6927-6931; (1985) the PNAS 82:6148-6152 such as Van der Putten). Transfection is by cultivating blastomere easily at individual layer virus producing cell (virus-producing cell) and effectively realizing (Van der Putten, supra; Stewart etc. (1987) EMBO J.6:383-388). Optional, infection can be carried out in the stage afterwards. Virus or virus producing cell can inject blastocoele (blastocoele) (Jahner etc. (1982) Nature 298:623-628). Most of creators (founder) are chimeric for transgenosis, and this is only to occur in the cell that partly forms transgenic nonhuman animal owing to mixing (incorporation). In addition, the diverse location in creator's genome can contain genetically modified miscellaneous retroviruses insert, and it separates the offspring usually. In addition, also can carry out retroviral infection in the uterus to the embryo in the pregnancy period (midgestation embryo), transgenosis is imported kind of system's (Jahner etc. (1982) see above).

The target cell of the third type that transgenosis imports is embryonic stem cell (ES). The embryo that the ES cell is cultivated outside implant precursor obtains, and merges (Evans etc. (1981) Nature 292:154-156 with the embryo; Bradley etc. (1984) Nature 309:255-258; Gossler etc. (1986) PNAS 83:9065-9069; Robertson etc. (1986) Nature 322:445-448). The transduction that transgenosis can effectively be passed through DNA transfection or retrovirus-mediated method imports the ES cell. The ES cell of described conversion can be combined with the blastocyst from the non-human animal (combine) subsequently. Described ES cell is built the group and had the embryo subsequently becomes the kind system that produces chimaeric animals. Referring to Jaenisch, R. (1988) Science 240:1468-1474.

The invention still further relates to the nucleic acid construct that destroys the GPR54 gene of host cell for function. This nucleic acid construct comprises: (a) non--homology replacing section (non-homologous replacement portion); (b) be positioned at described non--the first homologous region of homology replacing section upstream; Described the first homologous region has and the essentially identical nucleotide sequence of a GPR54 gene order; (c) be positioned at described non--homology puts the second homologous region of portion downstream, described the second homologous region has and the essentially identical nucleotide sequence of the 2nd GPR54 gene order, and described the 2nd GPR54 gene is positioned at the downstream of a GPR54 gene order described in the naturally occurring endogenous GPR54 gene. In addition, when described nucleic acid molecules was imported into host cell, the first and second homologous regions were answered long enough, carried out homologous recombination with the endogenous GPR54 gene that carries out in nucleic acid construct and the host cell. In the preferred embodiment, described non--the homology replacing section comprises the expression reporter, preferably includes lacZ and the positive expression cassette of selecting, and preferably comprises the neomycin phosphotransferase gene that is operatively connected in regulating element.

The transgenic animals of GPR54GPCR defective can followingly produce:

(a) construct GPR54 gene target type carrier (targeting vector)

Mouse GPR54 genomic clone separates from utilizing probe sequence available from HGMP (Hinxton, UK) the large intron of mouse (mouse large insert) PAC library, described library are to utilize standard technique to increase from the mouse open read frame cDNA sequence (SEQ ID NO:4) of part prediction. The mouse GPR54 genomic clone that separates utilizes small oligonucleotide probe and standard technique to pass through restriction mapping (restriction mapped) in the zone of GPR54 gene subsequently.

Musculus cdna group locus is carried out the part order-checking, so that can be designed for the homology arm that is cloned in the targeting type carrier. Two districts (from any side in the open read frame zone that will be lacked) that are generally the DNA of 1-5kb are called 5 ' and 3 ' homology arm, it is cloned into the targeting type carrier by pcr amplification and described fragment. The position of these arms select so that the homologous recombination event will be by lacking at least 7 cross-film districts functional destruction GPR54 gene. The targeting type carrier is prepared to wherein, and the GPR54 sequence of disappearance is replaced by non--homologous sequence, described non--homologous sequence comprises the endogenous gene of selecting box (selection cassette) upstream and expresses reporter (not relying on the lacZ gene of frame (frame independent)), it is by (promoted) neomycin phosphotransferase (neo) genomic constitution that starts, and the direction of described gene is the same with the GPR54 gene.

(b) transfection of embryonic stem cell and analysis

Embryonic stem cell (Evans and Kaufman, 1981) cultivate, in the Eagles culture medium of Dulbecco ' s improvement, grow at neomycin resistance embryo fibroblast culture medium supporting layer (feeder layer), described culture media supplemented 20% hyclone, 10% NBCS, the 2mM glutamine, nonessential amino acid, 100 μ M 2 mercapto ethanols and 500u/ml LIF ELISA (leukemia inhibitory factor). Every day, replaced medium and went down to posterity to the ES cell in per 3 days. 5 * 106ES cell carries out transfection with the linearizing plasmid of 5 μ g by electroporation (25 μ F electric capacity and 400 volts). Behind the electroporation 24 hours, the cell of transfection was cultivated 9 days in the culture medium that contains 200 μ g/ml neomycins. The clone is transferred to 96 orifice plates, copies and increase, then identify the wherein clone of endogenous GPR54 gene and targeting type construct generation homologous recombination by PCR. The positive colony ratio is generally 1-5%. These clones increase, so that allow replisome to be frozen and prepare enough high-quality DNA be used for by Southern trace utilization outside 5 ' and 3 ' probe determine target event (targeting event), the equal Application standard technology of described process (Russ etc., 2000, Nature 2000Mar 2; 404 (6773): 95-9).

(c) generation of GPR54 deficient mice

C57BL/6 is female to carry out mating with male mice, and separates blastocyst in the time of conceived 3.5 days. Inject 10-12 cell from selected clone in each blastocyst, and the 7-8 blastocyst is implanted false pregnancy F1 female mice uterus.

What contain higher level (reaching 100%) during brood chimeric young mouse birth has a male mouse (agouti males) (decorative pattern crust color shows by the effect of the clone's of target progeny cell) of decorative pattern. Male chimera and female and MF1 and 129 mouse mating determine that by decorative pattern crust color and pcr gene type analysis kind of a system transmits (germline transmission) respectively.

Other non-human transgenic animal

The invention still further relates to the non-human transgenic animal, it causes the GPR54 acceptor to cross expression or the low expression of described acceptor (comparing with suitable contrast).

Described animal can be used for identifying the activator and the antagonist (also can be used for treatment) of function of receptors.Antibody

The antibody of this paper can be used as the activator or the antagonist of GPR54 polypeptide.

