CN101171333A - Improved cellulases - Google Patents

Improved cellulases Download PDF

Info

Publication number
CN101171333A
CN101171333A CNA2006800147508A CN200680014750A CN101171333A CN 101171333 A CN101171333 A CN 101171333A CN A2006800147508 A CNA2006800147508 A CN A2006800147508A CN 200680014750 A CN200680014750 A CN 200680014750A CN 101171333 A CN101171333 A CN 101171333A
Authority
CN
China
Prior art keywords
cellulase
fusion protein
cbd
aminoacid sequence
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2006800147508A
Other languages
Chinese (zh)
Other versions
CN101171333B (en
Inventor
亚里·韦赫曼佩雷
泰尔希·普拉宁
莱纳·瓦尔塔卡里
亚尔诺·卡利奥
玛丽卡·阿拉普拉内恩
玛丽亚·帕洛黑莫
彭蒂·奥亚帕洛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AB Enzymes Oy
Original Assignee
AB Enzymes Oy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US11/119,526 external-priority patent/US7741093B2/en
Application filed by AB Enzymes Oy filed Critical AB Enzymes Oy
Priority claimed from PCT/FI2006/050161 external-priority patent/WO2006117432A1/en
Publication of CN101171333A publication Critical patent/CN101171333A/en
Application granted granted Critical
Publication of CN101171333B publication Critical patent/CN101171333B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38645—Preparations containing enzymes, e.g. protease or amylase containing cellulase
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • D—TEXTILES; PAPER
    • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
    • D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
    • D06M16/00—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Textile Engineering (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Detergent Compositions (AREA)
  • Peptides Or Proteins (AREA)
  • Chemical Or Physical Treatment Of Fibers (AREA)

Abstract

The present invention provides novel cellulase fusion proteins, preparations of cellulase fusion proteins and com- positions of cellulase fusion proteins. The present invention further provides cellulase expression vectors, host cells expressing cellulase and methods for preparing such vectors and cells. Uses of cellulases, cellulase preparations and cellulase compositions in the textile, detergent, pulp and paper industries are also provided.

