CN101163796B - Cationic lipids and methods of use - Google Patents

Abstract

The present invention is directed to lipid-based formulations for delivering, e.g., introducing, nucleic acid-lipid particles to a cell, and assays for optimizing the delivery efficiency of such lipid-based formulations. The nucleic acid-lipid particles comprise an interference RNA molecule, a cationic lipid with alkyl side chains from about 10 to about 20 carbon atoms having more than a single site of unsaturation, a noncationic lipid and a conjugated lipid that inhibits aggregation of the particle such as a polyethyleneglycol (PEG)-lipid conjugate or a polyamide (ATTA)-conjugate).

Description

Cation lipid and application method

Cross reference to related application

The application requires to be filed in the U.S. Provisional Patent Application number 60/578,075 on June 7th, 2004, is filed in 60/610 of on September 17th, 2004; 746; With 60/679,427 the rights and interests that are filed on May 9th, 2005, from all purposes with it each full content incorporate into as a reference hereby.

Background of invention

Effective and safe genes delivery system is that useful clinically gene therapy is needed.Virus vector is relative efficient gene delivery system, but suffers from multiple limitation, such as the possibility and the immunne response problem of being reversed into wild-type.As a result, the non-viral gene delivery system is receiving increasing concern (Worgall, etal., Human Gene Therapy8:37-44 (1997); Peeters, etal., Human Gene Therapy7:1693-1699 (1996); Yei, et al., Gene Therapy1:192-200 (1994); Hope, et al., Molecular Membrane Biology15:1-14 (1998)).DNA-cation lipid nanocrystal composition is present the most frequently used non-viral gene delivery vector (Felgner, Scientific American276:102-106 (1997); Chonn, et al., CurrentOpinion in Biotechnology6:698-708 (1995)).Yet mixture is bigger, and system is very uncertain, and it is inappropriate for the whole body application and can excites sizable toxic side effects (Harrison, et al., Biotechniques19:816-823 (1995); Huang, et al., Nature Biotechnology15:620-621 (1997); Templeton, etal., Nature Biotechnology15:647-652 (1997); Hofland, et al., Pharmaceutical Research14:742-749 (1997)).

Nearest work shown DNA can be encapsulated in little (～70nm diameter) " stable plasmid-lipid granule " (SPLP) in; It forms (Wheeler, etal.Gene Therapy6:271-281 (1999)) by the single plasmid that is encapsulated in the lipid bilayer carrier.These SPLPs typically comprise " confluent (fusogenic) " lipid dioleoyl phospholipid acyl-thanomin (DOPE), low-level cation lipid, and gather (terepthaloyl moietie) in existence be stable in aqueous medium during dressing (PEG).SPLP has whole body and uses, because after intravenously (i.v.) injection, they show the circulation lifetime that prolongs, because the vascular permeability that increases in these zones, they preferentially accumulate in the distally tumor sites, and can be at these tumor sites mediation transgene expressions.After i.v. injection comprises the SPLP of luciferase marker gene, be superior to using DNA-cation lipid nanocrystal composition (lipoplexes) or the obtainable level of naked DNA in the level of the observed transgene expression of tumor sites.However, for the ideal treatment benefit in some application, the expression that possibly improve the standard (see, for example, Monck, etal., J.Drug Targ.7:439-452 (2000)).

Typically, liposome and SPLPs comprise cation lipid.Usually, said cation lipid has 2 alkyl chains, ether (oxygen) key and amine head group such as, for example DODAC and DODMA.Typically, alkyl chain comprises undersaturated single site.Unfortunately, the cation lipid that only has a unsaturated single site can lack flexibility.The liposome or the SPLP that comprise these cation lipids can lack enough membrane fluidities, and therefore influence is delivered to the effect among cell or the patient with biologically active agent.

The lipid flexibility is important in exploitation liposome or SPLP drug delivery system.Therefore, it is desirable to develop the cation lipid that has more flexibility, increase the membrane fluidity of liposome or SPLP thus.The present invention has satisfied this and other needs.

Summary of the invention

The present invention provides new cation lipid, compares with cation lipid (such as DODAC and DODMA) commonly used, and it has the flexibility of increase.More specifically; Found surprisingly that cation lipid of the present invention has improved the character of liposome and nucleic acid-lipid granule (SPLPs) through the membrane fluidity that increases liposome or SPLP, is increased in the effect of sending biologically active agent among liposome and the SPLP thus.Particularly, the present invention provides the compound of the formula I with structure:

In the compound of above-mentioned formula I, R ¹And R ²Be H or C independently ₁-C ₃Alkyl.R ³And R ⁴In the compound of formula I, select independently and be alkyl group with about 20 carbon atoms of about 10-, and R ³And R ⁴At least one of them comprises at least two unsaturated sites.R ³And R ⁴Can be identical or different.If different, R ³And R ⁴Can aspect alkyl chain length, aspect undersaturated site, or be different aspect the number in undersaturated site.R ³And R ⁴Can comprise at least two unsaturated sites (R for example ³And R ⁴Can be, for example 12 carbon dialkylenes, 14 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base (linoleyl), 20 carbon dialkylenes).In preferred embodiments, R ³And R ⁴It all is inferior oil base.R ³And R ⁴Can comprise at least three unsaturated sites (R for example ³And R ⁴Can be, for example, 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl).

The present invention also provides the compound of the formula II with structure:

In above-mentioned formula II, R ¹And R ²Select independently and be H or C ₁-C ₃Alkyl.R ³And R ⁴Select independently and be the alkyl group with about 20 carbon atoms of about 10-, wherein R ³And R ⁴At least one comprises at least two unsaturated sites.In one embodiment, R ³And R ⁴All be identical, i.e. R ³And R ⁴It all is inferior oil base (C18) etc.In another embodiment, R ³And R ⁴Be different, i.e. R ³Be 14 carbon trialkenyl (C14), and R ⁴Be inferior oil base (C18).In preferred embodiments, cation lipid of the present invention is symmetric, i.e. R ³And R ⁴All be identical.In another preferred embodiment, R ³And R ⁴All comprise at least two unsaturated sites.In some embodiments, R ³And R ⁴Be independently selected from 12 carbon dialkylenes, 14 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base and 20 carbon dialkylenes.In preferred embodiments, R ³And R ⁴It all is inferior oil base.In some embodiments, R ³And R ⁴Comprise at least three unsaturated sites and be independently selected from, 12 carbon trialkenyl for example, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

In yet another aspect, the present invention provides liposome, and said liposome comprises formula I, the cation lipid of formula II or its combination.Said liposome can also comprise PEG-lipid (for example, PEG-DG, PEG-dialkoxy propyl group, PEG-ceramide, PEG-phosphatidylethanolamine or its mixture).Said liposome can be unloaded, or alternatively, said liposome can also comprise one or more biologically active agents.The biologically active agent that is fit to includes, but not limited to antitumour drug, microbiotic, immunomodulator, antiphlogistic drug with act on the medicament on the cns.Similarly, the biologically active agent that is fit to includes, but not limited to peptide, protein and nucleic acid (for example list or double-stranded DNA, strand or double-stranded RNA comprise siRNA).

In yet another aspect, the present invention provides the method that biologically active agent is delivered to cell, and said method comprises to be made cell and comprise formula I, the liposome contact of the cation lipid of formula II or its combination, and wherein said biologically active agent is encapsulated in the liposome.Similarly, in yet another aspect, the present invention provides biologically active agent is sent the method to the patient, and said method comprises using to the patient and comprises formula I, the liposome of the cation lipid of formula II or its combination, and wherein said biologically active agent is encapsulated in the liposome.

In yet another aspect, the present invention provides nucleic acid-lipid granule, and said nucleic acid-lipid granule comprises: nucleic acid; Formula I, formula II, or the cation lipid of its combination; The non-cationic lipid; With the PEG-lipid conjugates.

In yet another aspect, the present invention provides the method for nucleic acid being introduced cell, and said method comprises makes cell contact with nucleic acid-lipid granule; Said nucleic acid lipid granule comprises formula I, formula II, or the cation lipid of its combination; The non-cationic lipid, PEG-lipid conjugates, and nucleic acid.

Further feature of the present invention, target and advantage and preferred embodiment thereof will be through following detailed, embodiment, claim and accompanying drawing and become obvious.

The accompanying drawing summary

Fig. 1 illustrates the structure of two exemplary cation lipids of the present invention: 1, and 2-two inferior oil base oxygen base-N, N-dimethylaminopropanecompounds (DLinDMA) and 1,2-two flax base oxygen base-N, N-dimethylaminopropanecompounds (DLenDMA).

Fig. 2 illustrates the synthetic route of DLinDMA.

Fig. 3 illustrates the synthetic route of DLenDMA.

Fig. 4 illustrates the data that show the apparent pKa that is combined in the cation lipid among the SNALP.

Fig. 5 illustrates demonstration ³¹The result's that P-NMR analyzes data, said ³¹P-NMR is used for confirming unsaturated influence to transformation temperature.

Fig. 6 illustrates such data, and said data presentation is behind the Neuro2a cell of in-vitro transfection stably express luciferase, by SPLP (promptly; SNALP) make the silence of genetic expression; Said SPLP comprises DODAC, DODMA, or DLinDMA and seal anti-luciferase siRNA sequence.

Fig. 7 illustrates the data of the gene silencing of the outer SNALP mediation of display body.

Fig. 8 illustrates and is presented at intravenously and sent behind the SPLP of plasmid that seals the coding luciferase data that luciferase genes is expressed in tumour 48 hours.Said SPLP comprises that PEG-C-DMA conjugate and DODMA or DLinDMA are wherein arbitrary.Said peg moiety has 2000 or 750 molecular weight.

Fig. 9 illustrates and is presented at intravenous administration and sealed behind the SPLP of plasmid of coding luciferase the data that luciferase genes is expressed in carrying the male A/J mouse of Neuro2A tumour 48 hours.Said SPLP comprises PEG-C-DMA and the DODMA or the DLinDMA of various ratios (promptly 15%, 10%, 5% or 2.5%).

Figure 10 illustrates such data, and said data presentation is used the PEG-C-DMA's that comprises different ratios (promptly 2%, 5%, 10%, or 15%) in azygos vein ³Behind the SPLP of H-CHE-mark or SNALP or the unloaded vesicle, the per-cent of the ID of remaining SPLP, SNALP or unloaded vesicle in the blood plasma of male A/J mouse.

Figure 11 illustrates such data, and said data presentation is used the PEG-C-DMA's that comprises various ratios in azygos vein ³Behind the preparation of H-CHE-mark 48 hours, in carrying the male A/J mouse of Neuro-2A tumour, SPLP, the bio distribution of SNALP or unloaded vesicle.Said SNALP and unloaded vesicle comprise DLinDMA.Said SPLP comprises DODMA.

Figure 12 illustrates such data, and said data presentation comprises behind the SNALP of DLinDMA 48 hours in intravenous administration, the silence of luciferase expression in the far-end in the A/J mouse, the stable Neuro2A-G tumour.

Figure 13 illustrates such data, said data presentation send comprise DLinDMA with seal the SNALP preparation of anti--luciferase siRNA after, the silence of luciferase expression in the Neuro2A-G cell.

Figure 14 illustrates such data, said data presentation send comprise DLinDMA and the SNALP preparation of siRNA of sealing anti--luciferase after, the silence of the luciferase expression in the Neuro2A-G cell.Carry out sending of SNALP preparation lacking or exist under the situation of chloroquine.

Figure 15 illustrates the data that showed cell absorbs SNALP.

Detailed Description Of The Invention

I. introduce

The present invention provides new cation lipid, compares with cation lipid (such as DODAC and DODMA) commonly used, and it has the flexibility of increase.When being attached in the lipid vesicle (for example, liposome, SPLP and SNALP), cation lipid as herein described is given the amalgamation (fusogenicity) of increase.

II. definition

Term " lipid " refers to one group of organic cpds, and it includes, but are not limited to the ester of lipid acid, and characteristic is insoluble in water, but in many organic solvents, is soluble.Usually they are divided at least three types: it comprises fat and oil and wax (1) " simple lipid "; (2) " compound lipid " it comprise phosphatide and glycolipid; (3) " deutero-lipid " is such as steroid.

" lipid vesicle " refers to can be used for transmitting any lipid composition of compound, and it includes, but not limited to liposome, and wherein volume of water is sealed by amphipathic lipid bilayer; Or wherein lipid coating comprises and the inside of macromolecular components such as the plasmid that comprises interference RNA sequence, follows the aqueous interior of minimizing; Or lipid coacervate or micelle, wherein entrapped composition is included in the chaotic relatively lipid mixt.

When being used for this paper, " lipid of sealing " can refer to provide have fully seal, partially encapsulated or both lipid formulations of compound.In a preferred embodiment, said nucleic acid fully is encapsulated in the lipid formulations (for example forms SPLP, pSPLP, or other SNALP).

When being used for this paper, term " SNALP " refers to stable nucleic acid lipid granule, comprises SPLP.SNALP represents the vesicle of the lipid of the aqueous interior that encapsulates minimizing, and said inside comprises nucleic acid (for example, ssDNA, dsDNA; SsRNA, microRNA (miRNA), short hairpin RNA (shRNA); DsRNA, siRNA or plasmid comprise from the plasmid of wherein transcribing RNA interfering).When being used for this paper, term " SPLP " refers to comprise the nucleic acid lipid granule of the nucleic acid (for example, plasmid) that is encapsulated in the lipid vesicle.SNALPs and SPLPs typically comprise cation lipid, non-cationic lipid and stop the lipid (for example, PEG-lipid conjugates) of said particle aggregation.SNALPs and SPLPs have systemic administration; Because they show the cycle life that prolongs in intravenously (i.v.) injection back; (for example, on the health with use on the site of separating in the site) assembled and can be mediated by the expression of the gene of transfection in these far-end sites in the far-end site.SPLPs comprises " pSPLP ", and it comprises the entrapped condensing agent-nucleic acid complexes as in WO00/03683, mentioning.

The term lipid of vesicle " form " tend to comprise any amphipathic lipids with hydrophobic part and polar head group and itself can be in water spontaneous formation bilayer vesicle, be exemplified as most of phosphatide.

Term " adopts the lipid of vesicle " and tends to comprise stable and any amphipathic lipids of lipid bilayer bonded; And other amphipathic lipids, its hydrophobic part is with inner, and the hydrophobic region of duplicature contacts; And its polar head group part is towards the outside, the polar surfaces of film.Adopt the lipid of vesicle to comprise such lipid, it can be suitable for adopting unstratified phase independently, can also when having double-deck stabilising component consisting, take bilayer structure.Typical instance is DOPE (DOPE).Double-deck stabilising component consisting includes, but not limited to suppress the lipid that the SNALPs accumulative is puted together; Polyamide oligomer as well as (for example; The ATTA-lipid derivate), peptide, protein, stain remover, lipid derivate, PEG-lipid derivate are such as with dialkoxy propyl group link coupled PEG, with DG link coupled PEG, (see U.S. Patent number 5 with phosphatidylethanolamine link coupled PEG and the PEG that puts together with ceramide; 885,613).PEG can directly put together maybe and can be connected with lipid through shank with lipid.Can use any shank that is suitable for PEG is coupled to lipid, comprise, for example, comprise the shank and the shank that comprises ester of non-ester.

When being used for this paper, term " shank that comprises non-ester " refers to not comprise the shank of carboxylic acid ester bond (OC (O)-).The shank that comprises non-ester that is fit to includes, but not limited to amido (C (O) NH-), amino (NR-), carbonyl (C (O)-), carbamate (NHC (O) O-), urea (NHC (O) NH-), disulphide (S-S-), ether (O-), succinyl-((O) CCH ₂CH ₂C (O)-), succinic diamide (NHC (O) CH ₂CH ₂C (O) NH-), ether, disulphide etc., and combination (such as the joint that comprises carbamate shank and amido shank).In preferred embodiments, the carbamate joint is used for PEG is coupled to lipid.

In other embodiment, the shank that comprises ester is used for PEG is coupled to lipid.The shank that comprises ester that is fit to comprises, carbonic ether (OC (O) O-) for example, amber one acyl group (succinoyl), SULPHOSUCCINIC ACID ESTER (O-(O) POH-O-), sulphonate, and combination.

Term " amphipathic lipids " partly refers to any suitable material, and wherein the hydrophobic part of matrix material is towards hydrophobic phase, and hydrophilic segment is towards water.Amphipathic lipids is the staple of lipid vesicle normally.Hydrophilic nmature from polarity or charged group such as glucide, phosphoric acid salt (ester), the existence of carboxyl, sulfato, amino, sulfydryl, nitro, hydroxyl and other similar group.Hydrophobicity can be given through comprising non-polar group, and it is saturated with the unsaturated aliphatic hydrocarbyl group with by one or more aromatic series, the alicyclic or substituted such group of heterocyclic group that said non-polar group includes, but not limited to long-chain.The instance of amphiphilic cpds includes, but not limited to phosphatide, aminolipid and sphingolipid.The representative example of phosphatide comprises; But be not limited to phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, PI, phosphatidic acid, palmityl oleoyl phosphatidylcholine, lyso-phosphatidylcholine, LPE, DPPC, dioleoyl phospholipid phatidylcholine, DSPC or dilinoleoylphosphatidylcholine.Other compound that lacks phosphorus, such as sphingophospholipid, sphingoglycolipid family, DG and β-acyloxy acid also in being called as the group of amphipathic lipids.In addition, above-mentioned amphipathic lipids can be mixed with other lipid, and said lipid comprises triglyceride level and sterol.

Term " neutral lipid " refers to any in many lipid species that selected pH exists with not electrically charged or neutral zwitterionic form.Under physiological pH, such lipid comprises, for example, and diacyl phosphatidyl choline, diacyl phosphatidylethanolamine, ceramide, sphingomyelin, kephalin, SUV, cerebroside and DG.

Term " non-cationic lipid " refers to aforesaid any neutral lipid and negatively charged ion lipid.

Term " negatively charged ion lipid " refers to any lipid electronegative under physiological pH.These lipids comprise; But be not limited to; POPG, Val, diacyl phosphatidylserine, diacyl phosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl-phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine; Lysyl POPG, palmityl oleoyl POPG (POPG) are with other anion modified group that is connected with neutral lipid.

Term " cation lipid " refers at selected pH, any such as in many lipid species of carrying clean positive charge under the physiological pH.These lipids include, but not limited to 1,2-two inferior oil base oxygen base-N; N-dimethylaminopropanecompounds (" DLinDMA "), 1,2-two flax base oxygen base-N; N-dimethylaminopropanecompounds (" DLenDMA "), two octadecyl dimethylammoniums (" DODMA "), distearyl dimethylammonium (" DSDMA "); N, N-two oil bases-N, N-chlorination dimethylammonium (" DODAC "); N-(2,3-two oil base oxygen bases) propyl group)-and N, N, N-chlorination TMA(TriMethylAmine) (" DOTMA "); N, N-distearyl-N, N-dimethyl ammonium bromide (" DDAB "); N-(2,3-two oily acyloxy) propyl group)-and N, N, N-chlorination TMA(TriMethylAmine) (" DOTAP "); 3-(N-(N ', N '-dimethylamino ethane)-formamyl) SUV (" DC-Chol ") and N-(1,2 myristyl oxygen base, third-3-yl)-N, N-dimethyl--N-hydroxyethyl brometo de amonio (" DMRIE ").For example, the cation lipid that on low physiological pH, has a positive electric charge includes, but are not limited to: DODAP, DODMA, and DMDMA.In some cases, cation lipid comprise can be protonated tertiary amine head group, C18 alkyl chain, the two keys of ehter bond between head group and alkyl chain and 0-3.These lipids comprise, DSDMA for example, DLinDMA, DLenDMA, and DODMA.Said cation lipid can comprise ehter bond and the titratable head group of pH.These lipids comprise, for example DODMA.

Term " hydrophobic lipid " refers to have the compound of non-polar group, and it includes, but not limited to, and long-chain is saturated randomly to be replaced by one or more aromatic series, alicyclic or heterocyclic group group with unsaturated aliphatic hydrocarbyl group and these groups.Suitable instance includes, but not limited to DG, dialkyl group glycerine, N-N-dialkyl amido, 1,2-two acyloxy-3-aminopropane and 1,2-dialkyl group-3-aminopropane.

Term " confluent " refers to liposome, the ability that SNALP or other medicines delivery system and cytolemma merge.Said film can be plasma membrane or center on organoid, the for example film of endosome, nuclear etc.