Be the object of the invention, unless stated otherwise, term " antibody " includes but not limited to, polyclone, and monoclonal, chimeric, strand, Fab fragment and the fragment that produces by the Fab expression library.Described fragment comprises the fragment (activity that its maintenance combines with the target material) of complete antibody, Fv, F (ab ') and F (ab ') 2 fragments, and single-chain antibody (scFv), fusion and other synthetic proteins that comprises the antigen binding site of antibody.Antibody and fragment thereof can be humanized antibody, and for example EP-A-239400 is described.In addition, can use the antibody (or its fragment) with whole person variable region, for example United States Patent (USP) 5,545, and 807 and 6,075,181 is described.Neutralizing antibody promptly suppresses the bioactive antibody of described material amino acid sequence, specifically is preferred for diagnosis and treatment.

Antibody can prepare by standard technique, such as by immunity (immunization) or utilize phage display library.

Polypeptide of the present invention or peptide can be used for preparing antibody by known technology.Described antibody can combine with specificitys such as GPR54 albumen or its homologue, fragments.

As the needs polyclonal antibody, the available immunogenic composition immunity of selected mammal (for example, mouse, rabbit, goat, horse etc.), described composition comprises polypeptide of the present invention or peptide.Can utilize multiple adjuvant to come the enhance immunity reaction according to host type.Described adjuvant comprises, but be not limited to, Freund ' s, the mineral salt gel is such as aluminium hydroxide, and surface reactive material is such as lysolecithin, polyether polyhydroxy-compound (pluronic polyol), polyanion, peptide, fat liquor, keyhole limpet hemocyanin (keyholelimpet hemocyanin) and dinitrophenol dinitrophenolate.BCG (BacilliCalmette-Guerin) and CBP (Corynebacterium parvum) are the people's adjuvants that comes in handy, if the individuality of described material amino acid sequence administration immunocompromised host (compromised) can use described adjuvant when defending with stimulating system.

According to known method collect from the immunity animal serum and handle.As containing the antibody of other antigen available from serum polypeptide of the present invention, that contain anti-epi-position polyclonal antibody, described polyclonal antibody can pass through the immunoaffinity chromatography purifying.The technology that is used to prepare and processes polyclonal antiserum is known in the art.For preparing described antibody, the present invention also provides amino acid sequence of the present invention or its fragment, and it is haptenization (haptenised) to immunogenic other amino acid sequence as the animal or human.

The monoclonal antibody of anti-epi-position can be prepared easily by those skilled in the art, and described epi-position can be available from polypeptide of the present invention or peptide.The common method for preparing monoclonal antibody by hybridoma is known.Immortal (immortal) antibody producing cell system can be by Fusion of Cells and the preparation of other technology, and described other technology is such as with carcinogenic (oncogenic) dna direct conversion bone-marrow-derived lymphocyte, or carries out transfection with Epstein-Barr virus.Can screen various character, such as affinity for isotype and epi-position at all monoclonal antibodies of eye socket (orbit) epi-position preparation.

Monoclonal antibody can be cultivated the method preparation for preparing antibody molecule by continuous cell line by any.These technology include, but are not limited to the hybridoma technology of Koehler and Milstein (1975Nature 256:495-497), trioma technology, human B cell hybridoma technology (Kosbor etc. (1983) ImmunolToday 4:72; Cote etc. (1983) Proc Natl Acad Sci 80:2026-2030) and EBV-hybridoma technology (Cole etc., Monoclonal Antibodies and Cancer Therapy, pp.77-96, Alan R.Liss, Inc., 1985).

In addition, can use technology, as mouse antibodies gene and human immunoglobulin gene are spliced to obtain to have technology (Morrison etc. (1984) the Proc Natl Acad Sci 81:6851-6855 of suitable antigentic specificity and bioactive molecule into the development of preparation chimeric antibody; Neuberger etc. (1984) Nature 312:604-608; Takeda etc. (1985) Nature 314:452-454).Optional, the technology that is used to prepare single-chain antibody (United States Patent (USP) 4,946,779) can be used for preparing the material specific single-chain antibody.

Especially can be used for diagnosis at monoclonal and polyclonal antibody available from the epi-position of polypeptide of the present invention or peptide, and wherein in and type antibody can be used in the passive immunotherapy.Monoclonal antibody can be used for exciting anti--idiotype antibody particularly.Anti--idiotype antibody is the immunoglobulin (Ig) that carries material " internal image (intemalimage) " and/or need prevent the reagent of its attack.Be used to excite the technology of anti-idiotype known in the art.These anti-idiotypes also can be used for treatment.

Antibody also can be by producing in the lymphocyte populations inductor or preparing by screening recombination immunoglobulin library or whole high specific binding reagents, as Orlandi etc. (1989, Proc Natl Acad Sci86:3833-3837), and Winter G and Milstein C (1991; Nature 349:293-299) described.

Also can produce the antibody fragment of the specific binding site that contains polypeptide or peptide.For example, described fragment includes, but are not limited to F (ab ') 2 fragments (it can prepare by using the pepsin digested antibody molecule) and Fab fragment (it can pass through the disulphide bridges preparation of reduction F (ab ') 2 fragments).Optional, can make up the Fab expression library and have required specific monoclonal Fab fragment (HuseWD etc. (1989) Science 256:1275-1281) to allow easily to identify fast.

The technology (United States Patent (USP) 4,946,778) that is used to prepare single-chain antibody can be used for preparing the single-chain antibody of polypeptide of the present invention.Equally, transgenic mice or other biosome comprise that other mammal can be used for expressing humanized antibody.

Therefore, the inventor thinks that GPR54 antibody or the composition that comprises them especially can be used for treating nerve, reproductive hormone relevant with some other diseases.Described sacred disease includes but not limited to following one or more disease: Alzheimer's disease, sensory neuron disease or epilepsy.

The disease that described reproductive hormone is relevant comprises one or more that organize down: the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis or menelipsis.In addition, GPR54 activator or antagonist can be used for hormone replacement therapy (HRT).

Other disease comprises the muscle deeline, pain, hormonal dependent cancer and obesity.

Diagnostic test

The present invention provides diagnosis to be selected from down the method for the disease of group on the other hand: Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, the muscle deeline, pain, hormonal dependent cancer and obesity said method comprising the steps of:

(a) from patient to be diagnosed, select cell sample,

(b) more described cell sample and GPR54 expression of polypeptides level and/or functional activity from one or more control sample of healthy individual.

The invention still further relates to the GPR54 polynucleotide, the polynucleotide of coding GPR54 peptide part and polypeptide (with and homologue, variant and derivant) purposes in diagnostic reagent and genetic analysis.With can be with GPR54 nucleic acid (comprising homologue, variant and derivant) complementary or can with the nucleic acid of its hybridization, and the antibody of anti-GPR54 polypeptide and GPR54 ligand polypeptide also can be used for described experiment.