Description

The cellulase that improves
Invention field
The present invention relates to new cellulase fusion protein, the preparation and the composition and method of making the same that contain these cellulase fusion proteins, expression vector, host cell, and the application in textiles, stain remover and paper pulp and paper-making industry of described cellulase, preparation and composition.
Background of invention
Mierocrystalline cellulose is the linear polysaccharide that is linked to each other and form by β-1,4 key by glucosyl residue.At occurring in nature, Mierocrystalline cellulose links to each other with xylogen and hemicellulose usually, for example xylan and glucomannan.Cellulose hydrolysis endonuclease capable hydrocellulose, it can be produced by various bacteriums and fungi.Cellulase is the important enzyme of using of industry, and present year commercially available value is about 1.9 hundred million dollars.In textile industry, cellulase is used to the finishing of jean (denim), thereby causes the granite-wash outward appearance of fashion in biological stone mill (biostoning) process in the jean clothing, and they also are used to, for example, remove fine hair and prevent balling-up on the cotton cloth surface.In the stain remover industry, Mierocrystalline cellulose is used to make color vivid and prevent clothes graying and balling-up.Cellulase also can be used for foodstuffs industry and animal-feed production, and they also have powerful potential in paper pulp and paper industry, for example, makes the draining that ink blok disengages and improves paper pulp from fiber surface in deinking.The wide spectrum of cellulase in industry used and to have been set up comprising different cellulose components and have the demand of the commercialization cellulase goods of suitable function in different pH and temperature range.
The practical application of cellulase often is subjected to the obstruction of the character of the plain enzyme of known fiber, and the plain enzyme of known fiber normally has the cellulase mixture of different activities and substrate specificity.For this reason, carried out multiple trial in the hope of obtaining only to have required active cellulase.The peculiar property of every kind of cellulase makes some enzymes can be more suitable for some intention than other enzyme.Though these enzymes are all different in many aspects, one of most important difference is exactly an optimal pH.Neutral cellulase activity in the scope of pH6-8 is the highest, and alkali cellulose enzyme is then at pH7.5-10, and optimal pH is the acidic cellulase of pH4.5-5.5, has then shown quite low activity level under higher pH value.Neutrality and acidic cellulase are particularly useful in textile industry.In fabric treatment procedure, cellulase can be attacked the cellulose molecular chain from cotton fiber, thereby influences the character of described fabric.
In textile industry, " granite-wash " outward appearance or worn appearance are the interest places of jean manufacturers in recent years always.Traditional granite-wash meeting of using float stone to carry out reduces the intensity of fabric and increases the burden of laundry equpment.Present trend is to trend towards enzyme process jean finishing to handle, and cellulase has been substituted float stone or uses with float stone, to give fabric desirable " wearing and tearing " outward appearance.In check enzyme is handled the infringement that causes clothes and machine and has been reduced and removed from the needs of handling stone.
The cellulase that is used for the jean processing is divided into two big classes usually: acidity and neutral cellulase.Acidic cellulase plays a role neutral cellulase then at pH6-8 at pH4.5-5.5 usually.The acidic cellulase that is used for biological stone mill is mainly derived from Trichodermareesei (Trichoderma reesei) (the sexual form of Hypocrea jecorina (Hypocrea jecorina)), neutral cellulase comprises arthroderma (Melanocarpus), Humicola (Humicola), Thielavia (Thielavia), myceliophthora (Myceliophthora), Fusarium (Fusarium), Acremonium (Acremonium) and golden spore Pseudomonas (Chrysosporium) (Haakana etc. 2004) then from multiple fungi.The enzyme of Trichodermareesei comprises, for example, from glucosides family 5 (EG II, EGII), family 7 (cellobiohydrolase I, CBHI) and family's 12 (EG IIIs, EGIII, Ward etc. 1993) cellulase, and neutral cellulase, great majority are endoglucanase normally, it is from family 45 and family 7 (Henrissat, 1991; Henrissat and Bairoch, 1993).
Cellulase comprises catalyst structure domain/core (CD) of expressing cellulase activity.Except described catalyst structure domain, Cellulase Molecules also can contain one or more cellulose binding domains (CBD), is also referred to as carbohydrate binding domains/module (CBD/CBM), and it can be positioned at the N-or the C-end of described catalyst structure domain.CBD has carbohydrate in conjunction with activity, and can mediate combining of cellulase and crystalline cellulose, but to the very little or not effect for the cellulase hydrolysis active function of soluble substrate of described enzyme.These two kinds of structural domains normally are connected with the joint area of high glycosylation by flexibility.
Because dyestuff is positioned at the surface of fiber, so the cellulase of main attack fiber surface is specially adapted to the granite-wash with the jean of indigo dye and dyeing.When being used to handle cotton fabric, the washing time that neutral cellulase usually need be longer than acidic cellulase.Yet neutral cellulase but will be weaker than acidic cellulase to the aggressiveness effect of cotton, and does not also resemble the acidic cellulase strong to the influence of fabric intensity.Neutral cellulase has the pH scope of broad, and therefore, the pH that produces in biological stone mill process raises to the almost not influence of activity of neutral cellulase.Yet because cellulose treatment also has undesirable effect, for example fibre damage and strength loss are so need seek suitable balance in hope and undesired effect.
Disclosed three kinds of new neutral cellulases that derive from arthroderma by WO97/14804 incorporated by reference in this manual, it is specially adapted to weaving and stain remover industry.20kDa endoglucanase (Cel45A), 50kDa endoglucanase (cel7A) and 50kDa cellobiohydrolase (Cel7B) have been described especially.These cellulases of being appointed as " 20K-cellulase ", " 50K-cellulase " and " 50K-cellulase B " in this article respectively all come from Melanocarpus albomyces, and show good granite-wash effect.
Because to existing demand, especially in weaving and stain remover industry, therefore there is suggestion to think to obtain by the method for formation fusion rotein improvement to cellulase to deeply improving cellulase.Still in WO97/14804, advised prevailingly 20K-cellulase, 50K-cellulase and 50K-cellulase B with for example, the fusion protein construct in trichoderma reesei cellulase, hemicellulase or mannase or its functional structure territory.In addition, for disclosed cellulase is produced new character, also advised the fusion of cellulase and structural domain, described structural domain is cellulose binding domain (CBD) for example, preferably has joint.Yet the disclosure text had not both provided specific embodiment, did not describe institute interested new property place yet.
Equally, cellulase fusion protein also is known, for example, in WO96/29397, it discloses by by the endoglucanase that forms from thermophilic endoglucanase of ruining silk mould (a Myceliophthora thermophila), Kidney bean shell ball spore bacterium (Macrophomina phaseolina) and Crinipellis scabella and fusion from the CBD/ joint of special humicola lanuginosa (Humicola insolens).Described endoglucanase does not have the CBD/ joint in its natural form.
EP 663 950 discloses the varient of cellulase, the 43kD cellulose enzyme variznt of especially special humicola lanuginosa, wherein said cellulase can comprise the connecting zone that comes from another microbe species, for example, for improved character is provided, for example to anion surfactant, to the resistance of the improvement of oxygenant or SYNTHETIC OPTICAL WHITNER.
Yet, in the textile industry of routine use cellulase and in the other field, for equally also causing the demand of the improvement cellulase of less damage to continue to exist to fiber.Particularly, exist lasting demand, to improve process economics for more effective cellulase.
Purpose of the present invention is intended to satisfy this demand.
Summary of the invention
The object of the present invention is to provide the plain enzyme fusion proteins of the improved tencel of hydrolysising property, be used for textile industry, granite-wash jean especially, and can be applicable to detergent compositions and other field.The plain enzyme fusion proteins of tencel of the present invention all has activity under neutral and alkaline pH value, it is in biological fabric finishing (biofinishing) and biological stone mill are used and all have the highly scourability of improvement in detergent applications, but its not entail dangers to the intensity of fabric.Because the efficiency improvement of cellulase fusion protein of the present invention, the manufacture method of described enzyme obviously more economically.When the more a spot of enzyme product of needs, described enzyme product also has extra advantage aspect transportation and sales and the storage.
Another object of the present invention provides the polynucleotide of the plain enzyme fusion proteins of coding tencel of the present invention.
Another purpose of the present invention provides novel expression plasmid or the carrier that contains these class polynucleotide, and it can be used for producing the plain enzyme fusion proteins of tencel of the present invention, and the novel host who transforms with described expression plasmid is provided.
Another purpose of the present invention provides zymin, and it contains one or more and has the plain enzyme fusion proteins of the tencel that improves hydrolysising property.
Another purpose of the present invention provide use described zymin and described cellulase fusion protein be used to repair textiles, in particular for the method for the biological stone mill of jean.
A further object of the present invention provides the mode of using zymin of the present invention in detergent compositions.
The present invention relates to new cellulase fusion protein, it comprises
A. derive from first aminoacid sequence of optional modification of the cellulase core of species, and
B. derive from second aminoacid sequence of the optional modification of the joint of another species and/or cellulose binding domain (CBD),
Wherein, between described first aminoacid sequence and described second aminoacid sequence, introduce connecting zone, thereby obtain stable fusion rotein.
Preferably, described joining region has following general formula:
1A- 2B- 3C- 4D- 5E- 6F
Wherein
1A is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably, 1A is Gly or Val, most preferably is Gly;
2B is selected from Gly, Ala, Leu, Pro, Ile, Phe, Val, Glu, Asp, Gln and Asn; Preferably, 2B is Pro, Gln or Glu;
3C is selected from Gly, Ala, Lys, Leu, Pro, Ile, Val, Ser and Thr; Preferably, 3C is Ile;
4D is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably, 4D is Gly or Pro;
5E is selected from Ser, Pro and Thr; Preferably, 5E is Ser; And
6F is selected from Ser, and Thr or do not exist is preferred, 6F is Ser or does not exist; Wherein 1A be connected in the cellulase core the C-terminal amino acid sequence and 6F is connected in the-terminal amino acid sequence of joint and/or structural domain (CBD).
The invention still further relates to expression vector, it comprises first polynucleotide sequence, its coding derives from first aminoacid sequence of optional modification of the cellulase core of species, and second polynucleotide sequence, its coding derives from second aminoacid sequence of the optional modification of the joint of another species and/or cellulose binding domain (CBD), and coding connects the polynucleotide of the described first and second polynucleotide sequence connecting zones, the corresponding aminoacid sequence of described polynucleotide sequence coding cellulase fusion protein of the present invention.
The invention still further relates to the new host who transforms with carrier of the present invention, host that particularly can high level expression cellulase fusion protein of the present invention.
The invention still further relates to zymin, it contains one or more cellulase fusion proteins of the present invention.
The invention still further relates to and use zymin of the present invention to carry out the method that fabric is repaired, particularly jean carried out biological stone mill.
The invention still further relates to the application of zymin of the present invention in detergent compositions.
Accompanying drawing
Fig. 1 is the synoptic diagram of plasmid pALK1480.
Fig. 2 is the synoptic diagram of plasmid pALK492.
Fig. 3 is the synoptic diagram of plasmid pALK424.
Fig. 4 is the synoptic diagram of plasmid pALK1237.
Fig. 5 is the synoptic diagram of plasmid pALK1241.
Fig. 6 is the synoptic diagram of plasmid p3SR2.
Fig. 7 is the synoptic diagram of plasmid pALK1649.
Fig. 8 is the synoptic diagram of plasmid pALK1694.
Fig. 9 A is depicted as the expression cassette of the Trichodermareesei protoplast transformation that is used to produce the 20K+CBD fusion rotein.Described 20K+CBD gene is under the control of cbh1 (cel7A) promotor (cbh1 promotor), and by using cbh1 terminator sequence (terminator) to guarantee the termination of transcribing.It has also comprised amdS gene (amdS) and cbh1 3 ' flank region (cbh1 3 ' flank).Fig. 9 B is depicted as the aminoacid sequence of tie point, at this, Melanocarpus albomyces20K (Cel45A) albumen is fused to back in pALK1434 and the pALK1435 plasmid and follows on the joint peptide of Trichodermareesei CBHI (cel7A) of cellulose binding domain (CBD).The amino acid that joint area comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone is by the subscript numeral.
Figure 10 A is depicted as the expression cassette of the Trichodermareesei protoplast transformation that is used to produce the 20K+CBD fusion rotein.Described 20K+CBD gene is under the control of cbh1 (cel7A) promotor (cbh1 promotor), and by using cbh1 terminator sequence (terminator) to guarantee the termination of transcribing.It has also comprised amdS gene (amdS) and cbh1 3 ' flank region (cbh1 3 ' flank).Figure 10 B is depicted as the aminoacid sequence of tie point, at this, Melanocarpus albomyces20K (Cel45A) albumen is fused to back in pALK1768, pALK1769, pALK1770 and the pALK1775 plasmid and follows on the joint peptide of Trichodermareesei CBHI (cel7A) of cellulose binding domain (CBD).The amino acid that joint area comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone is by the subscript numeral.
Figure 11 A is depicted as and is used to produce 20K+CBD MutThe expression cassette of the Trichodermareesei protoplast transformation of fusion rotein.Described 20K+CBD MutGene is under the control of cbh1 (cel7A) promotor (cbh1 promotor), and by using cbh1 terminator sequence (terminator) to guarantee the termination of transcribing.It comprises that also the amdS gene is as transformation marker.Figure 11 B is depicted as the aminoacid sequence of tie point, and at this, Melanocarpus albomyces 20K (Cel45A) albumen is fused to the back and follows on the joint peptide of Trichodermareesei CBHI (cel7A) of cellulose binding domain (CBD) on the described tie point.Aminoacid replacement in the CDB zone of pALK1877-pALK1880 expression cassette is also presented.The amino acid that joint area comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone and tyrosine residues or its substituent are by the subscript numeral.
Figure 12 A is depicted as the aminoacid sequence of joint peptide between Trichodermareesei CBHI (cel7A) territory.The amino acid that joint area comprised underscore mark.Δ G-444 and Δ G-460 represent the joint disappearance of residue 434-444 and 434-460 respectively.Figure 12 B is depicted as the aminoacid sequence of tie point, at this, Melanocarpus albomyces 20K (Cel45A) albumen is fused in pALK1893, pALK1896, pALK1899 and pALK1952 expression cassette back and follows on the joint peptide that the Trichodermareesei CBHI (cel7A) of the cellulose binding domain (CBD) of complete or sudden change blocks, and is afterwards.The amino acid that connecting zone comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.Pass through the subscript numeral on first amino acid in described CBD zone and tyrosine residues or its substituent.
Figure 13 A is depicted as the expression cassette of the Trichodermareesei protoplast transformation that is used to produce the 50K+CBD fusion rotein.Described 50K+CBD gene is under the control of Trichodermareesei cbh1 promotor (cbh1 promotor), and guarantees the termination of transcribing by adding cbh1 terminator (terminator).It has also comprised amdS gene (amdS) and cbh1 3 ' flank region (cbh1 3 ' flank).Figure 13 B is depicted as the aminoacid sequence of the Melanocarpus albomyces50K tie point that is connected in Trichodermareesei CBHI joint+CBD.The amino acid that connecting zone comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone is by the subscript numeral.
Figure 14 A is depicted as the expression cassette of the Trichodermareesei protoplast transformation that is used to produce the 50KB+CBD fusion rotein.Described 50KB+CBD gene is under the control of Trichodermareesei cbh1 promotor (cbh1 promotor), and has guaranteed the termination of transcribing by adding cbh1 terminator (terminator).It has also comprised amdS gene (amdS) and cbh1 3 ' flank region (cbh1 3 ').Figure 14 B is depicted as the aminoacid sequence of the Melanocarpus albomyces 50KB tie point that is connected in Trichodermareesei CBHI joint+CBD.The amino acid that joint area comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone is by the subscript numeral.
Figure 15 A is depicted as and is used to produce the expression cassette that Trichodermareesei protoplastis preparation reorganization orange thermophilic ascomycete (Thermoascus aurantiacus) CBHI+CBD fusion rotein transforms.Described CBHI+CBD gene is under the control of cbh1 (cel7A) promotor (cbh1 promotor), and by using cbh1 terminator sequence (terminator) to guarantee the termination of transcribing.It comprises that also the amdS gene is as transformation marker.Figure 15 B is depicted as the aminoacid sequence of tie point, and at this, orange thermophilic ascomycete CBHI albumen is fused to the back and follows on the joint peptide of Trichodermareesei CBHI of cellulose binding domain (CBD).The amino acid that joint area comprised underscore mark, the aminoacid sequence in CBD zone are then by the italic mark.First amino acid in described CBD zone is by the subscript numeral.
Figure 16 shows that bacterial strain RF5977 and RF6090 and the performance comparison of commercialization 20K preparation in jean is handled of expressing fusion rotein of the present invention.In embodiment 8 and 9 described wash conditions, the rising of brightness is the function of enzyme dosage.
Figure 17 shows that 20K+CBD fusion rotein and of the influence of corresponding commercialization zymin to the intensity of jean fabric.Figure 17 A tear strength (N), warp thread.Figure 17 B tear strength (N), weft yarn.
Figure 18 has shown the anti-pilling effects of 20K+CBD fusion rotein.
Figure 19 illustrates the performance of 20K+CBD fusion rotein in detergent applications.Described figure has shown the color-match difference between anti-grey goods 224 that use or do not use described enzyme washing and starting materials (not washing); A is at 40 ℃, and B is at 60 ℃.
Figure 20 illustrates the performance of 20K+CBD fusion rotein in detergent applications.Described figure has shown and is using enzyme and do not using color-match difference between the anti-putty material 224 of enzyme washing; A is at 40 ℃, and B is at 60 ℃.
The detailed description of invention
The present invention is based on further improvement neutral cellulase, especially those are in the work of the neutral cellulase described in the WO97/14804, and its purpose is to reduce the loss of described fabric intensity in the enzyme processing procedure. In some applications, perhaps be that the 20K cellulase has shown undesirable character of relevant fibre strength because its size is smaller. A kind of simple hypothesis thinks that the size increase of enzyme might reduce the ability that described enzyme penetrates into fiber, thereby will be reduced to less degree to the reduction of fiber, that is, the offensiveness of described enzyme a little less than. For this reason, adopt the fusion method of in WO97/14804, advising, and designed the neutral cellulase core that comprises the ascus bacterial classification and the fusion constructs of the afterbody that formed by joint/CBD of the acid fiber disaccharide-hydrolysing enzymes I of trichoderma reesei. Yet, amazingly be, opposite with the suggestion of prior art, can not obtain completely stable fusion protein construct, but fusion partner is separated from one another at condition of culture. The chances are for this because the existence of protease.
In order to produce stable fusion, a kind of method be design and do not have adjacent hydrophobic amino acid (for example, V, the novel connection construct that I, L, F are connected with W, thus prevent the cutting that caused by aspartyl protease. Yet even described construct produces fusion, you observe some degraded when still understanding.
Based on to the natural comparison that contains the neutral cellulase of joint/CBD afterbody, produced other construct, and these constructs finally are proved to be the most stable and are best suited for further check. In addition, also designed the fusion constructs that in CBD, carries sudden change, caused reducing or minimizing (Linder etc., 1995) for cellulosic compatibility or adsorption capacity.
New constructs has produced the intensity property of improving, purpose that Here it is. Surprisingly, described stable cellulase fusion protein has also shown unexpected improvement in addition in scourability, renders a service even up to 6 times of its " parent " cellulase. Yet its output but remains on the roughly the same level. This means that the sixth that only needs the cellulase activity amount now just is enough to the scourability that reaches identical with the prior art cellulase. This and has produced the saving of certain degree in transportation and sales with in preserving in production stage, thereby has reduced the burden of environment. Equally, also reduce undesirable effect of cellulase preparation, thereby brought further saving for the end user of enzyme preparation. Consider that every annual meeting produces about 2,000,000,000 pairs of jean jeans, and its great majority repair through cellulase all, its advantage is very remarkable.
Therefore, the invention provides a kind of new cellulase fusion protein, it comprises
A. derive from species the cellulase core optional modification the first amino acid sequence and
B. derive from the second amino acid sequence of the optional modification of the joint of another species and/or cellulose binding domain (CBD),
Wherein, between described the first amino acid sequence and described the second amino acid sequence, introduce join domain, thereby obtain stable fusion.
In a preferred embodiment of the invention, described join domain has following general formula:
1A- 2B- 3C- 4D- 5E- 6F
Wherein
1A is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably,1A is Gly or Val, most preferably is Gly;
2B is selected from Gly, Ala, Leu, Pro, Ile, Phe, Val, Glu, Asp, Gln and Asn; Preferably,2B is Pro, Gln or Glu;
3C is selected from Gly, Ala, Lys, Leu, Pro, Ile, Val, Ser and Thr; Preferably,3C is Ile;
4D is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably,4D is Gly or Pro;
5E is selected from Ser, Pro and Thr; Preferably,5E is Ser; And
6F is selected from Ser, and Thr or do not exist is preferred,6F is Ser or does not exist; Wherein1A be connected in the cellulase core the C-terminal amino acid sequence and6F is connected in the-terminal amino acid sequence of joint and/or domain (CBD).
In a particular preferred embodiment of the present invention, described join domain has following general formula:
1Gly- 2B- 3Ile- 4D- 5Ser- 6F
Wherein
2B is Pro, Gln or Glu;
4D is Gly or Pro;
5E is Ser; And
6F is Ser or does not exist.