Term " nucleic acid " or " polynucleotide " refer to comprise the polymkeric substance that exists with list or double chain form of at least two deoxyribonucleotides or ribonucleotide.Nucleic acid comprises the main chain residue that comprises known nucleotide analogue or modification or the nucleic acid of key; It is a synthetic, and is naturally occurring, or the non-natural existence; It has the binding characteristic similar with reference nucleic acid, and it carries out metabolism with the mode similar with reference nucleotide.The instance of these analogues includes, but not limited to thiophosphatephosphorothioate (phosphorothioates), phosphoramidate, methyl orthophosphoric acid, chirality-methyl orthophosphoric acid, 2-O-methyl ribonucleotides, peptide-nucleic acid (PNAs).Only if concrete restriction, the nucleic acid of the known analogue that comprises natural nucleotide contained in this term, and it has and carries out metabolism with reference to the similar binding characteristic of nucleic acid and with the mode similar with naturally occurring Nucleotide.Only if point out in addition, concrete nucleotide sequence is contained the variant (for example, the degenerate codon replacement) that its conservative property is modified also in secretly, allelotrope, and directly to homologue, SNPs and complementary sequence and the sequence of obviously pointing out.Particularly; Can obtain the degenerate codon replacement through producing sequence; The 3rd position of the codon of one or more selected (or owning) replaces (Batzer etal., NucleicAcidRes.19:5081 (1991) by mixed base and/or Hypoxanthine deoxyriboside residue in said sequence; Ohtsuka et al., J.Biol.Chem.260:2605-2608 (1985); With Cassol et al. (1992); Rossolini et al., Mol.Cell.Probes8:91-98 (1994))." Nucleotide " comprises sugared ribodesose (DNA) or ribose (RNA), base, and phosphate group.Nucleotide links together through phosphate group.Nucleotide comprises the Nucleotide of chemically modified, as for example described in the WO03/74654." base " comprises purine and pyrimidine, and it also comprises natural compounds VITAMIN B4, thymus pyrimidine, guanine, cytosine(Cyt), uridylic, inosine, and natural analog; And the synthesis of derivatives of purine and pyrimidine; It includes, but are not limited to replace the modification of new reactive group, said reactive group such as; But be not limited to amine, alcohol, mercaptan, carboxylate salt (ester) and haloalkane.DNA can be with the part of antisense, DNA, DNA, precompressed DNA, the product of polymerase chain reaction (PCR), carrier (P1; PAC; BAC, YAC, artificial chromosome), the form of the verivate of expression cassette, chimeric sequences, chromosomal DNA or these groups exists.The mutual use of term nucleic acid and gene, plasmid, cDNA, mRNA and disturbance RNA molecule (for example, synthetic siRNA or expression are from the siRNA of plasmid).

The III cation lipid

The present invention provides new cation lipid, compares with cation lipid (such as DODAC and DODMA) commonly used, and it has the flexibility of increase.More specifically, the present invention provides the new cation lipid of the formula I with structure:

In above-mentioned formula I, R ¹And R ²Select independently and be H or C ₁-C ₃Alkyl.R ³And R ⁴Select independently and be the alkyl group with about 20 carbon atoms of about 10-, wherein R ³And R ⁴At least one of them comprises at least two unsaturated sites.In one embodiment, R ³And R ⁴All be identical, i.e. R ³And R ⁴It all is inferior oil base (C18) etc.In another embodiment, R ³And R ⁴Be different, i.e. R ³Be 14 carbon trialkenyl (C14), and R ⁴Be inferior oil base (C18).In preferred embodiments, cation lipid of the present invention is symmetric, i.e. R ³And R ⁴All be identical.In another preferred embodiment, R ³And R ⁴All comprise at least two unsaturated sites.In some embodiments, R ³And R ⁴Be independently selected from 12 carbon dialkylenes, 14 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base and 20 carbon dialkylenes.In preferred embodiments, R ³And R ⁴It all is inferior oil base.In some embodiments, R ³And R ⁴Comprise at least three unsaturated sites and be independently selected from, 12 carbon trialkenyl for example, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

The present invention also provides the new cation lipid of the formula II with structure:

In above-mentioned formula II, R ¹And R ²Select independently and be H or C ₁-C ₃Alkyl.R ³And R ⁴Select independently and be alkyl group with about 20 carbon atoms of about 10-; R ³And R ⁴At least one comprises at least two unsaturated sites.In one embodiment, R ³And R ⁴All be identical, i.e. R ³And R ⁴It all is inferior oil base (C18) etc.In another embodiment, R ³And R ⁴Be different, i.e. R ³Be 14 carbon trialkenyl (C14), and R ⁴Be inferior oil base (C18).In preferred embodiments, cation lipid of the present invention is symmetric, i.e. R ³And R ⁴All be identical.In another preferred embodiment, R ³And R ⁴All comprise at least two unsaturated sites.In some embodiments, R ³And R ⁴Be independently selected from 12 carbon dialkylenes, 14 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base and 20 carbon dialkylenes.In preferred embodiments, R ³And R ⁴It all is inferior oil base.In some embodiments, R ³And R ⁴Comprise at least three unsaturated sites and be independently selected from, 12 carbon trialkenyl for example, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

IV comprises the carrier system based on lipid of cation lipid

In one embodiment, the present invention provides stable nucleic acid-lipid granule (SPLPs or SNALPs) and other the carrier system based on lipid (for example, liposome; Micella, virosome, lipid-nucleic acid particle; Nucleic acid complexes and composition thereof), it comprises cation lipid of the present invention, i.e. formula I; Formula II, or the cation lipid of its combination.Lipid-nucleic acid particle of the present invention typically comprises nucleic acid, the cation lipid of formula I or formula II, non-cationic lipid and PEG-lipid conjugates.The cation lipid of formula I or formula II typically comprise be present in the said particle from about 2% to about 60%, from about 5% to about 50%, from about 10% to about 45%, from about 20% to about 40%, or about 30% TL.Said non-cationic lipid typically comprises and is present in the TL of about 5% in the said particle to about 90%, from about 10% to about 85%, from about 20% to about 80%, from about 30% to about 70%, from about 40% to about 60% or about 48%.Said PEG-lipid conjugates typically comprise be present in the said particle from about 1% to about 20%, from about 1.5% to about 18%, from about 4% to about 15%, from about 5% to about 12%, or about 2% TL.Nucleic acid-lipid granule of the present invention can also comprise SUV.If exist, SUV typically comprises and is present in about 10% in the said particle to about 60%, about 12% to about 58%, from about 20% to about 55%, or about 48% TL.To become easily to those skilled in the art, it is obvious that, for example, uses at ERP as herein described and measure, and the components in proportions of nucleic acid-lipid granule can change.For example, for systemic delivery, cation lipid can comprise and be present in the TL of about 5% in the said particle to about 15%, and for part or regional delivery, and said cation lipid comprises and is present in the TL of about 40% in the said particle to about 50%.

Nucleic acid-lipid granule of the present invention typically has about 50nm to about 150nm, and more typically about 100nm arrives about 130nm, and the most about 110nm is to the mean diameter of about 115nm and be nontoxic basically.In addition, in the time of in being present in nucleic acid-lipid granule of the present invention, nucleic acid has resistance for the degraded of aqueous solution amplifying nucleic acid enzyme.The method of nucleic acid-lipid granule and preparation thereof is disclosed in U.S. Patent number 5,753,613; 5,785,992; 5,705,385; 5,976,567; 5,981,501; 6,110,745; 6,320,017 and WO96/40964.

A. cation lipid

Can the cation lipid of formula I and II is independent, or combination comes with in the present invention with one or more other cation lipid kind or non-cationic lipid species.

The cation lipid of formula I as herein described and formula II is typically at selected pH, such as carrying clean positive charge on the physiological pH.Be surprisingly found out that, comprise and have a plurality of unsaturated sites that for example to have in the lipid-nucleic acid particle of membrane fluidity of increase in formation be useful especially to the cation lipid of the alkyl chain at least two or three unsaturated sites.Will also be that useful many cation lipids and related analogs is described in the USSN08/316 of pending trial simultaneously, 399 in the present invention; U.S. Patent number 5,208,036,5,264,618,5,279,833 and 5,283,185 and WO96/10390 in.

The cation lipid that is fit in addition comprises, for example two octadecyl dimethylammoniums (" DODMA "), distearyl dimethylammonium (" DSDMA "), N, N-two oil bases-N, N-dimethylammonium (" DODAC "); N-(2,3-two oil base oxygen bases) propyl group)-and N, N, N-chlorination TMA(TriMethylAmine) (" DOTMA "); N, N-distearyl-N, N-dimethyl ammonium bromide (" DDAB "); N-(2,3-two oily acyloxy) propyl group)-and N, N, N-chlorination TMA(TriMethylAmine) (" DOTAP "); 3-(N-(N ', N '-dimethylamino ethane)-formamyl) SUV (" DC-Chol ") and N-(1,2 myristyl oxygen base, third-3-yl)-N, N-dimethyl--N-hydroxyethyl brometo de amonio (" DMRIE ").Many these lipids and related analogs with also useful in the present invention are described in U.S. Patent number 5,208, in 036,5,264,618,5,279,833,5,283,185,5,753,613 and 5,785,992.

B. non-cationic lipid

The multiple neutrality that is used for non-cationic lipid of the present invention and can is producing stable complex is uncharged, any in zwitter-ion or the negatively charged ion lipid.They are neutral preferably, although they can alternatively be positively charged or electronegative.The instance of non-cationic lipid used in this invention comprises: phosphatide-relevant material, and such as Yelkin TTS, phosphatidylethanolamine, SUNLECITHIN A; LPE, phosphatidylserine, PI, sphingophospholipid; Kephalin, Val, phosphatidic acid, cerebroside; Two hexadecyl SULPHOSUCCINIC ACID ESTERs, DSPC (DSPC), dioleoyl phospholipid phatidylcholine (DOPC), DPPC (DPPC); DOPG (DOPG), two palmityl POPGs (DPPG), two oleoyls-phosphatidylethanolamine (DOPE); Palmityl oleoyl phosphatidylcholine (POPC), palmityl oleoyl-phosphatidylethanolamine (POPE) and two oleoyls-phosphatidylethanolamine 4-(N-maleimide ylmethyl)-cyclohexane-1-carboxylicesters (DOPE-mal), two palmityl phosphatidylethanolamines (DPPE); DPPA thanomin (DMPE), DSPE (DSPE), 16-O-monomethyl PE; 16-O-dimethyl-PE, the trans PE of 18-1-, 1-stearyl-2-oleoyl-phosphatidylethanolamine (SOPE).Non-cationic lipid or sterol such as SUV can exist.Not phosphorus-containing lipids in addition is, for example, and stearylamine, n-Laurylamine, cetylamine; The ethanoyl cetylate, glycerine ricinoleate, Triple Pressed Stearic Acid cetyl ester, isopropyl myristate, both sexes acrylic ester polymer; Trolamine-lauryl sulfate, alkyl-aromatic yl acid ester gather the ethoxyquin fatty acid amide, two (octadecyl) dimethyl-brometo de amonio etc., diacyl phosphatidyl choline, diacyl phosphatidylethanolamine; Ceramide, sphingophospholipid, kephalin, and cerebroside.Other lipid such as lyso-phosphatidylcholine and LPE can exist.The non-cationic lipid also comprises polymkeric substance based on polyoxyethylene glycol such as PEG2000, PEG5000 and with phosphatide or the polyoxyethylene glycol puted together with ceramide (being known as PEG-Cer), like the USSN08/316 of pending trial at the same time, described in 429.

In preferred embodiments; The non-cationic lipid is diacyl phosphatidyl choline (for example, DSPC, a dioleoyl phospholipid phatidylcholine; DPPC and dilinoleoylphosphatidylcholine); Diacyl phosphatidylethanolamine (for example, DOPE and palmityl oleoyl phosphatidylethanolamine), ceramide or sphingophospholipid.Carboxyl groups in these lipids is preferably from having C ₁₀-C ₂₄The carboxyl groups of the lipid acid of carbochain.More preferably be that carboxyl groups is a lauryl, mnyristoyl, palmityl, stearyl or oleoyl.In particularly preferred embodiments, the non-cationic lipid will be a SUV, 1, and 2-sn-DOPE, or ootheca phosphatide (ESM).

C. double-deck stabilising component consisting

Except positively charged ion and non-cationic lipid, SPLPs of the present invention comprises double-deck stabilising component consisting (BSC) such as ATTA-lipid or PEG-lipid, such as the PEG that is coupled to the dialkoxy propyl group (PEG-DAA); As for example described in the WO05/026372, be coupled to the PEG (PEG-DAG) of DG, as for example described in the U.S. Patent Publication 20030077829 and 2005008689; Be coupled to the PEG (PEG-PE) of phosphatidylethanolamine (PE); Or put together the PEG in ceramide, or its mixture (is seen U.S. Patent number 5; 885,613).In a preferred embodiment, said BSC suppresses the lipid that the accumulative of SPLPs is puted together.The lipid of puting together that is fit to includes, but not limited to the PEG-lipid conjugates, ATTA-lipid conjugates, positively charged ion-polymer-lipid conjugate (CPLs) or its mixture.In a preferred embodiment, said SPLPs comprises PEG-lipid conjugates or the ATTA-lipid conjugates with CPL.

PEG is a polyoxyethylene glycol, a kind of linearity with two terminal hydroxyl groups, the water-soluble polymers of ethene PEG repeating unit.According to their molecular weight, PEGs is classified; For example, PEG2000 has about 2,000 daltonian molecular-weight average, and PEG5000 has about 5,000 daltonian molecular-weight average.PEGs be can be purchased from Sigma Chemical Co. and other company and comprise for example following: mono methoxy polyethylene glycol (MePEG-OH); Mono methoxy polyethylene glycol-succinate (MePEG-S); Mono methoxy polyethylene glycol-succinimido succinate (MePEG-S-NHS), mono methoxy polyethylene glycol-amine (MePEG-NH ₂), mono methoxy polyethylene glycol-tresylate (MePEG-TRES), and mono methoxy polyethylene glycol-imidazolyl-carbonyl (MePEG-IM).In addition, mono methoxy polyethylene glycol-acetate (MePEG-CH ₂COOH), at preparation PEG-lipid conjugates, comprise in the PEG-DAA conjugate particularly useful.

In preferred embodiments, said PEG has from about 550 dalton to about 10,000 dalton, and more preferably about 750 dalton are to about 5; 000 daltonian molecular-weight average more preferably, has about 1,000 dalton to about 5; 000 daltonian molecular-weight average more preferably has about 1,500 dalton to about 3,000 daltonian molecular-weight average; And, even more preferably have about 2,000 dalton or about 750 daltonian molecular-weight average.Said PEG can be randomly by alkyl, alkoxyl group, and acyl group or aryl replace.PEG can directly put together in said lipid maybe can be connected in said lipid through shank.Can use any shank that is suitable for PEG is coupled to lipid, comprise, for example comprise the shank and the shank that comprises ester of non-ester.In preferred embodiments, said shank is the shank that comprises non-ester.When being used for this paper, term " shank that comprises non-ester " refers to not comprise the shank of carboxylic acid ester bond (OC (O)-).The shank that comprises non-ester that is fit to includes, but not limited to amido (C (O) NH-), amino (NR-), carbonyl (C (O)-), carbamate (NHC (O) O-), urea (NHC (O) NH-), disulphide (S-S-), ether (O-), succinyl-((O) CCH ₂CH ₂C (O)-), succinic diamide (NHC (O) CH ₂CH ₂C (O) NH-), ether, disulphide etc., and combination (such as the joint that comprises carbamate shank and amido shank).In preferred embodiments, the carbamate joint is used for PEG is coupled to lipid.

In other embodiments, the shank that comprises ester is used for PEG is coupled to lipid.The shank that comprises ester that is fit to comprises, for example, and carbonic ether (OC (O) O-), amber one acyl group, SULPHOSUCCINIC ACID ESTER (O-(O) POH-O-), sulphonate, and combination.

Form double-deck stabilising component consisting thereby can phosphatidylethanolamine and polyoxyethylene glycol be puted together, said phosphatidylethanolamine has the various acyl chain groups of different chain length degree and degree of saturation.These phosphatidylethanolamines are commercially available, maybe can use the known routine techniques of those skilled in the art to separate or synthetic.Comprise and have at C ₁₀-C ₂₀The phosphatidylethanolamine of the saturated or unsaturated lipid acid of the carbon chain lengths in the scope is preferred.Can also use such phosphatidylethanolamine, it has single or two unsaturated fatty acids and saturated and mixture unsaturated fatty acids.Suitable phosphatidylethanolamine includes, but not limited to as follows: two mnyristoyl phosphatidylethanolamines (DMPE), two palmityl phosphatidylethanolamines (DPPE), DOPE (DOPE) and DSPE (DSPE).

Term " ATTA " or " polymeric amide " refer to, but be not limited to, at U.S. Patent number 6,320, and disclosed compound in 017 and 6,586,559.These compounds comprise the compound with following formula:

Wherein: R is the member who is selected from the group of being made up of hydrogen, alkyl and acyl group; R ¹Be the member who is selected from the group of forming by hydrogen and alkyl; Or randomly, R and R ¹Form the azido-part with their institute's bonded nitrogen-atoms; R ²Be to be selected from hydrogen, randomly substituted alkyl, the member of the group of substituted aryl and amino acid side chain randomly; R ³Be the member who is selected from the group of forming by hydrogen, halogen, hydroxyl, alkoxyl group, sulfydryl, diazanyl, amino and NR4R5, wherein R ⁴And R ⁵Be hydrogen or alkyl independently; N is 4-80; M is 2-6; P is 1-4; And q is 0 or 1.Those skilled in the art will be clear that other polymeric amide can be used in the compound of the present invention.

Term " DG " refers to have the compound of 2-fatty acyl chain, its R ¹And R ²All have independently through the 1-of ester bond and glycerine and 2-30 carbon atom of 2-position bonding.Said carboxyl groups can be saturated or have in various degree unsaturated.DG has following general formula:

Term " dialkoxy propyl group " refers to have the compound of 2-alkyl chain, its R ¹And R ²All has 2-30 carbon independently.Alkyl group can be saturated or have in various degree unsaturated.The dialkoxy propyl group has following general formula:

In a preferred embodiment, the PEG-lipid is the PEG-DAA conjugate with following formula:

In formula VI, R ¹And R ²Selected independently and be long chain alkyl group with about 22 carbon atoms of about 10-.Said long chain alkyl group can be saturated or undersaturated.The alkyl group that is fit to includes, but not limited to lauryl (C12), myristyl (C14), palmityl (C16), stearyl (C18) and petrosilane base (C20).In preferred embodiments, R ¹And R ²Be identical, i.e. R ¹And R ²All be myristyl (being myristyl), R ¹And R ²It all is stearyl (that is distearyl) etc.

In above-mentioned formula VI, " R ¹And R ²" selected independently and be the alkyl group with about 20 carbon atoms of about 10-; PEG is a polyoxyethylene glycol; And L is the shank that comprises non-ester as stated.The alkyl group that is fit to includes, but not limited to lauryl (C12), myristyl (C14), palmityl (C16), stearyl (C18) and petrosilane base (C20).In preferred embodiments; R ¹And R ²Be identical, promptly they all are myristyls (C14) or all are palm alkyl (C16) or all are stearyl (C18) etc.In preferred embodiments, said alkyl group is saturated.

In above-mentioned formula VI, " PEG " is polyoxyethylene glycol, and it has about 550 dalton to the interior molecular-weight average of about 10,000 dalton's scopes; More preferably from about 750 dalton are to the interior molecular-weight average of about 5,000 dalton's scopes, and more preferably from about 1,000 dalton is to about 5; Molecular-weight average in 000 dalton's scope, more preferably from about 1,500 dalton is to the interior molecular-weight average of about 3,000 dalton's scopes; And even 2,000 dalton more preferably from about, or about 750 daltonian molecular-weight average.Said PEG can be randomly by alkyl, alkoxyl group, and acyl group or aryl replace.In a preferred embodiment, terminal hydroxyl group is replaced by methoxyl group or methyl group.

In above-mentioned formula VI, " L " is the shank that comprises the shank of non-ester or comprise ester.In a preferred embodiment, L is the shank that comprises non-ester.The joint that comprises non-ester that is fit to includes, but not limited to the amido shank, amino shank; The carbonyl shank, carbamate shank, urea shank; The ether shank, disulphide shank, succinoamino shank and combination thereof.In a preferred embodiment, the shank that comprises non-ester is carbamate shank (that is a PEG-C-DAA conjugate).In another preferred embodiment, the shank that comprises non-ester is amido shank (that is a PEG-A-DAA conjugate).In a preferred embodiment, the shank that comprises non-ester is succinoamino shank (that is a PEG-S-DAA conjugate).

Use known standard technique of those skilled in the art and reagent to synthesize the PEG-DAA conjugate.To recognize that said PEG-DAA conjugate will comprise various acid amides, amine, ether, sulfo-(thio), carbamate and urea key.Those skilled in the art will recognize that the method and the reagent that are used to form these keys are well-known and are to obtain easily.See March for example, ADVANCEDORGANIC CHEMISTRY (Wiley1992), Larock, COMPREHENSIVEORGANIC TRANSFORMATIONS (VCH1989); And Fumiss, VOGEL ' STEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY5th ed. (Longman1989).Also will understand the protection that any functional group of existence maybe be on different loci in synthetic said PEG-DAA conjugate and go protection.Those skilled in the art will recognize that these technology are well-known.See for example Green and Wuts, PROTECTIVE GROUPS INORGANIC SYNTHESIS (Wiley1991).