The detection of GPR54 gene mutation form, metastin gene or other the native ligand gene relevant with dysfunction can provide diagnostic tool, it can add or limit the diagnosis of disease or disease susceptibility, described disease is that the expression of GPR54 or its native ligand is low excessively, the result that overexpression or expression change.Can detect the individuality that carries sudden change in the GPR54 gene (comprising control sequence) at dna level by various technology.

For example, DNA is separable from the patient and measure GPR54 or metastin dna polymorphism pattern.The pattern of described evaluation can with control patients relatively, known described control patients suffer from GPR54 or metastin expressed low, the disease that overexpression or abnormal expression are correlated with.The patient of the genetic polymorphism of expression and GPR54 or metastin relevant disease can identify thus.The genetic analysis of GPR54 or metastin can be undertaken by any known technology in this area.For example, individuality can screen by mensuration GPR54 such as RFLP or snp analysis or the allelic dna sequence dna of metastin.Dna polymorphism in gene order by detecting GPR54 or metastin or any sequence of controlling its expression exists, the patient can be accredited as have trouble and GPR54 or metastin expressed low, the genetic predisposition of the disease that overexpression or abnormal expression are correlated with.

Can treat or prevent the patient's that so identifies GPR54 or metastin relevant disease, or further at the early treatment of GPR54 or metastin relevant disease, to prevent further developing of described disease.GPR54 or metastin relevant disease comprise Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer.

In the preferred embodiment, GPR54 or metastin relevant disease comprise Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, the muscle deeline, pain, hormonal dependent cancer and obesity.Preferably, described disease relates to sex steroid hormone axle (sex steroid hormonal axis) adjusting.

The invention still further relates to kit, it is used to identify the genetic polymorphism sexual norm of patient GPR54 or metastin relevant disease.Described kit comprises the DNA sample collection device, and the device of measuring the genetic polymorphism sexual norm, and it can relatively come to determine the neurological susceptibility of patient to GPR54 or metastin relevant disease with control sample.The kit of diagnosis GPR54 or metastin relevant disease comprises the antibody of GPR54 or metastin polypeptide and/or described polypeptide (or its fragment).

Diagnosis can such as from blood, be urinated the material of saliva biopsy or postmortem available from experimenter's cell with nucleic acid.In preferred embodiments, described DNA can refer to the haemocyte of blood available from being collected in patient on the absorption paper.In another preferred embodiment, described blood collecting is at AmpliCard.TM. (University of Sheffield, Department of Medicine and Pharmacology, RoyalHallamshire Hospital, Sheffield, EnglandS 10 2JF).

Described DNA can be directly used in detection or carry out enzymatic amplification with PCR or other amplification technique, analyzes then.The oligonucleotide DNA primer that can prepare target specificity polymorphic dna district in the genes of interest makes the amplification that realizes target sequence in PCR reaction.RNA or cDNA also can be used as template in a similar manner.Can utilize restriction enzyme analysis from the dna sequence dna of template DNA amplification,, and provide patient's genetic polymorphism collection of illustrative plates thus with the genetic polymorphism of the sequence of determining amplification.Limited fragment length can be determined by gel analysis.Can optional or jointly use such as technology such as SNP (single nucleotide polymorphism) analyses.

Lack and insert to change by amplified production and normal genotype size Comparatively speaking and detect.Point mutation can be by making amplification DNA and the GPR54 of mark or the hybridization of metasin nucleotide sequence identify.The sequence of preferred coupling can distinguish with unpaired duplex by RNase digestion or melting temperature difference.Dna sequence dna difference also can be by the change of dna fragmentation electrophoretic mobility in gel (can comprise or not comprise denaturant), or detects by direct dna sequencing.For example see Myers etc., Science (1985) 230:1242.The sequence of particular location changes also can be by nuclease protection experiment (nuclease protection assay) such as RNase and Sl protection or the demonstration of chemical cleavage method.See Cotton etc., Proc Natl Acad Sci USA (1985) 85:4397-4401.In another embodiment, can make up the array of the oligonucleotide probe that comprises GPR54 or metastin nucleotide sequence or its fragment, with for example gene mutation of effective screening.The array technique method is known and commonly used, can be used for illustrating the various problems in the molecular genetics, comprises gene expression, and gene connection and gene diversity (for example see: M.Chee etal., Science, Vol 274, pp 610-613 (1996)).

Single strand conformation poly morphism (SSCP) can be used for detecting electrophoretic mobility difference (Orita etc. (1989) Proc Natl.Acad.Sci USA:86:2766, see also Cotton (1993) the Mutat Res 285:125-144 between mutant and the wild-type nucleic acid; And Hayashi (1992) Genet Anal Tech Appl 9:73-79).The single stranded DNA fragment changeability of sample and contrast GPR54 or metastin nucleic acid also allows its renaturation.The secondary structure of single-chain nucleic acid is according to sequence and difference, and the electrophoretic mobility of generation changes and can be used for detecting single sequence change.Dna fragmentation can be labeled or with the probe in detecting of mark.The susceptibility of described experiment can strengthen by utilizing RNA (rather than DNA), and secondary structure wherein changes more responsive to sequence.In preferred embodiments, purpose (subject) method utilizes heteroduple analysis to separate double-stranded allos complex molecule (Keen etc. (1991) TrendsGenet 7:5) based on electrophoretic mobility.

Diagnostic test provides diagnosis or determines method to the susceptibility of following disease: infect such as virus fungi, the infection of prokaryotes and virus infections, especially HIV-1 or HIV-2; Pain; Cancer; Diabetes; Fat; Apocleisis; Voracious (bulimia); Asthma; Parkinson's disease; Thrombosis (thrombosis); Acute heart failure, low blood pressure; Hypertension; Impotence (erectile dysfunction); The retention of urine (urinary retention); Metabolic bone disease such as osteoporosis and osteopetrosis; Angina pectoris; Miocardial infarction; Ulcer; Asthma; Irritated; Rheumatoid arthritis; Inflammatory bowel disease; IBS; Benign prostatauxe and spirit and neurogenic disease, comprise anxiety (anxiety), schizophrenia (schizophrenia), mad dry type depression (manic depression), delirium (delirium), dull-witted (dementia), serious backwardness and dyskinesia (severe mental retardation anddyskinesia), such as Huntingdon (Huntington) family name's disease or Gilles dela Tourett ' s syndrome, can be by the sudden change in described method detection GPR54 or the metastin gene.

In concrete embodiment preferred, described diagnostic test is used for diagnosis or treats Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer and fat neurological susceptibility.Preferably, described disease relates to modulability steroid hormone axle.