In another particular preferred embodiment of the present invention, described connecting zone has following general formula:
1Val- 2Gln- 3Ile- 4Pro- 5Ser- 6Ser。
In another particular preferred embodiment of the present invention, described connecting zone has following general formula:
1Gly- 2Glu- 3Ile- 4Gly- 5Ser。
In another particular preferred embodiment of the present invention, described connecting zone has following general formula:
1Gly- 2Pro- 3Ile- 4Gly- 5Ser。
In a preferred embodiment of the invention, described first aminoacid sequence from neutral cellulase and described second aminoacid sequence from acidic cellulase.
In another preferred embodiment of the present invention, described first aminoacid sequence is from the cellulase of family 45 (Cel 45) and described second aminoacid sequence cellulase from family 7 (Cel 7).
As using in this article, the statement of " cellulase core " or " core " is meant the catalyst structure domain/core (CD) of the enzyme of expressing cellulase activity.Such catalyst structure domain can be its naturally occurring form (being complete form), and is perhaps preferred, carries out following modification.The statement of " derivative " and functional varient is meant the identical cellulase activity of expression but comprises following modified polypeptides.
Conventional single-letter amino acid code and trigram amino acid code have been used in this article.Therefore, A and Ala are meant L-Ala, and R and Arg are meant arginine, N and Asn are meant l-asparagine, D and Asp are meant aspartic acid, and Cys and C are meant halfcystine, and E and Glu are meant L-glutamic acid, Q and Gln are meant glutamine, G and Gly are meant glycine, and H and His are meant Histidine, and I and Ile are meant Isoleucine, L and Leu are meant leucine, K and Lys are meant Methionin, and M and Met are meant methionine(Met), and F and Phe are meant phenylalanine, P and Pro are meant proline(Pro), S and Ser are meant Serine, and T and Thr are meant Threonine, and W and Trp are meant tryptophane, Y and Tyr are meant tyrosine, and V and Val are meant Xie Ansuan.Except naturally occurring L-amino acid, can also use D-amino acid.
In cellulase fusion protein of the present invention, described neutral cellulase is originated from fungus preferably.Described neutral cellulase can derive from arthroderma (Melanocarpus), Humicola (Humicola), Thielavia (Thielavia), myceliophthora (Myceliophthora), Fusarium (Fusarium), Acremonium (Acremonium), gold spore Pseudomonas (Chrysosporium), thermophilic Pseudomonas (Thermoascus), the mould genus of broom (Scopulariopsis), Myriodontium (Myriococcum), Talaromyces (Talaromyces) or Chaetomium (Chaetomium).Particularly preferably be the ascomycetes subspecies, particularly preferred Melanocarpus albomyces.The acidic cellulase that is used for cellulase fusion protein of the present invention comes from mould subspecies of wood or meat seat bacterium (Hypocrea), especially from Trichodermareesei.
In a particularly preferred embodiment of the present invention, first aminoacid sequence is the Melanocarpus albomyces 20K cellulase or derivatives thereof of SEQ ID.NO:2, and second aminoacid sequence is joint and/or the CBD or derivatives thereof of the Trichodermareesei cellobiohydrolase I of SEQ ID.NO:4.
In a preferred embodiment of the invention, described cellulase fusion protein contains modification in the cellulase core and/or in joint and/or CBD.With in this article, the statement of " modification " is meant sudden change, for example one or more amino acid whose disappearances, insertion or replacement, or other modifications, for example glycosylation.The example that this class is modified comprises the use aliphatic amino acid, be preferably L-Ala, and/or die aromatischen Aminosaeuren, tryptophane for example, replace the conservative tyrosine residues on the CBD 31 (corresponding to the tyrosine Y492 of mature polypeptide) and/or 32 (corresponding to the tyrosine Y493 of mature polypeptide) of Trichodermareesei CBHI, as described in Linder etc. 1995.Suddenly change other example of this class comprises between the joint of 1993 described Trichodermareesei CBHI such as Srisodsuk and suddenling change, for example the disappearance of 434-444 position and 434-460 amino acids in the wooden mould CBHI sequence of maturation.Other examples of this class sudden change also comprise in the Melanocarpusalbomyces 20K cellulase sequence of SEQ ID.NO:2 the replacement of 207 disappearances that go up Ala, 208 disappearances that go up Val, Phe209Trp and the insertion of Pro after 206.
Cellulase fusion protein of the present invention is stable.In content of the present invention, the statement of " stable cellulase fusion protein " is meant at least 20%, be preferably at least 40%, more preferably at least 70%, most preferably be the cellulase fusion protein that 90-100% produces and contain the connecting zone that between aminoacid sequence, is not cut during the fermentation.This means 20%-100%, be preferably 40%-100%, more preferably the cellulase that 70%-100% produced all has first and second aminoacid sequences that merge.It can itself be stable that the statement of " stable cellulase fusion protein " can also refer to described cellulase fusion protein preparation, maybe can pass through, for example thermal treatment or regulate pH or by adding stablizer or reducing the reagent of protein-active or by from culture, dividing isolated fusion protein to be stablized.In this article, thermal treatment is meant and can allowing fusion rotein in the preparation to keep the processing of carrying out under the fully stable temperature.Described thermal treatment can be for example, to handle 60-70 minute at 65 ℃ at pH6.0.
In this article, the expression of " complete fusion rotein " is meant that in fusion rotein of the present invention, the connection between first and second aminoacid sequences is kept perfectly, although terminal degraded may maybe can not occur in described sequence.
In a preferred embodiment of cellulase fusion protein of the present invention, described first aminoacid sequence is the Melanocarpusalbomyces 20K sequence with SEQ ID.NO:2 or its functional varient.In another preferred embodiment, described first aminoacid sequence is the Melanocarpus albomyces 50K sequence with SEQ ID.NO:6 or its functional varient.In another preferred embodiment, described first aminoacid sequence is the Melanocarpus albomyces 50KB sequence with SEQ ID.NO:8 or its functional varient.In another preferred embodiment, described first aminoacid sequence is the orange thermophilic ascomycete CBHI sequence with SEQ ID.NO:10 or its functional varient.In the preferred embodiment of another cellulase fusion protein of the present invention, described second aminoacid sequence is the joint with SEQ ID.NO:4 and the cellulose binding domain sequence of Trichodermareesei cellobiohydrolase I or its functional varient.
Therefore in cellulase fusion protein highly preferred embodiment of the present invention, first aminoacid sequence of described cellulase core is selected from SEQ ID.NO:37,38,39,40,41,42 and 43, SEQ ID.NO:39 particularly, second aminoacid sequence of joint and/or CBD sequence then is selected from SEQ ID.NO:44,45,46,47,48,49 and 50.In particular of the present invention, first aminoacid sequence of described cellulase core is SEQ ID.NO:39, and second aminoacid sequence of joint and/or CBD sequence then is SEQ ID.NO:47,49 and 50.
The invention still further relates to expression vector, described carrier comprises first polynucleotide sequence, the optional described cellulase core of first aminoacid sequence of modifying of the described first polynucleotide sequence coding cellulase core derives from a certain species, also comprise second polynucleotide sequence, second aminoacid sequence of the optional modification of described second polynucleotide sequence coding joint and/or cellulose binding domain (CBD), described joint and/or cellulose binding domain (CBD) derive from another species, comprising that also coding connects the polynucleotide of the described first and second polynucleotide sequence connecting zones, described polynucleotide encoding is the amino acid sequence corresponding that specifically defines of institute as above.
The invention still further relates to cellulase preparation, other enzymes and additive that it can only contain one or more cellulase fusion proteins of the present invention or add the application-specific of determining according to quasi-solution.
The invention still further relates to for following disclosed especially purpose, use the purposes and the method for cellulase fusion protein preparation of the present invention.
Cellulase fusion protein preparation of the present invention is specially adapted to weaving and stain remover industry.These cellulases show the abrasive effect of highly improvement and the raising of visible and measurable brightness.It is the same good that they show the focusing contrast of dying (backstaining) for acceptable time and being produced with biological stone mill.It carries out the biology finishing applicable to textile industry to fabric or clothes, for example, remove ball, unhairing, clear look, reduce rough degree, produce different finishing (for example, ' peach face ', ' shabby ', ' sand is washed ' or ' antiquated ' effect), and the biology finishing that is used for yarn, for example reduce fluffing and improve smoothness.Having the good like this ball character of going is unusual for neutral cellulase, all is acid hydrolase usually because be used for the enzyme of industrial biological finish applications.Have the splendid neutral cellulase of ball character that goes and in dyeing course, to carry out biology finishing processing simultaneously, obtain the saving of certain degree as the 20K+CBD fusion rotein.Equally, the stability of color also normally is better than under the acidic conditions under neutrallty condition.Other purposes is included in and is used for detergent compositions, by anti pilling, anti-burnt hair, clear look and soften and improve fabric nursing character, and improves the cleaning effect of fabric, for example decontamination.
With in this article, " biological stone mill " this statement of fabric or clothes is meant uses enzyme to substitute float stone, or adds in the float stone, fabric or clothes is handled, particularly to jean.
With in this article, the statement of " biological finishing " is meant under controlled cellulosic fibre hydrolysising condition uses enzyme, thereby with prevent permanent balling-up, improve fabric feeling for example flexibility and slipperiness, modify fabric or yarn surface by the mode that reduces the fluffing clean surface structure, this has caused the purification of color, improved the drape of fabric, improve water absorbability, but can also improve dyeability.
With in this article, the statement of " return and dye " is meant that the dyestuff that discharges is deposited in the trend on fabric fibre surface again.
With in this article, the statement of " stain remover " is meant sanitising agent, it can contain tensio-active agent (negatively charged ion, nonionic, positively charged ion and amphoterics), builder and other optional ingredients, for example anti-redeposition and spot suspension agent, the agent of optics brilliant white, SYNTHETIC OPTICAL WHITNER, dyestuff and pigment and lytic enzyme.The stain remover composition inventory that is fit to sees United States Patent (USP) the 5th, 433, and No. 750, the inventory of the tensio-active agent that is fit to sees United States Patent (USP) the 3rd, 664, No. 961.
Be that the aminoacid sequence of " equivalent " or " derivative " of special aminoacid sequence is meant that described aminoacid sequence and specific aminoacid sequence are inconsistent, partial amino-acid changes (disappearance but contain at least, replace, oppositely, insert etc.), when as application-specific, described change is compared with the similar activity of described specific amino acids sequence, does not influence proteic biologic activity substantially.
The biologic activity of cellulase is meant its catalytic activity, and/or it is incorporated into the ability of cellulose materials.
Expression vector is after being transformed into desirable host, can express cloned plasmids or the carrier of the DNA of coding cellulase fusion protein of the present invention.When using fungal host, preferably provide goal gene to fungal host, as a part that is integrated into chromosomal clone of fungi or expression vector, or make goal gene be integrated into host chromosome, or as self-replicating type plasmid.In integration process, also can integrate with described DNA as the sequence of a cloning vector or an expression vector part.In addition, in fungi, described expression vector or its part can also be decided in predetermined locus by target.
Some control sequence of being provided by described carrier (itself and goal gene are integrated) for example under the control of promoter sequence (that is, can operate with it connect) equally preferably is provided the DNA of fusion rotein of the present invention of encoding.Perhaps, described control sequence can be that those are positioned at the sequence of inserting the site.
Whether be designed in protokaryon or eucaryon host to express certain gene (for example, shuttle vectors can be provided for the gene selected in host bacterium) according to described carrier, the expression control sequenc of expression vector is also different.Expression control sequenc can contain transcription regulatory element, promotor for example, enhancer element, and transcription termination sequence, and/or translation adjusting element, for example translation initiation and termination site.
Polynucleotide molecule, DNA for example, if it contains the expression control sequenc that comprises transcriptional control information, and these sequences are nucleotide sequences of " operationally being connected in " coded polypeptide, then, it can be considered to " can express " polypeptide.
Exercisable connection is such connection, and wherein a kind of sequence is connected in by this way regulates sequence (or sequence), and the expression that is about to described sequence places under the influence or control of regulating sequence.Two kinds of dna sequence dnas (for example being connected in the terminal promoter region sequence of albumen coded sequence 5 ') if the function of promotor has caused transcribing, then can be called and are operably connected.
Carrier of the present invention can also comprise the regulatory element that other can be operatively connected, for example enhancer sequence.
In a preferred embodiment, made up the transformant of inheritance stability, thereby by using carrier to transform, the DNA of coding cellulase fusion protein of the present invention is integrated into host chromosome, and described carrier contains and starts the sequence of described vector integration in the karyomit(e).
The cell of DNA that in its karyomit(e), has the stable integration of code book invention cellulase fusion protein, by introducing one or more homologies or allogenic mark screens, it allows screening to contain the host cell of expression vector in karyomit(e), for example, described mark can provide the biocide resistance, for example to microbiotic or the heavy metal resistance of copper for example, or the mark of extra-nutrition defective type sudden change in host chromosome or the like.Described selectable marker gene or can be directly connected in the DNA gene order that will express maybe can import identical cell by cotransformation.
Be used for expressing in case prepared the carrier of the present invention or the dna sequence dna that contain construct, can close various suitable modes, comprise conversion as known in the art, described DNA construct is imported appropriate host cell by appointing.After importing described carrier, recipient cell to be grown in selecting substratum, it can screen the growth of transformant.
Suitable expression and produce host system and be, for example, at the production system of fungal host wood mould (EP 244234) exploitation, or aspergillus (Aspergillus) production system, for example aspergillus oryzae (A.oryzae) or aspergillus niger (A.niger) (WO9708325 and WO9533386, US 5,843,745, US 5,770,418), or at fusarium, the production system (Malardier etc., 1989) of for example sharp spore reaping hook mould (Fusarium oxysporum) exploitation.The production system that is fit to of directed toward bacteria exploitation is the production system at bacillus (Bacillus) exploitation, subtilis (B.subtilis) or for example at intestinal bacteria (E.coli), or at the production system of ray fungi streptomycete (Streptomyces) exploitation.The production system that is fit at the yeast exploitation is the system that develops at Saccharomycodes (Saccharomyces), Schizosccharomyces (Shizosaccharomyces) or pichia spp (Pichia pastoris).Production system in some other microorganism or mammalian cell or plant also is possible.
The expression of described clone gene sequence has caused desired proteic generation, or the generation of this protein fragments.This expression can the successive form, or with in check form, takes place in transformant.
Fragment can be understood as length be enough to the to encode part of nucleic acid molecule of described albumen or its biological active fragment.Term " derivative " is meant that in this manual the nucleotide sequence of these molecules is different on one or more positions with the sequence of above-mentioned nucleic acid molecule, and with described sequence height homology.Homology can be regarded as and is meant at least 40% sequence identity, is in particular at least 60% consistence, is preferably above 80% and more preferably above 90%.The deviation of above-mentioned nucleic acid molecule can be the result of disappearance, replacement, insertion, adding or its combination.Homology can refer to that also other nucleotide sequence of branch or encoded protein are that function and/or structure are equal to.
Be used in this paper, the statement of " zymin " and " cellulase preparation " is meant enzyme preparation arbitrarily, and it contains at least a cellulase fusion protein.Therefore, such zymin can be substratum that exhausts or the filtrate of containing one or more cellulase fusion proteins or containing one or more cellulase fusion proteins and other enzymes, the mixture of the mixture of isolating cellulase fusion protein or one or more cellulase fusion proteins or one or more cellulase fusion proteins and one or more other enzymes.Except the cellulase fusion protein activity, such preparation also can contain additive, for example stablizer, buffer reagent, sanitas, tensio-active agent and/or medium component.Preferred additives is that those are generally used for supplying the additive in the zymin of usefulness, uses zymin in described application.Described zymin can be liquid, powder or particle form.
Here " substratum that exhausts " is meant host's substratum of the enzyme that contains generation.Preferably, described host cell is to produce to finish to separate with described substratum afterwards.
Described zymin can comprise that one or more cellulase fusion proteins of the present invention or other cellulases add one or more cellulase fusion proteins of the present invention.For example, can will have cellulase fusion protein combination of different nature, thereby prepare the zymin that is applicable to more under the different condition.
In order to obtain zymin of the present invention, can cultivate under suitable condition have desired character the host (promptly, can the economic host who expresses the cellulase fusion protein of the present invention of viable quantities), desirable enzyme can be secreted into the substratum from the host, and reclaims described zymin by means commonly known in the art from described substratum.
Described zymin also can comprise one or more other enzymes except cellulase fusion protein, and it can be for example amylase, laccase and/or peroxidase.Perhaps, can use cellulase fusion protein of the present invention handle before, among or afterwards, carry out another kind of enzyme and handle.Described enzyme is handled and can be comprised, for example, one or more amylase are handled, and one or more cellulose treatment and/or one or more peroxidases are handled and/or laccase is handled.Which other enzyme can be included in the zymin or can be used for will deciding according to application in the enzyme processing.
Described zymin can be the substratum that contains or do not have natural or transformed host cell, or by using approach well known to get from wherein reclaiming.Yet, because cellulase fusion protein of the present invention is secreted in the substratum, and can show activity under the envrionment conditions of cellulosic hydrolysate, advantage of the present invention is that zymin of the present invention can directly be utilized from substratum, need not further purification.If necessary, this class preparation can be frozen drying or the activity of and/or stabilized enzyme concentrated for preservation.Zymin of the present invention provide and use very economical because (1) described enzyme can the raw product form is used; Must from substratum, not separate specific enzyme and (2) and just can obtain needed zymin because described enzyme secretion in substratum, only needs to reclaim substratum; Do not need from the host, to extract enzyme.Preferably, the host who is suitable for this class production is that wood is mould, especially Trichodermareesei.
Zymin of the present invention can be used as liquid or solid and provides, for example with dry powder or particle or liquid form, particularly non-pulverizing particle, or stable liquid, perhaps described zymin also can concentrate separately or be stable so that preserve or use.Can predict, further enrichment or in partially or completely lacking the certain enzyme activity, be prepared of the zymin that contains one or more neutral cellulases of the present invention, thus in multiple application, for example in textile industry, satisfy the requirement of specific use.By host's mixture of the enzymic activity of fungus secretion particularly, can in specific industrial application, be selected for use valuably in the biological example stone mill.
Can regulate zymin of the present invention, thereby satisfy in weaving, stain remover or paper pulp or paper industry, the requirement of special requirement under the various application.
Can use not exclusively be other macromole of producing from identical host (for example, other enzymes are endoglucanase for example, proteolytic enzyme, lipase, peroxidase, oxydase or amylase) chemical substance that maybe can strengthen performance, stability or the surge capability of desirable zymin prepares adulterant.Can also carry out dressing to the non-pulverizing particle.According to existent method, can for example propylene glycol, sugar or sugar alcohol, lactic acid or boric acid or sodium-chlor come the stabilising liq zymin by adding dibasic alcohol.
Can be according to EP 238,216, prepare the protection form of enzyme of the present invention.
Zymin of the present invention can contain tensio-active agent, and it can be the mixture of anionic, non-ionic, cationic, zwitterionic or these types, particularly when being used as detergent compositions.The available detergent compositions is recorded in, and for example, WO 94/07998, United States Patent (USP) the 5th, 443,750 and United States Patent (USP) the 3rd, 664,961.
If necessary, can also for example extract according to existence conditions, precipitation, chromatography, affinity chromatography, electrophoresis etc. carry out purifying further to desirable enzyme.
Zymin of the present invention is specially adapted to textile industry, preferably can be used for biological stone mill and biological finishing or stain remover industry.Other fields applicatory are paper pulp and paper industry.
Granite-wash has three steps: destarch, wearing and tearing and aftertreatment.The first step, the destarch process is normally carried out wet treatment first to jeans, this means to have removed starch or other sizing agents that is applied to warp thread usually, to prevent the damage in fabrication processes.Can use α-Dian Fenmei to remove slurry based on starch, be used to improve and wet treatment uniformly.After the destarch, generally use the water rinse jeans or directly continue the wearing and tearing step.