In present embodiment preferred; Said PEG-DAA conjugate is dilauryl oxygen base propyl group (C12)-PEG conjugate; Myristyl oxygen base propyl group (C14)-PEG conjugate, two palm acyloxy propyl group (C16)-PEG conjugates or two steryl oxygen base propyl group (C18)-PEG conjugates.Those skilled in the art will understand easily that other dialkoxy propyl group can be used in the PEG-DAA conjugate of the present invention.

Except above-mentioned, those skilled in the art will be clear that easily, can replace PEG with other hydrophilic polymer.The instance that can be used for replacing the polymkeric substance that is fit to of PEG includes, but not limited to Vinylpyrrolidone polymer; Ju Jia oxazolin, the Ju ethyl oxazoline gathers the hydroxypropyl USAF RH-1; PMAm and polydimethylacrylamiin, POLYACTIC ACID, PGTA; With the derivatize Mierocrystalline cellulose, such as Walocel MT 20.000PV or Natvosol.

Except aforementioned composition; SNALPs of the present invention and SPLPs can also comprise that positively charged ion gathers (terepthaloyl moietie) (PEG) lipid, or CPLs, and it has been designed to insert gives positive charge and (see in the lipid bilayer; Chen et al., Bioconj.Chem.11:433-437 (2000)).Suitable SPLPs used in this invention and SPLP-CPLs, and preparation and use SPLPs and the method for SPLP-CPLs for example is disclosed in the U.S. Patent number 6,852,334 and WO00/62813.Cationic polymers lipid used in this invention (CPLs) has following structure feature: (1) is attached to the lipid anchor in the lipid bilayer with CPLs, such as hydrophobic lipid; (2) the lipid anchor is connected in the hydrophilic spacerarm of positively charged ion head group, such as polyoxyethylene glycol; The polycation part of the positively charged ion head group that (3) generation can be protonated is such as naturally occurring amino acid.

The CPL that is fit to comprises the compound of formula VII:

A—W—Y(VII)

A wherein, W and Y are described below.

With reference to formula VII, " A " be lipid part such as amphipathic lipids, neutral lipid or serve as the hydrophobicity lipid of lipid anchor.The lipid instance that is fit to comprises vesicle-formation lipid or adopts the lipid of vesicle and include, but are not limited to DG base, dialkyl group glyceryl, N-N-dialkyl amido, 1,2-two acyloxy-3-aminopropane and 1,2-dialkyl group-3-aminopropane.

" W " is polymkeric substance or oligopolymer, such as hydrophilic polymer or oligopolymer.Preferably, hydrophilic polymer is biocompatible polymkeric substance, and its right and wrong are immunogenic or have low innate immune originality.Perhaps, if use with suitable adjuvant, said hydrophilic polymer can be a poor antigen property.Suitable non-immunogenic polymkeric substance includes, but not limited to PEG, polymeric amide, POLYACTIC ACID, PGTA, POLYACTIC ACID/PGTA multipolymer and combination thereof.In a preferred embodiment, said polymkeric substance has about 250 to about 7000 daltonian molecular weight.

" Y " is the polycation part.Said term polycation partly refers at selected pH, and is preferably positively charged on the physiological pH, preferably bring to compound, verivate or the functional group of few 2 positive charges.Suitable polycation partly comprises basic aminoacids and their verivate such as l-arginine, l-asparagine, Stimulina, Methionin and Histidine; Spermine; Spermidine; The positively charged ion dendrimer; Polyamine; Polyamine sugar; And glycosaminoglycan.Said polycation part structurally can be linear in linear four Methionins (tetralysine), side chain or dendrimer.Polycation part is in selected pH value, has between about 2 positive charges between-about 15, preferably has the positive charge between about 2 to about 12, and more preferably has the positive charge between about 2 to about 8.The polycation type of selecting to use partly can be confirmed through the type that the ideal liposome is used.

Electric charge on polycation part can be distributed in around the whole liposome part or, they can be in the discontinuous set of electric density in a concrete zone of liposome part, for example electric charge spike (spike).If charge density distribution is on liposome, electric density can equally distribute or distribute unequally.The all changes of the charge distribution of polycation part comprise in the present invention.

The polymkeric substance " W " of lipid " A " and non-immunogenic can be through the whole bag of tricks and preferably is connected through covalently bound.The known method of those skilled in the art can be used for the covalently bound of " A " and " W ".Suitable key compound (linkage) includes, but not limited to acid amides, amine, carboxyl, carbonic ether, carbamate, ester and hydrazone key compound.Those skilled in the art will be clear that " A " and " W " thereby must have complementary functional group accomplishes said bonding.The reaction of such two groups will provide the ideal bonding, and one of said group is on the lipid and another is on polymkeric substance.For example, thus when said lipid be that DG and said terminal hydroxyl are activated with DCC with for example NHS and form active ester, follow with the polymkeric substance that comprises amino group and (see such as with polyamide reaction the time; U.S. Patent number 6; 320,017 and 6,586; 559), amido linkage will form between two groups.

In some cases, polycation part can have part such as the target part of connection or the huge legendary turtle of complexing calcium is closed part.Preferably, after said part connected, said cationic moiety was kept positive charge.In some cases, the part of connection has positive charge.Suitable part includes, but not limited to have the compound or the device of reactive functionality and comprise lipid, amphipathic lipids, carrier compound, bioaffinity compound; Biomaterial, XC polymer, biomedical devices, at detectable compound analytically, activated compound in the treatment, enzyme; Peptide, protein, antibody, immunologic stimulant, radio-labeling, fluorescence; Vitamin H, medicine, haptin, DNA, RNA, polysaccharide; Liposome, virosome, micella, Tegeline, functional group, other targeting moiety or toxin.

The D title product

Except said components, SPLPs of the present invention and SNALPs comprise nucleic acid (for example, strand or double-stranded DNA, strand or double-stranded RNA, RNAi, siRNA etc.).The nucleic acid that is fit to includes, but not limited to plasmid, antisense oligonucleotide, and the gathering of ribozyme and other-and widow-Nucleotide.In preferred embodiments, said nucleic acid encoding product, for example goal treatment property product.Can with SPLP ' s of the present invention and SNLPs be used for nucleic acid delivery to cell (for example mammiferous cell) thereby, express nucleic acid or make by the target sequence of cell expressing reticent for example.

Title product can be used for commercial purpose, comprises the therapeutic purpose that is used for as medicine or diagnosis.The instance of therapeutic product comprises, protein, nucleic acid, antisense nucleic acid, ribozyme, tRNA, snRNA, siRNA, antigen, the VIII factor, and apoptotic proteins (Zhuang etal. (1995) Cancer Res.55 (3): 486-489).The gene product that is fit to kind includes, but not limited to cytotoxicity/suicide gene, immunomodulator, cell receptor part, the gene of tumor inhibitor and angiogenesis inhibitor.The specific gene of selecting will depend on purpose or the treatment that is intended to.The instance of these target genes below with run through whole specification sheets and describe.

In some embodiments, said nucleic acid is the siRNA molecule that makes target gene reticent.These nucleic acid can be used separately, or make up to use using of medicament always, and said medicament commonly used is used to treat disease relevant with target gene or illness.In other embodiment, said nucleic acid encoding is expressed in the experimenter who suffers from specified disease or illness (for example pathogenic infection or tumor disease) or the polypeptide of overexpression and can being advantageously used in produces to the immunne response by the polypeptide of said genetic expression.These nucleic acid can be used separately or make up to use using of medicament always, and said medicament commonly used is used to treat said disease or illness.In other embodiment; Said nucleic acid encoding is expressed not enough in the experimenter who suffers from specified disease or illness (for example metabolic disease or illness) or polypeptide expressed not; And it can be advantageously used in express polypeptide and can use separately or make up to use using of medicament always, and said medicament commonly used is used to treat said disease or illness.

1. target gene

Target gene includes, but not limited to the gene relevant with survival with virus infection; With metabolic trouble and illness (for example; Hepatopathy and illness) gene relevant with cell transformation, angiogenic gene, take place with tumour in relevant gene; Immunomodulator gene such as those relevant with inflammation and autoimmune response, ligand receptor gene and the gene relevant with neurodegenerative disorders.

A) with the virus infection and the relevant gene of surviving

Thereby comprise through the expressing viral combination those that get into and in cell, duplicate with virus infection and the relevant gene of survival.The virus sequence relevant with chronic viral diseases is interested especially.Interested especially virus sequence comprises sequence (Hamasaki, et al., the FEBS Lett.543:51 (2003) of hepatitis virus; Yokota, et al, EMBO Rep.4:602 (2003); Schlomai, et al., Hepatology37:764 (2003); Wilson, et al., Proc.Natl.Acad.Sci.100:2783 (2003); Kapadia, et al., Proc.Natl.Acad.Sci.100:2014 (2003); And FIELDSVIROLOGY (Knipe et al.eds.2001)), human immunodeficiency virus (HIV) (Banerjea, etal., Mol Ther.8:62 (2003); Song, et al., J.Virol.77:7174 (2003); StephensonJAMA289:1494 (2003); Qin, et al., Proc.Natl.Acad.Sci.100:183 (2003)), simplexvirus (Jia, et al., J.Virol.77:3301 (2003)), and human papillomavirus (HPV) (Hall, et al., J.Virol.77:6066 (2003); Jiang, et al., Oncogene21:6041 (2002)).Can be included, but are not limited to by the exemplary hepatitis virus nucleotide sequence of silence: relate to the nucleotide sequence transcribing and translate (for example, En1, En2, X, P), the coding structure nucleic acid sequences to proteins (for example, comprises the proteinic core protein that C is relevant with C; Comprise S, M, and/or proteinic capsid of L and envelope protein matter, or its fragment) (see, for example, FIELDS VIROLOGY, 2001, the same).Can be included but not limited to by the exemplary hepatitis C nucleotide sequence of silence: (for example, NS3/NS4), (for example, NS3), polysaccharase (for example, NS5B) and envelope protein (for example, E1, E2, and p7) for helicase for Tryase.The hepatitis A nucleotide sequence is for example being mentioned among the Genbank registration number NC_001489; The hepatitis B nucleic acid sequence is for example being mentioned among the Genbank registration number NC_003977; The hepatitis C nucleotide sequence is for example being mentioned among the Genbank registration number NC_004102; The hepatitis D nucleotide sequence is for example being mentioned among the Genbank registration number NC_001653; The hepatitis E nucleotide sequence is for example being mentioned among the Genbank registration number NC_001434; And G type hepatitis nucleotide sequence is for example being mentioned among the Genbank registration number NC_001710.

B) gene relevant with metabolic trouble and illness

Comprise with metabolic trouble and the relevant gene of illness (for example, wherein liver is by the illness of target and hepatopathy and illness), for example; At for example hyperlipemia (for example, liver X receptor (for example, LXR α and LXR β Genback registration number NM_007121)); Farnesoid X receptor (FXR) (Genbank registration number NM_005123), sterol regulatory element conjugated protein (SREBP), site-1 proteolytic enzyme (SlP); 3-hydroxy-3-methyl glutaryl Kiev enzyme-A reductase enzyme (HMG coenzyme-A reductase enzyme), lipophorin (ApoB), and lipophorin (ApoE)) and mellitus are (for example; The gene of expressing Robison ester) (is seen; For example, Forman et al., Cell81:687 (1995); Seol et al., Mol.Endocrinol.9:72 (1995), Zavacki et al., PNAS USA94:7909 (1997); Sakai, et al., Cell85:1037-1046 (1996); Duncan, et al., J.Biol.Chem.272:12778-12785 (1997); Willy, et al., Genes Dev.9 (9): 1033-45 (1995); Lehmann, et al., J.Biol.Chem.272 (6): 3137-3140 (1997); Janowski, et al., Nature383:728-731 (1996); Peet, etal., Cell93:693-704 (1998)).It will be appreciated by those skilled in the art that the gene that is included in the gene of expressing in the liver itself and in other organ and tissue, expresses with the relevant gene of metabolic trouble and illness (for example wherein liver by the disease of target and illness and hepatopathy and illness).

C) with tumour relevant gene takes place

The instance that the gene order relevant with cell transformation takes place with tumour comprises easy bit sequence such as the MLL fusion gene, BCR-ABL (Wilda, etal., Oncogene, 21:5716 (2002); Scherr, etal, Blood101:1566), TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, BCL-2, AML1-ETO and AML1-MTG8 (Heidenreich, et al., Blood

101:3157 (2003)); The sequence of over-expresses such as multi-drug resistance gene (Nieth, et al., FEBSLett.545:144 (2003); Wu, et al, Cancer Res.63:1515 (2003)), cyclin (Li, et al., Cancer Res.63:3593 (2003); Zou, et al., Genes Dev.16:2923 (2002)), beta-catenin (Verma; Et al., Clin Cancer Res.9:1291 (2003)), Telomere terminal transferase gene (Kosciolek, etal.; Mol Cancer Ther.2:209 (2003)), c-MYC, N-MYC; BCL-2, ERBB1 and ERBB2 (Nagy, etal.Exp.Cell Res.285:39 (2003)); With mutant nucleotide sequence such as RAS (summarizing in Tuschl and Borkhardt Mol.Interventions, 2:158 (2002)).For example, make reticent be used in combination with using of chemotherapeutics (Collis, et al., the Cancer Res.63:1550 (2003)) of sequence of coding DNA repair enzyme.The proteinic gene relevant with tumor migration of encoding also is the target sequence, and said protein for example is integrin, select albumen and metalloprotein lytic enzyme.Previous examples is not exclusive.Can be with helping or promote tumour to take place or cell transformation, any complete or portion gene sequence of tumor growth or tumor migration is included as the target gene sequence.

D) angiogenic/anti-angiogenic gene

The angiogenic gene can promote the formation of neovascularity.VEGF (VEGF) (Reich, etal., Mol.Vis.9:210 (2003)) or VEGFr are interested especially.The siRNA sequence of target VEGFr is at for example GB 2396864; U.S. Patent Publication 20040142895; With propose among the CA2456444.

The anti-angiogenic gene can suppress neovascularization.These genes are used in particular for treating those cancers that have effect in the pathology development that its medium vessels occurs in said disease.The instance of anti-angiogenic gene includes, but not limited to endostatin and (sees that for example U.S. Patent number 6; 174,861), ANGIOSTAIN (sees that for example U.S. Patent number 5; 639,725), and VEGF-R2 (sees, for example Decaussin et al. (1999) J.Pathol.188 (4): 369-737).

E) immunomodulator gene

The immunomodulator gene is a gene of regulating one or more immunne responses.The instance of immunomodulator gene comprise cytokine such as growth factor (for example, TGF-α., TGF.-β, EGF, FGF, IGF, NGF, PDGF; CGF, GM-CSF, SCF, etc.), interleukin-(for example, IL-2, IL-3, IL-4; IL-6, IL-7, IL-10, IL-12, IL-15, IL-20, etc etc.), Interferon, rabbit is (for example; IFN-α, IFN-β, IFN-γ, etc.), TNF (for example, TNF-α) and Flt-3 part.Fas and Fas ligand gene also are target immunomodulator target sequence (Song, et al., Nat.Med.9:347 (2003)).The gene of the coding secondary signal molecule in green blood and lymphoidocyte is also included among the present invention, and for example, the Tec family kinase is such as Bruton ' s LCK (Btk) (Heinonen, et al., FEBS Lett.527:274 (2002)).

F) cell receptor part

The cell receptor part comprises such part, and it can combine cell surface receptor (for example, insulin receptor, EPO acceptor; The G-protein linked receptor has the acceptor of tyrosine kinase activity, cytokine receptor; Growth factor receptors etc.) thus (for example regulate physiological pathway that (for example, suppress, activate etc.) relate to acceptor; Glucose level is regulated, blood cell development, mitotic division generation etc.).The instance of cell receptor part comprises cytokine, growth factor, interleukin-, Interferon, rabbit, Hempoietine (EPO), Regular Insulin, hyperglycemic-glycogenolytic factor, G-protein-coupled receptor ligand etc.).The coding trinucleotide (for example repeats; The template of the extension CAG repetition) makes in the cause of disease sequence silence in nerve distortion disease and finds purposes; Said disease is extended institute by the trinucleotide multiple and is caused; Such as amyotrophy of spinal cord oblongata and Huntington Chorea (Caplen, et al., Hum.Mol.Genet.11:175 (2002)).

G) tumor suppressor gene

Tumor suppressor gene is the gene that can suppress the growth of cell, particularly tumour cell.Therefore, in tumour cell, be useful with these gene deliveries in treatment for cancer.Tumor suppressor gene includes, but not limited to p53 (Lamb et al., Mol.Cell.Biol.6:1379-1385 (1986); Ewen etal., Science255:85-87 (1992), Ewen et al. (1991) Cell66:1155-1164 and Hu etal.; EMBO is (1990) J.9:1147-1155), RB1 (Toguchida et al. (1993) Genomics17:535-543), WT1 (Hastie, N.D.; Curr.Opin.Genet.Dev.3:408-413 (1993)), NF1 (Trofatter et al., Cell72:791-800 (1993), Cawthon et al.; Cell62:193-201 (1990)), VHL (Latif et al., Science260:1317-1320 (1993)), APC (Gorden et al.; Cell66:589-600 (1991)), and the DAP kinases (see, for example, Diess et al. (1995) GenesDev.9:15-30); P16 (sees that for example, Marx (1994) Science264 (5167): 1846), ARF (sees; For example, Quelle et al. (1995) Cell83 (6): 993-1000), neurofibromin (is seen, for example; Huynh et al. (1992) Neurosci.Lett.143 (1-2): 233-236), and PTEN (see, for example, Li et al. (1997) Science275 (5308): 1943-1947).

H) cytotoxicity/suicide gene

Cytotoxicity/suicide gene is a direct or indirect cell killing in the cell cycle, causes transferring dying, or suppresses those genes of cell.These genes include, but not limited to the immunotoxin gene, the thymidine kinase of hsv (HSV-TK) gene; Cytosine deaminase gene, xanthine-guanine phosphoribosyl transferase gene, p53 gene; The purine nucleoside phosphorylase gene, hydroxy acid esterase gene, deoxycytidine kinase gene; TNT nitroreductase gene, thymidine phosphorylase gene and Cytochrome P450 2B1 gene.

In gene therapy, be known as gene delivery enzyme prodrug therapy (" GDEPT ") the technology or, alternatively; " suicide gene/prodrug " system, reagent such as acycloguanosine and guanine (for thymidine kinase), endoxan (cyclophosphoamide) (for Cytochrome P450 2B1); 5-fluorine cytidine (for Isocytosine deaminase) typically with expression cassette combination (for example, side by side or side by side non-, for example sequentially) thus carrying out systemic administration obtains required cytotoxicity or suppresses cytological effect and (see; For example, Moolten, F.L; Cancer Res., 46:5276-5281 (1986)), the said expression cassette suicide gene of the present invention of encoding is formed.About the summary of GDEPT system, see Moolten, F.L, The InternetBook of Gene Therapy, Cancer Therapeutics, Chapter11 (Sobol, R.E., Scanlon, NJ (Eds) Appelton & Lange (1995)).In the method; Heterologous gene is delivered in the cell in expression cassette; Said expression cassette comprises the RNAP promotor, and said heterologous gene coding promotes that more insensitive first compound of cell (that is, " prodrug ") metabolism is the more enzyme of the second responsive compound of cell.Said prodrug is delivered in the cell with gene or after the gene transmission.Said enzyme is treated to second compound and response in view of the above with prodrug.The system that is fit to that is proposed by Moolten is thymidine kinase (HSV-TK) gene and the prodrug guanine of hsv.Nearest Zerrouqui, et al., Can.Gen.Therapy, 3 (6): 385-392 (1996); Sugaya, et al., Hum.Gen.Ther.; 7:223-230 (1996) and Aoki, et al., Hum.Gen.Ther.; 8:1105-1113 (1997) uses positively charged ion-lipid nucleic acid coacervate to carry out local delivery (promptly; Directly inject in the tumour), or regional delivery (that is intraperitoneal) TK gene has been used this method in mouse tumor.Proposed to use people's clinical trial (seeing Hum.Gene Ther., 8:597-613 (1997) and Hum.Gene Ther., 7:255-267 (1996)) and its of the GDEPT system that uses virus vector to carry out.

Any suicide gene/prodrug combination can be used according to the present invention.Be suitable for several suicide gene/prodrugs of the present invention and be combined in Sikora, among the K.OECD Documents, Gene DeliverySystems, 59-71 page or leaf (1996) is cited, and it includes, but are not limited to following:

The suicide gene product	Still less active prodrug	The medicine that is activated
			Herpes simplex virus type 1 thymidine kinase (HSV-TK)	Guanine (GCV), acycloguanosine, vinyl bromide base-deoxyuridine, or other substrate	The dGTP analogue of phosphorylation
Isocytosine deaminase (CD)	5-flurocytosine	5 FU 5 fluorouracil
			Xanthine-guanine-phosphoribosyltransferase (XGPRT)	6-Thioxanthine (6TX)	6-thioguanosine phosplate
Purine nucleoside phosphorylase	MeP-dr	The 6-methyl purine
			Cytochrome P450 2B1	Endoxan	[cytotoxicity metabolite]
Linamarase	Amygdaloside	Prussiate
			TNT nitroreductase	CB1954	The oil of mirbane carbonamidine
β-Nei Xiananmei	PD	The PD mustard seed
			Beta-Glucuronidase	adria-glu	Zorubicin
Carboxypeptidase	The MTX-L-Ala	MTX
			P-FAD	Glucose	Superoxide
Penicillin amidase	adria-PA	Zorubicin
			Superoxide-dismutase	XRT	The dna damage agent
Ribozyme	RNA	Split product

If by the heterologous gene products metabolism is the more responsive compound of cell, can use any prodrug.Preferably, cell is 10 times for prodrug susceptibility for the susceptibility of metabolite at least.