But the existence of GPR54 or metastin polypeptide and nucleic acid in the test sample.Therefore, above-mentioned infection and disease can be diagnosed by the following method, and described method comprises: measure from unusual GPR54 or metastin polypeptide or GPR54 or the metastin mRNA level that reduces or increase in the sample of individuality.Described sample can comprise from suffering from or easily suffering from and increase, and reduction or unusual GPR54 or metastin express the cell or tissue of the biosome of relevant disease, comprise the spatiality or the temporary change of expression or pattern.Suffer from or easily suffer from the expression of GPR54 in the biosome of described disease or metastin or pattern can by with normal biosome in described expression or pattern relatively as methods for the diagnosis of diseases.

Therefore, usually the present invention includes the method that the test sample amplifying nucleic acid exists, described nucleic acid comprises GPR54 or metastin nucleic acid, and described method is by contacting described sample with at least a nucleic acid probe to described nucleic acid specificity, and the existence of monitoring nucleic acid described in this sample is carried out.For example, but described nucleic acid probe specificity is incorporated into GPR54 or metastin nucleic acid or its part, and detects both combinations; The existence of described compound itself also can be detected.In addition, the present invention includes the method that detects GPR54 or metastin polypeptide, described method by with cell sample with can contact in conjunction with the antibody of described polypeptide, and the existence that detects polypeptide described in this sample is carried out.This can form by the compound between described antibody of monitoring and the polypeptide, or monitors described polypeptide and realize with combining easily of antibody.The method that detects the combination between two kinds of entities is known in the art, and comprises FRET (FRET (fluorescence resonance energy transfer) (fluorescence resonance energy transfer)), surface plasmon resonance (surfaceplasmon resonance) etc.

The expression that reduces or increase can utilize any method that is used for quantitative polynucleotide known in the art to measure at rna level, and described method is such as PCR, RT-PCR, RNase protection, Northern trace and other hybrid method.The experimental technique that can be used for measuring albumen in host's sample such as GPR54 or metastin level is well known by persons skilled in the art.Described experimental technique comprises radioimmunoassay experiment, and competition is in conjunction with experiment, and Western engram analysis and ELIA test.

The present invention relates to be used to diagnose following any disease or to the diagnostic kit of the neurological susceptibility of following any disease: Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer or obesity.Preferably, described disease relates to the adjusting of sex steroid hormone axle.

Diagnose following disease or to the neurological susceptibility of following any disease with concrete preferred diagnostic kit: Alzheimer's disease, sensory neuron disease and epilepsy, the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis, muscle deeline, pain, hormonal dependent cancer or obesity.Preferably, described disease relates to the adjusting of sex steroid hormone axle.

Described diagnostic kit comprises GPR54 or metastin polynucleotide or its fragment; Complementary nucleotide sequence; GPR54 or metastin polypeptide or its fragment, or the antibody of anti-GPR54 or metastin polypeptide.

Prevention and methods of treatment

The invention provides the method for treatment and the too high or not enough relevant abnormal diseases of GPR54 polypeptide active, and the GPR54 polypeptide, it specifically can be used for treating nerve in conjunction with albumen and/or their nucleic acid of encoding, reproductive hormone be correlated with some other diseases.Described sacred disease includes but not limited to that one or more is selected from down the disease of group: Alzheimer's disease, sensory neuron disease or epilepsy.

The disease that described reproductive hormone is relevant comprises one or more disease that is selected from down the group disease: the adjusting of fertility, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis or menelipsis.In addition, GPR54 activator or antagonist can be used for hormone replacement therapy (HRT).

Other disease comprises the muscle deeline, pain, hormonal dependent cancer and obesity.

If the GPR54 hyperactivity can adopt several different methods.A kind of method comprises that the administration experimenter effectively suppresses above-mentioned inhibition compound (antagonist) and pharmaceutically suitable carrier of this paper of the amount that activates, and it combines by block ligand and GPR54's, thereby or alleviates described abnormal diseases by suppressing secondary signal.

In the other method, but administration still can be competed the GPR54 polypeptide of the soluble form of binding partner with endogenous GPR54.The common embodiment of this competition thing comprises the fragment of GPR54 polypeptide.

In the other method, endogenous GPR54 peptide coding expression of gene can be utilized and express the interrupter technique inhibition.Known this technology relates to utilizes antisense sequences, and described antisense sequences can innerly produce or administration respectively.See for example O ' Connor, JNeurochem (1991) 56:560in Oligodeoxynucleotidesas Antisense Inhibitors of gene Expression, CRC Press, Bocaraton, Fla. (1988). the optional oligonucleotides that forms triple helical with described gene that provides.See, for example, Lee etc., NucleicAcids Res (1979) 6:3073; Cooney etc., Science (1988) 241:456; Dervan etc., Science (1991) 251:1360.Administration in statu quo of these compositions or relevant oligomer can be expressed in vivo.

For treatment GPR54 or its active low relevant abnormal diseases of expressing, can adopt several different methods.A kind of method comprises compound and pharmaceutically suitable carrier of administration acceptor treatment effective dose, and described compounds is the GPR54 (being above-mentioned activator) of part combination seemingly, thereby alleviates described abnormal diseases.Optional, available gene therapy is to produce GPR54 by the relevant cell endogenous among the experimenter.For example, polynucleotide of the present invention can be through transforming to express the retroviral vector of aforesaid replication defective.Described retrovirus expression construct can be separated subsequently and be imported incasing cells (packaging cell), described incasing cells makes described incasing cells can produce the infectious viral particle that contains genes of interest with the retroviral plasmid vector transduction of the RNAd that contains code book invention polypeptide.Can be with these preparation type cell (producer cell) administration experimenters, with engineered cells in vivo and express described polypeptide in vivo.The summary of gene therapy is referring to Chapter 20, Gene Therapy and other Molecular Genetic-basedTherapeutic Approaches, (and references cited therein) in Human Molecular base Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).Preparation and administration

Peptide is such as the soluble form of GPR54 polypeptide, and activator and antagonist peptide or micromolecule can be formulated together with suitable pharmaceutical carrier.Described preparaton comprises described polypeptide or compound and the pharmaceutically useful carrier or the excipient for the treatment of effective dose.Described carrier includes but not limited to salt solution, buffered saline, dextrose, water, glycerine, ethanol and composition thereof.Preparaton should be fit to administration, and is well known by persons skilled in the art.The invention still further relates to pharmaceutical pack and kit, it comprises one or more container, is full of one or more composition of foregoing of the present invention in the described container.

Polypeptide of the present invention and other compound can use separately or with other compound such as the therapeutic compound coupling.

The preferred form that described pharmaceutical composition is administered systemically comprises injection, usually through intravenous injection.Can use other injecting pathway, such as through subcutaneous, in the muscle or intraperitoneal.The alternate manner that is administered systemically comprises through mucous membrane (transmucosal) with through skin (transdermal) administration, utilizes penetration agent (penetrant) such as cholate or fusidinic acid (Fusidic Acid) or other detersive.In addition, if suitably be mixed with the preparation of enteric or capsulation, also Orally-administrable.These compounds also can and/or localize (localize) through local (topical), with ointment (salve), and paste (paste), form administrations such as gel.