In second step, wearing and tearing can use enzyme or float stone or these two to carry out.In all situations, all need mechanical effect to remove dyestuff, and described processing is normally at washing machine, as what carry out in the drum-type washing machine.Herein, term " wearing and tearing " is meant when using after cellulase or stone or the two handle the outward appearance of jean fabric.Dyestuff is removed uneven result, contrast occurred between pigmented section and the removed zone of dyestuff." granite-wash outward appearance " or " worn appearance " are to agree to express.In enzyme process granite-wash or biological dressing process, use float stone to wear and tear and can omit wholly or in part, promote the wearing and tearing of bipseudoindoxyl dye from the fiber surface and add cellulase.Can use neutrality or acidic cellulase or these two to finish cellulose treatment.If fabric is not process cellulose treatment or granite-wash, then the outward appearance of fabric is known as " dimness ", because the contrast gradient of fashion has disappeared.When needs more obviously fade effect, can use chemical reagent and/or Enzymology method for example laccase handle and bleach.
Normally the 3rd go on foot after the wearing and tearing, aftertreatment, it comprises washing and rinse step, can use stain remover, brightening agent or tenderizer in this step.After enzyme is handled, necessary stopped reaction, to prevent the damage of treated material, for example, by the method for temperature and/or pH deactivation, the latter comprises rinsing completely and/or washes stain remover off.This has guaranteed that the physical strength of fiber can not be subjected to the harm of the lasting enzyme that exists.
For the present invention, " jean " is meant the jean fabric, normally jean clothes, especially jeans.Advantageously described jean is the jean of indigo dyeing.Can use indigo, indigo derivative to handle jean, or use indigo some other dyestuffs jean that dyes that adds, the jean of the indigo dyeing at the bottom of the sulphur is for example arranged.
Can replace fully with float stone processing (for example, 1kg commercialization enzyme is equivalent to 100kg stone) with cellulose treatment.Yet, when needs produce the finishing of heavy wear, cellulose treatment and float stone treatment combination can be used.Producing the very thin outstanding obducent peach face effect of hair sample also can realize by the washing of combination float stone and neutral cellulase.Cellulase of the present invention can be specially adapted to provide the outward appearance of wearing and tearing and minimize back in biological stone mill process and dye.
Biological stone mill is preferably at about pH4.5-9.5, and most preferably carries out between pH6.0-8.0.The temperature of reaction can be preferably 50-70 ℃ between about 40-80 ℃, and more preferably 55-65 ℃, most preferably be 60 ℃.Bath raio (ratio of the liquid volume of unit weight fabric) can be about 2: 1-30: 1, be preferably 4: 1-15: 1 and most preferably be 5: 1-10: 1.Enzyme dosage can be about 5-8000 NCU/g fabric, is preferably 20-3000 NCU/g fabric and most preferably is 30-1500 NCU/g fabric.Treatment time can be 15 minutes-4 hours, more preferably 20 minutes-90 minutes and most preferably be 30 minutes-60 minutes.Should be emphasized that enzyme dosage depends on the type of fabric to a great extent, machine, type of treatment condition (pH, temperature, bath raio, treatment time, jean loading capacity, treatment scale) and zymin or the like.If necessary, float stone and fusion cellulase protein can be used in combination.Needed enzyme dosage will significantly reduce subsequently.Those skilled in the art can determine suitable dosage and condition.
Cellulase fusion protein of the present invention is applicable to the biology finishing of textile industry to fabric or clothes, for example, remove ball, unhairing, clear look, reduce rough degree, produce different finishings (for example, ' peach face ', ' shabby ', ' sand is washed ' or ' antiquated ' effect) and the biology of yarn finishing (for example reduce fluffing, improve smoothness).Cellulase fusion protein of the present invention can use and the essentially identical condition of biological granite-wash under acid and neutrallty condition, is used for biological finishing.
Cellulase fusion protein of the present invention can be used for detergent compositions, thereby by anti pilling, anti-burnt hair, clear look and softening, improves the care properties of fabric, and improve the cleaning effect of textiles, for example decontamination.
Can or contain artificial cellulose or its mixture manufacturing of fiber with the natural cellulose that contains fiber with the textile materials of processing with enzyme preparation of the present invention.The example of natural cellulose is a cotton, flax, hemp, jute and ramie.Artificial cellulose's example is a viscose glue, cellulose acetate, cellulose triacetate, artificial silk, cuprammonium fiber (cupro) and disappearing fibre (lyocell).Above-mentioned Mierocrystalline cellulose also can be used as for example mixture use of polyester, polymeric amide or acrylic fibre of synthon.Described textile materials can be yarn or pass through what knitting or the woven or formation of his method.
Cellulase of the present invention except the processing that can be specially adapted to fabric, also is applicable to any field that needs cellulase activity usually.
In pulp and paper industry, neutral cellulase can be used for, and for example, dissimilar recycled writing papers and the cardboard with neutrality or alkaline pH value is carried out deinking, improves fiber quality or increase draining in paper-making process.Other example is removed seal cream thickening material and too much dyestuff after comprising fabrics printing and dyeing, and animal-feed is handled.For example, if the application of expection is an intensity of improving mechanical pulp, thereby zymin then of the present invention can provide one or more these albumen to strengthen or promote the ability that cellulosic fibre combines.In a similar fashion, in the paper pulp purified was used, cellulase fusion protein preparation of the present invention can strengthen or promote to provide on this type of swollen level one or more these albumen.In fusion rotein of the present invention, what be particularly suitable for pulp applications is those fusion roteins with Melanocarpus albomyces 50KB or orange thermophilic ascomycete CBHI core.
When being used to textile industry and particularly during biological stone mill, cellulase fusion protein of the present invention provides unexpected benefit.Cellulase fusion protein of the present invention is than the obvious effective force more of cellulase of the prior art.In biological stone mill, according to the dosage of the neutral cellulase activity unit that is applied to fabric weight, use be low at least twice, the dosage of low usually at least three times or even six times, and can not damage the intensity of fabric.In other words, the cellulase fusion protein of the application of the invention can realize nearly exceeding 6 times performance.Because the output of cellulase fusion protein of the present invention is corresponding to the output of known 20K cellulase, total production efficiency is significantly improved.This can be directly proportional with the significantly saving of required enzyme amount: the possibility of the enzyme amount that use reduces is for manufacturing and use, comprise that transportation all provides the economic worth of certain degree.
The present invention will describe in the following embodiments in further detail, and described embodiment should not be understood that scope of the present invention is limited, but only is used to illustrate purposes of the present invention.
Embodiment 1 makes up 20K+CBD Expression of Fusion Protein carrier
Handle among the DNA (plasmid, dna fragmentation) at separation, purifying and enzyme, in polymerase chain reaction (PCR), in intestinal bacteria transform or the like, use the standard molecular biology method.Used basic skills is recorded in the standard molecular biology handbook, for example, and Sambrook etc. (1989) and Sambrool and Russell (2001).
The plasmid construction body is designed to (Cel45A, AC#AJ515703 with Melanocarpus albomyces 20K; SEQ ID.NO:1) joint of encoding sequence and Trichodermareesei CBHI and CBD (AC#AR088330; Srisodsuk etc. 1993; SEQ ID.NO:3) encoding sequence links to each other.Designed 6 kinds of different connections altogether, as shown in table 1.
Construct #1 and #2 described in the his-and-hers watches 1 introduced unique N ruI site to the end of 20K encoding sequence.This site makes and can directly merge with any dna fragmentation with blunt ends after the Serine #213 of ripe 20K codon.Using primer 2 0K_Nco (SEQID NO:11) and 20K_NruXho (SEQ ID NO:14), is template with plasmid pALK1480 (Fig. 1), and service routine A (table 3) carries out the PCR reaction.PALK1480 contains Melanocarpusalbomyces cel45A (coding Cel45A or 20K) genome copy, described genome copy is positioned at pUC19 carrier (New Englang Biolabs as accurately merging and containing after being inserted in Trichodermareesei cbh1 promotor, Inc., USA) the cbh1 terminator in gene downstream.Contain 1x DyNAzyme in the described PCR reaction mixture TMEXT reaction buffer (Finnzymes, Finland), 8mM Mg 2+(by adding MgCl 2Regulate final concentration), 0.2mM dNTPs, every kind of primer of 0.5 μ M, 1.0 DyNAzyme of unit TMEXT archaeal dna polymerase (Finnzymes, Finland), and the template of about 50ng/100 μ l.Use NcoI and XhoI restriction enzyme to digest described PCR product, and after electrophoresis, from sepharose, separate described fragment.To similarly shear with isolating 6.1kb pALK1480 fragment and be connected with the PCR fragment, and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA) in.From transformant, extract plasmid DNA, and by sequence verification a suitable material standed for.The gained plasmid is named as pALK1429.
The PCR reaction is carried out respectively by above-mentioned, the primer that adopts is to being 1_BamMly (SEQ IDNO:16)+XhoAge (SEQ ID NO:15) and 2_BamMly (SEQ ID NO:17)+XhoAge (SEQ ID NO:15), with pALK492 as template (Fig. 2), the PCR product of gained contains described joint and CBD, uses digesting of MlyI (just in time producing blunt ends at joint and desirable first codon front of CBD encoding sequence) and AgeI.PALK492 carries the PstI fragment of the Trichodermareesei QM6a chromosomal DNA of the 6.9kb that has an appointment, and described Trichodermareesei QM6a karyomit(e) contains by the cbh1/cel7A gene of subclone to the PstI site of pUC19.Use NruI and AgeI that the pALK492 of above acquisition is digested, and with carrier part respectively with the PCR product separation of two kinds of digestion of above gained be connected, and be transformed among the intestinal bacteria XL1-Blue.Extract plasmid DNA, verify and with the plasmid called after pALK1430 (carrying PCR product) and the pALK1430 (carrying PCR product) of gained as the 2_BamMly+XhoAge of inset as the 1_BamMly+XhoAge of inset by order-checking.
The difference that table 1 makes up between Melanocarpus albomyces 20K and Trichodermareesei CBHI joint+CBD connects
Construct # Core-joint connects 20K-kernel templates pALK1480 Joint+CBD template pALK492 Plasmid construction
5 ' primer 3 ' primer 5 ' primer 3 ' primer
1 ...hddggfavfkaps.-gstgn... 20K_Ncol 20K-NruXho_GPI 1_BamMly_oligo XhoAge_oligo pALK1434＜-pALK1430 ＜-pALK1429
2 ...hddggfavfkaps.-ggnppg... 20K_Ncol 20K-NruXho_GPI 2_BamMly_oligo XhoAge_oligo pALK1435＜-pALK1431 ＜-pALK1429
3 ...hddggfa.fGPIgs-tgn... 20K_Ncol_2 20K-NruXho_GPI 3_BamMly_oligo XhoAge_oligo pALK1768＜-pALK1764 ＜-pALK1758
4 ...hddggfWGEIgs-tgn... 20K_Ncol_3 20K-NruXho_WGEI 3_BamMly_oligo XhoAge_oligo pALK1769＜-pALK1765 ＜-pALK1759
5 ...hddggfPavQIPSs-tgn... 20K_Ncol_2 20K-NruXho_PavQIPS 3_BamMly_oligo XhoAge_oligo pALK1770＜-pALK1766 ＜-pALK1760
6 ...hddggfaWGEIgs-tgn... 20K_Ncol_3 20K-NruXho_WGEI-2 3_BamMly_oligo XhoAge_oligo pALK1775＜-pALK1774 ＜-pALK1773
In secondary series, leftmost part is the ascomycetes derived sequence, and rightmost is wooden mould derived sequence.Lowercase is meant original series, and capitalization is meant modification sequence, and fullstop (.) is meant the amino acid of disappearance, and hyphen is meant the tie point that connects by the join dependency plasmid.First amino acid of ascomycetes sequence is the Histidine #201 of mature sequence, at construct #1, #3, among #4 and the #6, first amino acid of the mould sequence of wood is the glycine #427 of mature sequence, is glycine #434 in construct #2, is Serine #428 in construct #5.
The employed primer of table 2
Primer Length Nucleotide Sequence SequenceID NO：
20K_N∞ 27 5′-TACGCCATGGTCGTCCAGTCGACCAGC 11
20K_N∞_2 35 5′-TACGCCATGGTCGTCCAGTCGACCAGCACGGGCGG 12
20K_N∞_3 46 5′-TACGCCATGGTCGTCCAGTCGACCAGCACGGGCGGCGACCTCGGCA 13
20K_NruXho 40 5′-CGTACTCGAGTCATCGCGAGGGGGCCTTGAAGACGGCGAA 14
XhoAge 30 5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGG 15
1_BamMly 34 5′-TAGGATCCGAGTCCCATTGGCAGCACCGGCAACC 16
2_BamMly 36 5′-TAGGATCCGAGTCCTAGCGGCGGCAACCCTCCCGGC 17
3_BamMly 34 5′-TAGGATCCGAGTCCCATTACCGGCAACCCTAGCG 18
20K-NruXho_GPI 55 5′-CGTACTCGAGTCATCGCGAGCCGATGGGGCCGAAGGCGAAGCCGCCGTCGTCGTG 19
20K-NruXho_WGEI 52 5′-CCTACTCGAGTCATCGCGAGCCGATCTCGCCCCAGAAGCCGCCGTCGTCGTG 20
20K-NruXho_PavOIPS 58 5′CGTACTCGAGTCATCGCCACGAGGGGATCTGGACGGGGGGGAAGCCGCCGTCGTCGTG 21
20K-NruXho_WGEI-2 52 5′-CGTACTCGAGTCATCGCGAGCCGATGTCGCCCCAGGCGAAGCCGCCGTCGTC 22
50KB_NrulXhol 37 5′-TCGTCTCGAGTCGCCATGGGGCCGAAGCGGATGTTGG 23
50KB_Sphl 31 5′-GGAGGGCATGCCCAACAGGAGCGAGATCACC 24
2_50K_NrulSpel 38 5′-CGGCACTAGTTCGCGACCCGATCTCGCCCCAGCGCAGG 25
50K_Xhol 26 5′CGCCGAGGGCCGGCTCGAGAGCATCC 26
The employed PCR response procedures of table 3
Program
Step A B C D
1 95 ℃ 5 minutes 95 ℃ 5 minutes 98 ℃ 1 minute 98 ℃ 1 minute
2 95 ℃ 1 minute 95 ℃ 1 minute 98 ℃ 30 seconds 98 ℃ 30 seconds
3 55 ℃ 1 minute 60 ℃ 1 minute 72 ℃ 1 minute 65 ℃ 30 seconds
4 72 ℃ 1 minute 72 ℃ 1 minute Get back to 2 29 circulations 72 ℃ 1 minute
5 Get back to 2 24 circulations Get back to 2 24 circulations 72 ℃ 10 minutes Get back to 2 29 circulations
6 Keep 4 ℃ 72 ℃ 1 minute Keep 4 ℃ 72 ℃ 10 minutes
7 Keep 4 ℃ Keep 4 ℃
According to following description amdS mark and Trichodermareesei cbh1 3 ' flank region are inserted carrier pALK1430 and pALK1431: use EcoRI and SpeI cutting pALK424 (United States Patent (USP) 5,837,51; Fig. 3), the 4.8kb fragment of gained is made blunt end, and be connected with pALK1431 with the plasmid pALK1430 that uses the StuI cutting respectively, and be transformed among the intestinal bacteria XL1-Blue by the Klenow filling-in.Extract plasmid DNA and check desirable direction of insertion by suitable restriction enzyme digestion.The plasmid of checking is by difference called after pALK1434 (inset is from pALK1430) and pALK1435 (inset is from pALK1431) (table 1).
Construct #3 shown in the his-and-hers watches 1, #4, #5 and #6, employing be diverse ways.The encoding sequence of 20K is designed to finish at Serine coding password place with different modification tie points (table 1), and it has formed the part in the NruI site of being added.For all these constructs, use identical inset that the encoding sequence of the major portion of described joint and CBD is provided.The latter's structure is as follows.Use above-mentioned reaction mixture (except not adding Mg 2+), and use primer to 3_BamMly (SEQ ID NO:18) and XhoAge (SEQ IDNO:15), as template, carry out the PCR reaction with pALK492 DNA.Use the program B in the table 3.Use the PCR product of BamHI and XhoI digestion gained, (Stratagene, USA) carrier part of similar cutting connects, and is transformed among the intestinal bacteria XL1 Blue with its separation and with pBluescript II KS+.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Select a kind ofly have the plasmid material standed for of desired sequence and with its called after pALK1767.
Construct #3 in the his-and-hers watches 1 uses primer to 20K_Nco_2 (SEQ ID NO:12) and 20K-NruXho_GPI (SEQ ID NO:19), as template, carries out the PCR reaction with pALK1480 DNA.Used two kinds of reaction mixtures: a kind of composition with above-mentioned structure pALK1767, another kind have the DMSO that adding reaches 3% (v/v).These two kinds of reaction mixtures separate, and use program C and D operation in the table 3.All reactions have all produced the dna fragmentation with desired size, and described preparation is made up and digestion with NcoI and XhoI.Described dna fragmentation is separated and be connected with isolating fragment, and be transformed among the intestinal bacteria XL1 Blue with the similar cutting of 6.1kb pALK1480.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Select a kind ofly have the plasmid material standed for of desired sequence and with its called after pALK1758.
Construct #4 in the his-and-hers watches 1 uses primer to 20K_Nco_3 (SEQ ID NO:13) and 20K-NruXho_WGEI (SEQ ID NO:20), as template, carries out the PCR reaction with pALK1480 DNA.Described PCR reaction mixture contains 1x Phusion TMGC reaction buffer (Finnzymes, Finland), 0.2mM dNTPs, every kind of primer of 0.5 μ M, 3% (v/v) DMSO and 1.0 Phusion of unit TMArchaeal dna polymerase (Finnzymes, Finland), and about 70ng/100 μ l template.Reaction mixture separates, and uses program C and D operation in the table 3.Two kinds of reactions have all produced the dna fragmentation of desired size, and described preparation is made up and digestion with NcoI and XhoI.Described dna fragmentation is separated and is connected with isolating 6.1kb fragment with the similar cutting of pALK1480, and be transformed among the intestinal bacteria XLl Blue.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Select a kind ofly have the plasmid material standed for of desired sequence and with its called after pALK1759.
Construct #5 in the his-and-hers watches 1 uses primer to 20K_Nco_2 (SEQ ID.NO:12) and 20K-NruXho_PavQIPS (SEQ ID.NO:21), as template, carries out the PCR reaction with pALK1480 DNA.Used two kinds of reaction mixtures: a kind of have an above-mentioned composition that is used to make up pALK1759, and another kind does not have DMSO.These two kinds of reaction mixtures separate, and use program C and D operation in the table 3.All reactions have all produced the dna fragmentation of wishing size, and described preparation is made up and digestion with NcoI and XhoI.The similar cutting of described dna fragmentation with pALK1480 separated and be connected with isolating 6.1kb fragment, and be transformed among the intestinal bacteria XL1 Blue.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Select a kind of plasmid material standed for and with its called after pALK1760; It has obtained sudden change on unique XhoI site, but can't throw into question to further subclone.
Construct #6 in the his-and-hers watches 1 uses primer to 20K_Nco_3 (SEQ ID.NO:13) and 20K-NruXho_WGEI-2 (SEQ ID.NO:22), as template, carries out the PCR reaction with pALK1480DNA (70ng/100 μ l).Use and made up the identical reaction mixture composition of plasmid pALK1767, and used the program C in the table 3 to move.The preparation product digests with NcoI and XhoI.Described dna fragmentation separates and is connected with isolating 6.1kb fragment with the similar cutting of pALK1480, and is transformed among the intestinal bacteria XL1 Blue.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Select a kind ofly have the plasmid material standed for of desired sequence and with its called after pALK1773.
Use NruI and AgeI that plasmid pALK1758, pALK1759, pALK1760 and pALK1773 are cut respectively, and the carrier of separating part.With every kind prepare product with from linking to each other through the 235bp fragment that is separated to MlyI and the postdigestive pALK1767 of AgeI, and every kind of connection mixture is transformed into respectively among the intestinal bacteria XL10-Gold.Extract plasmid DNA, check and verify by order-checking by suitable restriction enzyme digestion.Will be through plasmid difference called after pALK1764, pALK1765, pALK1766 and the pALK1774 (table 1) of checking.
With amdS mark and the following insertion carrier of Trichodermareesei cbh1 3 ' flank region pALK1764, pALK1765, among pALK1766 and the pALK1774: with EcoRI and SpeI cutting pALK424, by the Klenow filling-in 4.8kb fragment of gained is made blunt ends, and divide to open with plasmid pALK1764, pALK1765, pALK1766 and pALK1774 respectively and be connected, and be transformed among the intestinal bacteria XL10-Gold with StuI cutting.Extract plasmid DNA, check desirable direction of insertion by suitable restriction enzyme digestion.With the plasmid difference called after pALK1768 of checking, pALK1769, pALK1770 and pALK1775 (table 1) are (Figure 10).
Embodiment 2 produces the 20K+CBD albumen that merges in Trichodermareesei
Be separated to the linear expression cassette of the 8.7kb that comes from plasmid pALK1434 and pALK1435 the carrier framework after digesting, and be transformed in the Trichodermareesei A47 protoplastis through EcoRI.According to (1993) described modifications such as the description of (1987) such as Penttila and Karhunen, select ethanamide to transform as only nitrogen source.By its single conidium before PD (potato dextrose agar (Potato Dextrose Agar)) goes up the formation spore, on the screening flat board, transformant is carried out purifying.
20K+CBD product from the transformant in the culture supernatants of shake-flask culture (50ml) is analyzed.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).The enzyme assay of fusion rotein is, 50 ℃ in the 50mM of pH7.0 Hepes damping fluid, release (NCU activity, the nkat of reducing sugar from carboxymethyl cellulose (3%CMC) in 10 minutes; Bailey and Nevalainen, 1981; Haakana etc., 2004).The NCU activity of best production transformant is shown in table 4.By verified the genotype of selected transformant with Southern hybridization, comprised some genomic digestion products in the described Southern hybridization and expression cassette separately has been used as probe.Can use the polyclonal antibody and the ProtoBlot Western blot AP system (Promega) that produce from purifying Melanocarpus albomyces 20K neutral cellulase (Haakana etc. 2004), from culture supernatants, measure 20K+CBD albumen.The Western hybridization analysis shows that the 20K+CBD enzyme of fusion is to produce mainly as stable fusion rotein in Trichodermareesei.
The NCU activity of the 20K+CBD transformant that table 4 is selected from shake-flask culture
Transformant Make up numbering The RF numbering The neutral cellulase activity, NCU/ml Endogenous cellulase phenotype
A47/pALK1434#20 #1 RF5580 3278 CBHI-
A47/pALK1434#23 #1 RF5581 2091 (CBHI+)
A47/pALK1434#37 #1 RF5582 2330 CBHI-
A47/pALK1435#3 #2 RF5583 3624 CBHI-
A47/pALK1435#7 #2 RF5584 3211 CBHI-
A47/pALK1435#11 #2 RF5585 1172 (CBHI+)
A47/pALK1435#14 #2 RF5586 3152 CBHI-
In table 4, making up numbering can be referring to table 1; The RF numbering is meant the name of described transformant as the RF bacterial strain.
Can hybridize by Western, it is that the negative genotype of CBHI-is screened that described expression cassette is had made to order for the possible target of cbh1 (cel7A) locus.(Promega USA) detects CBHI albumen can to use monoclonal antibody CI-258 or CI-261 (Aho etc., 1991) and ProtoBlot Western blot AP system.By using Southern hybridization to verify the genotype of selected transformant, comprised some genomic digestion products in the described Southern hybridization, and expression cassette separately has been used as probe.
The carrier framework after digesting through EcoRI, be separated to the linear expression cassette of 8.7kb of plasmid pALK1768, pALK176, pALK1770 and the pALK1775 of preparation from embodiment 1, and be transformed into ethanamide as (two kinds of bacterial strains are all from bacterial strain QM6a (Bailey and Nevalainen in the Trichodermareesei RF5796 of only nitrogen source screening and the RF5798 protoplastis, 1981), and have a phenotype CBHI-CBHII-EGI-EGII-to endogenous type trichoderma reesei cellulase).By its conidium before forming spore on the PD, on the screening flat board, transformant is carried out purifying.