Can be useful on the modification of GDEPT of the present invention system, comprise, for example; The TK enzyme construction of use modifying, thus wherein the TK gene is caused prodrug to change medicine quickly into by sudden change (for example seeing Black; Et al.; Proc.Natl.Acad.Sci, U.S.A., 93:3525-3529 (1996)).Perhaps, the TK gene can be sent with another gene that increases its effect in two cistron constructions.For example, be known as " bystander effect " (near the cell in wherein by cells transfected also is killed) of " proximity effect " in order to increase also, the TK gene can be connected albumen with the slit, sends together such as the gene that connects protein 43.Connect toxic product that albumen allows the TK enzyme from a cellular invasion to another cell.TK/ connects the protein 43 construction and has the CMV promotor, and said CMV promotor gets into sequence through internal ribosome and operationally is connected with the TK gene with the nucleic acid that coding is connected protein 43.

2.siRNA

In some embodiments, said nucleic acid is siRNA.Said siRNA can be used to make translation (that is, the expressing) downward modulation or the silence of target gene.Can use any way known in the art to identify suitable siRNA sequence.Typically; Be described in Elbashir; Et al., Nature411:494-498 (2001) and Elbashir, et al.; Method among the EMBO J20:6877-6888 (2001) with at Reynolds et al., the design rule of mentioning among Nature Biotech.22 (3): the 326-330 (2004) at random makes up.

Typically, from 3 of the AUG initiator codon of target gene transcription thing ' about 50 sequences in about 100 Nucleotide carry out about dinucletide sequence (for example, AA; CC, GG, or UU) scanning (see; Elbashir for example, et al., EMBO J20:6877-6888 (2001)).Be right after said dinucletide sequence 3 ' Nucleotide be accredited as potential siRNA target sequence.Typically, be right after dinucletide sequence 3 ' 19,21,23,25,27,29,31,33,35 or more Nucleotide be accredited as potential siRNA target site.In some embodiments, said dinucletide sequence is the AA sequence, and will be right after 3 of AA dinucletide ' 19 Nucleotide be accredited as potential siRNA target site.Typically, the siRNA target site along the length of target gene with different sites at interval.In order further to increase the reticent effect of siRNA sequence, can also analyze the site that does not comprise with other encoding sequence homologous zone to identify to potential siRNA target site.For example, the siRNA target site that is fit to of about 21 base pairs will not have with other encoding sequence homologous and surpass 16-17 base pair continuously.If said siRNA sequence will select to lack the siRNA target sequence that surpasses 4 continuous A ' s or T ' s from RNA Pol III promoter expression.

In case identified potential siRNA target site, can design the siRNA sequence that is complementary to the siRNA target site.In order to improve their reticent effect, can also analyze the one or more sequence that has feature with evaluation to said siRNA sequence through algorithm for design at random: the G/C content of (1) about 25% to about 60%G/C; (2) at least 3 A/Us of 15-19 in the site of sense strand; (3) there is not internal repeat; (4) at the A in the site 19 of sense strand; (5) at the A in the site 3 of sense strand; (6) at the U in the site 10 of sense strand; (7) there is not G/C in the site 19 of sense strand; (8) on the site 13 of sense strand, there is not G.The siRNA design tool can be shown in, for example Http:// boz094.ust.hk/RNAi/siRNA, said siRNA design tool combine to give these characteristics each value that is fit to algorithm and be used to select siRNA.

In some embodiments; In case identified potential siRNA sequence; Said sequence is carried out the existence whether analysis of immunostimulation motif (for example, the motif of rich GU), as in the for example U.S. Provisional Patent Application that is filed on July 2nd, 2004 of pending trial number 60/585301 simultaneously; Be filed in 60/589363 of on July 19th, 2004; Be filed on November 12nd, 2004 60/627326 be filed on March 25th, 2005 60/665297 described in.In case identified, make them have immunostimulatory properties thereby can modify to increase or to reduce their immunostimulatory properties and can modify to immunostimulation siRNA molecule to non-molecules of immunization stimulus.

3. produce siRNA

SiRNA can provide with several forms, comprises, for example as one or more isolating siRNAs (siRNA) duplex, siRNA that transcribes box or the dsRNA in the DNA plasmid transcribed in longer double-stranded RNA (dsRNA) or conduct.Can also carry out chemosynthesis to siRNA.Preferably, synthetic or the siRNA that transcribes have 3 ' overhang of about 1-4 Nucleotide, 3 ' overhang of preferably about 2-3 Nucleotide and 5 ' phosphate terminal.Said siRNA sequence can have overhang (for example, as at (Elbashir, et al., Genes Dev.15:188 (2001);

; Et al.; Describe among the Cell107:309 (2001) 3 ' or 5 ' overhang) maybe can not have an overhang (that is, having flush end).

RNA crowd can be used to the precursor RNA s that provides long, or the long precursor RNA s that has basic or complete identity with the selected target sequence that can be used for preparing siRNA.Said RNAs can come from cell or tissue, to separate according to well-known method among those skilled in the art, and is synthetic, and/or the clone.RNA can be the crowd that mixes (available from cell or tissue, transcribe from cDNA, (subtrated) of deduction, selection etc.), maybe can represent single target sequence.RNA can be naturally occurring (for example, separating self-organization or cell sample), external synthetic (for example, using T7 or SP6 polysaccharase and PCR product or clone's cDNA); Or it is chemically synthetic.

In order to form long dsRNA, for synthetic RNAs, complement can also and be hybridized to form ds RNA in in-vitro transcription.If use naturally occurring RNA crowd, for example through transcribing cDNAs, or through using RNA polymerase, RNA complement (for example, form dsRNA, it is through intestinal bacteria (E.coli) RNAse III or cut enzyme and digest) is provided also corresponding to RNA crowd.Then, thus precursor RNA s hybridize and form double-stranded RNA s and digest.DsRNAs can directly be applied to the experimenter or can before using, carry out external digestion.

Perhaps, can be used to provide siRNA with one or more DNA plasmids of the one or more siRNA templates of coding.For example; The natural transcription unit that exists based on small nuclear rna U6 or people RNase P RNA H1; Can the dna profiling from plasmid siRNA being transcribed into auto-folder is the sequence with duplex of hairpin loop, and said plasmid has rna plymerase iii transcription unit and (sees Brummelkamp; Et al., Science296:550 (2002); Donz é, etal, Nucleic Acids Res.30:e46 (2002); Paddison, et al., Genes Dev.16:948 (2002); Yu, et al., Proc.Natl.Acad.Sci.99:6047 (2002); Lee, et al., Nat.Biotech.20:500 (2002); Miyagishi, et al., Nat.Biotech.20:497 (2002); Paul, et al., Nat.Biotech.20:505 (2002); And Sui, et al., Proc.Natl.Acad.Sci.99:5515 (2002)).Typically; Transcription unit or box will comprise the rna transcription promoter sequence; Such as H1-RNA or U6 promotor and terminator sequence, said promotor operationally is connected with the template of transcribing required siRNA sequence, and said terminator sequence comprises 2-3 uridine residue and gathers thymidine (T5) sequence (polyadenylation signal) (Brummelkamp; Science, the same).But selected promotor can provide composing type or induction type to transcribe.The method of transcribing of the rnai molecule that compsn and DNA-are instructed is described in detail in U.S. Patent number 6,573,099.Transcription unit is attached in plasmid or the dna vector, and RNA interfering is transcribed from said plasmid or dna vector.To be suitable for the plasmid that delivery of genetic material in the body is used for therapeutic purpose and be described in detail in U.S. Patent number 5,962, in 428 and 5,910,488.Selected plasmid can provide instantaneous or stable the sending of target cell.Thereby those skilled in the art will be clear that the plasmid that originally is designed to express required gene order can be modified comprises transcription unit's box of transcribing siRNA.

Isolation of RNA, synthetic RNA, hybrid nucleic acid, preparation and screening cDNA library and the method for carrying out PCR be well-known in the art (see, for example., Gubler Hoffman, Gene25:263-269 (1983); Sambrook etal., the same; Ausubel etal., the same), PCR method also is (to see USP 4,683,195 and 4,683,202 like this; PCR Protocols:AGuide toMethods and Applications (Innis etal., eds, 1990)).Expression library also is that those skilled in the art are well-known.The other basic books that disclose general method used in this invention comprise Sambrook et al., Molecular Cloning, ALaboratory Manual (2nd ed.1989); Kriegler, Gene Transfer and Expression:ALaboratory Manual (1990); With Current Protocols in Molecular Biology (Ausubel et al., eds., 1994)).

Thereby the plasmid that is fit to is carried out engineeredly making it comprise template sequence with effable form the sequence of the partial-length of said sequence encoding target gene product or the sequence of complete length.Template sequence can also be used to provide isolating or synthetic siRNA and dsRNA.What generally speaking, it is desirable to make the target gene product transcribes and translates downward modulation or reticent.

V. prepare nucleic acid-lipid granule

The present invention provides the method for preparing serum stability nucleic acid lipid granule, and wherein plasmid or other nucleic acid are encapsulated in the lipid bilayer and by protection and avoid degraded.Particle by method preparation of the present invention typically has the size of about 50nm to about 150nm, more typically has the size of about 100nm to about 130nm, the most typically has the size of about 110nm to about 115nm.Said particle can form through any method known in the art, and said method includes, but are not limited to: method for continuously mixing, and stain remover dialysis process, or improved inversion method, it with an organic solvent provides single-phase in the process of mixed said composition.

In preferred embodiments, said cation lipid is lipid or its combination of formula I and formula II.In other embodiment preferred, said non-cationic lipid is ESM, DOPE, DOPC; DPPE, DMPE, 16:0 monomethyl phosphatidylethanolamine, 16:0 dimethyl-phosphatidylethanolamine; The trans phosphatidylethanolamine of 18:1,18:018:1 phosphatidylethanolamine (SOPE), 16:018:1 phosphatidylethanolamine, DSPE; Polymkeric substance (for example, PEG2000, PEG5000, the DG that PEG-modifies based on polyoxyethylene glycol; Or the dialkoxy propyl group of PEG-modification), DSPC (DSPC), SUV, or its combination.In other embodiment preferred, said organic solvent is a methyl alcohol, chloroform, methylene dichloride, ethanol, diethyl ether or its combination.

In particularly preferred embodiments, said nucleic acid is plasmid; Said cation lipid is lipid or its combination of formula I or II; Said non-cationic lipid is ESM, DOPE, PEG-DAAs, DSPC (DSPC), SUV, or its combination (for example, DSPC and PEG-DAAs); And said organic solvent is a methyl alcohol, chloroform, methylene dichloride, ethanol, diethyl ether or its combination.

In particularly preferred embodiments; The present invention provides the blending means through continuing to produce nucleic acid-lipid granule; The said method that mixes that continues; For example such process, said process are included in to be provided the aqueous solution that comprises nucleic acid such as siRNA or plasmid and organic lipid soln is provided in second holder in first holder; Thereby thereby and make the mixed generation of moment basically of the said organic lipid soln and the aqueous solution seal nucleic acid (for example, siRNA) liposome with the said aqueous solution and organic lipid soln are mixed.The method and apparatus that is used for carrying out this process is described in detail in U.S. Patent Publication .20040142025.

Lipid and buffering solution are continued to introduce mixed environment, caused with the lasting dilution of damping fluid, after mixed, produce liposome thus basically instantaneously lipid soln such as the operation in the mixed chamber.When being used for this paper, phrase " with the lasting dilution of damping fluid lipid soln " (and variation) is often referred to the strength of enough accomplishing vesicle formation and in the hydration process, fully promptly dilutes said lipid soln.The aqueous solution and organic lipid soln through comprising nucleic acid mix, and when having buffered soln (that is, the aqueous solution), thereby the dilution that organic lipid soln experience continues progressively produces nucleic acid-lipid granule.

Use the serum stability nucleic acid-lipid granule that continues mixed method formation typically to have the size of about 50nm, more typically have the size of about 100nm, the most typically have the size of about 110nm to 115nm to about 130nm to about 150nm.The particle that forms does not thus have to assemble and randomly carries out big minispread to obtain the particle size of homogeneous.

In some embodiments, use stain remover to dialyse and form said particle.Be not inclined to by any concrete formation mechanism and fetter, plasmid or other nucleic acid (for example siRNA) thus contact with the detergent solution of cation lipid and to form coated nucleic acid complex.These coated nucleic acid can be assembled and precipitate.Yet, the existence of stain remover reduced this gathering and make coated nucleic acid and excessive lipid (typically, the non-cationic lipid) thus reaction forms particle, in said particle, plasmid or other nucleic acid are encapsulated in the lipid bilayer.Therefore, the present invention is provided for preparing the method for serum stability nucleic acid-lipid granule, and it comprises:

(a) thus in detergent solution, make nucleic acid combine to form coated nucleic acid-lipid complex body with cation lipid;

(b) thus the non-cationic lipid is contacted with coated nucleic acid-lipid complex body forms the detergent solution comprise plasmid-lipid complex body and non-cationic lipid; With

(c) dialysis step (b) thus in detergent solution the solution of serum stability nucleic acid-lipid granule is provided, wherein said nucleic acid is encapsulated in the lipid bilayer, said particle be serum stability and have a size between the about 150nm of about 50-.

Through in detergent solution, making nucleic acid combine to form the starting soln of coated nucleic acid-lipid complex body with cation lipid.

In these embodiments, it is 15-300mM that said detergent solution preferably has micelle-forming concentration, more preferably is the aqueous solution of the neutral detergent of 20-50mM.The instance of suitable stain remover comprises, for example, N, N '-((capryloyl imino-)-two-(trimethylene))-two-(D-glucamide (gluconamide)) is (BIGCHAP); BRIJ35; Deoxidation-BIGCHAP; Dodecyl gathers (terepthaloyl moietie) ether; Polysorbas20; Polysorbate40; Polysorbate60; Tween 80; Polysorbate85; Mega8; Mega9;

3-08; 3-10; Triton X-405; Basic-, heptyl-, octyl group-and nonyl-β-D-glucopyranoside; With heptyl sulfo-glucopyranoside; Wherein octyl group β-D-glucopyranoside and polysorbas20 are most preferred.The concentration of stain remover in detergent solution typically is the about 2M of about 100mM-, the about 1.5M of preferably about 200mM-.

Thereby cation lipid and nucleic acid are typically combined to produce the about 20:1 ratio of about 1:1-, the about 12:1 ratio of preferably about 1:1-, and the electric charge ratio of the about 6:1 ratio of more preferably about 2:1-(+/-).In addition, the nucleic acid total concn in solution will typically be the about 1mg/mL of about 25 μ g/mL-, the about 200 μ g/mL of preferably about 25 μ g/mL-, and more preferably be the about 100 μ g/mL of about 50 μ g/mL-.In for some time, what in detergent solution, make nucleic acid and cation lipid combines typically to remain on room temperature, and the said time, enough coated complex body formed.Perhaps, nucleic acid and cation lipid can combine and be heated to the temperature that reaches about 37 ℃ in detergent solution.For the nucleic acid responsive especially to temperature, coated complex body can form in lower temperature, and said temperature typically is low to moderate about 4 ℃.

In a preferred embodiment, the scope of the ratio (mass/mass ratio) of nucleic acid in forming nucleic acid-lipid granule and lipid is between about 0.01-about 0.08.The ratio of starting substance is also in this scope, because purification step is typically removed not entrapped nucleic acid and empty liposome.In another preferred embodiment; Said nucleic acid-lipid granule preparation uses the about 400 μ g nucleic acid of every 10mg TL, or about 0.01 to about 0.08, more preferably about 0.04 nucleic acid and drugrlipid ratio; Said ratio is corresponding to per 50 μ g nucleic acid, the TL of 1.25mg.

Then, thus make the detergent solution of coated nucleic acid-lipid complex body contact the detergent solution that nucleic acid-lipid complex body and non-cationic lipid are provided with the non-cationic lipid.The non-cationic lipid that effectively is used in this step comprises, diacyl phosphatidyl choline, diacyl phosphatidylethanolamine, ceramide, sphingophospholipid, kephalin, Val and cerebroside.In preferred embodiments, said non-cationic lipid is a diacyl phosphatidyl choline, diacyl phosphatidylethanolamine, ceramide or sphingophospholipid.Carboxyl groups in these lipids is preferably derived from having C ₁₀-C ₂₄The carboxyl groups of the lipid acid of carbochain.More preferably, said carboxyl groups is lauryl, mnyristoyl, palmityl, stearyl or oleoyl.In particularly preferred embodiments, said non-cationic lipid will be 1,2-sn-DOPE (DOPE); Palmityl oleoyl phosphatidylcholine (POPC), Yelkin TTS phatidylcholine (EPC), DSPC (DSPC); SUV, or its mixture.In most preferred embodiment, said nucleic acid-lipid granule will be to have the fusion particle that improves characteristic in vivo, and said non-cationic lipid will be DSPC or DOPE.In addition, nucleic acid-lipid granule of the present invention also can comprise SUV.In other embodiment preferred; Said non-cationic lipid also will comprise polymkeric substance based on polyoxyethylene glycol such as PEG2000; PEG5000 and the polyoxyethylene glycol of puting together with DG, ceramide or phosphatide are as at U.S. Patent number 5; 820,873 with described in the U.S. Patent Publication 20030077829.In other preferred embodiment, said non-cationic lipid also will comprise polymkeric substance based on polyoxyethylene glycol such as PEG2000, PEG5000 and the polyoxyethylene glycol of puting together with the dialkoxy propyl group.

The amount that is used for the non-cationic lipid of the inventive method typically is the nucleic acid for 50 μ g, the TL of the about 20mg of about 2-.Preferably, the amount of TL is the about 10mg of the about 5-of nucleic acid of per 50 μ g.

Behind the detergent solution that forms nucleic acid-lipid complex body and non-cationic lipid, preferably remove stain remover through dialysis.The removal of stain remover causes around the formation of the double-layer of lipoid of nucleic acid; Thereby the nucleic acid-lipid granule of serum stability is provided; Said particle has the size of the about 150nm of about 50nm-, more typically has the size of about 100nm to about 130nm, the most typically has the size of about 110nm to 115nm.The particle that forms thus do not assemble and randomly with big minispread to obtain the homogeneous particle size.

Can come the nucleic acid-lipid granule of serum stability is carried out big minispread to obtain the liposome by size classification through arbitrary obtainable method.Thereby can carry out obtaining the particle size dispersion of ideal magnitude range and relative narrower by size classification.

Thereby can obtain some technology said particle is aligned to the ideal size by size.The method that is used for liposome and can be applicable to a big minispread of particulate of the present invention with being equal to is described in U.S. Patent number 4,737,323.Through water-bath or probe ultrasonication the particle suspension is carried out ultrasonication and produce the particle that gradually particle size is reduced to the size that is less than about 50nm.The homogenate method is to depend on shearing force bigger particle is fractured into another method of littler particulate.In a typical homogenate method, the milk sap homogenizer through standard make particle recycling up to observe typically about 60 and 80nm between selected particle size.In two kinds of methods, particle size dispersion can be distinguished through conventional laser bundle particle size, or QELS monitors.

Pushing particle through aperture polycarbonate membrane or asymmetric ceramic membrane also is that particle size is reduced to the relatively fully effective ways of the size distribution of definition.Typically, through film with the suspension circulation primary or for several times up to obtaining the ideal particle size dispersion.Thereby can push the minimizing gradually that said particle obtains size through the continuous more film of aperture.

In another group embodiment, the present invention provides the method for preparing serum stability nucleic acid-lipid granule, and said method comprises:

(a) in organic solvent, prepare the mixture that comprises cation lipid and non-cationic lipid;

(b) aqueous solution that makes nucleic acid with step (a) thus in said mixture contact and provide single-phase clearly; With

(c) remove the suspension that said organic solvent provides nucleic acid-lipid granule, wherein said nucleic acid is encapsulated in the lipid bilayer, and said particle is stable in serum and has the size of about 50-150nm.

The nucleic acid (or plasmid) that is used for this group embodiment, cation lipid and non-cationic lipid are as described for above-mentioned stain remover dialysis process.

To typically comprise for the selection of organic solvent can be in the consideration of removed easy property of granuloplastic later stage to solvent polarity and said solvent.The organic solvent that also can be used as solubilizing agent exists with the amount of the clear single-phase mixture that is enough to provide nucleic acid and lipid.Suitable solvent comprises, but is not limited to chloroform, methylene dichloride, diethyl ether, cyclohexane, pentamethylene, benzene, toluene, methyl alcohol or other fatty alcohol such as propyl alcohol, Virahol, butanols, uncle-butanols, isopropylcarbinol, amylalcohol and pure.Two kinds or more the combination of multi-solvent is also in the present invention available.