The required dosage scope depends on selected peptide, method of administration, and preparaton character, and the character of experimenter's disease, and the attending doctor judges.Appropriate dosage is the 0.1-100ug/kg acceptor.Expection required dosage variable rangeization is bigger, and this is owing to can obtain the efficient difference of all cpds and various methods of administration.For example expect that the dosage that oral administration needs is higher than intravenous injection.The difference of these dosage levels can utilize the standard experience approach of optimization to regulate, and this also is known in the art.

The polypeptide that is used for the treatment of also can produce in the modality that is commonly referred to " gene therapy " as mentioned above (modality) in acceptor is endogenous.Therefore, for example come the cell of autoreceptor to can be used on polynucleotide such as the DNA of coded polypeptide under the isolated condition or RNA and for example by utilizing retroviral plasmid vector transformation.Described cell is imported into the experimenter subsequently.

Pharmaceutical composition

The present invention also provides pharmaceutical composition, comprises the GPR54 polypeptide of the present invention of drug treatment effective dose, its binding molecule or their nucleic acid molecules of encoding, and optionally pharmaceutically suitable carrier, thinning agent or excipient (comprising its combination).

Described pharmaceutical composition can be used for humans and animals in people and animal doctor's medical science, and will generally include any one or more pharmaceutically acceptable diluent, carrier or excipient.The carrier and the thinning agent that can be used for treating are known at pharmaceutical field, and as Remington ' s Pharmaceutical Sciences, Mack Publishing Co. (A.R.Gennaro edit.1985) is described.Pharmaceutical carrier, excipient or thinning agent can be selected according to method of administration and standard drug practice.Described pharmaceutical composition can comprise carrier, excipient or thinning agent, any suitable bonding agent, lubricant, suspending agent, coating agent (coating agent), solubilizer etc.

Antiseptic, stabilizing agent, dyestuff even flavoring additives can be used for pharmaceutical composition of the present invention.Examples of preservatives comprises Sodium Benzoate (sodium benzoate), the ester of sorbic acid (sorbic acid) and p-hydroxybenzoic acid.Also can use antioxidant and suspending agent.

Different delivery systems need different components/preparaton.For example, pharmaceutical composition of the present invention can be mixed with and utilize micropump (mini-pump) or send (for example as nasal spray or gasoloid so that suck) or ingestible solution by mucosal route, or outside stomach and intestine (preparation of wherein said composition claims injectable forms to be used for by for example through intravenous, in the muscle or subcutaneous delivery).Optional, described preparaton can be designed to send by described two kinds of approach.

When described preparation during by gastrointestinal tract mucous and transmucosal delivery, it should keep stable by intestines and stomach the time; For example, it should resist proteolysis, stablizes and resist the cleaning action of bile at acid pH.

Appropriate drug composition administration in the following way: through sucking, form with suppository or pessary (pessary), form with washing lotion, solution, emulsifiable paste, ointment or fine powder (dusting powder), by utilizing lagging agent (skin patch), oral with the tablet form that contains excipient such as starch or lactose, or in capsule or avette capsule (ovule) separately or with excipient, or with contain seasoning or colorant the form of elixir, solution or suspension, or outside stomach and intestine such as, for example through intravenous, in the muscle or hypodermic injection.For parenteral, described composition is preferably the form of sterile aqueous solution, and described solution can contain other material, such as enough salt or monose, makes described solution and blood etc. open.For through sucking (buccal) or sublingual administration, described composition can be with the tablet or the lozenge form administration of usual way preparation.

Administration

Usually, the doctor determines to be fit to the actual dose of individual subjects, and described dosage changes with age, body weight or concrete reaction.Described dosage is lower than exemplary average case.The dosage individual cases that preferably are higher or lower than described scope can be arranged certainly.

Pharmaceutical composition of the present invention can pass through direct injection.Described composition can be mixed with outside stomach and intestine, through mucous membrane, and in muscle, through intravenous, through subcutaneous, (intraocular) or percutaneous dosing in ear.Usually, the dosage of every kind of albumen is the 0.01-30mg/kg body weight, preferred 0.1-10mg/kg, more preferably 0.1-1mg/kg body weight.

Term " administration " comprises by virus or non-virus technology to be sent.The virus delivery mechanism includes but not limited to adenovirus vector, adeno-associated virus (AAV) carrier, herpesvirus vector, retroviral vector, slow virus carrier and baculovirus vector.Non-viral delivery matrices comprises, the transfection of lipid mediation, liposome, immunoliposome (immunoliposome), lipofection, cationic surface amphiphile (cationicfacial amphiphil) and combination thereof.The approach of this delivery mechanism includes but not limited to through mucous membrane, and intranasal is oral, outside stomach and intestine, through intestines and stomach, through the part or through the hypogloeeis approach.

Term " " including but not limited to: send by mucosal route, for example be used for sucking or of administration as ingestible solution as nasal spray or gasoloid; The outer approach of stomach and intestine, its by injectable form such as in intravenous, muscle or subcutaneous route send.

Term " (co-administered) of co-administered " refers to the administration site and feasible can the realization immune necessary adjusting of time of every kind of polypeptide for example of the present invention and other entity such as adjuvant.Therefore, though can be with the same site of described polypeptide and adjuvant administration simultaneously the time, preferably at different time and described polypeptide of site administration and adjuvant.Described polypeptide and adjuvant even can administration in same delivery vector, and described polypeptide and antigen can be coupling and/or non-coupling and/or gene coupling/or non-coupling.

Described polypeptide, polynucleotide, peptide, nucleotide and optional adjuvant can be used as single dose or a plurality of dosage separates or the co-administered host receptor.

Pharmaceutical composition of the present invention can be by multiple different approaches administration, such as injection (comprise outside stomach and intestine, through subcutaneous and through intramuscular injection), in the intranasal, in the mucous membrane, in the oral administration, transvaginal, in the per urethra or through the ear administration.

Pharmaceutical composition of the present invention can be conventional by injection for example by in subcutaneous or the muscle and through parenteral.Other preparaton that is fit to other administering mode comprises suppository, and the oral formulations under the certain situation.For suppository, typical binders and carrier can comprise, for example, and polyglycol or glyceryl ester; Described suppository can be formed by the potpourri of the property component that 0.5%-10% or 1%-2% are arranged.Oral formulations comprises the excipient such as common employing, pharmaceutical grade sweet mellow wine for example, lactose, starch, dolomol, saccharin sodium, cellulose, magnesium carbonate etc.Described composition can be solution, suspension, and tablet, ball, capsule continues the preparaton or the powder of release, and contains 10%-95%, the active component of preferred 25%-70%.When vaccine combination was freeze-drying, the material of freeze-drying can dissolve before administration, for example was dissolved as suspension.Dissolving is preferably carried out in damping fluid.

The present invention will be specifically described according to embodiment, and described embodiment should not be construed as limitation of the present invention.

Embodiment

Embodiment 1. transgenosis GPR54 knock-out mices

Make up the carrier of target GPR54 gene

Mouse GPR54 gene is identified by bioinformatics method (bioinformatically), and is found that it is arranged in the 10.3kb genomic fragment group from the PAC library.Further bioinformatics research expands this slice groups to 28kb.This slice groups provides enough flanking sequence information, makes can design homology arm so that be cloned into targeting type carrier (structure of used targeting vector comprises that the relevant limit site is presented at Fig. 3).

Mouse GPR54 gene has five code-shaped extrons.The target strategy is designed to remove the major part that part first extron and second before the 7tm code area contains the extron (second 7tm-containing exon) of 7tm.4.7kb 5 homology arms of the extron that contains 7tm that side joint is to be lacked and 1.0kb 3 ' homology arm can pass through pcr amplification, and its fragment cloning is gone into the targeting type carrier.5 ' end of every kind of Oligonucleolide primers of the synthetic described arm that is used to increase, it contains the different recognition sites of rare cutting type restriction enzyme (rare cuttingrestriction enzyme), and compatible with the cloning site of the poly joint (polylinker) of described carrier and lack from arm itself.For GPR54, described design of primers is such shown in the following sequence, has 5 ' arm clone's enzyme (cloning enzyme) of AgeI/SpeI and 3 ' arm clone enzyme of AscI/FseI.

In addition, for the arm primer to (5 ' arm 5 ' 1 (AgeI)/5 ' arm 3 ' (SpeI) and 3 ' arm 5 ' terminal AscI/3 ' arm 3 ' 2Fse), other designed to be used following purpose to the special primer of GPR54 locus: 5 ' and 3 ' probe primer to (5 ' probe FII/5 ' probe RII and 3 ' probe F1/3 ' probe R1), be used for increasing in two 150-300bp short-movie sections (described fragment is positioned at each arm outside and extends beyond described arm) of the non-repeatability genomic DNA of inferring the target clone that separates, analyze thereby allow that the target gene seat is carried out Southem; Mouse genotype primer is to (hetF and hetR), when itself and carrier specificity primer (being Asc403 herein) when being used for polynary PCR, allows wild type, heterozygosis and the differentiation between the mouse of isozygotying; At last, target screens primer (target screening primer) (3P3A), and it is the annealing of terminal upstream in 3 ' arm district, and produces target event-specific 1.2kb amplimer (amplimer) when matching with carrier 3 ' terminal Auele Specific Primer (neo36).This amplimer can be only from the template DNA that the cell that required genome changes occurs, and allow to distinguish the cell and the background of correct target, described background is the clone who contains the copy of this carrier random integration.The position of these primers in the target strategy (targeting strategy) and the locus structure of GPR54 are presented among the SEQ ID NO:10.

MusHarryP5 ' probe eFII GTGTACCAGGTGAGGAGGCCATCAGAGGTG

MusHarryP5 ' probe eRII TGTCATCCTGAGGCCCAATGGTTCTTCAGG

MusHarry5 ' arm 5 ' 1Age AAAACCGGT AAATGCTGTTAATCCTGCCAAGAG

MusHarry5 ' arm 3 ' Spe ATAACTAGTGTAGCGAAAAACAGGGGAAC

MusHarry3 ' arm 5 ' terminal AscI AAATTCGTCAACTACATCCAGC

MusHarry3 ' arm 3 ' 2Fse GGGAAGTGGGATAGACACG

musHarry 3P3A GGAAAAGCTAAGAACTAAGTGTGG

MusHarry3 ' probe eF1 ATGAGTGTGGACCGCTGGTATGTGAC

MusHarry3 ' probe eR1 TCTGAGACTGAGTATGTGCCCTTG

musHarryP heft TCACTCGGACCCGGATGTACAGGTCAG

musHarryP hetR AGCCCGCGTACCTGCTGGATGTAGTTG

Asc403 CAGCCGAACTGTTCGCCAGGCTCAAGG

Neo36 CGCATCGCCTTCTATCGCCTTCTTGAC

Table 1.GPR54 primer sequence

The choice of location of homology arm is for coming functional destruction GPR54 gene by lacking 7 major parts 5 ' of striding the film district.Preparation targeting type carrier, the GPR54 sequence that lacks in the described carrier replaces with non-homogeneous sequence, described non-homogeneous sequence is made up of the endogenous gene expression reporter (not relying on the lacZ gene of frame) of selecting the box upstream, and described selection box is by (promoted) neomycin phosphotransferase (neo) genomic constitution consistent with GPR54 gene direction, that start.

In case with 5 ' and 3 homology arms be cloned into targeting type carrier pTK4IBLMNL (see figure 5), big high-purity DNA prepared product utilizes the preparation of standard molecule biotechnology.The no endotoxin DNA of 20 μ g prepared fresh limits (restricted) with rare cutting restriction enzyme PmeI in another, and it is present in the unique site between middle ampicillin resistance gene of carrier bracket (backbone) and the bacterium origin of replication.Linearization DNA is precipitated and be resuspended in the salt solution of 100 μ l phosphoric acid buffers, for electroporation ready.

Behind the electroporation 24 hours, cells transfected was cultivated 9 days in the nutrient culture media that contains the 200g/ml neomycin.The clone is transferred to 96 orifice plates, duplicates and increases, and (utilizes primer 3P3A and neo36, as mentioned above) to identify the clone, between endogenous GPR54 gene and targeting type construct homologous recombination has taken place among the described clone by the PCR screening then.Positive colony is less, is 1-5%.Expanding these is cloned into and allows duplicate (replica) to be frozen, and can prepare enough high-quality DNA be used to utilize outside 5 as above-mentioned preparation ' and 3 ' probe determine by the Southern trace as described in the target incident, all processes are all utilized standard technique (Russ etc., Nature 2000Mar 2; 404 (6773): 95-92000).When during with external probe hybridization, being confirmed by the existence of (homologously targeted) ES cell clone of homology target by the wild type band of sudden change band and change with the Southern trace of the DNA of diagnostic restriction enzyme digestion.For example, utilize 5 ' probe, the DNA of BglII digestion produces the band of 9kb wild type band and 14.5kb target; The DNA of HindIII digestion produces the band of 15kb wild type band and 9.5kb target; The DNA of XbaI digestion produces the band of 15kb wild type band and 19.5kb target.Similar, utilize 3 ' probe, the DNA of BamHI produces the band of 7.5kb wild type band and 4kb target; The DNA of EcoRI produces the band of 7kb wild type band and 4.5kb target.

The structure of the genomic gene seat of mouse GPR54 is shown in Fig. 1 before knocking out.The structure that knocks out the genomic gene seat of back mouse GPR54 is shown in Fig. 2.Express in the site that confirms (verification) relevant enzyme with Southern.

The generation of GPR54GPCR deficient mice

C57BL/6 is female to carry out mating with male mice, and separates blastocyst the 3.5th day pregnancy period (gestation).Inject 10-12 cell in each blastocyst from selected clone, and the uterus of 7-8 blastocyst being implanted false pregnancy F1 female mice.Chimeric brood young mouse contains several high levels (reaching 100%) dapple male (agouti male) mouse (effect of the clone's of decorative pattern crust color (agouti coat colour) prompting target cell) when being born.These male gomphosis mouses and female MF1 and 129 mouse mating, and by having decorative pattern crust color and pcr gene somatotype (PCR genotyping) to measure kind of system's transmission (germline transmission) respectively.

The pcr gene somatotype utilize primer hetF and hetR, and the third carrier specificity primer (Asc403) carries out on the tail fragment (clip) of dissolving.This polynary PCR allows from wild type gene seat (as existing) from primer hetF and hetR increases produces the 217bp band.The site of hetF lacks in knock-out mice, makes that described amplification can not be from the allele (fail from a targetedallele) of target.Yet, the Asc403 primer will with 3 ' arm district in the hetR primer of district annealing from the band of the locus amplification 439bp of target.Therefore, this polynary PCR genotype of showing brood mouse is as follows: the wild type sample shows single 217bp band; The hybrid DNA sample shows two bands: 217bp and 439bp; The homozygote sample is display target specificity 439bp band only.

Embodiment 2

B) result

I) gene expression pattern

1) electric Northern

Electricity Northem sees Figure 16.

PCR result.The expression of given tissue is expressed as: (-) do not detect, and (+) detects low-level abundance, and (++) detects the medium level abundance, and (+++) detects high-level abundance.Testis+, muscle-, ovary+, Prostato-, small intestine+, lung ++, kidney+, leucocyte+, liver-, brain +++, the heart+, spleen+

Est database search result

BF470621	Mouse	The standardization library of 10 samples
			BE309865	Mouse	Tumor of breast, big soma
AL541044	The people	Placenta
			BF470621	Mouse	Brain ((pooled) that compile)
BB193083	Mouse	Spinal cord
			AI823800	The people	Kidney neoplasms
AA887801	The people	Colon tumor

2) structure that is dyeed by Lac Z

In the lacZ experiment, following structure contains the evidence that LacZ expresses: brain (with inferior segment), spinal cord (sensory area), testis.

LacZ expresses the zones of different that sees brain, such as hippocampus (the strongest district), and SCN (suprachiasmatic nucleus), corpora mammillare, pons and cerebellum, and spinal cord dorsal part (sensation) district.

Observe and microscopic section

Fix the brain warp of 6 wild types and 6 mutant GPR54 knock-out mices and cut out 40 microscopic sections at freezing-microtome (freezing microtome).

Examine under a microscope section and show that LacZ dyeing is in the location with lower area:

Hippocampus

Olfactory bulb (Olfactory bulbs)

(Preoptic) hypothalamus before the optic chiasma

Ventricles of the brain week (Periventricular) hypothalamus

Habenular nucleus (Habenular nucleus)

Hypothalamus bundle (Hypothalamic tract)

Nucleus nervi cochlearis (Cochlear nucleus)

Last corpora mammillare (Supramamillary body)

3) Lac Z expresses figure

The mutant brain section is seen Fig. 4 a; The testis of heterozygote and wild type is seen b.

II) Anatomical Observation

Harry Potter knock-out mice shows that some gross anatomies are unusual: the overall obviously fear of the genital tract of mutant atrophy (male preputial gland (preputial gland) atrophy, microcaulia (micropenis), testis and seminal vesicle/solidify (coagulatory) gland are very little), muscle weight reduces, and brown fat minimizing and stomach and salivary gland are less.

Female mutant mammary dysplasia, ovary (Fig. 6), uterus and fallopian tubal atrophy.

The anus genitals distances (anogenital distance) of male mutant are shorter than wild type (with cm is unit: mutant: 0.97 ± 0.03 wild type 1.4 ± 0.3, p＜0.001), and this causes the sex of keeper's false judgment animal.But in female, do not observe difference.

Uterus and ovary (last figure, wild type; Figure below, mutant)

III) behavior

All animals are schemed to support, and it can freely obtain food and water, the daytime-night circulation is 12 hours daytime/12 hour nights, 7am begins to light.

Detect when age in mouse 8-10 week, remove Barnes maze and sexual behaviour and detect the 15-17 point carries out in the afternoon, all test all in the morning that the 10-12 point carries out.

Detect between demonstration mutant and the wild type variant

a)Barnes maze

Bames maze is spatial memory (spatial memory) experiment, and it carries out on white circular platform, needs to distinguish particular space.It comprises circular platform, has 18 holes to be evenly distributed along girth on the described platform.There is the black box of runing away below, hole.Barnes maze experiment utilizes rodent to avoid the non-confining surface (brightly lit unenclosed surface) of illumination and seeks the natural tendency of dark sealing place (darkened enclosed shelter).

Train described animal animal more than 10 days, the record enter the described box of runing away the waiting period and errors number and search strategy.

There is trend to show, this experiment performance relatively poor (Fig. 7) of male mutant.

B) mating behavior

5 male mutants and 5 brood mouse of wild type and wild females mouse in estrus (by the vaginal smear assessment) together place new cage, and observe 30 minutes.Described mouse all shows to female interesting (smelling (sniffing)) and at viewing duration and carries out mating.

Mutant is to the female interest that do not show, and do not carry out mating at viewing duration.In addition, an exist together cage but do not have pregnancy of several male and female mutant mouse shows that the GPR54 knock-out mice is sterile.

C) cycle in estrus

Female and 6 the brood mouse of wild type of 6 mutant were accepted the smear experiment in continuous 5 days.Also checked 3 weeks big+/+female.Utilize the methyl blue described slide glass that dyes.All wild types show tangible stage oestrous cycle, but mutant does not show.Vagina picture and big wild-type mice similar (Fig. 8) of 3 weeks that-/-is female.

D) physiology

It is right to set up 15 mating, and it comprises either gender GPR54 sudden change and different in nature wild-type mice, but never produces brood mouse.Therefore, male and female GPR54 mutant is all sterile.

1) weight

A) organ weight

Measure testis (Fig. 9), muscle (Figure 10), (Figure 11 is a) and the weight of salivary gland (Figure 11 b) for adrenal gland.

2) experiment

A) testis west ketone, estrogen and GnRH measure

Measure the testosterone of 6 male mutants and 6 wild-type mices.The testosterone levels of mutant is starkly lower than (P＜0.05) wild-type mice (Figure 12).

The estrogen level of female mutant is starkly lower than normal female mouse in estrus.This lacks cycle in estrus unanimity in the former.In preoestrus, estrus, metaoestrus, and the wild type estradiol level of anoestrum shows normal cyclical level (Figure 13).

GnRH level and wild type animal are comparable in the hypothalamus.This shows that sudden change is for the synthetic (not shown) that do not influence of the GnRH of knock-out mice.

B) LH/FSH experiment

Much lower (Figure 14 a is female to FSH in the mutant; Figure 14 b is male).The LH level does not have the difference (not shown).

C) exogenous promoting sexual gland hormone.

Administration 1000iu PMS (conceived mare serum-FSH-sample promoting sexual gland hormone) gave 1000iu bHCG (β human chorionic gonadotrophin) in back two days, cause 50% female mutant (n=6) to discharge mature egg, show that described terminal organ (end organ) keeps the aitiogenic ability of natural promoting sexual gland hormone.This with GPR54 acceptor and part at hypophysis hypothalamus axle but not inferring of working of terminal organ's level is consistent.

3) the exogenous GnRH of administration and to the influence of hypophysis FSH and LH secretion

Method: divide four minor ticks to inject in 30 minutes 25ng GnRH peptide, and inject back 30 minutes execution animals to collect blood and hypophysis at last.All mouse are put to death between the 1pm at 11am.

The animal grouping: 6WT only injects PBS (contrast), and 6WT is infused in the GnRH for preparing among the PBS, and 6HP injects GnRH/PBS.All WT animals are used by stages and in anoestrum (LH and FSH peak latter stage).All mouse are the 2-4 monthly age.Repeat described process and measure LH and FSH.

The serum FSH experiment: the serum FSH of the WT of injection GnRH than those increases 1.9-that only injects PBS doubly.The HP level increases by 1.7 times than the WT that only injects PBS, and this shows that described mutant animal keeps at least GnRH being had partial reaction.This effect that shows GPR54 can discharge control by the GnRH in the hypothalamus.

The serum Lh experiment: the serum Lh of the WT of injection GnRH than those increases 5-that only injects PBS doubly.The HP level increases by 500 than the WT that only injects PBS.This shows the release of LH, and (Figure 15 a) stimulates by exogenous GnRH.

The exogenous consumption that stimulates the back to measure LH level in the hypophysis.The result shows the corresponding consumption of hypophysis LH level, shows that mutant is still to GnRH and the LH that discharges from hypophysis respond (Figure 15 b).Knock out gene without any deleterious effect from mutant.

All public publications mentioned above are included in this paper as a reference.Described method and system various modifications and change obviously to those skilled in the art, and do not depart from the scope of the invention and spirit.Although the present invention is described according to concrete preferred embodiment, should understands claim of the present invention and be not limited to described specific embodiments.In fact, the various variations of putting into practice described pattern of the present invention are that chemistry, molecular biology and biotechnology or various equivalent modifications are conspicuous, and intention comprises in the claims.

Claims (6)

1. identify and be suitable for treatment or alleviate reproductive disease or reproductive hormone relevant disease, as hormone replacement therapy (HRT), be used to the method handling the sex hormone axle of animal or be used to regulate the molecule of fertility and sexual desire, described method comprises measures whether candidate molecules is the activator or the antagonist of GPR54 polypeptide, described GPR54 polypeptide comprises Genbank accession number AF 343725, NM_032551, AY029541, NT_011255, NM_053244, BC016531, AK039628, NT_039496, the amino acid sequence of nucleic acid sequence encoding shown in AF343726 or the BB261471 or have the sequence of at least 90% sequence homogeneity with it.

2. have transgenic nonhuman animal or its isolated cells of the endogenous GPR54 gene that function destroys or be organized in the activator of identifying the GPR54 polypeptide or the method for antagonist in purposes, wherein said GPR54 gene comprises Genbank accession number AF 343725, NM_032551, AY029541, NT_011255, NM_053244, BC016531, AK039628, NT_039496, nucleotide sequence shown in AF343726 or the BB261471 or have the sequence of at least 90% sequence homogeneity with it, the activator of described GPR54 polypeptide or antagonist are used for the treatment of or alleviate reproductive disease or reproductive hormone relevant disease, as hormone replacement therapy (HRT), be used to handle the sex hormone axle of animal or be used to regulate fertility and sexual desire, wherein said GPR54 polypeptide comprises Genbank accession number AF 343725, NM_032551, AY029541, NT_011255, NM_053244, BC016531, AK039628, NT_039496, the amino acid sequence of nucleic acid sequence encoding shown in AF343726 or the BB261471 or have the sequence of at least 90% sequence homogeneity with it.

3. according to the purposes of claim 2, wherein said transgenic nonhuman animal is a rodent, preferred mouse.

4. according to each method in the claim 1,2 or 3, wherein said activator or antagonist comprise immunoglobulin (Ig), the preferred antibody that can combine with the GPR54 polypeptid specificity, described GPR54 polypeptide has Genbank accession number AF343725, NM_032551, AY029541, NT_011255, NM_053244, BC016531, AK039628, NT_039496, the amino acid sequence of nucleic acid sequence encoding shown in AF343726 or the BB261471 or have the sequence of at least 90% sequence homogeneity with it.

5.GPR54 the purposes of the activator of polypeptide in pharmaceutical compositions, described GPR54 polypeptide has Genbank accession number AF343725, NM_032551, AY029541, NT_011255, NM_053244, BC016531, AK039628, NT_039496, the amino acid sequence of nucleic acid sequence encoding shown in AF343726 or the BB261471 or have the sequence of at least 90% sequence homogeneity with it, wherein said pharmaceutical composition is used for the treatment of reproductive disease or reproductive hormone relevant disease in individuality, as hormone replacement therapy (HRT), be used to handle the sex hormone axle of animal or be used to regulate fertility and sexual desire.

6. according to the method or the purposes of aforementioned arbitrary claim, wherein said reproductive disease or reproductive hormone relevant disease are selected from the group that following disease is formed: fertility disease and sexual desire disease, the adjusting of fertility, birth control, sexual desire and pubarche, lactation, osteoporosis/osteopetrosis, menelipsis comprises the hormone imbalances that menelipsis is relevant, hormonal dependent cancer and benign prostatauxe.

Images