From the culture supernatants of shake-flask culture (50ml), analyze the 20K+CBD product of transformant.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).Then, the NCU of the 20K+CBD fusion rotein of generation is active in above-mentioned analysis.The NCU activity of the transformant of selecting is shown in table 5.By using Southern hybridization to verify the genotype of selected transformant, comprised some genomic digestion products in the described Southern hybridization, and expression cassette separately has been used as probe.Can use the polyclonal antibody and the ProtoBlot Western blot AP system (Promega) that produce from the Melanocarpus albomyces 20K neutral cellulase (Haakana etc. 2004) of purifying, from culture supernatants, detect 20K+CBD albumen.The Western hybridization analysis shows that the 20K+CBD enzyme of fusion is produced by transformant.Some cultures also show the band with anti-20K antiserum(antisera) reaction, and have the proteic mobility of wild-type 20K, and some shearings of described joint+CBD might take place in culturing process in explanation.The 20K+CBD fusion rotein that the pALK1770 transformant produces is owing to its stability, the selected further investigation.
Table 5 is from the NCU activity of the 20K+CBD transformant of shake-flask culture selection
Transformant Make up numbering The RF numbering The neutral cellulase activity, NCU/ml
RF5796/pALK1768#6 #3 RF5966 3622
RF5796/pALK1768#7 #3 RF5967 1316
RF5796/pALK1768#9 #3 RF6035 6605
RF5798/pALK1768#11 #3 RF5970 1525
RF5798/pALK1768#17 #3 RF5971 2885
RF5798/pALK1768#20 #3 RF5972 2598
RF5796/pALK1769#7 #4 RF5968 4344
RF5796/pALK1769#10 #4 RF5969 4858
RF5796/pALK1769#11 #4 RF6036 6145
RF5798/pALK1769#4 #4 RF5973 4505
RF5798/pALK1769#8 #4 RF5974 4895
RF5796/pALK1770#13 #5 RF5975 3073
RF5796/pALK1770#17 #5 RF5976 2256
RF5796/pALK1770#22 #5 RF5977 2107
RF5796/pALK1770#10 #5 RF5978 1907
RF5796/pALK1770#14 #5 RF5979 3661
RF5796/pALK1775#8 #6 RF6078 2431
RF5796/pALK1775#13 #6 RF6079 3505
RF5796/pALK1775#21 #6 RF6080 2541
RF5796/pALK1775#22 #6 RF6081 1697
RF5796/pALK1775#29 #6 RF6082 3096
In table 5, making up numbering can be referring to table 1; The RF numbering is meant the name of described transformant as the RF bacterial strain.
Li's Trichoderma strains RF5582, RF5583, RF6036, RF5977 and RF5978 are grown in the bio-reactor for detecting use.Some preparation products are heat-treated (pH6.0,65 ℃, 60-70 minute), thus the Trichodermareesei endogenous enzyme activity of any remnants of deactivation.Described 20K+CBD is heat-staple relatively (Miettinen-Oinonen etc. 2004), and can sex change in treating processes.
Embodiment 3 produces the 20K+CBD affinity mutain that merges in Trichodermareesei
With Melanocarpus albomyces 20K (cel45A, AC#AJ515703) enzyme is blended in the cellulose binding domain (CBD) of Trichodermareesei CBHI, wherein sported L-Ala at 31 (corresponding to the Y492 of mature polypeptide) and/or 32 (corresponding to the Y493 of mature polypeptide) upward conservative tyrosine residues, as Linder etc., 1995 is described.In addition, tyrosine residues on 31 also can be substituted by tryptophane, described tryptophane is at for example grey humicola lanuginosa (Humicola grisea) CBHI (Azevedo etc., 1990) and Trichodermareesei EGV (Cel45A, Saloheimo etc., 1994) amino acid of natural discovery in the CBD zone.The CBD of sudden change makes up by PCR, and has also comprised the aminoacid replacement (numbering of carrying out according to the aminoacid sequence of CBD) of Y31A, Y32A, Y31W and Y31A_Y32A in the cellulose binding domain of Trichodermareesei CBHI.In whole constructs, all used forward primer 3_BamMly:5 '-TAGGATCCGAGTCCCATTA-CCGGCAACCCTAGCG-3 ' (SEQ ID.NO:18).Different CBD are used to increase MutThe reverse primer of product is as shown in table 6.Described PCR reaction mixture contains 1xPfuUltra TM(Stratagene, USA), it provides 2mM Mg to the HF reaction buffer 2+Concentration, 0.2mMdNTP, every kind of primer of 2 μ M and 1.5 PfuUltra of unit TM(Stratagene, USA), and about 45ng pALK492 plasmid is as template for the HF archaeal dna polymerase.PALK492 (Fig. 2) plasmid contains Trichodermareesei cbh1 gene.The PCR reaction conditions is as follows: 95 ℃ of initial sex change 2 minutes are the final extension 10 minutes that 2 minutes and 72 ℃ are extended in 1 minute, 72 ℃ of 95 ℃ 1 minute, 65 ℃ (± 5 ℃ of gradients) annealing of 30 round-robin then.
Table 6 is the inverse PCR primer of amplification sudden change CBD product design
Primer Length (nts) Sequence, reverse Aminoacid replacement Sequonce ld.No
XhoAge_Y31A 69 5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGCACGGAGCTTTACAGGCACTSAGAGTAGGCAGGGTTCAGG Y31A SEQ ID.NO：27
XhoAge_Y32A 69 5′-TGACTCGAGACCGGTCCGTCAGGCTTTCGCACGGAGCTTTACAGGCACTGAGAGGCGTAAGGGTTCAGG Y32A SEQ ID.NO：28
XhoAge_Y31W 69 5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGCACGGAGCTTTACAGGCACTGAGAGTACCAAGGGTTCAGG Y31W SEQ ID.NO：29
XhoAge_Y31A-Y32A 69 5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGCACGGAGCTTTACAGGCACTGAGAGGCGGCAGGGTTCAGG Y31A_Y32A SEQ ID.NO：30
In annealing temperature was 60 ℃ PCR reaction, all combination of primers had all produced specific dna fragmentation.The PCR product separates from these reactions, with XhoI and the digestion of BamHI restriction enzyme, and be cloned into subsequently pBluescript II KS+ (Stratagene, USA) in.The plasmid of gained is named as pALK1884 (Y31A sudden change), pALK1885 (Y32A sudden change), pALK1886 (Y31W sudden change) and pALK1887 (Y31A_Y32A sudden change).By sequence verification the PCR fragment in the plasmid.The MlyI of plasmid pALK1884 to pALK1887 and AgeI digestion inset further are connected in the pALK1760 carrier segments of Nru and AgeI digestion, and this fragment contains the total length Melanocarpus albomyces 20K gene that is blended in Trichodermareesei cbh1 (cel7A) promotor and terminator.C-terminal portions to 20K gene among the pALK1760 is modified, and makes the segmental connection of CBD produce the tie point of PAVQIPSS (construct #5), and it shows in Trichodermareesei and has produced stable fusion product, as described in embodiment 1 and 2.In the end in the step, the blunt ends SpeI-EcoRI fragment (4.5kb) of amdS mark as p3SR2 plasmid (Fig. 6) added, to have obtained in Trichodermareesei, the producing 20K+CBD that merges MutThe expression plasmid pALK1877 of enzyme (Y31A sudden change), pALK1878 (Y32A sudden change), pALK1879 (Y31W sudden change), and pALK1880 (Y31A_Y32A sudden change).Be blended in the back and and then suddenly change the proteic aminoacid sequence of 20K of joint peptide in CBD zone shown in Figure 11 B.By the sequence verification expression vector, in the postdigestive carrier framework of NotI, separate the linear expression cassette (Figure 11 A) of 8.4kb, and be transformed in the Trichodermareesei RF5796 protoplastis.According to (1993) described modifications such as Penttila etc. (1987) and Karhunen, select ethanamide as only nitrogen source, transform.By its single conidium before forming spore on the PD, on the screening flat board, transformant is carried out purifying.
From the culture supernatants of shake-flask culture (50ml), analyze the 20K+CBD of transformant MutProduce.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).The enzyme assay of fusion rotein is, in 50 ℃, the 50mM Hepes damping fluid of pH7.0, and the reducing sugar (NCU activity, the nkat that discharge from carboxymethyl cellulose (3%CMC) in 10 minutes; Bailey and Nevalainen, 1981; Haakana etc., 2004).The NCU activity of best production transformant is shown in table 7.By the genotype of the selected transformant of use Southern hybridization checking, described Southern is hybridized comprising some genomic digestion products, and expression cassette separately is used as probe.Can use the polyclonal antibody and the ProtoBlot Western blot AP system (Promega) that produce from the Melanocarpus albomyces 20K neutral cellulase (Haakana etc. 2004) of purifying, from culture supernatants, measure 20K+CBD MutAlbumen.The Western hybridization analysis shows the 20K+CBD of fusion MutEnzyme is to produce as stable fusion rotein in Trichodermareesei.
The 20K+CBD that table 7 is selected from shake-flask culture MutThe NCU activity of transformant
Transformant Aminoacid replacement The RF numbering The neutral cellulase activity, NCU/ml
pAKL1877#26 Y31A RF6084 3658
pAKL1877#34 Y31A RF6085 2447
pAKL1878#02 Y32A RF6086 3434
pAKL1878#13 Y32A RF6088 2915
pAKL1879#13 Y31W RF6090 2545
pAKL1879#24 Y31W RF6091 3452
pAKL1880#06 Y31A_Y32A RF6092 3415
pAKL1880#25 Y31A_Y32A RF6094 2727
The RF numbering is meant the called after of described transformant as the RF bacterial strain.
To bacterial strain RF6084-RF6086, RF6088, RF6090-RF6092 and RF6094 ferment, with the material (referring to embodiment 9-11) that obtains to use for detecting.
Embodiment 4 prepares the 20K+CBD joint disappearance albumen that merges in Trichodermareesei
With Melanocarpus albomyces 20K enzyme be blended in Trichodermareesei CBHI cellulose binding domain (=CBD), by in the indirect head polypeptides of structural domain, introducing disappearance to its further modification.According to Srisodsuk etc., 1993 description designed joint disappearance.The disappearance of 434-444 amino acids in mature polypeptide (mutant Δ G-444) has been removed and has been included about 1/3rd joints that are rich in glycine and proline(Pro) tumor-necrosis factor glycoproteins, but has kept whole complete O-glycosylation sites of inferring.The disappearance of 434-460 amino acids residue (mutant Δ G-460) has in fact been removed all joints (Figure 12 A).Other 20K+CBD joint disappearances that in the CBD zone, have the two sudden changes of Y31A_Y32A affinity have also been made up.
Carry out the PCR reaction in the joint peptide, to introduce disappearance and in the CBD zone, to introduce aminoacid replacement.Pcr amplification is carried out in description by embodiment 3, except using the annealing temperature of 60 ℃ (± 5 ℃).Use forward primer respectively
5′-TAGGATCCGAGTCCCATTACCGGCAACCCTAGCACCACC-ACCACCCGCCGCCCAGCC-3′(SEQ ID.NO：31)
With
5′-TAGGATCCGAGTCCCATTACCGGCAACCCTAGCCC-TACCCAGTCTCACTACGGCCAGTGC-3′(SEQ ID.NO：32)
The joint disappearance of synthesizing Δ G-444 and Δ G-460.Accordingly, use reverse primer
5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGCACGGAGCT-TTACAGG-3(SEQ ID.NO：33)
The increase complete CBD zone of Trichodermareesei CBHI.Adopt reverse primer
5′-TGACTCGAGACCGGTGCGTCAGGCTTTCGCACGGAGCTT-TACAGGCACTGAGAGGCGGCAGGGTTCAGG-3′(SEQ ID.NO：30)
Produce the Y31A_Y32A sudden change in the CBD zone.
In the PCR of 55.2 ℃ of-65.0 ℃ of annealing regions reaction, all combination of primers has all produced specific dna fragmentation.According to the description construct expression plasmid pALK1893 (Δ G-444 disappearance) of embodiment 3, pALK1896 (Δ G-460 disappearance), pALK1899 (Δ G-444 disappearance, Y31A_Y32A sudden change) and pALK1952 (Δ G-460 disappearance, Y31A_Y32A sudden change).Being blended in the back follows the proteic aminoacid sequence of 20K of the joint peptide that blocks of complete or sudden change CBD shown in Figure 12 B.From the postdigestive carrier framework of EcoRI, separate the linear expression cassette of 8.3kb, and be transformed in the Trichodermareesei RF5796 protoplastis.Transform, the transformant purifying, shake-flask culture, determination of activity, Southern hybridization and Western hybridization analysis are all according to embodiment 3 described carrying out.
The 20K+CBD joint that table 8 is selected from shake-flask culture lacks the NCU activity of transformant
Transformant Joint disappearance/aminoacid replacement The RF numbering The neutral cellulase activity, NCU/ml
pALK1893#08 ΔG-444 RF6107 1182
pALK1893#10 ΔG-444 RF6108 2058
pALK1896#05 ΔG-460 RF6110 2576
pALK1896#07 ΔG-460 RF6111 2628
pALK1899#07 ΔG-444，Y31A_Y32A RF6112 1947
pALK1899#20 ΔG-444，Y31A_Y32A RF6114 2462
pALK1952#01 ΔG-460，Y31A_Y32A RF6115 2428
pALK1952#17 ΔG-460，Y31A_Y32A RF6116 1738
The RF numeral is meant the name of described transformant as the RF bacterial strain.
Bacterial strain RF6107, RF6108, RF6110-RF6112 and RF6114-RF6116 are fermented, with the material (embodiment 9-11) that obtains to use for detecting.The Western hybridization analysis shows that the 20K+CBD joint disappearance enzyme of fusion is to produce in Trichodermareesei as stable fusion rotein.
Embodiment 5 produces the Melanocarpus albomyces50K+CBD fusion rotein of reorganization in Trichodermareesei
The plasmid construction body is designed to (Cel7A, AC#AJ515704) encoding sequence and Trichodermareesei CBHI (cel7A, AC#AR088330 with Melanocarpus albomyces 50K; Srisodsuk etc. 1993) connector area link to each other with cellulose binding domain (CBD).Plasmid pALK1237 (Fig. 4) is the basis of novel constructs, and it contains the accurate fusions of cel7A gene conduct under the control of Trichodermareesei cbh1 promotor.
At first, near the C-terminal of 50K encoding sequence, introduce unique N ruI restriction site.It makes after the amino acid S393 of ripe 50K polypeptide that the dna direct of blunt ends merges (Figure 13 B) arbitrarily.Use primer 2 _ 50K_NrulSpel (5 ' CGGCAC-TAGTTCGCGACCCGATCTCGCCCCAGCGCAGG 3 '; SEQ ID.NO:25) and 50K_Xhol (5 ' CGCCGAGGGCCGGCTCGAGAGCATCC 3 '; SEQ ID.NO:26), be template with pALK1237, carry out the PCR reaction.Described PCR reaction contains 1x DyNAzyme TMEXT reaction buffer (Finnzymes, Finland), 0.25mM dNTPs, the various primers of 0.5 μ M, 2.0 DyNAzyme of unit TMEXT archaeal dna polymerase (Finnzymes, Finland), and the pALK1237 template DNA of about 50ng/100 μ l.The pcr amplification condition is as follows: 96 ℃ of initial sex change 5 minutes are 96 ℃ of 25 round-robin 15 seconds then, 56 ℃ or 61 ℃ of annealing 60 seconds, and 72 ℃ were extended 60 seconds, and 72 ℃ final extension 10 minutes.Use XhoI and SpeI restriction enzyme digestion PCR product, and from sepharose purifying.The PCR fragment of purifying is connected in the 6.9kb XhoI-SpeI restriction fragment of plasmid pALK1237, and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).From transformant, extract plasmid DNA, and by sequence verification three material standed fors.Selected clone is named as pALK1703.
Trichodermareesei CBHI joint+CBD is with pcr amplification, primer be 3_BamMly_50 (5 ' TTGG-ATCCGAGTCGCAGCACCGGCAACCCTAGCG 3 '; SEQ ID.NO:36) and XhoAge (5 ' TGACTCGAGACCGGTGCGTCAGGCTTTCGC3 '; SEQ ID.NO:15), use pALK492 as template.The PCR reaction conditions as mentioned above, except the extension time in amplified reaction is 90 seconds.Use MlyI and AgeI enzymic digestion PCR product, and from sepharose purifying.To contain the 6.8kb AgeI-NruI restriction fragment that the segmental joint+CBD of PCR is connected into plasmid pALK1703, and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).As mentioned above transformant is analyzed, and with suitable clone's called after pALK1704.
For the Trichodermareesei transformant is screened, amdS marker gene and Trichodermareesei cbh1 3 ' flank region can be inserted vector plasmid pALK1704.The 4.8kbEcoRI-SpeI restricted fragment (US 5,837,515) that separates pALK424, and use the Klenow enzyme to mend flat described segmental end.With blunt ends amdS labeled fragment be connected into through the pALK1704 of StuI digestion and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).Extract plasmid DNA from transformant, and by the desirable direction of insertion of restriction enzyme digestion checking.With selected transformant called after pALK1708.
By EcoRI digestion, from the pALK1708 skeleton, separate the linear expression cassette (Figure 13 A) of 9.2kb, be transformed into Trichodermareesei RF5636 protoplastis and (derive from bacterial strain QM6a; Bailey and Nevalainen, 1981), and with ethanamide screen transformant as only nitrogen source.Described host strain lacks three kinds of main endogenous cellulase: CBHII (Cel6A), EGI (Cel7B) and EGII (Cel5A).Transform according to (1993) described modifications such as the description of (1987) such as Penttila and Karhunen.Transformant was carried out purifying by its single conidium on the screening flat board before forming spore on the PD.
From the culture supernatants of shake-flask culture (50ml), analyze the 50K+CBD fusion rotein that transformant produces.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).The enzyme assay of fusion rotein is, in 50 ℃, the 50mM Hepes damping fluid of pH7.0, and reducing sugar (the NCU activity that carboxymethyl cellulose (3%CMC) discharges; Bailey and Nevalainen, 1981; Haakana etc., 2004).The active difference of described transformant is from 2035-3633 NCU/ml.Use is from the polyclonal antibody of Melanocarpus albomyces 50K neutral cellulase (Haakana etc. the 2004) generation of purifying, by using ProtoBlot Western blot AP system (Promega), from culture supernatants, measure 50K+CBD albumen.The Western hybridization analysis shows that the 50K+CBD fusion rotein that produces is stable from Trichodermareesei.Make probe with expression cassette,, analyze the genotype of the transformant of selecting by Southern hybridization.Also can detect the proteic Western hybridization of CBHI, verify that expression cassette is fixed for the possible target of cbh1 locus by using mono-clonal CBHI antibody (CI-261, Aho etc., 1991).
Embodiment 6 produces reorganization Melanocarpus albomyces50KB+CBD fusion rotein in Trichodermareesei
The plasmid construction body is designed to (Cel7B, encoding sequence AC#AJ515705) and Trichodermareesei CBHI (cel7A, AC#AR088330 with Melanocarpus albomyces 50KB; Srisodsuk etc. 1993) connector area link to each other with cellulose binding domain (CBD).Plasmid pALK1241 (Fig. 5) is the basis of novel constructs, and it contains the cel7B gene of the accurate fusions of conduct under the control of Trichodermareesei cbh1 promotor.
At first, near the C-terminal of 50KB encoding sequence, introduce unique N ruI restriction site.It can make any blunt ends dna direct after the amino acid S426 of ripe 50KB polypeptide merge (Figure 14 B).With primer 50KB_NrulXhol (5 ' TCGTCTCGA-GTCGCGATGGGGCCGAAGCGGATGTTGG 3 '; SEQ ID.NO:23) and 50KB_Sphl (5 ' GGAGGGCATGCCCAACAGCAGCGAGATCACC 3 '; SEQ ID.NO:24), be template with pALK1241, carry out the PCR reaction.Described PCR reaction contains 1 x DyNAzyme TMEXT reaction buffer (Finnzymes, Finland), 0.25mMdNTPs, the various primers of 0.5 μ M, 2.0 DyNAzyme of unit TMEXT archaeal dna polymerase (Finnzymes, Finland), and the pALK1241 template DNA of about 50ng/100 μ l.The pcr amplification condition is as follows: 96 ℃ of initial sex change 5 minutes are 96 ℃ of 25 round-robin 15 seconds then, 56 ℃ or 60 ℃ of annealing 60 seconds, and 72 ℃ were extended 60 seconds, and 72 ℃ final extension 5 minutes.Use XhoI and SphI restriction enzyme digestion PCR product, and from sepharose purifying.The PCR fragment of purifying is connected into the 6.9kb XhoI-SphI restriction fragment of plasmid pALK1241, and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).From transformant, extract plasmid DNA, and by sequence verification a material standed for.Selected clone is named as pALK1705.
Trichodermareesei CBHI joint+CBD pcr amplification, primer be 3_BamMly_50 (5 ' TTG-GATCCGAGTCGC AG CACCG G CAACCCTAG CG 3 '; SEQ ID.NO:18) and XhoAge (5 ' TGACTCGAGACCGGTGCGTCAGGCTTTCGC3 '; 15), pALK492 is as template.。The PCR reaction conditions as mentioned above, except the extension time in amplified reaction is 90 seconds.Use MlyI and the described PCR product of AgeI enzymic digestion, and from sepharose purifying.To contain the 7.2kb AgeI-NruI restriction fragment that the segmental joint+CBD of PCR is connected into pALK1705, and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).As mentioned above transformant is analyzed, and with suitable clone's called after pALK1706.
For the Trichodermareesei transformant is screened, amdS marker gene and described Trichodermareesei cbh1 3 ' flank region can be inserted vector plasmid pALK1706.The 4.8kb EcoRI-SpeI restricted fragment (US 5,837,515) that separates pALK424, and use the Klenow enzyme to mend flat described segmental end.Described blunt ends amdS labeled fragment is connected into the pALK1706 of StuI digestion and be transformed into intestinal bacteria XL1-Blue (Stratagene, USA).Extract plasmid DNA from described transformant, and by the desirable direction of insertion of restriction enzyme digestion checking.With selected transformant called after pALK1709.
Linear expression cassette (Figure 14 A) by EcoRI digestion separation 9.2kb from the pALK1709 skeleton is transformed into Trichodermareesei RF5636 protoplastis, and screens transformant with ethanamide as only nitrogen source.Described host strain lacks three kinds of main endogenous cellulase: CBHII (Cel6A), EGI (Cel7B) and EGII (Cel5A).Transform according to (1993) described modifications such as the description of (1987) such as Penttila and Karhunen.Transformant was carried out purifying to it by single conidium on the screening flat board before forming spore on the PD.
Analyze from the culture supernatants of shake-flask culture (50ml) that transformant produces the 50KB+CBD fusion rotein.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).Use 4-methyl umbrella shape base-β-D-lactoside substrate to measure cellobiohydrolase activity (the MUL activity of fusion rotein; Van Tilbeurgh etc. 1988).Can use the polyclonal antibody that produces from the Melanocarpus albomyces50KB cellulase (Haakana etc. 2004) of purifying,, from culture supernatants, measure 50KB+CBD albumen by ProtoBlotWestern blot AP system (Promega).Do not detect wild-type 50KB albumen in the Western hybridization analysis, show that the 50KB+CBD fusion rotein that produces is stable from Trichodermareesei.Available expression cassette is as probe, with the genotype of the selected transformant of Southern hybridization analysis.Also can detect the proteic Western hybridization of CBHI, verify that expression cassette is fixed for the possible target of cbh1 locus by using mono-clonal CBHI antibody (CI-261, Aho etc., 1991).
Embodiment 7 produces reorganization thermophilic ascomycete CBHI+CBD fusion rotein in Trichodermareesei
With thermophilic ascomycete CBHI (AC#AF478686, Hong etc., 2003; SEQ ID.NO:9) with Trichodermareesei CBHI (AC#AR088330; Srisodsuk etc. 1993; SEQ ID.NO:3) joint and CBD merge.At first, use primer 5 '-TTAAAC-ATATGTTATCTACTCCAACATCAAGGTCGGACCCATTGGCAGCAC-CGG CAACCCTAGCGGC-3 ' (forward sequence, SEQ ID.NO:34)
With
5′-TATATGCGGCCGCACCGGTGCGTCAGGCTTTCGCACGGAGC-
TTTACAGGC-3 ' (reverse sequence, SEQ ID.NO:35),
Encoding sequence by synthetic Trichodermareesei CBHI joint of PCR and CBD.
Described PCR reaction mixture contains 1 x DyNAzyme TMEXT reaction buffer (Finnzymes, Finland), 15mM Mg 2+, 0.2mM dNTPs, the various primers of 2 μ M, 0.6 DyNAzyme of unit TMEXT archaeal dna polymerase (Finnzymes, Finland), and the pALK492 template of about 75ng/30 μ l.The pALK492 plasmid contains Trichodermareesei cbh1 (cel7A) gene.The PCR reaction conditions is as follows: 98 ℃ of initial sex change 2 minutes are 98 ℃ of 30 round-robin 30 seconds then, 68 ℃ (± 4 ℃ of gradients) annealing 30 seconds, and 72 ℃ were extended 30 seconds, and 72 ℃ final extension 10 minutes.In 64 ℃-68.5 ℃ annealing region, in described PCR reaction, obtained specific DNA fragments.Use NdeI and NotI restriction enzyme, the synthetic CBD fragment that also contains thermophilic ascomycete cbh1 gene 3 '-terminal nucleotide sequence is digested, and after electrophoresis, from sepharose, separate described fragment.After this, isolating PCR fragment is connected with pALK1649 (Fig. 7) carrier segments that contains total length thermophilic ascomycete cbh1 gene of NotI digestion with NdeI.The gained plasmid is named as pALK1888, and by order-checking the pcr amplified fragment in the described plasmid is verified.As the result who merges, the C-terminal portions of the thermophilic ascomycete CBHI in the pALK1888 plasmid contains the tie point of GPIGST (Figure 15 B).The inset of the SacII and the plasmid pALK1888 of AgeI digestion is linked to each other with pALK1694 (Fig. 8) carrier segments of AgeI digestion with SacII, and it has produced the thermophilic ascomycete CBHI+CBD that is blended in Trichodermareesei cbh1 (cel7A) promotor (accurately fusions) and terminator.In the end in the step, add the amdS labeled fragment, as described in embodiment 3,, be used for producing reorganization thermophilic ascomycete CBHI+CBD and merge enzyme at Trichodermareesei to obtain expression plasmid pALK1890.Being blended in joint peptide back follows the proteic aminoacid sequence of thermophilic ascomycete CBHI in the CBD zone of Trichodermareesei CBHI to be shown in Figure 15 B.
Prove conclusively expression plasmid by restriction enzyme digestion, and after through NotI digestion, from carrier framework, separate the linear expression cassette (Figure 15 A) of 8.9kb, and it is transformed into Trichodermareesei RF5796 protoplastis.Transform according to (1993) described modifications such as the description of (1987) such as Penttila and Karhunen.Transformant was carried out purifying to it by single conidium on the screening flat board before forming spore on the PD.