Through first solution with nucleic acid, it typically is that second organic solution of the aqueous solution and lipid is mixed in and comes together to accomplish nucleic acid and contact with the organic solution of positively charged ion with the non-cationic lipid.It will be appreciated by those skilled in the art that and for example to take place such as this being mixed through many methods through use vortex mixer through mechanical system.

With after the organic solution of lipid contacts, remove said organic solvent at nucleic acid, therefore form the aqueous suspension of serum stability nucleic acid-lipid granule.The method that is used to remove organic solvent will typically comprise vapourisation under reduced pressure or said mixture will be blown in the air-flow air blast of rare gas element (for example, nitrogen or argon gas).

The serum stability nucleic acid that forms thus-lipid granule typically size more typically arrives between about 130nm at about 100nm between about 50nm and 150nm, the most typically arrives between about 115nm at about 110nm.Size reduces or big or small homogeneity in the further particle in order to obtain, can be according to arranging by size as stated.

In other embodiment, said method is added non-lipid polycation with also comprising, it can be used for utilizing compsn of the present invention to realize cytotropic sending.The instance of suitable non-lipid polycation comprises; But be not limited to; Hexadimethrine bromide (hexadimethrine bromide) is (under trade name

, from Aldrich Chemical Co., Milwaukee; Wisconsin, USA buys) or the salt of other heaxadimethrine.Other suitable polycation comprises, for example, gathers-the L-ornithine, gathers-the L-l-arginine, and poly-L-Lysine gathers-D-Methionin the salt of polyallylamine and polymine.

In certain embodiments, can in monophase system (for example, the similar mixtures of Bligh and Dyer single-phase or water-based and organic solvent) or biphasic system, carry out the formation of nucleic acid-lipid granule, accompany by suitable mixed.

When in monophase system, carrying out the formation of complex body, each all is dissolved in cation lipid and nucleic acid in a large number in the single-phase miscellany of (a volume of).The combination of two kinds of solution provides single mixture, and complex body is formed in the said mixture.Perhaps, said complex body can form in two-phase mixture, and in said two-phase mixture, cation lipid combines with nucleic acid (it appears at aqueous phase), and it " is pushed away " in organic phase.

In another embodiment, the present invention provides the method for preparing nucleic acid-lipid granule, and said method comprises:

(a) nucleic acid is contacted to form nucleic acid-lipid mixt with the solution that comprises non-cationic lipid and stain remover;

(b) thus in making cation lipid and nucleic acid-lipid mixt contacting with the part of the negative charge of nucleic acid and form nucleic acid with lipid in and the mixture of electric charge; With

(c) thus stain remover is removed from the mixture that electric charge is neutralized provides nucleic acid-lipid granule, wherein said nucleic acid by protection avoid the degraded.

In one group of embodiment, the solution of non-cationic lipid and stain remover is the aqueous solution.Come together typically to accomplish nucleic acid and contact through first solution of nucleic acid and second solution of lipid and stain remover are mixed in the solution of non-cationic lipid and stain remover.It will be appreciated by those skilled in the art that through many methods, for example mix and to take place such as being somebody's turn to do through the use turbine mixer through mechanical system.Preferably, said nucleic acid solution or detergent solution.Amount with in the methods of the invention non-cationic lipid typically confirms based on the amount of used cation lipid, and typically is about 0.2-5 times of amount of cation lipid, about 2 times of about 0.5-of the amount of preferably used cation lipid.

In some embodiments, as for example described in the Patent Application No. 09/744,103 nucleic acid being carried out precompression.

Thereby with the nucleic acid-lipid mixt that therefore forms with during cation lipid contact with the negative charge part, said negative charge is partly related with the nucleic acid (or other polyanionic materials) of existence.The amount of used cation lipid will typically be enough to neutralize at least 50% negative charge of said nucleic acid.Preferably, said negative charge will have at least 70% and is neutralized, and more preferably has at least 90% to be neutralized.Effective cation lipid used in this invention comprises, for example DLinDMA and DLenDMA.These lipids and relevant analogue are in the U.S. Provisional Patent Application that is filed on June 7th, 2004 number 60/578,075; Be filed in 60/610,746 of on September 17th, 2004; Be filed on May 9th, 2005 60/679,427 in describe to some extent.

Can preferably mix with the solution that comprises said nucleic acid-lipid mixt through any of many technology, accomplish contacting of cation lipid and nucleic acid-lipid mixt through solution with cation lipid.After two kinds of solution are mixed (or with any alternate manner contact), the negative charge related with nucleic acid partly is neutralized.But nucleic acid still remains on unpressed state and obtains water-wet behavior.

, with after nucleic acid-lipid mixt contacts stain remover (or combination of stain remover and organic solvent) is removed at cation lipid, therefore formed said nucleic acid-lipid granule.The method that is used to remove stain remover will typically comprise dialysis.When organic solvent exists, come typically successfully to remove it through vapourisation under reduced pressure or through mixture is blown in the air-flow air blast of rare gas element (for example, nitrogen or argon gas).

The particle that forms thus will be typically from about 50nm to several microns, more typically from about 50nm to about 150nm, even more typically from about 100nm to about 130nm, the most typically come to arrange by size to about 115nm from about 110nm.In said particle size reduces or the homogeneity of size in order further to obtain, and can said nucleic acid-lipid granule be carried out ultrasonication, filter or carry out other and be used in the Liposomal formulation and be big or small permutation technology well-known to those skilled in the art.

In other embodiments, this method is added non-lipid polycation with also comprising, it can be used for utilizing compsn of the present invention to realize the lipofection of cell.The instance of suitable non-lipid polycation comprises; Hexadimethrine bromide is (under trade name

; From Aldrich Chemical Co.; Milwaukee, Wisconsin, USA buys) or the salt of other heaxadimethrine.Other suitable polycation comprises, for example, gathers-the L-ornithine, gathers-the L-l-arginine, and poly-L-Lysine gathers-D-Methionin the salt of polyallylamine and polymine.The interpolation of these salt is preferably carried out after particle forms.

On the other hand, the present invention provides the method for preparing nucleic acid-lipid granule, and said method comprises:

(a) a certain amount of cation lipid is contacted with nucleic acid; The amount of the water that said solution comprises about 15-35% and the organic solvent of about 65-85% and cation lipid be enough to produce from about 0.85-about 2.0+/-the electric charge ratio, thereby hydrophobic nucleic acid-lipid complex body is provided;

(b) thus hydrophobic nucleic acid-lipid complex body is contacted with the non-cationic lipid provides nucleic acid-lipid mixt; With

(c) thus from nucleic acid-lipid mixt, removing organic solvent provides nucleic acid-lipid granule, its amplifying nucleic acid is avoided degraded by protection.

Effectively be used in said nucleic acid, non-cationic lipid, cation lipid and organic solvent in this aspect of the present invention with described those are identical for the method for top use stain remover.In one group of embodiment, the solution of step (a) is monophasic.In another group embodiment, the solution of step (a) is biphase.

In preferred embodiments, said non-cationic lipid is ESM, DOPE, DOPC; Polymkeric substance (for example, PEG2000, PEG5000, the DG that PEG-modifies based on polyoxyethylene glycol; Or the dialkoxy propyl group of PEG-modification), DSPC (DSPC), DPPE, DMPE; 16:0 monomethyl phosphatidylethanolamine, 16:0 dimethyl-phosphatidylethanolamine, the trans phosphatidylethanolamine of 18:1,18:018:1 phosphatidylethanolamine (SOPE); The 16:018:1 phosphatidylethanolamine, DSPE, SUV, or its combination.In other embodiment preferred, said organic solvent is a methyl alcohol, chloroform, methylene dichloride, ethanol, diethyl ether or its combination.

In one embodiment, said nucleic acid is from the plasmid of wherein transcribing RNA interfering; Said cation lipid is DLindMA, DLenDMA, DODAC, DDAB, DOTMA, DOSPA, DMRIE, DOGS or its combination; Said non-cationic lipid is ESM, DOPE, DAG-PEGs, DSPC (DSPC); DPPE, DMPE, 16:0 monomethyl phosphatidylethanolamine, 16:0 dimethyl-phosphatidylethanolamine; The trans phosphatidylethanolamine of 18:1,18:018:1 phosphatidylethanolamine (SOPE), 16:018:1 phosphatidylethanolamine DSPE; SUV, or its combination (for example, DSPC and PEG-DAA); And said organic solvent is a methyl alcohol, chloroform, methylene dichloride, ethanol, diethyl ether or its combination.

As above, preferably through mechanical system such as through using the vortex mixer that first solution of nucleic acid and second solution of lipid are mixed in together, come typically to accomplish contacting of said nucleic acid and cation lipid.The mixture that obtains comprises aforesaid complex body.Then, with the removal organic solvent these complex bodys are changed into particle through adding the non-cationic lipid.The interpolation of non-cationic lipid is added typically completion in the solution that comprises said complex body to through simple solution with the non-cationic lipid.Can also use reverse interpolation.Can and also accomplish the removal subsequently of organic solvent as stated through the known method of those skilled in the art.

The amount of the non-cationic lipid of use in the present invention is aspect this typically is about 15 times of about 0.2-of amount (based on mole foundation) of the cation lipid of nucleic acid-lipid complex body of being used to provide electric charge to be neutralized.Preferably, said amount is about 9 times of about 0.5-of the amount of used cation lipid.

In another aspect, the present invention provides nucleic acid-lipid granule, and it prepares through aforesaid method.In these embodiments, said nucleic acid-lipid granule is the net charge neutral or carries total charge that said total charge provides bigger gene fat transfection activity for said particle.Preferably, the particulate nucleic acid component is to disturb the nucleic acid that does not need proteinic generation.In a preferred embodiment, nucleic acid comprises RNA interfering, and the non-cationic lipid is that ootheca phosphatide and said cation lipid are DLinDMA or DLenDMA.In preferred embodiments, said nucleic acid comprises RNA interfering, and said non-cationic lipid is the mixture of DSPC and SUV, and said cation lipid is DLinDMA or DLenDMA.In other embodiment preferred, said non-cationic lipid also can comprise SUV.

The multiple universal method of preparation SNALP-CPLs (SNALPs that comprises CPL) has been discussed at this paper.Two kinds of current techiques comprise " inserting the back " technology, are about to CPL and insert, and among the for example preformed SNALP and " standard " technology, wherein for example, SNALP forms in the step, and CPL is included in the lipid mixt.Said insertion back technology causes such SNALPs, and said SNALPs mainly has CPLs in the outside of SNALP duplicature, and standard technique provides such SNALPs, and it all has CPLs at inner face and outside.Said method is particularly useful for the vesicle of being processed by phosphatide (it can comprise SUV), and is useful on the vesicle that comprises PEG-lipid (such as PEG-DAAs and PEG-DAGs).The method for preparing SNALP-CPL is at for example U.S. Patent number 5,705,385,6,586,410,5,981,5016,534,484; 6,852,334; Instruct among U.S. Patent Publication 20020072121 and the WO00/62813.

A. nucleic acid-lipid granule uses

Nucleic acid-lipid granule of the present invention can be separately or with physiology acceptable carrier (such as saline water or phosphate buffered saline buffer) mixed applying, said physiology acceptable carrier is selected according to the medicinal practice of using path and standard.Usually, saline water will be employed as pharmaceutical carrier.Other suitable carriers comprises, water for example, and buffered water, 0.4% salt solution, 0.3% glycocoll etc. comprise the gp that increases stability, such as BSA, lipoprotein, sphaeroprotein etc.

Pharmaceutical carrier normally is added after particle forms.Therefore, after particle formed, said particle can be diluted to pharmaceutical carrier such as in the saline water.

Particulate concentration can change in broad range in medicinal prepns; Promptly from being less than about 0.05 weight %; Usually or at least about 2-5 weight % to as many as 10-30 weight %, and will mainly select according to selected specific application mode through fluid volume, viscosity etc.For example, can concentration be increased to reduce the fluid load relevant with treatment.This can be special ideal in the patient who suffers from congestive heart failure relevant with atherosclerosis or serious essential hypertension.Perhaps, thus can be diluted to lower concentration by the particle that the pungency lipid is formed reduces inflammation using the site.

As stated, in some embodiments, nucleic acid-lipid granule of the present invention comprises the PEG-DAA conjugate.Comprise normally ideal of other component, said other component is with the mode effect similar with the PEG-DAA conjugate, and acts on and stop particle aggregation to increase the circulation existence time limit and increase the mode of nucleic acid-lipid granule to the transmission of target tissue with providing.These components include, but not limited to the PEG-lipid conjugates, such as the PEG-DG in particle, and PEG-ceramide or PEG-phosphatide (such as PEG-PE), Sphingolipids,sialo G _M1The lipid or the ATTA-lipid of-modification.Typically, the concentration of composition will be about 1-20% and more preferably from about 3-10% in the particle.

Pharmaceutical composition of the present invention can be through conventional, and well-known sterilising technology is sterilized.Can pack to use or under aseptic condition, to filter and lyophilize the aqueous solution, before using, said cryodesiccated preparation and aseptic aqueous solution made up.Said compsn can such as suitable physiological condition requirement comprise medical aid matter, said auxiliary substance is such as pH regulator agent and buffer reagent, tension regulator etc., for example sodium acetate, Sodium.alpha.-hydroxypropionate, sodium-chlor, Repone K and calcium chloride.In addition, said particle suspension can comprise lipid-protectiveness reagent, and it is when storing, and the protection lipid avoids radical and lipid-peroxide injury.Lipotropy radical quencher such as alpha-tocopherol and water-soluble iron specificity sequestrant, is suitable such as the ironweed ammonium.

In another instance that their are used, the lipid-nucleic acid particle can be incorporated into widely in the topical formulations, and said formulation includes, but not limited to gel, oil, emulsion etc.For example, the suspension that comprises nucleic acid-lipid granule can and be used as topical cream by preparation, stick with paste, and ointment, gel, lotions etc. are used.

In case form, serum stability nucleic acid-lipid granule of the present invention is used for nucleic acid is introduced cell.Therefore, the present invention also provides the method for nucleic acid (for example, plasmid or and siRNA) being introduced cell.Said method is through form particle at first as stated, then makes particle and cells contacting for some time external or carry out in vivo, is enough to make that nucleic acid is cytotropic sends generation the said time.

Nucleic acid-lipid granule of the present invention can be adsorbed on almost any cell type that mixes or contact with them.In case be adsorbed, said particle can be exchanged lipid with cytolemma by the part of said cell institute endocytosis, or and cytogamy.The transfer of particulate nucleic acid moiety or combination can be through any generations of these approach.Particularly, when taking place to merge, the particulate film is integrated in the cytolemma and said particulate content and the combination of cell inner fluid.

Use ERP of the present invention to measure, can the transfection efficiency based on the carrier system of lipid of SPLP or other be optimized.More specifically, the purpose measured of ERP is based on them and distinguishes the various cation lipids of SPLPs and the effect of auxiliary lipid composition to the combination/absorption of endosome film or with its relative influence of fusion/instabilityization.This mensuration can confirm in quantity that how SPLP or other each component based on the carrier system of lipid realize transfection efficiency, make SPLPs or other the carrier system optimization based on lipid thus.As above explain, the endosome dropout value, or alternatively, ERP is defined as:

Acceptor gene expression/cell

SPLP absorption/cell

To be that it is obvious that for those skilled in the art easily can use any reporter gene (for example, luciferase, beta-galactosidase enzymes, green fluorescent protein etc.).In addition, can with any detectable mark come the mark lipid composition (or, alternatively, SPLP or based on any component of the preparation of lipid), provide and suppress or absorbing the interference in the cell.Use ERP of the present invention to measure, those skilled in the art can estimate various lipid composition (for example, cation lipid; The non-cationic lipid, PEG-lipid derivate, PEG-DAA conjugate; The ATTA-lipid derivate, calcium, CPLs; SUV, etc.) pair cell absorbs and the influence of transfection efficiency, optimizes SPLP or other carrier system based on lipid thus.Through every kind or other ERPs of more various SPLPs based on the preparation of lipid, can easily confirm the system of optimization, for example, in cell, have maximum absorption, and SPLP or other preparation based on lipid of maximum transfection efficiency.

Carry out the suitable mark that ERP of the present invention measures and comprise, but be not limited to, the spectrum mark, (for example, resorcinolphthalein and verivate are such as fluorescein isothiocyanate (FITC) and OregonGreen υ such as optical dye; Rhodamine and verivate, such as texas Red, four rhodamine lsothiocyanates (tetrarhodimine isothiocynate) (TRITC), etc., digoxigenin, vitamin H, phycoerythrin, AMCA, CyDyes ^υDeng; Radio-labeling, such as ³H, ¹²⁵I, ³⁵S, ¹⁴C, ³²P, ³³P, etc.; Enzyme is such as horseradish peroxidase, SEAP etc.; Spectrum colorimetric mark such as colloidal gold or tinted shade or plastic bead, such as PS, Vestolen PP 7052, latex etc.Use method well-known in the art, can be directly or indirectly and SNALP with mark, the component based on the carrier system of lipid of SPLP or other is carried out coupling.As above point out, can use the mark of broad variety, wherein depend on required susceptibility, with the easy property that the component of SNALP is puted together, durability requirements and obtainable use instrument and processing scheme are come selective marker.

VI. the liposome that comprises cation lipid

Except above-mentioned SNALP preparation, cation lipid of the present invention (that is the cation lipid of formula I or formula II) can be used in empty liposome or comprise in the preparation of liposome of one or more biologically active agents.

A. Liposomal formulation

The several different methods that can be used to prepare liposome is described in, Szoka for example, et al., Ann.Rev.Biophys.Bioeng., 9:467 (1980), U.S. Patent number 4,186,183,4; 217,344,4,235,871,4,261,975,4; 485,054,4,501,728,4,774,085,4; 837,028,4,946,787, WO91/17424, Deamer and Bangham, Biochim.Biophys.Acta, 443:629-634 (1976); Fraley, et al., PNAS.USA, 76:3348-3352 (1979); Hope, et al., Biochim.Biophys.Acta, 812:55-65 (1985); Mayer, et al., Biochim.Biophys.Acta, 858:161-168 (1986); Williams, et al., Proc.Natl.Acad.Sci., 85:242-246 (1988), the text Liposomes, Marc J.Ostro; Ed., Marcel Dekker, Inc., New York, 1983; Chapter1, and Hope, et al., Chem.Phys.Lip. is among the 40:89 (1986).The method that is fit to includes, but not limited to UW, extruding, and high pressure/homogenate, microfluidization (microfluidization), the stain remover dialysis, the calcium inductive of small liposome vesicle merges, and ether-inculcate method, these methods all are well-known in the art.

A kind of method produces the vesicle of multiwalled heterogeneous body size.In the method, thus vesicle-formation lipid is dissolved in suitable organic solvent or the solvent systems and be dried under vacuum or under the rare gas element and form thin lipid membrane.If desired, said film can be dissolved in the suitable solvent once more, such as the trimethyl carbinol, thereby and then be frozen drying and form the more lipid mixt of homogeneous, its powder-like form with hydration more easily exists.This film is capped with aqueous buffer and allows hydration, typically in 15-60 minute period, follows stirring.The size distribution of the multilayer vesicle that obtains can be through making the lipid hydration or through adding the solubilising stain remover, changing to littler size such as deoxidation cholate (ester) under more violent agitation condition.

The vesicle that can prepare individual layer through UW or extrusion process.Usually with most advanced and sophisticated (tip) ultrasonoscope, in ice bath, carry out supersound process such as most advanced and sophisticated (tip) ultrasonoscope of Branson.Typically, said suspension is carried out the circulation of intensive supersound process.Extruding can be carried out on such as Lipex Biomembrane Extruder at the microbial film extrusion machine.The hole size of the qualification in the extruding filter can produce the liposome vesicle of the individual layer of concrete size.Through asymmetric ceramic filter, such as being purchased the Company from Norton, the extruding that the Ceraflow Microfilter of Worcester MA carries out also can form liposome.Can also cause lipid to form monolayer vesicle simultaneously and prepare monolayer vesicle through phosphatide being dissolved in the ethanol and then lipid being expelled in the damping fluid.In addition, phosphatide can be dissolved in stain remover, cholate (salt) for example, and Triton X, or in the positive alkyl glucoside.After adding to said medicine in dissolved lipid-stain remover micella, remove stain remover through in many possible methods any, said method comprises, dialysis, gel-filtration, affinity chromatography, centrifugal and ultrafiltration.

Behind the preparation liposome, thus can be by liposome size distribution in process for preparation according to big minispread acquisition ideal magnitude range and relative narrower through the liposome of size screening.The magnitude range of about 0.2-0.4 micron makes liposome turbid liquor sterilize with filter method through conventional filter.If said liposome has been sieved about 0.2-0.4 micron by size, filtration sterilization process can carry out on the high-throughput basis.

Can obtain the technology that several sieve liposome required size.A kind of method for sieving is described in U.S. Patent number 4,737, in 323.Come that through water-bath or detector supersound process liposome turbid liquor is carried out supersound process and size is reduced to gradually the little monolayer vesicle that is less than about 0.05 micron size.The homogenate method is to depend on shearing force big liposome is fractured into the more another kind of method of small liposome.In typical homogenate method, the milk sap homogenizer through standard carries out recycling up to observing selected liposome size, typically between about 0.1 and 0.5 micron with the multilayer vesicle.Confirm the size of liposome vesicle through accurate electronic light scattering (QELS), as at Bloomfield, described in the Ann.Rev.Biophys.Bioeng., 10:421-450 (1981).Liposome through supersound process forms can reduce average liposome diameter.Thereby discontinuous supersound process circulation can be estimated to hocket and instruct effective liposome synthetic with QELS.

Pushing liposome through aperture polycarbonate membrane or asymmetric ceramic membrane also is the effective ways that the liposome size reduced to the size distribution that relatively fully limits.Typically, said suspension is through the film circulation primary or repeatedly up to obtaining required liposome size distribution.Thereby said liposome can through continuously more the film of aperture push the minimizing gradually that obtains the liposome size.For use in the present invention, it is preferred having about 0.05 micron liposome to the interior size of about 0.40 micrometer range.In particularly preferred embodiments, liposome between about 0.05 and about 0.2 micron between.

In preferred embodiments, use the known ordinary method of those skilled in the art to prepare empty liposome.

B. liposome is used as delivery vector

Drug delivery composition of the present invention (for example, liposome, micella, lipid-nucleic acid particle, virosome etc.) is useful for the whole body or the local delivery of therapeutical agent or biologically active agent, and also is useful in diagnositc analysis.

Following discussion is usually about liposome; Yet; For those skilled in the art with becoming easily it is obvious that this identical discussion for other medicines delivery system of the present invention (for example, micella, virosome; The lipid complex body; Lipid-nucleic acid particles etc. use the cation lipid of formula I as herein described or II, and they can be advantageously formed) can fully use.

For sending of therapeutical agent or biologically active agent, the liposome compsn that comprises cation lipid can load with therapeutical agent and be applied to the experimenter of needs treatment.The therapeutical agent that uses the compositions and methods of the invention to use can be any of multiple medicine that is selected for the suitable treatment of disease to be treated.Usually, medicine will be an antitumour drug, such as vincristine(VCR) (and other catharanthus alkaloid), Dx, mitoxantrone, NSC 94600, cis-platinum, bleomycin, endoxan, methotrexate, streptozocin etc.Especially preferred antitumour drug comprises, for example, dactinomycin, vincristine(VCR), vincaleucoblastine, the Gelucystine Arabinoside, anthracycline, alkylating agent, platinic compound, antimetabolite, and nucleoside analog are such as methotrexate and purine and pyrimidine analogue.Using Compounds and methods for of the present invention that anti-infective is delivered in the concrete tissue also can be ideal.Compsn of the present invention can also be used for optionally sending other medicines, includes, but not limited to local anesthetic, for example, and Percamine and CHLORPROMAZINE HCL; The beta-adrenaline blocking agent, for example, Proprasylyte, timolol and Trate; Antihypertensive drug, for example clonidine and hydralazine; Thymoleptic, for example, imipramine, amitriptyline and doxepin; Anti-conversants, for example, Phenytoin Sodium Salt; Antihistaminic, diphenhydramine for example, chlorphenirimine and promethazine; Microbiotic/antiseptic-germicide, for example, qingfengmeisu qiong, CIPROFLOXACIN USP 24, and cefoxitin; Anti-mycotic agent, for example, miconazole, Triaconazole, econazole, Travogyn, butaconazole, clotrimazole, itraconazole, nystatin, naftifine and amphotericin B; Antiparasitic, hormone, hormone antagonist, immunomodulator, neurotransmitter antagonists, Betimol, VITAMINs, narcotic and photographic developer.

As mentioned above, cation lipid can be used in the sending of therapeutic gene or oligonucleotide, and it is intended in cell, induce or blocks some proteinic generations.Thereby nucleic acid is electronegative and can combines with positively charged body to form SPLP that its cell that is suitable for preparation and aforesaid nucleic acid is sent.

Another clinical application of cation lipid of the present invention is to be used for the immunity to the animal and human as adjuvant.From immune purpose, can be with proteantigen, such as DT, Toxins,exo-, cholera, parasitic antigens, virus antigen, Tegeline, enzyme and histocompatibility antigen are attached in the liposome that comprises cation lipid of the present invention or are attached to it.

The liposome that comprises cation lipid of the present invention also is useful especially as the carrier of vaccine, and it is replied lymphoid organ that target is fit to immune stimulatory.

The liposome that comprises cation lipid of the present invention can also be used as carrier, and it optionally is delivered to target cell with immunosuppressor or immunostimulant.For example, use liposome of the present invention, can be with being used to suppress the glucocorticosteroid of macrophage activity and the lymphokine of activating macrophage is sent.

Can be used for selectivity with the liposome that comprises target molecule and regulate many biological activitys comprising cation lipid of the present invention.For example, can be used to stimulate the B cell proliferation of the surface antibody of showing the specificity conjugated antigen, therefore induce and be specific to said antigenic immunne response in conjunction with concrete antigenic liposome.As another instance, the liposome of binding growth factor or lymphokine can be oriented on their surface stimulates the cell of expressing for the suitable acceptor of these factors.Use this method, can be with the part (for example, treatment for cancer) of the propagation that stimulates medullary cell as regimen.

Can the liposome that comprise cation lipid of the present invention be used to send any product (for example, comprising the therapeutical agent of nucleic acid, diagnostic agent, mark or other compound) to cell or tissue, comprise in the cell or tissue in the Mammals.

In certain embodiments, it is desirable to use the targeting moiety that is specific to cell type or tissue to come target liposome of the present invention.Use multiple targeting moiety, such as part, cell surface receptor, gp, VITAMINs (for example vitamin G) and the monoclonal antibody target liposomes is former is described (see, for example, U.S. Patent number 4,957,773 and 4,603,044).Said targeting moiety can comprise complete albumen or its fragment.

Target mechanism needs targeting agent to be positioned at by this way on the surface of liposome usually, thus make targeting moiety can with said target, for example, cell surface receptor interacts.In one embodiment, said liposome is designed to the linker part is attached in the film when liposome forms.Said linker part must have by firm embedding and be anchored on the lipotropy part in the film.It must also have the hydrophilic parts that Tong Guo the chemical process on the aqueous surface of liposome obtains.Thereby said hydrophilic parts is selected chemically be suitable for targeting agent, thereby make said part and reagent form stable chemical bond.Therefore, the surface that the linker part is extended liposome usually, and constructed with correct location targeting agent.In some cases, possible is that targeting agent is directly connected in the linker part, but in many situations, it is more suitable in using the 3rd molecule to serve as " molecule bridge ".Said bridging is junctor part and the targeting agent that leaves surface of liposome in succession, makes targeting agent can freely obtain the interaction with cellular targets thus.

Can use the standard method of coupling targeting agent.For example, can use phosphatidylethanolamine, the connection targeting agent thereby it can be activated, or the lipophilic compound of use derivatize are such as lipid-deutero-bleomycin.Use, for example, the liposome of conjugated protein A can make up the liposome of antibody-target and (see Renneisen; Et al., J.Bio.Chem., 265:16337-16342 (1990) I: and Leonetti; Et al., PNAS.USA, 87:2448-2451 (1990)).The instance of targeting moiety can also comprise, is specific to other protein of cellular component, comprises the antigen relevant with vegetation or tumour.Can the protein as targeting moiety be connected in liposome through covalent linkage.See, Heath, Covalent Attachment of Proteins to Liposomes, 149Methods in Enzymology111-119 (Academic Press, Inc.1987).Other targeted approach comprises biotin-avidin system.

In some cases, the diagnosis target of liposome can be used to treat the cell or tissue by target subsequently.For example, during when toxin and by the liposome coupling of target, said toxin can be followed effective destruction by the cell of target, such as tumour cell.

C. liposome is used as diagnostic agent

Can be with mark to using the drug delivery composition of cation lipid preparation of the present invention, for example liposome carries out mark, and said mark will promote the diagnosing image of various disease states, and said disease comprises tumour, inflamed joints, pathology etc.Typically, although can also use fluorescent mark, these marks will be radioactive mark's things.It is particularly advantageous using γ-radiation ri, because they can easily count in scintillation well counter, before counting, does not need tissue homogenate and can form images with γZhao Xiangji.

Typically use γ-or positron radiating ri, such as as γ-radiating ⁹⁹Tc, ²⁴Na, ⁵¹Cr, ⁵⁹Fe, ⁶⁷Ga, ⁸⁶Rb, ¹¹¹In, ¹²⁵I and ¹⁹⁵Pt; Such as as the positron radiating ⁶⁸Ga, ⁸²Rb, ²²Na, ⁷⁵Br, ¹²²I with ¹⁸F.From the purpose of in-vivo diagnostic, can also use paramagnetic coordination mark liposome usually, as carrying out through use nuclear magnetic resonance (MRI) or ESR spectrum (ESR).See, for example, U.S. Patent number 4,728,575.

D. the loading of liposome

The method that conventional medicine is loaded in the liposome comprises that for example, wrapper technology is loaded into double-deck and transmembrane potential loading method.

In a wrapper technology, medicine and liposome components dissolved are in organic solvent, and wherein all kinds are blendable and are concentrated with dry film.Then, damping fluid is added in the exsiccant film and forms liposome in the wall that medicine is incorporated into vesicle.Alternatively, said medicine is placed damping fluid and adds the exsiccant film that lipid composition is only arranged.By this way, medicine will be encapsulated in the aqueous interior of liposome.Being used in the damping fluid that forms in the liposome can be the buffered soln of any biocompatibility, isotonic saline solution for example, phosphate buffered saline buffer, or the damping fluid of other LIS.Usually, medicine will exist with the amount from about 0.01ng/mL to about 50mg/mL.Then the liposome that obtains is randomly arranged as stated by size, said liposome has and is combined in aqueous interior or the medicine in film.

The transmembrane potential loading method has been described in detail in U.S. Patent number 4,885, in 172,5,059,421 and 5,171,578.In brief, the transmembrane potential loading method can be used for any basically conventional medicine, and said medicine can exist with electriferous state in being dissolved in suitable aqueous medium the time.Preferably, thus said medicine will be lipophilic relatively will being assigned in the liposome membrane.Transmembrane potential passes liposome or protein-liposome is multiple and the bilayer of body produces, and said medicine is loaded in the liposome by means of transmembrane potential.Transmembrane potential produces for one or more charged species (for example, Na through passing film ⁺, K ⁺And/or H ⁺) concentration gradient produce.The liposome that this concentration gradient has different inside and outside media through generation produces and has a relevant proton gradient.Drug accumulation can then take place with the mode through the expection of Henderson-Hasselbach equation.

Can liposome compsn of the present invention be applied to the experimenter according to standard technique.Preferably, the pharmaceutical composition of liposome compsn is through parenteral, i.e. intraperitoneal ground, and intravenously ground is used hypodermically or intramuscularly.More preferably, said pharmaceutical composition comes intravenously ground to use through bolus infusion.Suitable preparation used in this invention is shown in Remington ' s PharmaceuticalSciences, Mack Publishing Company, Philadelphia, Pa., 17th ed. (1985).Can pharmaceutical composition be used for, for example diagnose multiple disease, or treatment various disease states (such as inflammation, infecting (viral and bacterial infection) vegetation, cancer etc.).

Preferably, pharmaceutical composition is carried out intravenous administration.Therefore, the present invention is provided for the compsn of intravenous administration, and it comprises that liposome is suspended in acceptable carrier, preferably the solution in the aqueous carrier.Can use multiple aqueous carrier, for example, water, buffered water, 0.9% isotonic saline solution, etc.These compsns can be through conventional, and well-known sterilising technology is sterilized, or can filtration sterilization.Can or carry out lyophilize with the aqueous solution former state packing that obtains, said cryodesiccated preparation makes up with the aqueous solution of sterilizing before using.According to roughly physiological condition institute requirement, said compsn can comprise medical aid matter, such as pH regulator and buffer reagent, tension regulator, wetting agent etc.; For example, sodium acetate, Sodium.alpha.-hydroxypropionate, sodium-chlor; Repone K, calcium chloride, Arlacel-20, Emulphor FM etc.

According to the selected concrete pattern of using; The concentration of the liposome compsn in pharmaceutical prepn can change in broad range, that is, and and from being less than about 0.05 weight %; Usually or at least about 2-5 weight % to as many as 10 to 30 weight % and will be mainly according to fluid volume, viscosity etc. are selected.For diagnosis, the amount of the compsn of using will depend on used concrete mark (that is, and radio-labeling, fluorescent mark, etc.), by the morbid state diagnosed and clinicist's judgement, still will be usually between per kilogram of body weight about 1 and about 5mg.

Embodiment

The present invention will describe through the mode of the following example in more detail.The following example is to provide from illustrational purpose, and is not intended to limit by any way the present invention.Thereby those skilled in the art will readily appreciate that and can be changed or revise the multiple non-key parameter that produces substantially the same result.

Embodiment 1: material and method

Material: DPPS, 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC) and SUV available from Avanti Polar Lipids (Alabaster, AL).TNS available from Sigma-Aldrich Canada (Oakville, ON).RiboGreen available from Molecular Probes (Eugene, OR).The methylsulfonic acid alkyl ester is available from Nu-Chek Prep, and Inc. (Elysian, MN, USA).SiRNA (contrast of anti-luciferase and mispairing) available from Dharmacon (Lafayette, CO, USA).Said anti-luciferase have adopted sequence be 5 '-G.A.U.U.A.U.G.U.C.C.G.G.U.U.A.U.G.U.A.U.U-3 '.Said anti-luciferase anti-sense sequence is 5 '-U.A.C.A.U.A.A.C.C.G.G.A.C.A.U.A.A.U.C.U.U-3 '.All other chemical available from Sigma-Aldrich (Oakville, ON, Canada).

DSDMA and DODMA's is synthetic: use each alkyl bromide, use derived from the method for DOTMA precursor and synthesize DSDMA and DODMA (Felgner et al, PNASUSA, 84,7413-7417 (1987)).With 3-(dimethylamino)-1, (714mg, 6mmol) (NaH, 1.26g 50mmol) in benzene (30mL), stirred 30 minutes under argon gas the 2-Ucar 35 with 95% sodium hydride.(5.0g 15mmol) adds, and reaches 18 hours at the said reactant of argon gas refluxed with (oil base or the stearyl) alkyl bromide that is fit to.Then, the said reaction mixture of cooling carries out quencher through slow adding ethanol simultaneously on ice bath.After diluting with other 150mL benzene, wash said mixture with zero(ppm) water (2x150mL) and salt solution (150mL), if necessary, use ethanol (～20mL) assist to be separated.Evaporate through the next dry said organic phase of sal epsom and with it.On silica gel (Kiesel Gel60) post, come the said raw product of purifying, and carry out wash-out with the chloroform of the methyl alcohol that comprises 0-5%.Come analytical column level branch through thin-layer chromatography (TLC) (silica gel, chloroform/methanol 9:1v/v observe with molybdate), and will comprise purified product (R _f=0.5) level is divided and is merged, and concentrates.Through in the suspension of the ethanol (75mL) of gac (1g), stirring to come said product is decoloured in 30 minutes in 60 ℃.Said charcoal is removed through the Celite filtration, and ethanolic soln is concentrated the pure product that typically produces 2.4g (65%). ¹H-NMR (DSDMA): δ _H3.65-3.32 (m, 7H, OCH, 3xOCH ₂), 2.45-2.31 (m, 2H, NCH ₂), 2.27 (s, 6H, 2xNCH ₃), 1.61-1.45 (m, 4H, OCH ₂ CH ₂ ), 1.40-1.17 (m, 60H, H _Stearyl ), 0.86 (t, 6H, CH ₂C H ₃ ). ¹H-NMR (DODMA): δ _H5.4-5.27 (m, 4H, 2xC H=C H), 3.65-3.35 (m, 7H, OCH, 3xOCH ₂), 2.47-2.33 (m, 2H, NCH ₂), 2.28 (s, 6H, 2xNCH ₃), 2.06-1.94 (m, 8H, 4xC H ₂ CH=CH), 1.61-1.50 (m, 4H, OCH ₂C H ₂ ), 1.38-1.20 (m, 48H, H _{Oil base}), 0.88 (t, 6H, CH ₂C H ₃ ).

DLinDMA and DLenDMA's is synthetic: the synthetic of said DLinDMA and DLenDMA is similar to DSDMA and DODMA, but is to use methylsulfonic acid alkyl ester substituted alkyl bromide.General compound method is identical with the compound method of DSDMA and DODMA, replaces bromide with identical molar ratio with the methylsulfonic acid alkyl ester.Omit the activated carbon decolorizing step, because the product here comprises the two keys of conjugated and expects that charcoal absorption comprises the compound of these characteristics.Productive rate typically is 2.0g (55%). ¹H-NMR (DLinDMA): δ _H5.43-5.27 (m, 8 H, 4xC H3.65-3.35 (m, 7H, OCH, 3xOCH ₂), 2.77 (t, 4H ,=CHC H ₂ CH=), 2.47-2.33 (m, 2H, NCH ₂), 2.28 (s, 6H, 2xNCH ₃), 2.05 (q, 8H, 4xCH ₂C H ₂ CH=), 1.62-1.50 (m, 4H, OCH ₂C H ₂ ), 1.40-1.22 (m, 32H, H _{Inferior oil base}), 0.89 (t, 6H, CH ₂C H ₃ ). ¹H-NMR (DLenDMA): δ _H5.44-5.27 (m, 8H, 4xC H=C H), 3.62-3.48 (m, 7H, OCH, 3xOCH ₂), 2.80 (t, 4H ,=CHC H ₂ CH=), 2.43-2.32 (m, 2H, NCH ₂), 2.26 (s, 6H, 2xNCH ₃), 2.12-1.99 (m, 8H, 4xCH _2/3C H ₂ CH=), 1.61-1.51 (m, 4H, OCH ₂C H ₂ ), 1.40-1.22 (m, 20H, H _{Flax base}), 0.98 (t, 6H, CH ₂C H ₃ ).

PEG ₂₀₀₀-C-DMA's is synthetic: synthetic as follows PEG-C-DMA.In brief, through at first coming alkanisation 3-allyloxy propane-1 with the Semen Myristicae acylbromide, the oh group of 2-glycol prepares C ₁₄The lipid anchor.Subsequently, remove allyl group, obtain C through palladium catalysis ₁₄The hydroxyl lipid.Through formylation and amination oh group is converted into primary amine, to produce 1,2-myristyl oxygen base propyl group-3-amine, said lipid anchor.Gather (terepthaloyl moietie) (molecular-weight average 2000) and form chloro-formic ester through handle mono methoxy with excessive superpalite to realize and the puting together of PEG.Add C ₁₄Amine lipid anchor and stirred overnight produce PEG ₂₀₀₀-C-DMA, it is called as PEG-C-DMA at this paper.

SNALP preparation: through the alcohol dilution method; Using spontaneous vesicle to form to prepare iipidomic becomes DSPC:Chol:PEG-C-DMA: the SNALP of cation lipid (20:48:2:30 molar percentage) [Jeffs et al., Pharm.Res.In Press (2005)].Use cross-stream ultrafiltration cartridge case (Amersham Biosciences; Piscataway NJ) comes to the PBS (20 times of wash volumes) of 100mL said sample to be carried out diafiltration, and it is passed through Acrodisc0.2 μ m Posidyne filter (Pall Corp.; Ann Arbor MI) carries out filtration sterilization.Use RiboGreen mensuration and siRNA typical curve to confirm the siRNA concentration of final sample.(Malvern UK) confirms particle size and polymolecularity to use MalvernInstrumentsZetasizer3000HSA.Use the RiboGreen assay method, exist with the situation that does not have Triton X-100 under relatively fluorescence confirm that nucleic acid seals.Use has λ _Ex=500nm, λ _EmThe Varian Eclipse spectrofluorometer (Varian Inc) of=525nm comes measure R iboGreen fluorescence.

The TNS assay method: the SNALP lipid of 20 μ M and the TNS of 6 μ M are mixed in the 20mM sodium phosphate of pH at the 2mL of 4.5-9.5 variation in the fluorescence cuvette, the 25mM Citrate trianion is among the ammonium acetate of 20mM and the NaCl of 150mM.Use is set to λ _Ex=322nm, λ _EmThe Varian Eclipse spectrofluorometer (Varian Inc) of=431nm is measured fluorescence on each pH.Then, at different pH, the fluorescence standard of every kind of system is turned to the value at the pH4.5 place.PK _aValue is the 50% charged point of molecule that exists wherein.Through supposing that minimum fluorescence represents 0 electric charge, and maximum fluorescence is represented 100% electric charge, can estimate pKa through the pH of half the point just that measures between the value of minimum and maximum electric charges.

³¹The P NMR spectroscopy: preparation comprises the multilayer vesicle (MLV) of DPPS and cation lipid with the molar ratio of 1:1.Through the lipid of drying, it is transferred in the NMR pipe of 10mm, and at the 10mM of 1.5mL Trisodium Citrate, hydration is accomplished this among the pH4 from chloroformic solution.Acquisition is corresponding to the free induction decay (FIDs) of 1000 scannings, and it has the interpulse 3.0 μ s that are spaced apart 1s, the 60o pulse, and spectrum width is 25000Hz.The two horizontal proton-decoupled of gate are share the enough decoupling that carry out with minimum sample heating in guaranteeing.Before fourier transformation, will be applied to FIDs corresponding to the index multiplication of the spectral line broadening of 50Hz.Use BrukerB-VT1000 variable temp device to regulate sample temperature (+/-1 ℃).Chemical shift is with reference to 85% phosphoric acid as outer standard.

In-vitro transfection: with cell cultures comprise 10% foetal calf serum (FBS) (CanSera) with the MEM (Invitrogen) of 0.25mg/mL G418 (Invitrogen) in.(transfection stably of Neuro2A cell quilt is to express luciferase [R.E.Kingston.in CurrentProtocols inMolecular Biology with the Neuro2A-G cell; Vol.2; Pp.9.1.4-9.1.9, John Wiley&Sons, Inc. (1997)]) with 4x10 ⁴The concentration of cells/well is inoculated in 24 orifice plates, and with its overnight cultures.With the dosage of the nucleic acid of 0.0625-1.0 μ g/mL handle cell (AntiLuc activity or Mismatch contrast) with SNALP and with it at 37 ℃ and 5%CO ₂Incubation 48 hours.Then, come washed cell and use the 250mM sodium phosphate of the 200 μ L that comprise 0.1%TritonX-100 to carry out cracking with PBS.The luciferase protein matter (Roche) of use luciferase reagent (Promega) and standard is measured the luciferase activity in each hole.Use Berthold MicroLumatPlus LB96V plate luminometer to measure the luminous of each.Then, use Micro BCA to measure test kit (Pierce) and the luciferase activity that obtains is carried out stdn for proteinic amount.Then, confirm to descend for each system with respect to the luciferase of contrast.

Cell absorbs: preparation SNALP; It combines non-swappable tritium-labeled lipid cholesteryl n-Hexadecane ether (3H-CHE) (11.1 μ Ci/mol TL) [Bally et al., inLiposomeTechnology, Vol.III; Pp.27-41, CRC Press (1993)].(ATCC, VA USA) are seeded in the minimum medium of 12 orifice plates with the 1.6x105 cells/well with the Neuro2A cell.Next day, remove substratum and use the substratum of the SNALP that comprises radiolabeled 0.5 μ g/mL nucleic acid to replace.After 24 hours, remove substratum and unconjugated SNALP, with the soft washing of PBS 4 times, then the lysis buffer (the 250mM phosphoric acid salt with 0.1%Triton X-100) with 600 μ L carries out cracking with attached cell.The cell lysate that obtains (500 μ L) adding is comprised in the glass scintillation bottle of 5mL Picofluor40 (Perkin Elmer), and use Beckman LS6500 scintillometer (Beckman Instruments) to measure ³H-CHE.Use Micro BCA assay method (Pierce) to measure the protein contnt of cell lysate.Absorption is expressed as the per-cent of the total amount/mg cell protein that is applied to cell activity.

Comprise the absorption of SNALP of the siRNA of Cy3-mark: prepare SNALP as previously mentioned, but be to use siRNA with fluorophore Cy3 (Cy3-siRNA is Sima Therapeutics Inc, Boulder, the present of CO) mark.Confirm to seal siRNA concentration and particle size as said.

For Absorption Study, with 8x10 ⁴(BDFalcon, Mississauga is among the MEM that comprises 0.25mg/mL G418 ON) at 4 pore chamber slide glasss for Neuro2A-G cell incubated overnight.The DSDMA that will comprise Cy3-siRNA, DODMA, DLinDMA and DLenDMA SNALP, and naked Cy3-siRNA and unlabelled DSDMA SNALP place on the cell with the siRNA of 0.5 μ g/mL.After 4 hours, using the PBS washed cell with the substratum incubation of transfection, then washing, and finally wash again with PBS with the MEM that comprises G418.Then, said cell in room temperature, is fixed in the PBS solution of 4% paraformaldehyde and reaches 10 minutes.Wash said cell with PBS, and (Molecular Probes, Eugene dyeed 5 minutes OR) to be used in 300nM DAPI among the PBS.Wash said cell with PBS, use mounting medium (mounting media) ProLongGold Antifade reagent (Molecular Probes, Eugene, OR) and add deckglass.The Olympus BX60 microscope that uses the fluorescence ability to improve to some extent comes observation of cell.(Microgen Optics, Redding CA) observe Cy3 fluorescence in cell, and (Carsen Group, Markham ON) observe DAPI fluorescence to use DAPI cube device to use rhodamine cube device.Use Olympus DP70 photographic system to catch digital picture.When inspection Cy3 fluorescence,, when inspection DAPI fluorescence, take the picture of cell with 1/80 second time shutter with the picture of 1/4 second time shutter shooting cell.

Embodiment 2: the mensuration of serum stability

Can carry out the mensuration of serum stability through the whole bag of tricks according to the lipid/nucleic acid particle of the above-mentioned technology preparation of pointing out.

For example, in typical DNase1 digestion, with being encapsulated in 1 μ gDNA in the target particles at the 5mM HEPES of 100 μ l TVs, 150mM NaCl, 10.0mM MgCl ₂Carry out incubation among the pH7.4.With 100 or the DNase I (Gibco-BRL) of 10U handle the sample of being handled by Dnase.Can 1.0% Triton X-100 be added in the control experiment to guarantee that lipid formulations does not directly make said enzyme deactivation.37 ℃ of incubations 30 minutes, through adding the DNAZOL of 500 μ L, the ethanol that adds 1.0mL subsequently came DNA isolation then with sample.With sample in desk centrifuge with 15, centrifugal 30 minutes of 000rpm.Supernatant and precipitate twice and carry out drying with the DNA that 80% washing with alcohol obtains inclines.This DNA is resuspended in the TE damping fluid of 30 μ L.This sample of 20 μ L uploaded in 1.0% the sepharose and in the TAE damping fluid, carry out electrophoresis.

In typical determination of serum, free is entrapped, or 50 μ gDNA of entrapped+0.5%TritonX100 form are distributed in the 1.5mL Eppendorf pipe.The normal mice or the human serum that in said pipe, add 45 μ l, dH2O (making final volume is 50 μ L).Seal said pipe and carry out incubation with Parafilm at 37 ℃.With the free of nucleicacidase of no use (standard) digestion, entrapped, or the sample of entrapped+0.5%Triton X100 is freezing and be stored in-20 ℃ in liquid nitrogen in the Eppendorf pipe.Take out aliquots containig at each time point, its adding is comprised in the GDP damping fluid of Proteinase K (133 μ g/mL), freezing with stopped reaction in liquid nitrogen immediately.In case collected all time points, thereby in water-bath, made the exonuclease sex change of any remnants with the 55 ℃ of said sample activator of incubation enzyme K.To be applied in the polyacrylamide gel to estimate the level of exonuclease degraded by the sample of protease K digesting.

The particle of above-mentioned announcement through in addition when having 100U DNase1, show that these process result are to be less than 5% and the dna degradation of undetectable amount (part or total) preferably, prove serum stability.Its advantageously with dissociative DNA, and plasmid/lipid complex body (such as DOTMA or DODAC:DOPE complex body) is relatively, said dissociative DNA is by thoroughly degraded, wherein DNA handles the back by basic degraded (that is, greater than 20%, common 80%) at these

Embodiment 3:1,2-two inferior oil base oxygen base-N, N-dimethylaminopropanecompounds (DLinDMA) and 1,2-two Asias The basic oxygen base-N of fiber crops, N-dimethylaminopropanecompounds (DLenDMA) synthetic

With 3-(dimethylamino)-1, (714mg, 6mmol) (NaH, 1.26g 50mmol) in benzene (30mL), stirred 30 minutes under argon gas the 2-Ucar 35 with 95% sodium hydride.(5.0g 15mmol) adds, and reaches 3 hours at the said reactant of refluxed under nitrogen with the inferior grease of methylsulfonic acid.Then, the said reaction mixture of cooling carries out quencher through slow adding ethanol simultaneously on ice bath.After diluting, wash said mixture with zero(ppm) water (2x150mL) and salt solution (150mL) with other 150mL benzene.Evaporate to obtain raw product through the next dry said organic phase of sal epsom and with it.On silica gel (Kiesel Gel60) post, come the said raw product of purifying, and carry out wash-out with the chloroformic solution of 0-5% methyl alcohol.Come analytical column level branch through thin-layer chromatography (TLC) (silica gel, chloroform/methanol 9:1v/v observe with molybdate dipping (dip)), and will comprise purified product (R _f=0.5) level is divided and is merged, and concentrates.

Realize the decolouring and further purifying of DLinDMA with second post, the ETHYLE ACETATE in hexane with 20-50% comes wash-out specifically.Come the level of analytical column to divide through TLC (silica gel, ETHYLE ACETATE/hexane 1:1v/v is observed with molybdate), and will comprise the level branch (R of purified product _f=0.4) merges and concentrate.Method as herein described typically produces the purified product of 2.2g (60%).

For synthesizing of DLenDMA, replace the inferior grease of methylsulfonic acid with the methylsulfonic acid linaethol, and carry out remaining synthesizing, decolouring and purification reaction as stated.

Embodiment 4: the preparation characteristic of unsaturated lipids is homogeneous and can reproduces

This embodiment proposes the physical features of SNALP preparation as herein described.Prepare the SNALP that comprises various cation lipids and assess RNA and the particle size of sealing (following table 1) as said.Three kinds of unsaturated cation lipids that form preparation roughly are identical sizes (132-140nm).The polymolecularity of all preparations is all very low, shows narrow particle size dispersion.It is whole 84-85% that RNA in final particle seals.Use saturated lipid DSDMA that siRNA is encapsulated in the formation that trial among the SNALP obtains having the 67% slightly larger particle (180nm) sealed.

Use the RiboGreen fluorometry to measure amount, confirm that per-cent seals with respect to the entrapped nucleic acid of the TNA that exists.Use Malvern Zetasizer to measure particle diameter and polymolecularity.Value is the MV of 3 independent experiments, and error is a standard deviation.

Cation lipid	% seals	Diameter (nm)	Polymolecularity
				DSDMA	67±3	182±11	0.15±0.03
DODMA	84±1	137±4	0.12±0.01
				DLinDMA	84±3	140±6	0.11±0.02
DLenDMA	85±1	132±7	0.13±0.03

Embodiment 5: the saturated pKa that influences cation lipid

Like the top embodiment 1 said apparent pK that confirms cation lipid _aWe confirm lipid pK _aUse 2-(p-toluino) naphthalene-6-sulfonic acid, the electronegative indicator of membrane potential (Bailey and Cullis, Biochemistry3312573-80 (1994)).TNS is through being electrostatically drawn on the positively charged film.Causing instantaneous (immediate) environment of TNS to become for the absorption of lipid film subsequently has more lipotropy, removed water molecules, otherwise said water molecules makes TNS quenching of fluorescence.Because TNS is adsorbed by positively charged film more easily, TNS fluorescence is the indicator of positive film surface charge.Through changing the surface p K that local pH is confirmed every kind of SNALP preparation existing under the situation of TNS _aValue.In Fig. 5, can observe the preparation that comprises unsaturated lipids and have similar pK _aValue (6.7-7.0) shows that said particle is a neutral charge in physiological pH, but positively charged on endosome pH.Yet, saturated lipid DSDMA, generation has about 7.6 higher pK _aParticle.Expect that the SNALP particle that comprises DSDMA is charged on physiological pH.

Result displayed confirms lipid pK in Fig. 5 _aWith the pK that shows 7.6,7.0,6.7 and 6.7 respectively _aDSDMA, DODMA, DLinDMA, relevant with the degree of saturation of DLenDMA.

Embodiment 6:

The double-deck hexagon transformation temperature that arrives is with the saturated increase of alkyl chain

Use ³¹P-NMR studies the saturated significance about transformation temperature.The lipid heteromorphism in anionic phospholipid/cation lipid mixture that other people have used this technical inspection promotes (Epand et al., Chem.Phys.Lipids5775-80 (1991)) by the existence of the phosphate group in phosphatide; Felgner et al., PNAS USA847413-7417 (1987)).The shape of NMR spike changes according to the arrangement of lipid.Bilayer structure produces the High-Field peak value with low shoulder (field shoulder).Yet on transformation temperature (Tc), lipid adopts the H that merges _IIPhase, indicated by reverse mode with the peak value that appears at a low side. ³¹P-NMR research shown in front some temperature (transformation temperature, Tc) on, lipid can adopt the H of fusion _IIPhase [Epand et al., Chem.Phys.Lipids5775-80 (1991); Felgner et al., PNAS USA.847413-7417 (1987)].Double-deck (L α phase) changes H into _IIThe bilayer of mutually required higher temperature indication fusion still less.Through confirming to transform the temperature that takes place, can confirm that lipid forms H _IIThe relatively easy property of phase, their " amalgamation ".

Use prepares MLV with negatively charged ion lipid DPPS and every kind of cation lipid that the 1:1 molar ratio exists.On different temperature, measure MLV's ³¹P-NNM spectrum.Comprise the MLV of saturated lipid DSDMA even on up to 50 ℃ temperature, show employing H _IIMeasurable sign of phase.Yet the MLV that comprises DODMA (1 two key of every alkyl chain) shows the transformation temperature between 30 and 35 ℃.Exist (DLinDMA) of second pair of key further reduced T _cTo between 20 and 25 ℃, the combination (DLenDMA) of the 3rd pair of key simultaneously has few further effect.Like finding in Fig. 6 A, for the DSDMA/DPPS system, double-deck pattern occurs in 30 to 50 ℃ temperature (the High-Field peak value with low shoulder).

Therefore, DSDMA shows that having combination negatively charged ion lipid forms H _IIThe low-down ability of phase.Cation lipid DODMA with single pair of key has the transformation temperature (Fig. 6 B) between 30 and 35 ℃.DLinDMA (2 two keys) and DLenDMA (3 two keys) system are presented in a way the similarly transition temperature (Fig. 6 C and 6D) between 20 and 25 ℃.It should be noted, observed center in spike 6C and 6D, isotropic peak value is not represented transformation temperature, and from the little phosphatide vesicle that also is present in the preparation.From High-Field peak value/low shoulder (double-deck phase, lower temperature) to a low peak value/transformation during the spectral line shape of High-Field shoulder (reverse hexagon phase, higher temperature) is asymmetric is the indication of phase transformation.This is particularly illustrated among the spike 6B (DODMA).Based on these results; We infer that the amalgamation of the SNALPs comprise said cation lipid will increase with following order: DSDMA DODMA DLinDMA ≈ DLenDMA, and hypothesis SNALPs about the validity of delivery of nucleic acids will show similar grade (DSDMA DODMA DLinDMA ≈ DLenDMA).

Embodiment 7: the gene table after sending the siRNA that is encapsulated among the SPLP that comprises cation lipid The silence that reaches

This embodiment has described after with SNALP in-vitro transfection Neuro2A cell, the relatively experiment of expression of nucleic acids, and said SNALP comprises: (1) DODAC, DODMA, or DLinDMA; (2) PEG-C-DMA; (3) to be encapsulated in the luciferase among the SNALP the siRNA duplex (that is, and such siRNA, it comprises following sequence: GAUUAUGUCCGGUUAUGUAUU and target is complementary to: the dna sequence dna of GATTATGTCCGGTTATGTATT).The plasmid (PLO55) that is used in coding luciferase under the control of CMV promotor comes stable transfection Neuro2A cell.Then, with the cell of SNALP transfection stable transfection, said SNALP comprises 15,20,25,30,35, or 40% DODAC, DODMA, or DLinDMA; 2%PEG-C-DMA and to being encapsulated in the siRNA duplex of the luciferase among the SNALP.Measured the expression of luciferase protein matter after with the SNALP transfection in 48 hours.Compare with the SNALP that comprises DODAC or DODMA, the SNALP that comprises 30%DLinDMA is more effective in the luciferase expression that reduces the Neuro2A cell.These results are presented among Fig. 6.

Such as in Fig. 6 demonstration, use and to send directly the reticent result of experiment support of luciferase genes that the SNALP to the siRNA of luciferase genes carries out ³¹The P-NMR data.Every kind SNALP with comprising four kinds of cation lipids (that is, DSDMA.DODMA, DLinDMA, and DLenDMA) handles cell.After 48 hours, express not influence for luciferase genes through the confluent SNALP that comprises DSDMA a little less than the NMR demonstration.In contrast, more be subject to the undersaturated lipid formulations that HII forms influence mutually, cause the significant silence of luciferase genes.In addition, reticent degree forms the H that merges corresponding to every kind of cation lipid _IIThe tendency of phase.DLinDMA, the confluent lipid of tool with minimum apparent transformation temperature in the time of in being combined in SNALP, produces maximum knocking down, and wherein luciferase expression only is 21% of a untreated control.Follow by DLenDMA preparation (32%) and DODMA (54%).As viewed at the H that knocks down efficient and cation lipid _IITwo kinds of parameters of the prompting of dependency closely between the formation ability mutually are related.

Embodiment 8: the SNALP that comprises undersaturated cation lipid shows the active for gene silencing that increases

Having assessed every kind the SNALP that comprises four kinds of cation lipids (that is, DSDMA, DODMA, DLinDMA, and DLenDMA) influences the ability of gene silencing in the Neuro2A of stable transfection cell.Handle by stable transfection with the SNALP of siRNA that comprises anti--luciferase and to reach 48 hours with the Neuro2A cell of expressing luciferase.Through the efficient that compares luciferase activity remaining in these cells and remaining luciferase activity is assessed gene silencing in the cell that the contrast SNALP with the siRNA that comprises mispairing handles.

Like hypothesis, find to knock down efficient forms confluent reverse hexagon phase corresponding to lipid ability.The preparation that comprises saturated lipid DSDMA confirms not have activity.Like the unsaturated increase in the lipid alkyl chain, the RNA interference capability also increases, and wherein the DLinDMA particle produces 80% knock down in genetic expression. ³¹P-NMR confirms that DLinDMA has minimum transformation temperature and therefore in said series, is the confluent lipid of tool.Comprise DLenDMA, the particle of least saturated lipid, with comprise DLinDMA those compare, validity is low slightly.Through t check find all results have significance (P on the siRNA concentration of 0.5 μ g/mL 0.05, on the siRNA concentration of 1.0 μ g/mL, P 0.01).Error bars is represented standard deviation, n=3.The result is presented among Fig. 7.

Embodiment 9: various SPLP preparations are to transfection in the body of organ

This embodiment has described such experiment, and said experiment confirm can use the SPLP that comprises 15%DLinDMA to come transfection organ in the body.The SPLP that seals plasmid is applied to the male A/J mouse with Neuro2A tumour, the said plasmid luciferase of under the control of CMV promotor, encoding.Said SPLP has following series preparation:

	Sample description
		A	SPLP-PEG 2000-C-DMA(CHOL:DSPC:DODMA:PEG 2000-C-DMA55:20:15:10mol％)
B	SPLP-PEG 2000DlinDMA(CHOL:DSPC:DlinDMA:PEG 2000-C-DMA55:20:15:10mol％)
		C	SPLP-PEG 750-C-DMA/DODMA(CHOL:DSPC:DODMA:PEG 750-C-DMA55:20:15:10mol％)
D	SPLP-PEG 750-C-DMA/DLinDMA(CHOL:DSPC:DlinDMA:PEG 750-C-DMA55:20:15:10mol％)041mg/ml
		E	SPLP-High?PEG 750-C-DMA(CHOL:DSPC:DODMA:PEG 750-C-DMA50:20:15:15mol％)
F	SPLP-High?PEG 750-C-DMA(CHOL:DSPC:DlinDMA:PEG 750-C-DMA50:20:15:15mol％)
		G	SPLP-DODAC(CHOL:DSPC:DODMA:PEG 2000-C-DMA:DODAC45:20:15:10:10mol％)0.35mg/ml

After the SPLP intravenous administration 48 hours, the assessment luciferase genes was expressed in liver, lung, spleen, heart and tumour.Said result is shown among Fig. 8.

Embodiment 10: with transfection tumour in the other SPLP preparation body

This embodiment has described such experiment, and it has shown with SPLP organ is carried out transfection in the body, and said SPLP comprises the PEG-C-DMA of DLinDMA or DODMA and different ratios (15%, 10%, 5%, or 2.5%).The SPLP of the plasmid of sealing the coding luciferase is applied in the male A/J mouse with Neuro2A tumour.Said SPLP has following series preparation:

	Mol％(DSPC：Chol：PEG-C-DMA：DXDMA
		A	20：50：15：15(DODMA)
B	20：55：10：15(DODMA)
		C	20：60：5：15(DODMA)
D	20：62.5：2.5：15(DODMA)
		E	20：55：10：15(DLinDMA)
F	20：60：5：15(DLinDMA)
		G	20：62.5：2.5：15(DLinDMA)

Behind intravenous administration SPLP 48 hours, the assessment luciferase genes was expressed in tumour.The result is shown among Fig. 9.

Embodiment 11: the blood clearance that comprises the lipid vesicle of PEG-C-DMA

This embodiment has described such experiment, carries out the blood clearance that the lipid vesicle of the PEG-C-DMA that comprises different weight percentage is assessed in said experiment.With dosage in the azygos vein ³The SPLP of H-CHE-mark, SNALP, or unloaded vesicle is applied to male A/J mouse.SPLP comprises cation lipid DODMA, and SNALP comprises cation lipid DLinDMA.Said lipid vesicle has following series preparation:

Group	Handle	Mol% (DSPC:Chol:PEG-C-DMA: cation lipid)
			A	Empty vesicle	20:48:2:30
B	SNALP(DlinDMA，PEG-C-DMA)	20:48:2:30
			C	SNALP(DlinDMA，PEG-C-DMA)	20:55:5:20
D	SPLP(15mol％PEG-C-DMA)	20:50:15:15
			E	SPLP(10mol％PEG-C-DMA)	20:55:10:15
F	SPLP(5mol％PEG-C-DMA)	20:60:5:15

³The SPLP of H-CHE-mark, SNALP, or empty vesicle uses the back after 1,2,4 and 24 hours, confirms the per-cent of the ID of the lipid vesicle of remnants in the blood plasma of mouse.Said result is shown among Figure 10.

Embodiment 12: the bio distribution that comprises the lipid vesicle of PEG-C-DMA

This embodiment has described such experiment, carries out the bio distribution that the lipid vesicle of the PEG-C-DMA that comprises different weight percentage is assessed in said experiment.With dosage in the azygos vein ³The SPLP of H-CHE-mark, SNALP, or empty vesicle is applied to the male A/J mouse with Neuro2A tumour.SPLP comprises cation lipid DODMA, and SNALP comprises cation lipid DLinDMA.Said lipid vesicle has following series preparation:

Group		Mol% (DSPC:Chol:PEG-C-DMA: cation lipid)
			A	Empty vesicle	20:48:2:30
B	SNALP(DlinDMA，PEG-C-DMA)	20:48:2:30
			C	SNALP(DlinDMA，PEG-C-DMA)	20:55:5:20
D	SPLP(15mol％PEG-C-DMA)	20:50:15:15
			E	SPLP(10mol％PEG-C-DMA)	20:55:10:15
F	SPLP(5mol％PEG-C-DMA)	20:60:5:15

³The vesicle of H-CHE-mark was used back 48 hours, the per-cent of the ID of assessment lipid vesicle in liver, spleen, lung and the tumour of mouse.Said result is shown among Figure 11.

Embodiment 13: in the far-end tumour, make genetic expression reticent

This embodiment has described such experiment, shown in the experiment be presented at use SNALP after, the gene silencing in the far-end tumour, said SNALP comprise DLinDMA and seal anti--luciferase siRNA sequence.

Produce the Neuro2A-G cell with plasmid stable transfection Neuro2A cell, the said plasmid luciferase of under the control of CMV promotor (pLO55), encoding.Inoculate male A/J mouse with the Neuro2A-G cell.The SNALP intravenous administration that to seal anti--luciferase siRNA sequence (that is, siRNA comprises the dna sequence dna that following sequence: GAUUAUGUCCGGUUAUGUAUU and target are complementary to GATTATGTCCGGTTATGTATT) is in the A/J mouse with Neuro2A-G tumour.Said SNALP preparation is following:

Group	Handle	Mol％(DSPC:Chol:PEG-C-DMA：DLinDMA)
			A	Anti-luciferase SNALP	20:48:2:30
B	Contrast (reverse sequence) SNALP	20:48:2:30
			C	Anti-luciferase SNALP	20:55:5:20
D	Contrast (reverse sequence) SNALP	20:55:5:20
			E	Anti-luciferase SNALP	20:55:10:15
F	Contrast (reverse sequence) SNALP	20:55:10:15

After using SNALP, measured the luciferase genes expression in 48 hours, said SNALP comprises DLinDMA and seals anti--luciferase siRNA sequence.The result is presented among Figure 12.

Embodiment 14: the silence that the outer-gene in the Neuro2A-G tumour cell is expressed

This embodiment has described such experiment, and after said experiment was presented at the SNALP described in contact as the top embodiment 3, the gene silencing in mammalian cell, said SNALP comprised DLinDMA and seal anti-luciferase siRNA sequence.The plasmid stable transfection Neuro2A cell of using the coding luciferase described in top embodiment 3 is to produce the Neuro2A-G cell.Said Neuro2A-G cell contacts with the SNALP preparation and reaches 24 or 48 hours.Said SNALP preparation comprises PEG-C-DLA (C ₁₂) or PEG-C-DMA (C ₁₄) and as follows:

Group	Handle	Mol％(DSPC:Chol:PEG-C-DAA：DLinDMA)
			A	SNALP(PEG-C-DLA)	20:48:2:30
B	SNALP(PEG-C-DLA)	20:45:5:30
			C	SNALP(PEG-C-DLA)	20:40:10:30
D	SNALP(PEG-C-DMA)	20:48:2:30

After with the SNALP contact Neuro2A-G cell of the siRNA sequence of sealing anti--luciferase 24 or 48 hours, measure luciferase genes and express.The result is shown among Figure 13.

Embodiment 15: the silence that the outer-gene in the Neuro2A-G tumour cell is expressed

This embodiment has described such experiment, and after said experiment was presented at the SNALP described in contact as the top embodiment 3, the gene silencing in mammalian cell, said SNALP comprised DLinDMA and seal anti-luciferase siRNA sequence.The plasmid stable transfection Neuro2A cell of using the coding luciferase described in top embodiment 3 is to produce the Neuro2A-G cell.Exist and do not exist under the situation of chloroquine, Neuro2A-G cells contacting SNALP preparation reaches 48 hours.Said SNALP preparation comprises the PEG-C-DMA (C of different weight percentage ₁₄) and DODMA or DLinDMA.Said preparation is following:

Group	Handle	Mol％(DSPC:Chol:PEG-C-DAA：DLinDMA)
			A	PBS	-
B	Naked siRNA	-
			C	SNALP(PEG-C-DMA)	20:40:10:30
D	SNALP(PEG-C-DMA)	20:46:4:30
			E	SNALP(PEG-C-DMA)	20:48:2:30
F	SNALP(PEG-C-DMA)	20:49:1:30

Behind SNALP contact Neuro2A-G cell, measure luciferase genes and reach 48 hours with the siRNA sequence of sealing anti--luciferase.The result is shown among Figure 14.

Embodiment 16: for gene silencing efficient, it is not ratio limiting factor (rate that SNALP absorbs Limiting)

With combining ³The SNALP of the CHE of H-mark measures the degree [Ballyet al., inLiposome Technology, Vol.III, pp.27-41, CRC Press (1993)] that cell absorbs preparation.Handle the Neuro2A cell with the SNALP of CHE that comprises the 3H-mark and reach 24 hours.Measuring ³Before the H-CHE, wash said cell to remove unconjugated SNALP.Absorption is expressed as the per-cent of the gross activity that is applied to cell.The absorption of showed cell increases with the saturated increase of cation lipid.Error bars is represented standard deviation, n=3.The result is shown among Figure 15.

With cellular exposure in the SNALP preparation after 24 hours, the rinsing cell carries out cracking with it, and measures ³H-CHE absorbs (Figure 15).The absorption of each body preparation is independent of the concentration of SNALP, and wherein the DSDMA particle shows farthest absorption.As if the absorption of observing SNALP reduces with saturated minimizing, and said DLenDMA preparation is being limited aspect this especially.Based on the result of gene silencing, find that wherein the validity of DSDMA preparation is minimum, these results are opposite with our expection.Their prompting cells absorb the gene silencing ability that does not limit SNALP, but in the delivery of nucleic acids of SNALP mediation, have vital role by the endosome escape that the fusion event with the endosome film mediates.Find that through the analysis of t-check all results have significance (P < 0.05), except the difference between DODMA and DLinDMA on 0.10,0.50 and 1.00 μ gmL concentration.

Use fluorescently-labeled SNALP further to check absorption process.With the preparation of siRNA that comprises the Cy3-mark Neuro2A-G cell is handled and to be reached 4 hours.After washing and fixing, carried out dye (blueness) with fluorescent marker DAPI pair cell nuclear, to confirm the location (Fig. 6) of fluorescently-labeled siRNA more accurately.With ³The result of H-CHE absorption experiment is consistent, and can observe the DSDMA preparation obviously is the most effective sending siRNA in cell.Cy3 fluorescence (redness) is the strongest in the cell of handling with the SNALP that comprises DSDMA.In addition, consistent with radiolabeled Absorption Study, like the degree of saturation increase of cation lipid, the cell of the siRNA of Cy3 mark absorbs to be increased.In addition, for the DLenDMA preparation, Cy3 fluorescence is very faint, shows weak the absorption.SiRNA or the announcement of unlabelled SNALP processing negative control with naked Cy3-mark do not have cell relevant with Cy3 fluorescence.

To be applied to cell with the SNALP of fluorophore Cy3 mark and its incubation will be reached 4 hours.After washing and fixing, as measured through Cy3 fluorescence, it is saturated relevant with cation lipid that fluorescent microscope shows that siRNA absorbs.Dye with fluorophore DAPI pair cell nuclear.Unlabelled SNALP and naked Cy3-siRNA are used as negative control.

Study the interesting observations (Fig. 5) of the further generation of efficient that SNALP absorbs through the mark of binding radioactivity mark.Possibly be contemplated that the SNALP absorption will be relevant with the pKa of cation lipid composition; The particle of the more positive charges of band has bigger affinity for electronegative cell surface, has bigger absorption subsequently.This hypothesis is not supported by the result of this research.Has the highest pK _aThe preparation that comprises DSDMA of (～7.6) obviously is absorbed the most easily, follows by DODMA and DLinDMA preparation.Making us curious is, when considering these particulate pK _aBe identical, with the specific absorption of DLinDMA preparation than the time, the absorption of DLenDMA preparation is limited.This demonstration is the another kind of characteristics of these lipids, rather than pK _a, influence cell and absorb.This discovery can not be relevant with the difference of granule stability, because time course research confirms that the ratio that the DLenDMA preparation absorbs was constant in 24 hour stage, points out said preparation in tissue culture medium (TCM), to be kept perfectly.

These results suggest, when siRNA that use is sealed, endocytosis is not the ratio limiting factor in the outer-gene silence.In fact, as if the difference in cell absorbs has influence significantly still less to preparation validity.DLinDMA and DLenDMA preparation, although similar on the ability of their inhibition of gene expression, on the degree that they are absorbed by cell, be very different.On the contrary, the DSDMA preparation does not almost have ability for influencing the RNA interference, but is obviously absorbed by cell easily.In case data presentation siRNA by cell internalization, has the incident generation of a maximum effect to the efficient of gene silencing.

In brief, we have synthesized the homologous series thing of the cation lipid of the degree of saturation with increase.We show, when being used to seal and sending siRNA, and the degree affect lipid pKa that cation lipid is saturated, amalgamation, cell absorbs and the gene silencing ability.Significantly, having more confluent cation lipid is the more effective medium of RNAi, although they do the time spent in the internalization of mediated cell, efficient reduces.The relative importance that this endosome of having given prominence to the nucleic acid useful load discharges.This knowledge can be used to improve the effect of other lipid nucleic acid delivery system, and should in the delivery system of design for small-molecule drug, be taken into account.

Should be understood that foregoing description is intended to illustrate rather than restrictive.After reading foregoing description, many embodiments will be conspicuous for those skilled in the art.Therefore, scope of the present invention should not be to confirm with reference to foregoing description, but should confirm together with the abundant scope of the Equivalent of being authorized these claims with reference to accompanying Claim.From all purposes, with all articles and reference, comprise patented claim, the content and the Genbank registration number of patent and PCT publication are incorporated this paper into as a reference.

Claims (48)

1. compound with formula I of structure:

Wherein: R ¹And R ²Be C ₁-C ₃Alkyl; With

R ³And R ⁴Be independently selected from the group of forming by alkyl, wherein R with 10 to 20 carbon atoms ³And R ⁴The two all comprises at least two unsaturated sites and is selected from the group of being made up of following: 12 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base, 20 carbon dialkylenes, 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

2. according to the compound of claim 1, R wherein ³And R ⁴Be identical.

3. according to the compound of claim 1, R wherein ³And R ⁴Be independently selected from the group of forming by following: 12 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base and 20 carbon dialkylenes.

4. according to the compound of claim 1, R wherein ³And R ⁴It all is inferior oil base.

5. according to the compound of claim 1, R wherein ³And R ⁴All comprise at least three unsaturated sites.

6. according to the compound of claim 1, R wherein ³And R ⁴Be independently selected from the group of forming by following: 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

7. liposome, said liposome comprises the cation lipid of the formula I with structure:

Wherein: R ¹And R ²Be C ₁-C ₃Alkyl; With

R ³And R ⁴Be independently selected from the group of forming by alkyl, wherein R with 10 to 20 carbon atoms ³And R ⁴The two all comprises at least two unsaturated sites and is selected from the group of being made up of following: 12 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base, 20 carbon dialkylenes, 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

8. according to the liposome of claim 7, it also comprises the non-cationic lipid.

9. according to the liposome of claim 8, wherein said non-cationic lipid is the member who is selected from by the following group of forming: DOPE (DOPE), palmityl oleoyl phosphatidylcholine (POPC); Yelkin TTS phatidylcholine (EPC), DSPC (DSPC), palmityl oleoyl POPG (POPG); Two palmityl phosphatidylethanolamines (DPPE), two mnyristoyl phosphorylethanolamines (DMPE), distearyl-phosphatidyl-thanomin (DSPE); 16-O-monomethyl PE; 16-O-dimethyl-PE, the trans PE of 18-1-, palmityl oleoyl-phosphatidylethanolamine (POPE); 1-stearyl-2-oleoyl-phosphatidylethanolamine (SOPE), SUV and composition thereof.

10. according to the liposome of claim 7, it also comprises the PEG-lipid.

11. liposome according to claim 10; Wherein said PEG-lipid is selected from the group of being made up of following: polyoxyethylene glycol-DG (PEG-DAG) conjugate; Polyoxyethylene glycol-dialkoxy propyl group (PEG-DAA) conjugate, PEG-ceramide, PEG-PE and composition thereof.

12. according to the liposome of claim 7, it also comprises biologically active agent.

13. according to the liposome of claim 12, wherein said biologically active agent is the member who is selected from by the following group of forming: antitumour drug, microbiotic, immunomodulator, antiphlogistic drug and act on medicament, polypeptide and the nucleic acid on the cns.

14. the liposome of claim 7 is used for biologically active agent is delivered to the application in the reagent of cell in preparation, said liposome is used for and said cells contacting, and wherein said biologically active agent is encapsulated in the said liposome.

15. the application of claim 14, wherein said cell is in Mammals.

16. a nucleic acid-lipid granule, it comprises:

(a) nucleic acid;

(b) formula I's and cation lipid with structure:

Wherein:

R ¹And R ²Be C ₁-C ₃Alkyl; With

R ³And R ⁴Be independently selected from the group of forming by alkyl, wherein R with 10 to 20 carbon atoms ³And R ⁴The two all comprises at least two unsaturated sites and is selected from the group of being made up of following: 12 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base, 20 carbon dialkylenes, 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

(c) non-cationic lipid; With

(d) PEG-lipid conjugates.

17. nucleic acid-lipid granule according to claim 16; Wherein said cation lipid is selected from the group of being made up of following: 1, and 2-two inferior oil base oxygen base-N, N-dimethylaminopropanecompounds (DLinDMA) and 1; 2-two flax base oxygen base-N, N-dimethylaminopropanecompounds (DLenDMA).

18. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is DLinDMA.

19. according to the nucleic acid-lipid granule of claim 16, wherein said non-cationic lipid is the member who is selected from by the following group of forming: DOPE (DOPE), palmityl oleoyl phosphatidylcholine (POPC); Yelkin TTS phatidylcholine (EPC), DSPC (DSPC), palmityl oleoyl POPG (POPG); Two palmityl phosphatidylethanolamines (DPPE), two mnyristoyl phosphorylethanolamines (DMPE), distearyl-phosphatidyl-thanomin (DSPE); 16-O-monomethyl PE; 16-O-dimethyl-PE, the trans PE of 18-1-, palmityl oleoyl-phosphatidylethanolamine (POPE); 1-stearyl-2-oleoyl-phosphatidylethanolamine (SOPE), SUV and composition thereof.

20. according to the nucleic acid-lipid granule of claim 16, wherein said non-cationic lipid is DSPC.

21. nucleic acid-lipid granule according to claim 16; Wherein said PEG-lipid is the member who is selected from by the following group of forming: polyoxyethylene glycol-DG (PEG-DAG) conjugate; Polyoxyethylene glycol-dialkoxy propyl group (PEG-DAA) conjugate; The PEG-ceramide, PEG-PE and composition thereof.

22. according to the nucleic acid-lipid granule of claim 16, wherein said PEG-lipid is the PEG-DAA conjugate.

23. according to the nucleic acid-lipid granule of claim 22, wherein said PEG-DAA conjugate is a PEG-myristyl oxygen base propyl group.

24. according to the nucleic acid-lipid granule of claim 16, it also comprises sterol.

25. according to the nucleic acid-lipid granule of claim 24, wherein said sterol is a SUV.

26. according to the nucleic acid-lipid granule of claim 16, wherein said nucleic acid is the member who is selected from by the following group of forming: DNA, RNA, siRNA, plasmid, antisense oligonucleotide, ribozyme.

27. according to the nucleic acid-lipid granule of claim 16, wherein said nucleic acid encoding goal treatment property product.

28. according to the nucleic acid-lipid granule of claim 27, wherein said goal treatment property product is the member who is selected from by the following group of forming: polypeptide and little RNA interfering (siRNA).

29. according to the nucleic acid-lipid granule of claim 16, wherein the nucleic acid in said nucleic acid-lipid granule said particle in 37 ℃ be exposed to nucleicacidase and reach 20 minutes after, be not degraded.

30. according to the nucleic acid-lipid granule of claim 16, wherein said nucleic acid fully is encapsulated in said nucleic acid-lipid granule.

31. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is formed in 2% to 60% of the TL that exists in the said particle.

32. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is formed in 5% to 45% of the TL that exists in the said particle.

33. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is formed in 15% to 40% of the TL that exists in the said particle.

34. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is formed in 30% of the TL that exists in the said particle.

35. according to the nucleic acid-lipid granule of claim 16, wherein said cation lipid is formed in 40% to 50% of the TL that exists in the said particle.

36. according to the nucleic acid-lipid granule of claim 16, wherein said non-cationic lipid is formed in 5% to 90% of the TL that exists in the said particle.

37. according to the nucleic acid-lipid granule of claim 16, wherein said non-cationic lipid is formed in 20% to 85% of the TL that exists in the said particle.

38. according to the nucleic acid-lipid granule of claim 16, wherein said PEG-lipid is formed in 1% to 20% of the TL that exists in the said particle.

39. according to the nucleic acid-lipid granule of claim 16, wherein said PEG-lipid is formed in 4% to 15% of the TL that exists in the said particle.

40. according to the nucleic acid-lipid granule of claim 24, wherein said sterol is formed in 10% to 60% of the TL that exists in the said particle.

41. according to the nucleic acid-lipid granule of claim 24, wherein said sterol is formed in 20 to 45% of the TL that exists in the said particle.

42. a pharmaceutical composition, it comprises according to the nucleic acid-lipid granule of claim 16 and pharmaceutical carrier.

43. nucleic acid-lipid granule is used for nucleic acid is introduced the application of the reagent of cell in preparation, said nucleic acid-lipid granule is used for and said cells contacting, and said nucleic acid-lipid granule comprises:

(a) formula I's and cation lipid with structure:

Wherein:

R ¹And R ²Be C ₁-C ₃Alkyl; With

R ³And R ⁴Be independently selected from the group of forming by alkyl, wherein R with 10 to 20 carbon atoms ³And R ⁴The two all comprises at least two unsaturated sites and is selected from the group of being made up of following: 12 carbon dialkylenes, 16 carbon dialkylenes, inferior oil base, 20 carbon dialkylenes, 12 carbon trialkenyl, 14 carbon trialkenyl, 16 carbon trialkenyl, flax base and 20 carbon trialkenyl.

(b) non-cationic lipid;

(c) PEG-lipid conjugates; With

(d) nucleic acid.

44. according to the compound of claim 1, wherein R ¹And R ²It all is methyl.

45. according to the compound of claim 1, wherein R ³And R ⁴It all is flax base.

46. according to the compound of claim 1, wherein said compound is selected from the group of being made up of following: 1,2-two inferior oil base oxygen base-N, N-dimethylaminopropanecompounds (DLinDMA) and 1,2-two flax base oxygen base-N, N-dimethylaminopropanecompounds (DLenDMA).

47. according to the compound of claim 1, wherein said compound is 1,2-two inferior oil base oxygen base-N, N-dimethylaminopropanecompounds (DLinDMA).

48. according to the compound of claim 1, wherein said compound is 1,2-two flax base oxygen base-N, N-dimethylaminopropanecompounds (DLenDMA).

Images