The thermophilic ascomycete CBHI+CBD that analyzes transformant from the culture supernatants of shake-flask culture (50ml) produces.Described transformant is at the 5%KH with pH5.5 2PO 4Growth is 7 days in the buffered complex cellulase inducing culture (Joutsjoki etc. 1993).According to the description of van Tilbeurgh etc. 1988, use 4-methyl umbrella shape base-β-D-lactoside (MUL) substrate to analyze cellobiohydrolase activity.By using comprising the Southern hybridization of some genomic digestion products, and with expression cassette as probe, verify the genotype of selected transformant.SDS-PAGE analysis revealed reorganization thermophilic ascomycete CBHI+CBD enzyme is to produce as stablizing fusion rotein in Trichodermareesei.
The performance of 20K+CBD protein formulation in jean finishing/biological stone mill that embodiment 8 merges
To described with the mould 20K+CBD fusion rotein that produces as the host of wood, detect it similar ability of worn appearance that is provided to float stone is provided in the biological stone mill of jean according to embodiment 2.Effective commercialization 20K preparation is with making comparisons in the jean finishing.
Use ECOSTONE After the destarch of A200 α-Dian Fenmei, have Britain's jeans that the jean drills of the indigo dyeing at the bottom of the sulphur makes as test material.The warp thread of described fabric and weft yarn are RING SPINNING systems.Under the described condition of table 9, carry out cellulose treatment with Electrolux ' s WascatorFOM 71 CLS laundry machine dehydration machines.
Table 9 is used for the condition for surveys of cellulose treatment
Machined parameters
The jean loading capacity 1.3kg
Water 19L
Damping fluid/pH controls (pH6.5) 31.6gNa 2HPO 4·H 2O 10.5g citric acid
Time 55 minutes
Temperature
60℃
Cellulase dosage 250-3000 NCU/g fabric
The dosage of enzyme is the amount of giving that the neutral cellulase activity unit (NCU) of unit weight fabric carries out enzyme.After draining, by adding 5g NaOH (10 minutes, 40 ℃) pH is increased to more than 11, and rinsing comes the deactivation cellulase three times.Jeans are dry in rotating cylinder.Two pairs of jeans are used in each check.
Use L *a *B color space coordinate uses Minolta CM 2500 or CM 1000 spectrophotometers, evaluates the effect/wear levels (light source D65/2 °) of biological stone mill by the reflectance value of measuring color.After destarch, after (that is, before cellulose treatment) and the cellulose treatment, measure the color (data not shown) of the pro and con of jean.Each measured value all is the mean value of about 40 mensuration.Two pairs of jeans are all used in each check, and final result is its mean number.The brightness after enzyme is handled or the rising of brightness can be used to evaluate abrasive effect (performance or biological stone mill effect).The results are shown in table 10 and 11, wherein runic is used to emphasize similar wear levels and the dosage that equates.Use 20K or do not use the processing of any enzyme to be used as comparison.Some preparations (table 11) are through Overheating Treatment (pH6.0,65 ℃, 60-70 minute), for any residual Trichodermareesei endogenous enzyme activity of deactivation and/or in order to check the effect of described thermal treatment for enzyme stability.
Table 10 is handled the color measurenent in jean front with the 20K+CBD fusion rotein
Strain number Enzyme The NCU/g fabric Before the cellulose treatment After the cellulose treatment The increase of L*
L * b * L * b *
- There is not enzyme 0 16.77 -9.95 18.18 -12.39 1.42
- 20K 1 3000 16.8O -9.70 24.00 -14.71 7.20
- 20K 1 1500 16.73 -10.05 22.98 -14.62 6.25
RF6036 20K+CBD 500 16.41 -10.14 22.80 -14.19 6.40
RF5977 20K+CBD 250 16.68 -9.91 22.81 -14.47 6.13
RF5977 20K+CBD 500 16.73 -10.01 24.07 -14.70 7.34
RF5977 20K+CBD 1500 16.71 -9.68 25.63 -14.79 8.93
L *Be meant brightness ,-b *Be blue direction ,+b *It is yellow direction
1Commercial formulation
Table 11 uses heat treated 20K+CBD fusion rotein to handle the color measurenent in jean front
Strain number Enzyme The NCU/g fabric Before the cellulose treatment After the cellulose treatment The increase of L*
L * b * L * B *
- There is not enzyme 0 16.77 -9.95 18.18 -12.39 1.42
- 20K 1Without thermal treatment 3000 16.80 -9.70 24.00 -14.71 7.20
- 20K 1Without thermal treatment 1500 16.73 -10.05 22.98 -14.62 8.25
RF5206 20K CBHI- 3000 16.80 -10.00 22.61 -14.59 5.81
RF5582 20K+CBD construct #1.CBHI- 3000 16.83 -10.01 26.39 -15.13 9.56
RF5582 20K+CBD-construct #1.CBHI- 1000 16.61 -9.76 23.98 -14.98 7.37
RF5582 20K+CBD-construct #1.CBHI- 500 16.70 -9.93 22.75 -14.75 6.05
RF5583 20K+CBD-construct #2.CBHI- 3000 16.73 -9.98 24.78 -14.95 8.05
RF5583 20K+CBD-construct #2.CBHI- 1000 16.92 -9.92 22.73 -14.57 5.81
RF5583 20K+CBD-construct #2.CBHI- 500 16.62 -10.03 21.76 -14.37 5.14
RF5977 20K+CBD-construct #5. 2 500 16.56 -9.77 23.00 -14.55 6.45
L *Be meant brightness ,-b *Be blue direction ,+b *It is yellow direction
1Commercial formulation, 2CBHI-, CBHII-, EGI-, EGII-
Result among table 10 and Figure 16 shows, compares with the 20K bacterial strain, and the scourability of 20K+CBD fusion rotein of the present invention in jean is handled obtained being greatly improved.Use bacterial strain RF5977, can use the enzyme dosage that is low to moderate 250 NCU/g fabrics, just can obtain and use wear levels (the luminosity L of the 20K gained of 1500 NCU/g dosage *) similar.Therefore, obtain 6 times of better scourabilities, and contrast gradient might as well.Equally, the scourability of use bacterial strain RF5978 acquisition and use RF5977 gained is similar.
To the thermal treatment of the fusion protein formulations granite-wash effect that as if decreases, for example use RF5977, need the dosage of 500NCU/g fabric to obtain and use the identical wear levels (table 10) of dosage without the 250NCU/g of thermal treatment preparation.Yet, compare with prior art formulations, still in scourability, obtained 3 times improvement.
The performance of 20K+CBD joint disappearance protein formulation in jean finishing/biological stone mill of 20K+CBD affinity mutant protein that embodiment 9 merges and fusion
As described in embodiment 3, use the mould fusion 20K+CBD affinity mutant enzyme that produces as the host of wood, with the mould fusion 20K+CBD joint disappearance albumen that produces as the host of usefulness wood as described in embodiment 4, its ability in the biological stone mill of jean is tested.Effective commercialization 20K preparation is with making comparisons in the jean finishing.
Be used for the jean of biological stone mill and checking system as described in the embodiment 8.Equally, about the evaluation of cellulose treatment effect also as described in the embodiment 8.As shown in table 12 to exemplary fused 20K+CBD affinity mutant protein with the result that fusion 20K+CBD joint disappearance protein formulation carries out biological stone mill check.
Bacterial strain RF6090 with Y31W aminoacid replacement has shown fabulous scourability (making an appointment 6 times than 20K is big) and good contrast gradient.The effectiveness of bacterial strain RF6090 and 20K more also can clearly be found out in Figure 16.Bacterial strain RF6084 with Y31A aminoacid replacement is approximately than 1.5 times of 20K.Fusion 20K+CBD with Y32A or Y31A_Y32A aminoacid replacement MutProteic biological stone mill effect is lower than 20K.Compare with the 20K bacterial strain, the scourability of 20K+CBD joint disappearance albumen in jean is handled is greatly improved and obtained good contrast gradient.Than 6 times at least of 20K, make an appointment 3 times greatly with the scourability of bacterial strain RF6108 (Δ G-444) with bacterial strain RF6110 (Δ G-460).
Table 12 is with 20K+CBD affinity mutant and merge the color measurenent that the 20K+CBD joint lacks albumen processing jean front
Strain number Enzyme (aminoacid replacement) Activity/g fabric Before the cellulose treatment After the cellulose treatment The increase of L*
L * B * L * B *
- There is not enzyme 0 16.77 -9.95 18.18 -12.39 1.42
- 20K 1 3000 16.80 -9.70 24.00 -14.71 7.20
- 20K 1 1500 16.73 -10.05 22.98 -14.62 6.25
RF6086 20K+CBDmul(Y32A) 1500 16.83 -9.68 22.05 -14.14 5.22
RF6086 20K+CBDmul(Y32A) 3000 16.68 -9.76 23.30 -14.40 6.62
RF6084 20K+CBDmul(Y31A) 1000 16.83 -9.42 23.15 -14.26 6.32
RF6090 20K+CBDmul(Y31W) 250 16.79 -9.32 22.99 -14.24 6.21
RF6090 20K+CBDmul(Y31W) 1000 16.77 -9.22 25.10 -14.74 8.33
RF6094 20K+CBDmul(Y31A_Y32A) 1500 16.78 -9.30 21.68 -14.02 4.89
RF6094 20K+CBDmul(Y31A_Y32A) 3000 16.71 -9.36 22.27 -14.14 5.56
- 20K 1 3000 16.80 -9.70 24.00 -14.71 7.20
RF6108 20K+CBD(ΔG-444) 250 16.65 -9.59 23.62 -13.97 6.97
RF6110 20K+CBD(ΔG-460) 1000 16.81 -9.72 24.17 -14.39 7.37
L *Be meant brightness ,-b *Be blue direction ,+b *It is yellow direction. 1Commercial formulation
Embodiment 10 20K+CBD fusion roteins are to the influence of jean intensity
From from wash the jeans that check obtains with 20K+CBD fusion rotein (embodiment 8 and 9), selecting the similar (L after cellulose treatment of wear levels *-be worth be about 23 or 24) some, carry out strength detection.According to standard SFS-EN ISO 13937-1,, tear strength and check sample after handling with the 20K+CBD fusion rotein are measured by the Elmendof method.Sample cuts at warp thread and weft direction.The gained result is as shown in table 13.
Cellulase fusion protein has caused the loss of strength substantially the same or lower with 20K,, uses some preparation that is, and it is higher that the intensity of fabric can keep.On warp thread and weft direction strength loss minimum be that bacterial strain RF6108 with joint disappearance Δ G-444 obtains.Equally, it is lower than 20K to have a strength loss that the affinity mutant RF6090 of Y31W aminoacid replacement causes.And bacterial strain RF5977 has the influence for fabric intensity similar with 20K.
Measure with the also selected tearing strength that carries out of some jeans of thermal treatment fusion protein formulations (embodiment 8, table 11) washing.Should be noted that with some thermal treatment preparation, the improved strength of fabric, but owing to reduced washing effect, need to use higher dosage to obtain identical wear levels.
Table 13 is measured with the tear strength of the jeans that 20K+CBD fusion rotein of the present invention is handled
Strain number Zymoprotein The NCU/g fabric L * Warp thread Weft yarn
Tear strength (N) (％) Tear strength (N) (％)
- No enzyme 0 1.5 62.2 100.0 46.2 100.0
- 20K 1 1500 22.9 46.3 74.4 31.9 69.0
RF5977 20K+CBD 250 22.9 48.1 77.3 32.1 69.5
RF6086 20K+CBDmut(Y32A) 3000 23.1 46.6 74.9 30 64.9
RF6084 20K+CBDmut(Y31A) 1000 23.1 47.2 75.9 30.6 66.2
RF6090 20K+CBDmut(Y31W) 250 23.2 48.6 78.1 34.4 74.5
RF6094 20K+CBDmut(Y31A Y32A) 3000 22.3 48.4 77.8 32.9 71.2
- 20K 1 3000 23.9 47.6 76.5 28.9 62.6
RF6108 20K+CBD(AG-444) 250 23.8 54.3 87.3 35.2 76.2
RF6110 20K+CBD(AG-460) 1000 24.0 48.4 77.8 29.8 64.5
1Commercial formulation
The 20K+CBD fusion protein formulations that embodiment 11 selects and the comparison of prior art zymin
Use the jean of other type that the best 20K+CBD fusion rotein in embodiment 8 and 9 is tested.The prior art preparation that effectively 20K preparation (Ecostone  NP8500) and two kinds can commercial acquisitions in jean finishing, the DeniMax  399S of Novozymes and the Mex 500 of Meiji, it is can the commercial the most spissated solid zymin that obtains, with making comparisons.
To the checking system of biological stone mill as described in the embodiment 8.Except the jean loading capacity is 1kg, so bath raio is slightly high.5 jean of being made by Down Under jean drills (Bradmill Textiles Pty, Australia) (" trouser legs ") are used for each check after destarch.The warp thread of described fabric and weft yarn are RING SPINNING systems.Enzyme is pressed NCU-activity unit and is given amount, therefore obtains similar wear levels (being determined as the cellulose treatment brightness in jean front afterwards).The effect of cellulose treatment is according to embodiment 8 evaluations, except each trouser legs being carried out 20 times color detection.
From detecting, each washing select two to have similar wear levels (L after the cellulose treatment *-be worth be about 26) trouser legs carry out intensity detection.The tear strength after handling with the 20K+CBD fusion rotein and the mensuration of check sample are as described in the embodiment 10.The gained result is shown in table 14 and Figure 17 A and 17B.
The tear strength of weft yarn is weaker than warp thread usually, but will be higher than the intensity of handling through 20K after the fusion rotein that uses bacterial strain RF5977, RF6090, RF6108 and RF6110 is handled.Compare with Mex 500 with DeniMax 399S, all obtained warp thread and weft direction intensity significantly improves with all fusion rotein bacterial strains.Equally, compare with other prior art formulations, the 20K bacterial strain is littler to the damage of fabric intensity.
The tear strength that table 14 is handled jean with 20K+CBD fusion rotein of the present invention, 20K and prior art preparation detects
Enzyme Form L * Warp thread Weft yarn
Tear strength (N) Tear strength (N)
Ecostone NP8500 Powder 25.9 58.0 40.3
RF5977，20K+CBD Particle 26.0 56.1 44.4
Mex 500，Meiji Powder 26.1 48.4 31.1
DeniMax399S，Novozymes Particle 25.5 50.6 38.1
RF6090，20K+CBD mut(Y31W) Liquid 26.0 57.9 43.4
RF6108，20K+CBD(ΔG-444) Liquid 25.9 55.6 43.9
RF6110，20K+CBD(ΔG-460) Liquid 26.2 59.8 45.4
L *Be meant brightness through jean front after the cellulose treatment
The service check of embodiment 12 20K+CBD preparations in biology finishing (preventing balling-up) performance of concentrated 20K+CBD fusion protein formulations in the biology finishing.The business-like acid cellulose zymin (US 5,874,293) that is rich in EGII is used for biological finishing goods, and will pass through the situation of enzyme processing with making comparisons.Use Electrolux ' s WascatorFOM 71 CLS laundry machine dehydration machines under the described condition of table 15, to prevent the processing of balling-up.
Two kind of 100% cotton unworn blouse piece material of making: fabric and the screw thread fabric with fine hair surface based on stockinette are used as Packed experimental material.Sample earlier at 60 ℃ with 1ml/l tensio-active agent/wetting agent (the Sandoclean PCJ of Sandos and the Imacol CN of Clariant) pre-wash 10 minutes and rinsing 3 times.Afterwards, under the condition that has the used identical textiles auxiliary agent of pre-wash, handle 60 minutes described cotton goods (cotton knits) at 60 ℃ with cellulase.After dehydration, pH is transferred to 11 above inactivators (60 ℃ 10 minutes) by using sodium hydroxide.Then with the piece material rinsing three times of tricot and dry on cylinder.
Table 15 is used for condition for surveys/machined parameters that biological finishing is handled
Machined parameters
The fabric loading capacity 1.0kg
Water 15L
Sandoclean PCJ and Imacol CN 1ml/l
PH controls pH5-5.3/pH6-6.3 Use acetate to regulate (80%)
Time 60 minutes
Temperature
60℃
Cellulase dosage The fabric weight of 0.25%-0.63%
With bore hole and magnifying glass the effect of cellulose treatment is carried out the vision evaluation.The gained result is shown in table 16, and the digital camera photo that the target of shooting is amplified as shown in figure 18.
The 20K+CBD fusion protein formulations has outstanding biology finishing character, has caused nappy extensive reduction and has prevented balling-up, and it can be clear that in the photo (taking the photograph from the screw needle tissue samples) of Figure 18.Check sample, particularly screw thread fabric blouse without enzyme is handled contain intensive surperficial fine hair and serious balling-up.Use the 20L+CBD preparation, (0.25% fabric weight o.w.f) has obtained the very knitted surfaces of cleaning, and the neutral cellulase that is equivalent to the 125NCU/g fabric is active to use minimum dosage mutually.This dosage has produced the same good effect with almost twice dosage.Compare with the dosage of the preparation that is rich in EGII that uses 0.63%o.w.f., this is the common dose of this enzyme concn in biological finish applications, uses the dosage of the 0.5%20K+CBD preparation of fabric weight, also can obtain similarly to go the ball effect.Equally, the validity of 20K+CBD substratum in the biology finishing that produces by recombinant host, on the volume at least twice be effective in the EGII that produces by recombinant host.
Table 16 is compared with the contrast that does not have enzyme with being rich in RGII, carries out the result that biological finishing is handled with the 20K+CBD fusion rotein
Sample Dosage g Dosage %o.w.f. a) Go the ball effect b)
20K+CBD concentrates 5 0.50 +++++
20K+CBD concentrates 2.5 0.25 ++++
Be rich in concentrating of RGII 6.3 0.63 +++++
Contrast does not have enzyme - - -
A) weight of fabric
B) ++ +++fabulous ball the effect of going, visually unusual clean Surface
++ ++ extraordinary ball effect, the visually clean Surface of going
-intensive surperficial fine hair and/or serious balling-up
The performance of embodiment 13 20K+CBD preparations in detergent applications
Can not contain any enzyme in the described goods by using the enzyme of 0-0.5% stain remover goods (standard stain remover ECE 98) weight, in the family expenses washing machine, circulate and check the effectiveness of granulating 20K+CBD fusion protein formulations by repeated washing.Condition for surveys is shown in table 17.Loading capacity, stain remover dosage and main condition for surveys be according to standard EN 60456:2003, but tool spot in addition.After through 5,10 and 15 washings, gather the fabric sample.
The check design of table 17 check 20K+CBD preparation performance
Project Explanation
The concentration of the enzyme that uses 0，0.1，0.25，0.5％
Washing machine Simens 1632 IQ
Washing procedure The cotton program of standard that does not have fuzzy logic
Stain remover ECE 98, and 50g washs at every turn
Stain remover pH in washing liquid 11
Wash temperature 40/60℃
Water hardness
16°fH
Loading capacity IEC60456:2003 loads 4kg
Every type of the artificial dirt that adds is 38 (37x37cm) altogether Art.No.101 *The cotton Art.No.163 that carbon black/sweet oil is made dirty *The cotton Art.No.112 that brose is made dirty *The cotton that cocoa is made dirty
The check textiles Art.No.224 *Anti-burnt hair Art.No.224 *Tensile strength
*From EMPA Test materialen AG, Switzerland
Carry out and be determined as the anti-burnt hair assay of color-match difference at material 224 (ISO 2267), be shown in table 18 and 19 and Figure 19 and 20.Use Spectraflsh 500 colourimeters (brightness D65/10 °), adopt the tristimulus method to measure aberration.
Therefore the 20K+CBD fusion protein formulations has the positivity effect on tristimulus color value Y, be anti-burnt hair.The effect of different enzyme concns much at one.Extremely low enzyme concn (0.10%) just is enough to anti-burnt hair.And with contain the commercial degreaser cellulase BIOTOUCH that exceeds 1.8 times of neutral cellulase activity (NCU) DCC compares, and uses the 20K+CBD fusion rotein just can obtain similar effects (data not shown).
After material 224 washings 15 times, be used for too detecting (data not shown) according to the tensile strength of ISO 13934-1:1999.Without any an enzyme concn tensile strength there is damaging action.All results are within each other the deviation scope and (change ± 2.5%).Identical result is applicable to stretching until breaking weight.
The performance of table 18 20K+CBD fusion rotein in detergent applications
Enzyme washs the article 224 of anti-burnt hair and the color-match difference between original (not washing) article
Wash temperature, enzyme concn (%) Difference (Δ Y)
Wash after 5 times Wash after 10 times Wash after 15 times
40℃，0％ -7.46 -10.39 -12.30
40℃，0.10％ -5.78 -6.60 -8.01
40℃，0.25％ -5.52 -6.08 -8.18
40℃，0.50％ -4.85 -5.24 -7.56
60℃，0％ -8.65 -11.43 -13.95
60℃，0.10％ -5.77 -6.77 -8.41
60℃，0.250％ -4.72 -5.70 -7.46
60℃，0.50％ -4.33 -6.29 -7.44
The performance of table 19 20K+CBD fusion rotein in detergent applications
Enzyme washs the article 224 of anti-burnt hair and does not use color-match difference between the enzyme washing
Wash temperature, enzyme concn (%) Difference (Δ Y)
Wash after 5 times Wash after 10 times Wash after 15 times
40℃，0％ 0 0 0
40℃，0.10％ 1.68 3.79 4.29
40℃，0.25％ 1.94 4.31 4.12
40℃，0.50％ 2.61 5.15 4.74
60℃，0％ 0 0 0
60℃，0.10％ 2.88 4.66 5.54
60℃，0.250％ 3.93 5.73 6.49
60℃，0.50％ 4.32 5.14 6.51
Reference
Aho S，V Olkkonen，T Jalava，M Paloheimo，R Bhler，M-L Niku-Paavola，EH Bamford and M Korhola.1991.Monoclonal antibodiesagainst core and cellulose-binding domains of Trichoderma reeseicellobiohydrolases I and II and endoglucanase I.Eur.J.Biochem.200：643-649.
Azevedo Mde O，Felipe MS，Astolfi-Filho S，Radford A.1990.Cloning，sequencing and homologies of the cbh-1(exoglucanase)gene ofHumicola grisea var.thermoidea.J Gen Microbiol.136：2569-2576.
Bailey MJ and Nevalainen KMH.1981.Induction，isolation and test-ing of stable Trichoderma reesei mutants with improved production ofsolubilizing cellulase.Enz Microbiol Technol.3：153-157.
Haakana H，Miettinen-Oinonen A，Joutsjoki V，Mantyla A，SuominenP，and Vehmaanpera J.2004.Cloning of cellulase genes fromMelanocarpus albomyces and their efficient expression in Trichodermareesei.Enz Microbiol Technol.34：159-167.
Henrissat B.(1991)A classification of glycosyl hydrolases based onamino acid sequence similarities.Biochem.J.280：309-316.
Henrissat B.and Bairoch A.(1993)New families in the classificationof glycosyl hydrolases based on amino acid sequence similarities.Biochem.J.293：781-788.
Hong J，Tamaki H，Yamamoto K and Kumagai H.2003.Cloning of agene encoding thermostable cellobiohydrolase from Thermoascusaurantiacus and its expression in yeast.Appl Microbiol Biotechnol 63：42-50.
Joutsjoki VV，Torkkeli TK，and Nevalainen KMH.1993.Transforma-tion of Trichoderma reesei with the Hormoconis resinaeglucoamylase P(gamP)gene：production of a heterologous glucoamylaseby Trichoderma reesei.Curr.Genet.24：223-228.
Karhunen T，A Mantyla，KMH Nevalainen，and PL Suominen.1993.High frequency one-step gene replacement in Trichoderma reesei.I.Endoglu-canase I overproduction.MoI.Gen.Genet.241：515-522.
Laemmli UK.1970.Cleavage of structural proteins during theassembly of the head of bacteriophage T4.Nature 227：680-685.
Linder M，Mattinen ML，Kontteli M，Lindeberg G，Stahlberg J，Dra-kenberg T，Reinikainen T，Pettersson G，Annila A.1995.Identification offunc-tionally important amino acids in the cellulose-binding domain ofTrichoderma reesei cellobiohydrolase I.Protein Science 4：1056-1064.
Lowry OH，NJ Roseborough，AL Farr and RJ Randall.1951.Proteinmeasurement with the FoNn phenol reagent.J.Biol Chem 193：265-275.
Malardier L，Daboussi MJ，Julien J，Roussel F，Scazzocchio C andBrygoo Y.1989.Cloning of the nitrate reductase gene (niaD) ofAspergillus nidulans and its use for transformation of Fusarium oxysporum.Gene 15：I47-156.
Miettinen-Oinonen A，Londesborough J，Joutsjoki V，Lantto R andVehmaanpera，J.2004.Three cellulases from Melanoarpus albomyces withapplications in the textile industry.Enz Microbiol Technol.34：332-341.
Penttila M，H Nevalainen，M Rattó，E Salminen，and J Knowles.1987.A versatile transformation system for the cellulolytic filamentousfungus Trichoderma reesei.Gene 61：155-164.
Saloheimo A，Henrissat B，Hoffren AM，Teleman O，Penttila M.1994. A novel，small endoglucanase gene，eg/5，from Trichoderma reeseiiso-lated by expression in yeast. MoI Microbiol 13：219-228.
Sambrook J，EF Fritsch，and T Maniatis.1989.Molecular cloning，alaboratory manual.Cold Spring Harbor Laboratory，New York，US.
Sambrook J and DW Russell.2001.Molecular cloning，a laboratorymanual.Cold Spring Harbor Laboratory，New York，US.
Srisodsuk M，Reinikainen T，Penttila M，Teeri TT.1993.Role of theinterdomain linker peptide of Trichoderma reesei cellobiohydrolase I in itsinteraction with crystalline cellulose.J.Biol.Chem.268：20756-20761.
Van Tilbeurgh H，Loonties F，de Bruyne C，Clayssens M 1988.Fluorogenic and chromogenic glycosides as substrates and ligands ofcarbo-hydrases.Meth.Enzymol.160：45-59.
Ward M，Shan W，Dauberman J，Weiss G，Larenas E，Bower B，ReyM，Clarkson K and Bott R.(1993) Cloning，sequence and preliminarystructural analysis of a small，high pi endoglucanase(EGIII) fromTrichoderma reesei.Proceedings of the second TRICEL symposium onTRICHODERMA REESEI CELLULASES AND OTHER HYDROLASES，Espoo，Finland，1993，ed.by P.Suominen and T.Reinikainen.Foundationfor Biotechnical and Industrial Fermentation Research 8(1993)：153-158.

Claims (55)

1. cellulase fusion protein, it comprises:
A. first aminoacid sequence of the optional modification of cellulase core, described cellulase core derives from a certain species, and
B. second aminoacid sequence of the optional modification of joint and/or cellulose binding domain (CBD), described joint and/or cellulose binding domain derive from another species,
Wherein, introduced connecting zone between described first aminoacid sequence and described second aminoacid sequence, thereby obtained stable fusion rotein.
2. the cellulase fusion protein of claim 1, wherein said connecting zone has following general formula:
1A- 2B- 3C- 4D- 5E- 6F
Wherein
1A is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably, 1A is Gly or Val, most preferably is Gly;
2B is selected from Gly, Ala, Leu, Pro, Ile, Phe, Val, Glu, Asp, Gln and Asn; Preferably, 2B is Pro, Gln or Glu;
3C is selected from Gly, Ala, Lys, Leu, Pro, Ile, Val, Ser and Thr; Preferably, 3C is Ile;
4D is selected from Gly, Ala, Leu, Pro, Ile and Val; Preferably, 4D is Gly or Pro;
5E is selected from Ser, Pro and Thr; Preferably, 5E is Ser; And
6F is selected from Ser, and Thr or do not exist is preferred, 6F is Ser or does not exist; Wherein 1A is connected in the C-terminal amino acid sequence of cellulase core, and 6F is connected in the-terminal amino acid sequence of described joint and/or structural domain (CBD).
3. the cellulase fusion protein of claim 2, wherein said connecting zone has following general formula:
1Gly- 2B- 3Ile- 4D- 5Ser- 6F
Wherein
2B is Pro, Gln or Glu;
4D is Gly or Pro;
5E is Ser; And
6F is Ser or does not exist.
4. the cellulase fusion protein of claim 2, wherein said connecting zone has following general formula:
1Val- 2Gln- 3Ile- 4Pro- 5Ser- 6Ser。
5. the cellulase fusion protein of claim 2, wherein said connecting zone has following general formula:
1Gly- 2Glu- 3Ile- 4Gly- 5Ser or 1Gly- 2Pro- 3Ile- 4Gly- 5Ser.
6. each cellulase fusion protein of claim 1-5, wherein said first aminoacid sequence from neutral cellulase and described second aminoacid sequence from acidic cellulase.
7. the cellulase fusion protein of claim 6, wherein said first aminoacid sequence is from the cellulase of family 45 and described second aminoacid sequence cellulase from family 7.
8. the cellulase fusion protein of claim 6, wherein said neutral cellulase derives from fungi.
9. the cellulase fusion protein of claim 8, wherein said neutral cellulase derives from Melanocarpus and belongs to, Humicola (Humicola), Thielavia (Thielavia), myceliophthora (Myceliophthora), Fusarium (Fusarium), Acremonium (Acremonium), gold spore Pseudomonas (Chrysosporium), thermophilic ascomycete belongs to (Thermoascus), the mould genus of broom (Scopulariopsis), Myriodontium (Myriococcum), Talaromyces (Talaromyces) or Chaetomium (Chaetomium) preferably derive from Melanocarpus sp, most preferably derive from Melanocarpus albomyces.
10. the cellulase fusion protein of claim 9, wherein said cellulase is a Melanocarpus albomyces 20K cellulase, 50K cellulase, 50KB cellulase, or derivatives thereof.
11. the cellulase fusion protein of claim 9, wherein said cellulase are orange thermophilic ascomycete (Thermoascus aurantiacus) CBHI or derivatives thereofs.
12. the cellulase fusion protein of claim 6, wherein said acidic cellulase derive from Trichoderma (Trichoderma sp.) or meat seat bacterium (Hypocrea), preferably derive from Trichodermareesei (Trichoderma reesei).
13. the cellulase fusion protein of claim 6, wherein said neutral cellulase is the Melanocarpus albomyces 20K cellulase or derivatives thereof of SEQ ID.NO:2, and joint and/or the CBD or derivatives thereof of described second aminoacid sequence Trichodermareesei cellobiohydrolase I that is SEQ ID.NO:4.
14. each cellulase fusion protein of claim 1-13, wherein said first aminoacid sequence and/or second aminoacid sequence are adorned.
15. the cellulase fusion protein of claim 14, wherein in described second aminoacid sequence, last 492 of ripe Trichodermareesei CBHI (CBD 31) and/or 493 s' (CBD 32) amino acid tyrosine is by aliphatic amino acid, preferably replaced by L-Ala, and/or, preferably replaced by tryptophane by die aromatischen Aminosaeuren.
16. the cellulase fusion protein of claim 15, wherein said second aminoacid sequence is selected from SEQ ID.NO:45,46,47 and 48.
17. the cellulase fusion protein of claim 14, wherein in described second aminoacid sequence, amino acid 434-444 in the ripe Trichodermareesei CBHI sequence or 434-460 lack.
18. the cellulase fusion protein of claim 17, wherein said second aminoacid sequence is selected from SEQ ID.NO:49 and 50.
19. the cellulase fusion protein of claim 14, wherein in described first aminoacid sequence, the amino acid Xie Ansuan disappearance on 208 of the Melanocarpus albomyces 20K cellulase sequence of SEQ ID.NO:2.
20. the cellulase fusion protein of claim 14, wherein in described first aminoacid sequence, the amino acid alanine disappearance on 207 of the Melanocarpus albomyces 20K cellulase sequence of SEQ ID.NO:2.
21. the cellulase fusion protein of claim 14, wherein in described first aminoacid sequence, the amino acid phenylalanine on 209 of the Melanocarpus albomyces 20K cellulase sequence of SEQ ID.NO:2 is replaced by Trp.
22. the cellulase fusion protein of claim 14, wherein in described first aminoacid sequence, amino acid contains the proline(Pro) of the insertion after 206 of the Melanocarpus of SEQ ID.NO:2 albomyces 20K cellulase sequence.
23. the cellulase fusion protein of claim 14, wherein in described first aminoacid sequence, amino acid is selected from SEQ ID.NO:37,38,39 and 40.
24. each cellulase fusion protein of claim 1-23, wherein said fusion rotein is stable.
25. each cellulase fusion protein of claim 1-23, the preparation that wherein contains described fusion rotein by thermal treatment by further stabilization.
26. the cellulase fusion protein of claim 1, wherein said first cellulase lacks CBD natively.
27. the cellulase fusion protein of claim 1, wherein CBD is from described first cellulase disappearance.
28. expression vector, first polynucleotide sequence that comprises optional first aminoacid sequence of modifying of coding cellulase core, described cellulase core derives from a certain species, and second polynucleotide sequence of coding joint and/or optional second aminoacid sequence of modifying of cellulose binding domain (CBD), described joint and/or cellulose binding domain (CBD) derive from another species, and coding connects the polynucleotide of the connecting zone of described first and second polynucleotide sequences, and described polynucleotide sequence coding is the aminoacid sequence separately of the concrete qualification of institute as above.
29. the expression vector of claim 28, the joint of wherein said first polynucleotide sequence coding neutral cellulase core and the described second polynucleotide sequence coding acidic cellulase and/or cellulose binding domain (CBD).
30. the expression vector of claim 29, wherein said neutral cellulase derives from Melanocarpus and belongs to, Humicola (Humicola), Thielavia (Thielavia), myceliophthora (Myceliophthora), Fusarium (Fusarium), Acremonium (Acremonium), gold spore Pseudomonas (Chrysosporium), thermophilic ascomycete belongs to (Thermoascus), the mould genus of broom (Scopulariopsis), Myriodontium (Myriococcum), Talaromyces (Talaromyces) or Chaetomium (Chaetomium) preferably derive from Melanocarpus sp., most preferably derive from Melanocarpus albomyces.
31. the expression vector of claim 30, wherein said cellulase are Melanocarpusalbomyces 20K cellulases, 50K cellulase, 50KB cellulase, or derivatives thereof.
32. the expression vector of claim 30, wherein said cellulase are orange thermophilic ascomycete (Thermoascus aurantiacus) CBHI.
33. the expression vector of claim 28, wherein said acidic cellulase derive from Trichoderma or meat seat bacterium (Hypocrea), preferably derive from Trichodermareesei (Trichoderma reesei).
34. the expression vector of claim 28, wherein said neutral cellulase is the Melanocarpus albomyces 20K cellulase or derivatives thereof of SEQ ID.NO:1, and joint and/or the CBD or derivatives thereof of described second aminoacid sequence Trichodermareesei cellobiohydrolase I that is SEQ ID.NO:3.
35. each expression vector of claim 28-34, wherein said first aminoacid sequence and/or second aminoacid sequence are adorned.
36. the expression vector of claim 35, wherein said second polynucleotide sequence coding are selected from SEQ ID.NO:45,46,47 and 48 aminoacid sequence.
37. the expression vector of claim 35, wherein said second polynucleotide sequence coding is selected from the aminoacid sequence of SEQ ID.NO:49 and 50.
38. the expression vector of claim 35, wherein said first polynucleotide sequence coding are selected from SEQ ID.NO:37,38,39 and 40 aminoacid sequence.
39. the expression vector of claim 28, the wherein said first polynucleotide sequence coding cellulase, the natural shortage CBD of described cellulase.
40. host cell comprises each expression vector that is limited as claim 28-39.
41. the host cell of claim 40, it derives from fungi.
42. the host cell of claim 41, it belongs to filamentous fungus.
43. the host cell of claim 41 or 42, it belongs to Trichoderma (Trichoderma) or Aspergillus (Aspergillus).
44. the host cell of claim 43, it is a Trichodermareesei.
45. produce as the method for each cellulase fusion protein that is limited of claim 1-27, it comprise cultivate as each described host cell of claim 41-44 and from substratum the proteic step of recovery.
46. zymin, it comprises each cellulase fusion protein that is limited as claim 1-27.
47. the method for biological stone mill, it comprises the step that adds as each cellulase fusion protein that is limited of claim 1-27 or the described preparation of claim 46 in fabric that contains cotton thread or clothes.
48. the method for claim 47, wherein said fabric or clothes are jean.
49. the method for biological finishing, it comprises the step that adds as each cellulase fusion protein that is limited of claim 1-27 or the described preparation of claim 46 in textile materials kind fabric or clothes or yarn.
50. the method for claim 49, wherein said textile materials are by the fiber that contains natural cellulose or contain that artificial cellulose's fiber manufacturing forms or its mixture.
51. the method for claim 49, wherein said textile materials are synthon and the adulterant that contains cellulosic fiber.
52. detergent compositions, it contains just like each cellulase fusion protein that is limited of claim 1-27 or described zymin of claim 46 and auxiliary agent, for example surfactant, tensio-active agent, SYNTHETIC OPTICAL WHITNER or builder.
53. handle the method for the textile materials contain cellulosic fibre, wherein said method comprises the described detergent compositions of described textile materials and claim 52 is contacted.
54. handle the method for wooden source slurry or fiber, it comprises the step that adds as preparation as described in each cellulase fusion protein that is limited of claim 1-27 or the claim 46 in the machinery of wooden source property or chemical pulp or secondary fiber.
55. improve the animal-feed method for quality, it comprises uses as each cellulase fusion protein that is limited of claim 1-27 or the described preparation materials to process vegetal of claim 46.
CN200680014750.8A 2005-04-29 2006-04-25 Improved cellulases Active CN101171333B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US11/119,526 US7741093B2 (en) 2005-04-29 2005-04-29 Cellulases and their uses
FI20055202A FI118340B (en) 2005-04-29 2005-04-29 New cellulase fusion protein comprises a cellulase core, and a linker and/or cellulose-binding domain (CBD), useful in textile industry, e.g. biostoning or biofinishing, or as detergent composition or as enzyme preparation
FI20055202 2005-04-29
PCT/FI2006/050161 WO2006117432A1 (en) 2005-04-29 2006-04-25 Improved cellulases
US11/119,526 2007-04-29

Publications (2)

Publication Number Publication Date
CN101171333A true CN101171333A (en) 2008-04-30
CN101171333B CN101171333B (en) 2014-04-02

Family

ID=34508201

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200680014750.8A Active CN101171333B (en) 2005-04-29 2006-04-25 Improved cellulases

Country Status (2)

Country Link
CN (1) CN101171333B (en)
FI (1) FI118340B (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101915709A (en) * 2010-06-11 2010-12-15 天津工业大学 Method and device for detecting wear resistance of metallic coated fabric
CN103045565A (en) * 2012-12-14 2013-04-17 南京林业大学 High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof
US8592195B2 (en) 2008-12-30 2013-11-26 Ab Enzymes Oy Fungal endoglucanases, their production and use
CN109234174A (en) * 2018-11-12 2019-01-18 陕西科技大学 A kind of thermophilic fungal of cellulase-producing and its application
CN110981965A (en) * 2019-11-06 2020-04-10 天津科技大学 Fusion protein for improving lignocellulose hydrolysis rate, construction method, expression and application
CN111670250A (en) * 2017-12-21 2020-09-15 生化酶股份有限公司 Variants of fungal cellulases
CN113195713A (en) * 2018-11-13 2021-07-30 生化酶股份有限公司 Fungal cellulase variants with improved stability

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK115890D0 (en) * 1990-05-09 1990-05-09 Novo Nordisk As ENZYME
JP3532576B2 (en) * 1996-09-17 2004-05-31 ノボザイムス アクティーゼルスカブ Cellulase mutant

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8592195B2 (en) 2008-12-30 2013-11-26 Ab Enzymes Oy Fungal endoglucanases, their production and use
CN102272298B (en) * 2008-12-30 2014-07-16 生化酶股份有限公司 Fungal endoglucanases, their production and use
CN101915709B (en) * 2010-06-11 2012-11-21 天津工业大学 Method and device for detecting wear resistance of metallic coated fabric
CN101915709A (en) * 2010-06-11 2010-12-15 天津工业大学 Method and device for detecting wear resistance of metallic coated fabric
CN103045565A (en) * 2012-12-14 2013-04-17 南京林业大学 High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof
CN103045565B (en) * 2012-12-14 2014-06-18 南京林业大学 High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof
CN111670250A (en) * 2017-12-21 2020-09-15 生化酶股份有限公司 Variants of fungal cellulases
CN111670250B (en) * 2017-12-21 2024-02-13 生化酶股份有限公司 Variants of fungal cellulases
CN109234174A (en) * 2018-11-12 2019-01-18 陕西科技大学 A kind of thermophilic fungal of cellulase-producing and its application
CN109234174B (en) * 2018-11-12 2021-04-27 陕西科技大学 Thermophilic fungus for producing cellulase and application thereof
CN113195713A (en) * 2018-11-13 2021-07-30 生化酶股份有限公司 Fungal cellulase variants with improved stability
CN110981965B (en) * 2019-11-06 2022-11-15 天津科技大学 Fusion protein for improving lignocellulose hydrolysis rate, construction method, expression and application
CN110981965A (en) * 2019-11-06 2020-04-10 天津科技大学 Fusion protein for improving lignocellulose hydrolysis rate, construction method, expression and application

Also Published As

Publication number Publication date
FI20055202A0 (en) 2005-04-29
CN101171333B (en) 2014-04-02
FI20055202A (en) 2006-10-30
FI118340B (en) 2007-10-15

Similar Documents

Publication Publication Date Title
EP1874927B1 (en) Improved cellulases
US7981654B2 (en) Cellulases and their uses
CN107109385B (en) Fungal endoglucanase variants, their production and use
DK1969123T3 (en) Hitherto UNKNOWN ENZYMS
KR101439352B1 (en) Enzyme fusion proteins and their use
FI122028B (en) Endoglucanases derived from fungi, their preparation and use
FI122029B (en) Fungal endoglucanases, their production and use
US7256032B2 (en) Enzymes
WO1997014804A1 (en) Cellulases, the genes encoding them and uses thereof
JP2001523463A (en) Cellulase produced by actinomycetes and method for producing the same
CN101171333B (en) Improved cellulases
US7361487B2 (en) Enzyme fusion proteins and their use
CN101346464B (en) Novel enzymes
US7273748B2 (en) Cellulases, the genes encoding them and uses thereof
EP0866165B2 (en) Method and enzyme mixture for improved depilling of cotton goods
CN101460617B (en) Enzyme fusion proteins and their use

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant