CN101163713A

CN101163713A - Compound having amino acid residue or peptide residue and process for producing the same

Info

Publication number: CN101163713A
Application number: CNA2006800130174A
Authority: CN
Inventors: 池田寿文; 外崎圆
Original assignee: Credia Japan Co Ltd
Current assignee: Credia Japan Co Ltd
Priority date: 2005-04-22
Filing date: 2006-04-21
Publication date: 2008-04-16

Abstract

A compound having a structure which comprises a backbone and, bonded thereto, a side chain having an amino acid or oligopeptide. The compound is represented by the following general formula (1). [Chemical formula 1] (1) [In the formula (1), n1 to n3 and m1 to m6 each is a given integer; Y represents hydroxy or amino; E represents N or CH; R represents an amino acid residue or a peptide residue comprising 2-100 amino acid residues; and L represents hydrogen, a group having a lipid group, a group having a fatty acid residue, or a group having a fluorescent group.

Description

Has compound of amino-acid residue or peptide residue and preparation method thereof

Technical field

The functional compound that the present invention relates to have amino-acid residue or peptide residue and can effectively show this residue.The invention still further relates to the preparation method of above-claimed cpd.

Background technology

Known amino acid or oligopeptides have various useful effects according to its kind.For example, known arginine and oligopeptides thereof have the effect of permeate through cell membranes, and it is useful that known its conduct is used for the reagent in the target compound transfered cell.In addition, also known and independent use amino acid or oligopeptides are compared, and using can be favourable at the aspects such as raising of the enhancing of desired effect, security with their a plurality of bonded compounds.

But for the compound that contains amino acid or oligopeptides, the also not mentioned up to now side chain with amino acid or oligopeptides is incorporated into the compound of the structure of main chain.

Summary of the invention

The purpose of this invention is to provide compound that the side chain with amino acid or oligopeptides is incorporated into the structure of main chain, with the above-claimed cpd of protecting group protection and the preparation method of these compounds.

The invention provides following general formula (1) and (1a) shown in compound and the preparation method of these compounds.

The 1st. the compound shown in the following general formula (1):

[in the formula (1), n1 represents 0～10 integer, and n2 represents 1～50 integer, and n3 represents 1～10 integer; M1 represents 0～100 integer, and m2 represents 0～100 integer, and m3 represents 0～100 integer, and m4 represents 0 or 1 integer, and m5 represents 0～100 integer, and m6 represents 0～100 integer;

Y represents hydroxyl or amino;

E represents N or CH;

R represents amino-acid residue or the peptide residue that is made of 2～100 amino-acid residues;

L represents hydrogen atom, have the group of lipid base, have the group of fatty acid residue or have the group of fluorescence group;

N1 is 2 when above, and the m1 among the repeating unit A can be the same or different between each repeating unit A;

N2 is 2 when above, and m2～m5 among the repeating unit B and R can be the same or different between each repeating unit B;

N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C.]

The 2nd. the 1st described compound, in the formula (1), L is the group with phosphatide base.

The 3rd. the 1st described compound, in the formula (1), R is the amino-acid residue that is selected from arginine residues, lysine residue and the serine residue, or contains at least a kind peptide residue in these amino-acid residues.

The 4th. the 1st described compound, in the formula (1), R is a peptide residue, this peptide residue by be selected from that the amino-acid residue more than a kind or 2 kinds in arginine residues, lysine residue and the serine residue constitutes and amino-acid residue add up to 2～20.

The 5th. the 1st described compound, in the formula (1), the peptide residue of R for constituting by 2～5 arginine residues.

The 6th. the 1st described compound, in the formula (1), n1 is 0～2 integer, and n2 is 1～10 integer, and n3 is 0～2 integer.

The 7th. the 1st described compound, in the formula (1), E is N, and m2 is 2, and m3 and m4 are 1, and m5 is 5.

The 8th. the 1st described compound, in the formula (1), E is CH, and m2, m3 and m4 are 0, and m5 is 4.

The 9th. the compound shown in the following general formula (1a):

[n1～n3, m1～m6, E and R are same as described above,

Y represents hydroxyl;

X represents protecting group;

Z represents protecting group Za different with protecting group X or the protecting group Zb identical with protecting group X;

RZ represents to be combined with protecting group Z in the functional group of the amino-acid residue of above-mentioned R or peptide residue;

N2 is 2 when above, and m2～m5 among the repeating unit B and RZ can be the same or different between each repeating unit B;

The 10th. the 9th described compound, in the formula (1a), X is tertbutyloxycarbonyl or 9-fluorenylmethyloxycarbonyl.

The 11st. the 9th described compound, in the formula (1a), R is the amino-acid residue that is selected from arginine residues, lysine residue and the serine residue, or for containing 2～20 the peptide residue of ading up to of in these amino-acid residues at least a kind and amino-acid residue.

The 12nd. the 9th described compound, in the formula (1a), R is a peptide residue, this peptide residue by be selected from that the amino-acid residue more than a kind or 2 kinds in arginine residues, lysine residue and the serine residue constitutes and amino-acid residue add up to 2～20.

The 13rd. the 9th described compound, in the formula (1a), the peptide residue of R for constituting by 2～5 arginine residues.

The 14th. the 9th described compound, in the formula (1a), n1 is 0～2 integer, and n2 is 1～10 integer, and n3 is 0～2 integer.

The 15th. the 9th described compound, in the formula (1a), E is N, and m2 is 2, and m3 and m4 are 1, and m5 is 5.

The 16th. the 9th described compound, in the formula (1a), E is CH, and m2, m3 and m4 are 0, and m5 is 4.

The 17th. complex chemical compound, synthesize by above-mentioned the 9th described compound and the condensation reaction with compound of amino or hydroxyl.

The 18th. the 17th described complex chemical compound, wherein, having amino compound is PNA monomer or PNA oligomer.

The 19th. the preparation method of the compound shown in the following general formula (1), it comprises following 1-1 operation～the 1st～5 operation:

[in the formula (1), n1 represents 0～10 integer, and n2 represents 1～50 integer, and n3 represents 1～10 integer; M1 represents 0～100 integer, and m2 represents 0～100 integer, and m3 represents 0～100 integer, and m4 represents 0 or 1 integer, and m5 represents 0～100 integer, and m6 represents 0～100 integer; Y represents hydroxyl or amino; E represents N or CH; R represents amino-acid residue or the peptide residue that is made of 2～100 amino-acid residues; L represents hydrogen atom, have the group of lipid, have the group of fatty acid residue or have the group of fluorescence group; N1 is 2 when above, and the m1 among the repeating unit A can be the same or different between each repeating unit A; N2 is 2 when above, and m2～m5 among the repeating unit B and R can be the same or different between each repeating unit B; N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C.]

1-1 operation: make the compound shown in the following general formula (I)

[in the formula (I), m6 is same as described above]

Condensation behind solid-phase resin or solid-phase compound, by carry out n3-1 condensation in the protecting group X of the compound of solid-phase resin or solid-phase compound remove and general formula (I) shown in the polycondensation of compound, obtain the operation of the compound shown in the following general formula (i);

[in the formula (i), n3, m6 and X are same as described above." solid phase " expression solid-phase resin or solid-phase compound]

1-2 operation: carry out the compound shown in n2 the following general formula (II) by the compound shown in the mutual-through type (i)

[in the formula (II), m2～m5 and X are same as described above.Za represents the protecting group different with X.]

Condensation reaction, obtain the operation of the compound of following general formula shown in (ii)

[formula (ii) in, n2, n3, m2～m6, X, Za and " solid phase " are same as described above];

1-3 operation: carry out the compound shown in n1 the following general formula (III) by the compound of mutual-through type shown in (ii)

[in the formula (III), m1 and X are same as described above]

Condensation reaction, obtain the operation of the compound of following general formula shown in (iii)

[formula (iii) in, n1～n3, m1～m6, X, Za and " solid phase " are same as described above];

1-4 operation: carry out in the functional group beyond the carboxyl that is incorporated into α position carbon atom, being combined with for 1～100 time the amino acid whose condensation reaction of protecting group Za by the compound of mutual-through type shown in (iii), obtain the operation of the compound of following general formula shown in (iv)

[formula (iv) in, n1～n3, m1～m6, X, RZa and " solid phase " are same as described above];

The 1-5 operation: from the compound excision solid-phase resin of general formula shown in (iv) or solid-phase compound and endways formation-COOH or-CONH ₂, and remove protecting group X and Za, thus the operation of the compound shown in the general formula (1) obtained.

The 20th. the preparation method of the compound shown in the following general formula (1a), it comprises following 3-1 operation～3-5 operation:

[n1～n3, m1～m6, E, X and RZ are same as described above; Y is a hydroxyl; N1 is 2 when above, and the m1 among the repeating unit A can be the same or different between each repeating unit A; N2 is 2 when above, and m2～m5 among the repeating unit B and RZ can be the same or different between each repeating unit B; N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C];

3-1 operation: make the compound shown in the following general formula (I)

[in the formula (I), m6 is same as described above]

Polycondensation is after having amino solid-phase resin or solid-phase compound; by carrying out n3-1 polycondensation removing and, obtain the operation of the compound shown in the following general formula (i) in the protecting group X of the compound of solid-phase resin or solid-phase compound with the polycondensation of the compound shown in the general formula (I)

[in the formula (i), n3, m6 and X are same as described above." solid phase " expression solid-phase resin or solid-phase compound];

3-2 operation: carry out the compound shown in n2 the following general formula (II) by the compound shown in the mutual-through type (i)

[in the formula (II), m2～m5, X and Za are same as described above]

3-3 operation: carry out the compound shown in n1 the following general formula (III) by the compound of mutual-through type shown in (ii)

[in the formula (III), m1 and X are same as described above]

3-4 operation: carry out on amino, being combined with for 1～100 time the amino acid whose condensation reaction of protecting group Z by the compound of mutual-through type shown in (iii), obtain the operation of the compound of following general formula shown in (iv)

The 3-5 operation: as required with general formula (iv) shown in the protecting group Za of compound be replaced into protecting group Zb; under the state that keeps protecting group X and Z; excision solid-phase resin or solid-phase compound, formation-COOH endways obtains the operation of the compound shown in the general formula (1a) thus.

Below, in this manual, so-called " film perviousness " is meant the characteristic of permeate through cell membranes.

Description of drawings

[Fig. 1] Fig. 1 is the figure of experimental result (detecting the result of bcl-2 protein expression by Western blotting) in the expression reference experiment example 4.Among the figure, the corresponding following content of each swimming lane:

Swimming lane 1: negative control swimming lane;

The importing of the corresponding siRNA of swimming lane 2:bcl-2 (addition 45pmpl/well): XtremeGene;

The importing of the corresponding siRNA of swimming lane 3:bcl-2 (addition 90pmpl/well): XtremeGene;

The importing of the corresponding siRNA of swimming lane 4:GFP (addition 42.5pmpl/well): the nucleic acid of reference example 3 imports uses carrier;

The importing of the corresponding siRNA of swimming lane 5:bcl-2 (addition 13.5pmpl/well): the nucleic acid of reference example 3 imports uses carrier;

The importing of the corresponding siRNA of swimming lane 6:bcl-2 (addition 45pmpl/well): the nucleic acid of reference example 3 imports uses carrier;

The importing of the corresponding siRNA of swimming lane 7:bcl-2 (addition 135pmpl/well): the nucleic acid of reference example 3 imports uses carrier;

The importing of the corresponding siRNA of swimming lane 8:bcl-2 (addition 225pmpl/well): the nucleic acid of reference example 3 imports uses carrier;

The importing of the corresponding siRNA of swimming lane 9:bcl-2 (addition 450pmpl/well): the nucleic acid of reference example 3 imports uses carrier.

Embodiment

1. the compound shown in the general formula (1)

Be incorporated into the compound of the structure of main chain as side chain, the compound shown in the following general formula (1) is provided with amino acid or oligopeptides.

In the formula (1), n1 represents the number of repeating unit A, the integer of expression 0～10, preferred 0～5 integer, more preferably 0～2 integer.

Among the repeating unit A, m1 represents 0～100 integer, preferred 0～30 integer, more preferably 0～11 integer.N1 be more than 2 integer, be that repeating unit A is 2 when above, between each repeating unit A, m1 can be the same or different.

In addition, in the formula (1), n2 represents the number of repeating unit B, the integer of expression 1～50, preferred 1～20 integer, more preferably 1～10 integer.

Among the repeating unit B, m2 represents 0～100 integer, preferred 0～20 integer, more preferably 0～2 integer.M3 represents 0～100 integer, preferred 0～20 integer, more preferably 0～2 integer.M4 represents 0 or 1 integer.M5 represents 0～100 integer, preferred 0～30 integer, more preferably 0～11 integer.

In addition, among the repeating unit B, E represents N or CH.In repeating unit B, when E was N, preferably enumerating m2 was 0～2, is preferably 2; M3 is 0～1, is preferably 1; M4 is 1; M5 is 0～11, is preferably 5 compound.In addition, in repeating unit B, when E was CH, preferably enumerating m2 was 0～2, is preferably 0; M3 is 0～1, is preferably 0; M4 is 0; M5 is 0～11, is preferably 5 compound.

Among the repeating unit B, R represents amino-acid residue or the peptide residue that is made of 2～100 amino-acid residues.Among the R, as amino-acid residue, can be natural amino acid residue or alpha-non-natural amino acid residue arbitrarily, there is no particular restriction.From making the compound shown in the general formula (1) possess the viewpoint of film perviousness, be preferably arginine residues, lysine residue and serine residue, more preferably arginine residues.

In addition, among the R, for peptide residue, so long as by getting final product that 2～100 amino-acid residues constitute, there is no particular restriction to this kind that constitutes amino-acid residue.As an example of this peptide residue, possess the viewpoint of film perviousness from making the compound shown in the general formula (1), can enumerate peptide residue with amino-acid residue of at least a kind in the arginine residues of being selected from, lysine residue and the serine residue; Preferred only with arginine residues, lysine residue and serine residue peptide residue as the formation amino-acid residue; Preferred especially only with arginine residues and/or lysine residue as the peptide residue that constitutes amino-acid residue.

In addition, in this peptide residue, when containing lysine residue as the formation amino-acid residue, any or these the two kinds of amino in the α position of Methionin or the amino of ε position can constitute peptide bond with the amino acid whose carboxyl of adjacency.

As the number of the amino-acid residue that constitutes peptide residue, can enumerate preferred 2～50, more preferably 2～20, further preferred 2～5, preferred especially 2～3.

As an example of the preferred form of R, can enumerate the peptide residue that constitutes by 2～5 arginine residues, as more preferred example, can enumerate the tri-arginine residue that constitutes by 3 arginine residues.By having this peptide residue, the compound shown in the general formula (1) can possess more excellent film perviousness.

In repeating unit B, amino-acid residue or peptide residue be, the amino of the amino acid whose carboxyl of the formation of C-terminal side and the side chain of repeating unit combines in the mode of dehydrating condensation.That is, the amino-acid residue of R or peptide residue are equivalent to the group that the OH of the amino acid whose carboxyl of formation of the C-terminal side of amino acid or peptide is removed.

Among the repeating unit B, m2 be more than 2 integer, be that repeating unit B is 2 when above, between each repeating unit B, m2～m5 and R can be the same or different.

In the formula (1), n3 represents the number of repeating unit C, the integer of expression 0～10, preferred 0～5 integer, more preferably 0～2 integer.

Among the repeating unit C, m6 represents 0～100 integer, preferred 0～30 integer, more preferably 0～11 integer.N3 be more than 2 integer, be that repeating unit C is 2 when above, between each repeating unit C, m6 can be the same or different.

As the object lesson of n1～n3 in the formula (1), can enumerate n1 and be 0～2 integer, n2 and be 1～10 integer and n3 and be 0～2 integer, preferred especially n1 is that 1 or 2 integer, n2 are that 4～6 integer and n3 are 1 or 2 integer.

In formula (1), Y represents hydroxyl or amino.

In formula (1), L represents hydrogen atom, have the group of lipid, have the group of fatty acid residue or have the group of fluorescence group.

There is no particular restriction as the formation lipid of the group with lipid base, can enumerate phosphatide such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylinositols, sphingophospholipid, sphingosine, ceramide, plasmalogen, phosphatidyl glycerol, phosphatidic acid; Glyceroglycolipids such as galactosyl diglyceride, 6-sulfo-quinovose triglyceride; Sphingoglycolipids such as galactocerebroside; Steroid; Prostaglandin(PG) etc.In these, preferred phosphatide preferredly can be enumerated phosphatidylethanolamine, and there is no particular restriction as the fatty acid residue that constitutes these lipid bases, can enumerate the saturated or unsaturated fatty acids residue of carbonatoms 4～30 (preferred 12～20).As this fatty acid residue, specifically can enumerate lauroyl, tetradecanoyl, hexadecanoyl, octadecanoyl, oleoyl, inferior oleoyl etc.In this fatty acid residue, as preferably enumerating hexadecanoyl and oleoyl.

Group with lipid base can be the basic body of lipid, also can be to be combined with the group that connects base on the lipid base.As connecting base, use for example following (a) and (b) shown in the group of structure.

-CO-(CH ₂) _i-CO- (a)

-O(CH ₂CH ₂O) _j- (b)

I represents 1～20, preferred 1～8 integer; J represents 1～1000, preferred 1～21 integer.

Specifically, as being combined with the group that connects base on the lipid base, when the formation lipid has amino, can enumerate with the group shown in the following formula (L1); When the formation lipid has carboxyl, can enumerate with the group shown in the following formula (L2).

-CO-(CH ₂) _i-CO- (L1)

-O(CH ₂CH ₂O) _j- (L2)

Formula (L1) and (L2) in, i and j are same as described above.

In addition, the group with lipid base can be the group that is combined with above lipid base.

In addition, among the L,, can be fatty acid residue itself as group with fatty acid residue, also can be to be combined with the group that connects base on the fatty acid residue.At this, so-called fatty acid residue is meant the removed group of OH of the carboxyl of lipid acid.As fatty acid residue, specifically can enumerate the saturated or unsaturated fatty acids residue of carbonatoms 4～30 (preferred 12～20).As this fatty acid residue, specifically can enumerate lauroyl, tetradecanoyl, hexadecanoyl, octadecanoyl, oleoyl, inferior oleoyl etc.In this fatty acid residue, as preferably enumerating hexadecanoyl and oleoyl.

In addition, be combined with the group that connects base on the fatty acid residue, connect base as this, use above-mentioned (a) and (b) shown in the group of structure.Specifically, as being combined with the group that connects base on the fatty acid residue, can enumerate the group shown in the following formula (L3).

-O(CH ₂CH ₂O) _j- (L3)

In the formula (L3), j is same as described above.

In addition, having the group of fatty acid residue, can be the group that is combined with (for example 2～8, preferred 2～4) fatty acid residue more than 2.As the group that is combined with 2 above fatty acid residues, specifically can enumerate group shown below.

In addition, among the L,, can be fluorescence group itself as group with fluorescence group, also can be to be combined with the group that connects base on the lipid base.So-called fluorescence group is meant the group with character of sending fluorescence.Can use known fluorescent chemicals as the fluorescence group.As an example of fluorescence group, can enumerate the group of following structure.

In addition, be combined with the group that connects base on the fatty acid residue, connect base as this, use above-mentioned (a) and (b) shown in the group of structure.

In formula (1), L is when having the group of lipid base or having the group of fatty acid residue, can improve the compound shown in the general formula (1) the film perviousness, with the compatibility of oiliness composition.

In addition, in formula (1), L is when having the group of fluorescence group, the compound shown in can fluorescent mark general formula (1), thereby can detect this compound by having or not of fluorescence.

2. the compound shown in the general formula (1a)

Be incorporated into the compound of the structure of main chain as side chain, the compound shown in the following general formula (1a) also is provided with amino acid or oligopeptides.

In the formula (1a), n1～n3, m1～m6, E and R are same as described above.

In the formula (1a), Y represents hydroxyl.

In the formula (1a), X represents protecting group.In addition, in the formula (1a), Z represents protecting group different with protecting group X (being designated as protecting group Za) or the protecting group (be designated as protecting group Zb) identical with protecting group X.At this; so-called protecting group; be meant the combination base of protecting in the specific region that constitutes the compound shown in the general formula (1a); so that it can not be subjected to by other the group that constitutes the caused influences of reaction such as oxidation in the zone, reduction, hydrolysis, condensation of this compound, and this group can remove under defined terms and is replaced into hydrogen atom, hydroxyl.As protecting group, specifically, representational is tertbutyloxycarbonyl (Boc yl) or 9-fluorenylmethyloxycarbonyl (Fmoc yl), in addition also can enumerate protecting group shown below.As protecting group X, be preferably Boc base or Fmoc base.As protecting group R, be preferably the protecting group (protecting group Za) different with protecting group X.

Particularly when protecting group X was Boc base or Fmoc base, preferred protecting group R was an Aloc base as follows.

In the formula (1a), so-called RZ represents to be combined with protecting group Z in the functional group of the amino-acid residue of above-mentioned R or peptide residue.In addition, in the amino-acid residue or peptide residue of above-mentioned R, when having 2 above functional groups, being incorporated into the protecting group Z of each functional group, can be protecting group of the same race, also can be different types of protecting group.As the functional group of amino-acid residue or peptide residue, can enumerate amino, carboxyl, guanidine radicals, imidazolyl, thiol group etc.

In addition, n2 be more than 2 integer, be that repeating unit B is 2 between each repeating unit B, RZ can be identical when above, also can be different.

In the compound shown in the general formula (1a), all functional groups protect with protecting group X and Z, and have free carboxy at the end of repeating unit C.Therefore, the compound shown in the general formula (1a) can easily carry out condensation reaction with the target compound with amino or hydroxyl, thereby becomes the complex chemical compound that the compound shown in the general formula (1a) combines with target compound.Therefore, by using the compound shown in the general formula (1a), can make repeating unit A, B and C easily be incorporated into target compound as raw material.In addition, be replaced into hydrogen atom, can make the compound shown in the above-mentioned general formula (1) by protecting group with the compound shown in the general formula (1a).

As the target compound that becomes the compound shown in the general formula (1a),,, can enumerate PNA (peptide nucleic acid(PNA)) oligomer, PNA monomer, peptide, lipid, lipid acid etc. as object lesson as long as have amino or hydroxyl just is not particularly limited in conjunction with object.

For example, as following reaction formula (15) until (17), or reaction formula (18) is until shown in (19), the compound shown in the general formula (1a) by via and PNA monomer or PNA oligomer between condensation reaction, can prepare the PNA monomer or the PNA oligomer that have repeating unit A, B and C efficiently.

[Fmoc-[......]-OH represents that the protecting group X in the general formula (1a) is the compound of Fmoc, and B represents nucleic acid bases such as VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine, and Bhoc represents the protecting group beyond the Fmoc.Q is more than 1, preferred 1～50 integer.]

[Boc-[......]-OH represents that the protecting group X in the general formula (1a) is the compound of Boc, and B represents nucleic acid bases such as VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine, and Cbz represents the protecting group beyond the Boc.Q is more than 1, preferred 1～50 integer.]

3. the preparation method of the compound shown in the general formula (1)

Compound the 1st preparation method as shown in the general formula (1) can enumerate the method for carrying out 1-1 operation～1-5 operation shown below successively.For 1-1 operation～1-5 operation, be described in detail each operation.

The 1-1 operation

In the 1-1 operation, use the compound shown in the following general formula (I) and solid-phase resin or solid-phase compound, the compound shown in the synthetic general formula (i).

[changing 30]

[in the formula (I), m6 is same as described above]

Compound shown in the general formula (I) is a known compound or according to the prepared compound of known preparation method.

There is no particular restriction as the solid-phase resin that uses in this operation or solid-phase compound, can enumerate for example MBHA (methyldiphenyl methylamine resin), PAL (peptide amide connector), Oxime (to the nitro benzophenone oxime), PAM (4-hydroxymethyl phenyl ethanamide methyl resin), Merrifield resin etc.

At first, make compound shown in the above-mentioned general formula (I) and solid-phase resin or solid-phase compound carry out condensation reaction.

The condensation reaction of the compound shown in the general formula (I) and solid-phase resin or solid-phase compound with respect to 1 mole of the compound shown in the general formula (I), is normally carried out solid-phase resin or 0.01～100 mole of solid-phase compound, preferred 0.1～10 mole of mixing.

The condensation reaction of the compound shown in the general formula (I) and solid-phase resin or solid-phase compound is carried out in appropriate solvent usually.As solvent, just can not be extensive use of known solvent so long as do not hinder the solvent of reaction.As such solvent, can enumerate for example dimethyl formamide (DMF), N-Methyl pyrrolidone (NMP) etc.

The condensation reaction of the compound shown in the general formula (I) and solid-phase resin or solid-phase compound preferably uses condensing agent and reaction promotor to carry out.As condensing agent, can enumerate for example O-(azo benzotriazole-1-yl)-N, N, N ', N '-tetramethyl-urea  hexafluorophosphate (HATU), O-(benzotriazole-1-yl)-N, N, N ', N '-tetramethyl-urea  hexafluorophosphate (HBTU), hydrochloric acid 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDCI), dicyclohexylcarbodiimide (DCC) etc.As condensing agent, preferably use HATU.In addition,, can enumerate for example N, N-diisopropyl ethyl amine (DIEA), triethylamine (TEA) etc. as reaction promotor.As reaction promotor, preferred DIEA.

The usage quantity of condensing agent, with respect to 1 mole of solid-phase resin or solid-phase compound, condensing agent is generally 0.01～100 mole in total amount, is preferably 0.1～10 mole.

In addition, the usage quantity of above-mentioned reaction promotor, with respect to 1 mole of solid-phase resin or solid-phase compound, condensing agent is generally 0.01～100 mole in total amount, is preferably 0.1～10 mole.

The condensation reaction of the compound shown in the general formula (I) and solid-phase resin or solid-phase compound at 5～80 ℃, preferred 10～30 ℃, was undertaken 0.1～48 hour by stirring usually as required, preferred 0.1～1 hour.

Like this, can obtain making the compound condensation shown in 1 general formula (I) in the compound of the following structure of solid-phase resin or solid-phase compound.Below, the compound note that is incorporated into the state of solid-phase resin or solid-phase compound is done the solid phase binding compounds.

Carry out the removing of protecting group X of the solid phase binding compounds of gained like this.The corresponding method of kind that removes suitable employing and protecting group X of the protecting group X of solid phase binding compounds is carried out.For example, when protecting group X is the Boc base, can be set forth in TFA (trifluoracetic acid) solution (95 volume %TFA/5 volume % m-cresol), handles 0.1～1 hour method down at 10～30 ℃.In addition, when protecting group X is the Fmoc base, can be set forth in the piperidine solution (20 volume % piperidines/80 volume %DMF), handles 0.01～0.5 hour method down at 10～30 ℃.And then, when protecting group X is Alloc, can be set forth in Pd (PPh ₃) ₄In [four (triphenylphosphines) close palladium, 312mg] solution (55 volume % chloroforms/30 volume % acetic acid/15 volume %N-methylmorpholines), 10～30 ℃ of methods of handling 0.1～1 hour down.

Then, removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (I) of protecting group X.The conditions of this condensation reaction etc. are except with solid-phase resin or solid-phase compound and the replacement of solid phase binding compounds, identical with above-mentioned condensation reaction.

By with the removing reaction and removed the solid phase binding compounds of protecting group X and the condensation reaction of the compound shown in the general formula (I) is carried out n3-1 time repeatedly of the protecting group X of above-mentioned solid phase binding compounds, can obtain the compound shown in the general formula (i).

The 1-2 operation

In the 1-2 operation, use compound shown in the general formula (i) that obtains by the 1-1 operation and the compound shown in the following general formula (II), the compound of synthetic following general formula shown in (ii).

In the formula (II), m2～m5, X and Za are same as described above.In addition, the compound shown in the general formula (II) is a known compound or according to the prepared compound of known preparation method.

Formula (ii) in, n2, n3, m2～m6, X, Za and " solid phase " are same as described above.

In the 2nd operation, at first carry out the solid phase binding compounds protecting group X remove reaction.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 1-1 operation.

Then, removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (II) of protecting group X.

Removed the condensation reaction of solid phase binding compounds and the compound shown in the following general formula (II) of protecting group X, can adopt the condition identical with the condensation reaction of above-mentioned 1-1 operation.Specifically, under the condensation reaction condition of above-mentioned 1-1 operation, by solid-phase resin or solid-phase compound and solid phase binding compounds are replaced, and then the compound shown in the general formula (I) is replaced with the compound shown in the general formula (II), carry out the condensation reaction of 1-2 operation.

Carry out n2 time with the condensation reaction total of the compound shown in the general formula (II) by the solid phase binding compounds that removes reaction and removed protecting group X, can obtain the compound of general formula shown in (ii) the protecting group X of above-mentioned solid phase binding compounds.

The 1-3 operation

In the 1-3 operation, use the general formula that obtains by 1-2 operation compound shown in (ii) and the compound shown in the following general formula (III), the compound of synthetic following general formula shown in (iii).

In the formula (III), m1 and X are same as described above.Compound shown in the general formula (III) is a known compound or according to the prepared compound of known preparation method.

Formula (iii) in, n1～n3, m1～m6, X, Za and " solid phase " are same as described above.

In the 1-3 operation, at first carry out the solid phase binding compounds protecting group X remove reaction.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned the 1st operation.

Then, removed the condensation reaction of solid phase binding compounds and the compound shown in the following general formula (III) of protecting group X.

Removed the condensation reaction of solid phase binding compounds and the compound shown in the following general formula (III) of protecting group X, can adopt the condition identical with the condensation reaction of above-mentioned 1-1 operation.Specifically, under the condensation reaction condition of above-mentioned 1-1 operation, by solid-phase resin or solid-phase compound and solid phase binding compounds are replaced, and then the compound shown in the general formula (I) is replaced with the compound shown in the general formula (III), carry out the condensation reaction of 1-3 operation.

Carry out n3 time with the condensation reaction total of the compound shown in the general formula (III) by the solid phase binding compounds that removes reaction and removed protecting group X, can obtain the compound of general formula shown in (iii) the protecting group X of above-mentioned solid phase binding compounds.

The 1-4 operation

In the 1-4 operation, use the general formula that obtains by 1-3 operation compound shown in (iii) and the amino acid that in the functional group beyond the carboxyl that is incorporated into α position carbon atom, is combined with protecting group Za, the compound of synthetic following general formula shown in (iv).

Formula (iv) in, n1～n3, m1～m6, X, RZa and " solid phase " are same as described above.

In addition, the above-mentioned amino acid that uses in this operation can be combined with protecting group Za in the functional group beyond the carboxyl that is incorporated into α position carbon atom.

For example, except the carboxyl that is incorporated into α position carbon atom and amino when not having the amino acid of functional group, can on the amino that is incorporated into α position carbon atom, be combined with protecting group Za.

In addition, for example beyond the carbon atom of α position, be combined with the amino acid of functional group, can in all functional groups beyond the carboxyl that is incorporated into α position carbon atom, be combined with protecting group Za as Methionin, arginine, Serine etc.At this moment, preferred combination is in the protecting group Za of the amino of α position carbon atom, and the protecting group Za with the functional group that is incorporated into α position carbon atom position in addition is respectively different types of protecting group.Like this; when the protecting group Zb that exists on the above-mentioned amino acid more than 2; by adopting different types of protecting group respectively, can the protecting group Za that be incorporated into the amino that uses in the condensation reaction be removed, and make the protecting group Za that is incorporated into other functional groups be in the state of reservation.

In the 1-4 operation, at first carry out being incorporated in the solid phase binding compounds amino that uses in the condensation reaction protecting group Za remove reaction.The method that removes of carrying out protecting group Za identical condition in the time of can adopting with above-mentioned 1-1 operation.

Then, solid phase binding compounds and the above-mentioned amino acid whose condensation reaction of protecting group Za have been removed as described above.

Removed solid phase binding compounds and the above-mentioned amino acid whose condensation reaction of protecting group Za, can adopt the condition identical with the condensation reaction of above-mentioned 1-1 operation.Specifically, under the condensation reaction condition of above-mentioned 1-1 operation, by solid-phase resin or solid-phase compound and solid phase binding compounds are replaced, and then the compound shown in the general formula (I) is replaced with above-mentioned amino acid, carry out the condensation reaction of 1-4 operation.

By the solid phase binding compounds and the above-mentioned amino acid whose condensation reaction that remove reaction and removed protecting group Za of the protecting group Za of above-mentioned solid phase binding compounds are carried out 1～100 time repeatedly, can obtain the compound of general formula shown in (iv).For example, with above-mentioned protecting group Za remove and condensation reaction is carried out 1 time, can synthesize R is the compound of amino-acid residue; in addition; for example, with above-mentioned protecting group Za remove and condensation reaction is carried out 3 times, can synthesize R and be the compound of the peptide residue that constitutes by 3 amino-acid residues.

The 1-5 operation

Then, the compound excision solid-phase resin of the general formula that obtains from the 1-4 operation shown in (iv) or solid-phase compound and endways formation-COOH or-CONH ₂, and make protecting group X and Z remove and be replaced into hydrogen atom.In addition, the group that as required, makes group with lipid base, has the group of fatty acid residue or have a fluorescence group is incorporated into the terminal amino group of the repeating unit A of compound shown in the general formula (1).Like this, can synthesize the compound shown in the general formula (1).

For example, as solid-phase resin or solid-phase compound, when using the Merrifield resin, be the compound shown in the general formula (1) of carboxyl by placing under the superpower acidity condition, can accessing Y.In addition, for example,, when using mbha resin, be the compound shown in the amino general formula (1) by placing under the superpower acidity condition, can accessing Y as solid-phase resin or solid-phase compound.

Further, the 2nd preparation method as the compound shown in the general formula (1) can enumerate the method for carrying out 2-1 operation～2-5 operation shown below successively.For 2-1 operation～2-5 operation, be described in detail each operation.

The 2-1 operation

In the 2-1 operation, use compound solid-phase resin or the solid-phase compound shown in the above-mentioned general formula (I), the compound shown in the synthetic general formula (i).

At first, make the compound condensation shown in the above-mentioned general formula (I) and after obtaining the solid phase binding compounds in solid-phase resin or solid-phase compound, carry out this solid phase binding compounds protecting group X remove reaction.The identical condition that removes with above-mentioned 1-1 operation time of protecting group X is carried out.

Then, carry out n3-1 time repeatedly removing the solid phase binding compounds of protecting group X and the condensation reaction of the compound shown in the general formula (I).This condensation reaction identical condition with above-mentioned 1-1 operation the time is carried out.Like this, can access the compound shown in the general formula (i).

The 2-2 operation

In the 2-2 operation, use the compound shown in the above-mentioned general formula (II) and be incorporated into the amino acid that is combined with protecting group Za in the functional group beyond the carboxyl of α position carbon atom, the compound shown in the synthetic following general formula (II ').

Formula (II ') in, m2～m5, X and RZa are same as described above.

In this 2-2 operation, the carboxyl of the compound shown in the preferred formula (II) uses the protecting group different with X and Zb to protect.

At first, carry out the removing of protecting group Za of the compound shown in the general formula (II).The identical condition that removes with above-mentioned 1-4 operation time of protecting group Za is carried out.

Then removed compound and the above-mentioned amino acid whose condensation reaction shown in the general formula (II) of protecting group Za.This condensation reaction identical condition with above-mentioned 1-4 operation the time is carried out.

As mentioned above; the compound and the above-mentioned amino acid whose condensation reaction that remove reaction and removed the protecting group Za that is incorporated into the amino that uses in the condensation reaction of protecting group Za by will being incorporated into the amino that uses in the condensation reaction; add up to and to carry out 1～100 time, can obtain the compound shown in the general formula (II ').

The 2-3 operation

In the 2-3 operation, the compound shown in the general formula that uses the compound shown in the general formula (i) that obtains by the 2-1 operation and obtain (II '), the compound shown in the synthetic following general formula (ii ') by the 2-2 operation.

In the formula (ii '), n2, n3, m2～m6, RZa and " solid phase " are same as described above.

At first, carry out the removing of protecting group X of solid phase binding compounds.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 1-2 operation.

Then removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (III) of protecting group X.This condensation reaction identical condition with above-mentioned 1-2 operation the time is carried out.

By with the protecting group X of above-mentioned solid phase binding compounds remove reaction and removed the solid phase binding compounds of protecting group X and general formula (II ') shown in the condensation reaction of compound; add up to and to carry out n2 time, can obtain the compound shown in the following general formula (ii ').

The 2-4 operation

In the 2-4 operation, use compound shown in the general formula that obtains by the 2-3 operation (ii ') and the compound shown in the general formula (III), the compound of synthetic general formula shown in (iv).

At first, carry out the solid phase binding compounds protecting group X remove reaction.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 1-3 operation.

Then removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (III) of protecting group X.This condensation reaction identical condition with above-mentioned 1-3 operation the time is carried out.

By the condensation reaction that removes reaction and removed solid phase binding compounds and the compound shown in the general formula (III) of protecting group X with the protecting group X of above-mentioned solid phase binding compounds, total is carried out n1 time, obtains the compound of general formula shown in (iv).

The 2-5 operation

Then, from the general formula of the 2-4 operation gained compound excision solid-phase resin shown in (iv) or solid-phase compound and endways formation-COOH or-CONH ₂, and protecting group X and Za are removed.In addition, as required, the group that make group, the group with fatty acid residue with lipid base, has the fluorescence group is incorporated into the terminal amino group of the repeating unit A of compound shown in the general formula (1).Like this, can synthesize the compound shown in the general formula (1).Should illustrate that this 2-5 operation is undertaken by the method identical with above-mentioned 1-5 operation.

In addition, as the 3rd preparation method of the compound shown in the general formula (1), can enumerate the method that the protecting group X that makes in the compound shown in the general formula (1a) and Z remove.Protecting group X and Z remove reaction, can be undertaken by the kind corresponding condition of suitable setting and protecting group.

4. the preparation method of the compound shown in the general formula (1a)

The 1st preparation method as the compound shown in the general formula (1a) can enumerate the method for carrying out 3-1 operation～3-5 operation shown below successively.Below, for 3-1 operation～3-5 operation, be described in detail each operation.

The 3-1 operation

In the 3-1 operation, use the compound shown in the above-mentioned general formula (I) and solid-phase resin or solid-phase compound, the compound shown in the synthetic general formula (i).

For the synthetic solid-phase resin or the solid-phase compound that are used for the compound shown in the general formula (1a), can suitably select according to protecting group X that compound contained shown in the general formula (1a) and the kind of Z.For example, as the side of protecting group X that compound contained shown in the general formula (1a) and Z or both sides during, preferably adopt the Oxime resin as solid-phase resin, or oxygen benzyl compounds (オキシ Le ベ Application ジ Le) is as solid-phase compound for the Boc base.In addition, as the side of protecting group X that compound contained shown in the general formula (1a) and Z or both sides during, preferably adopt the PAM resin as solid-phase resin for the Fmoc base.

At first, make the compound condensation shown in the general formula (I) and after obtaining the solid phase binding compounds in solid-phase resin or solid-phase compound, carry out this solid phase binding compounds protecting group X remove reaction.The identical condition that removes with above-mentioned 1-1 operation time of protecting group X is carried out.

The 3-2 operation

In the 3-2 operation, use compound shown in the general formula (i) that obtains by the 3-1 operation and the compound shown in the general formula (II), the compound of synthetic general formula shown in (ii).

At first, carry out the solid phase binding compounds protecting group X remove reaction.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 1-2 operation.

Then, removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (II) of protecting group X.This condensation reaction identical condition with above-mentioned 1-2 operation the time is carried out.

By with the solid phase binding compounds that removes and removed protecting group X of the protecting group X of above-mentioned solid phase binding compounds and the condensation reaction of the compound shown in the general formula (II), add up to and carry out n2 time, can obtain the compound of general formula shown in (ii).

The 3-3 operation

In the 3-3 operation, use the general formula that obtains by 3-2 operation compound shown in (ii) and the compound shown in the general formula (III), the compound of synthetic general formula shown in (iii).

Then, removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (III) of protecting group X.This condensation reaction identical condition with above-mentioned 1-3 operation the time is carried out.

By with the solid phase binding compounds that removes and removed protecting group X of the protecting group X of above-mentioned solid phase binding compounds and the condensation reaction of the compound shown in the general formula (III), add up to and carry out n1 time, can obtain the compound of general formula shown in (iii).

The 3-4 operation

In the 3-4 operation, use the general formula that obtains by 3-3 operation compound shown in (iii) and the amino acid that in the functional group beyond the carboxyl that is incorporated into α position carbon atom, is combined with protecting group Za, the compound of synthetic general formula shown in (iv).

The amino acid that uses in the amino acid that uses in the 3-4 operation and the above-mentioned 1-4 operation is identical.

At first, carry out the removing of protecting group Za of the compound of general formula shown in (iii).The identical condition that removes with above-mentioned 1-4 operation time of protecting group Za is carried out.

Compound and the above-mentioned amino acid whose condensation reaction of the general formula that has then removed protecting group Za shown in (iii).This condensation reaction identical condition with above-mentioned the 4th operation the time is carried out.

As mentioned above; the compound and the above-mentioned amino acid whose condensation reaction that remove reaction and removed the protecting group Za that is incorporated into the amino that uses in the condensation reaction of protecting group Za by will being incorporated into the amino that uses in the condensation reaction; add up to and to carry out 1～100 time, can obtain the compound of general formula shown in (iv).

The 3-5 operation

On the compound of the general formula that obtains by above-mentioned 3-4 operation shown in (iv), be combined with Za as protecting group.Therefore, as required,, protecting group Za is replaced with the protecting group (protecting group Zb) identical with protecting group X according to known method.

Then, under the state that protecting group X and Z keep, the compound excision solid-phase resin of the general formula that obtains from the 3-4 operation shown in (iv) or solid-phase compound and formation-COOH endways.

For example, when using the Oxime resin,, can obtain the compound shown in the general formula (1-a) by placing under the alkaline condition as solid-phase resin or solid-phase compound.

Further, the 2nd preparation method as the compound shown in the general formula (1a) can enumerate the method for carrying out 4-1 operation～4-5 operation shown below.Below, for 4-1 operation～4-5 operation, be described in detail each operation.

The 4-1 operation

In the 4-1 operation, use the compound shown in the above-mentioned general formula (I) and solid-phase resin or solid-phase compound, the compound shown in the synthetic general formula (i).This 4-1 operation is carried out with the condition identical with above-mentioned 3-1 operation.

The 4-2 operation

In the 4-2 operation, use the amino acid that is combined with protecting group Za in compound shown in the above-mentioned general formula (II) and the functional group beyond the carboxyl that is incorporated into α position carbon atom, the compound shown in the synthetic general formula (II ').

The amino acid that uses in this 1-2 operation is identical with the amino acid that uses in the above-mentioned 3-4 operation.

At first, carry out the removing of protecting group Za of the compound shown in the general formula (II).The identical condition that removes with above-mentioned 3-4 operation time of protecting group Za is carried out.

Then removed compound and the above-mentioned amino acid whose condensation reaction shown in the general formula (II) of protecting group Za.This condensation reaction identical condition with above-mentioned 3-4 operation the time is carried out.

The 4-3 operation

In the 4-3 operation, the compound shown in the general formula that uses the compound shown in the general formula (i) that obtains by the 4-1 operation and obtain (II '), the compound shown in the synthetic general formula (ii ') by the 4-2 operation.

At first, carry out the removing of protecting group X of solid phase binding compounds.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 3-2 operation.

Then removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (III) of protecting group X.This condensation reaction identical condition with above-mentioned 3-2 operation the time is carried out.

By condensation reaction with the compound shown in the solid phase binding compounds that removes and removed protecting group X of the protecting group X of above-mentioned solid phase binding compounds and the general formula (II '); add up to and to carry out n2 time, can obtain the compound shown in the following general formula (ii ').

The 4-4 operation

In the 4-4 operation, use compound shown in the general formula that obtains by the 4-3 operation (ii ') and the compound shown in the general formula (III), the compound of synthetic general formula shown in (iv).

At first, carry out the solid phase binding compounds protecting group X remove reaction.The method that removes of carrying out protecting group X identical condition in the time of can adopting with above-mentioned 3-3 operation.

Then removed the condensation reaction of solid phase binding compounds and the compound shown in the general formula (III) of protecting group X.This condensation reaction identical condition with above-mentioned 3-3 operation the time is carried out.

By with the solid phase binding compounds that removes and removed protecting group X of the protecting group X of above-mentioned solid phase binding compounds and the condensation reaction of the compound shown in the general formula (III), add up to and carry out n1 time, can obtain the compound of following general formula shown in (iv).

The 4-5 operation

In the compound of the general formula that in by above-mentioned 4-4 operation, obtains shown in (iv), be combined with Za as protecting group.Therefore, as required,, protecting group Za is replaced with the protecting group (protecting group Zb) identical with protecting group X according to known method.

Then, under the state that protecting group X and Zb keep, the compound excision solid-phase resin of the general formula that obtains from the 4-4 operation shown in (iv) or solid-phase compound and formation-COOH endways.This 4-5 operation is carried out with the method identical with above-mentioned 3-5 operation.

Embodiment

Below, enumerate embodiment and test example illustrating in greater detail the present invention.But the present invention is not limited to these embodiment and test example.

With reference to synthesis example 1Synthesizing of compound shown in the general formula (11)

Compound shown in the synthetic following general formula (11) (below, be designated as compound (11))

Specifically, under water-bath cooling to Alloc (allyloxycarbonyl)-HN-C ₅H ₁₀-COOH (891mg, 3.0mmol) and Pfp-OH (Pentafluorophenol) (adding DCC (1, the 3-dicyclohexylcarbodiimide) (845mg among the 754mg, dichloromethane solution 4.5mmol) (12ml), 4.5mmol), with this reaction solution 0 ℃ stir 30 minutes, then stirring at room 15 hours.Filtering reacting liquid also concentrates filtrate decompression, with residue with silica gel column chromatography (CH ₂Cl ₂) behind the purifying, obtain white powder Alloc-HN-C with the hexane recrystallization ₅H ₁₀-COO-Pfp (537.5mg, 98%). ¹H-NMR(CDCl ₃)δ5.92(m，1H)，5.26(m，2H)，4.96(brt，1H)，4.57(brd，2H)，3.22(q，J＝6.2Hz，2H)，2.69(t，J＝7.2Hz，2H)，2.0-1.8(m，2H)，1.75-1.1(m，8H)；LRMS(FAB ⁺)calcd forC ₁₆H ₁₇F ₅NO ₄[(M+H) ⁺]382.3 observed 382。

Then, in the mixing solutions of acetone (6.0mL) and water (1.0mL), add NaHCO ₃(67.2mg, 0.8mmol), with Alloc-HN-C ₅H ₁₀(763mg, 2.0mmol) (681mg, 2.0mmol) dissolving was stirring at room 6 hours with the compound shown in the following formula (12) for-O-Pfp.

With water-bath refrigerative 1N hydrochloric acid the refrigerative reaction soln is transferred to pH3.0, and then after adding 1% aqueous solution of citric acid, use ethyl acetate extraction, organic layer is cleaned with saturated aqueous common salt.Make after the organic layer drying with anhydrous magnesium sulfate to concentrate, with silica gel column chromatography (1-5%MeOH/CH ₂Cl ₂) purifying.Thereafter, be dissolved in methylene dichloride, concentrating under reduced pressure obtains the compound (11) (157.3mg, 80%) as amorphous powder. ¹H-NMR(CDCl ₃)δ7.75(d，J＝6.8Hz，2H)，7.59(d，J＝7.6Hz，2H)，7.35(m，4H)，5.8(m，1H)，5.8(ma)and 5.6(mi)(m，1H)，5.2(m，2H)，4.6(mi)and 4.53(ma)(brd，2H)，4.37(brd，2H)，4.22(mi)and 4.04(ma)(brd，2H)，3.50(m，2H)，3.33(m，2H)，3.16(m，2H)，2.37(ma)and 2.2(mi)(brt，2H)，1.8-1.2(m，6H)；LRMS(FAB ⁺)calcd for C ₂₉H ₃₆N ₃O ₇[(M+H) ⁺]538.6 observed 538。

Embodiment 1Synthesizing of compound shown in the general formula (1-A)

Compound (1-A) shown in the synthetic following general formula (below, be designated as compound (1-A)).

According to standard tBoc method (cf.Koch, T.; Hansen, H.F.; Andersen, P.; Larsen, T.; Batz, H.G; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier MBHA (4-methyl-benzhydrylamine) resin (120mg, 73.2 μ mol) is used Boc-HN-C ₅H ₁₀-COOH (tertbutyloxycarbonyl-6-aminocaprolc acid; 34.3mg, 109.8 condensing agent HATU[2-(1H-9-azo benzotriazole-1-yl)-1 μ mol),, 1,3,3 tetramethyl-urea  hexafluorophosphates] (41.7mg, 109.8 μ mol) and DIEA (diisopropyl ethyl amine) (50 μ L) carry out condensation reaction (room temperature, 30 minutes) (reaction process r1-1).By TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes) (reaction process r1-2 and r1-3).

Then; by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after (reaction process r1-4); use condensing agent HATU (41.7mg; 109.8 μ mol) and DIEA (50 μ L); make the compound (58.6mg shown in the following formula (13); 109.8 condensation μ mol) (room temperature, 30 minutes).Should operate and repeat 5 times (reaction process r1-5 and 2-6).

Carry out piperidines and handle (the DMF solution of 20% piperidines, room temperature 5 minutes) Fmoc base deprotection (reaction process r1-7) thereafter.Then, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L), make Fmoc-Arg (Mts:N-sym-trimethylbenzene-2-alkylsulfonyl)-OHIPE (sec.-propyl ethylamine) (747mg, 1098 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r1-8～r1-10) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; carry out obtaining target compound (compound (1-A)) (reaction process r1-11) with well-established law (TFA/TFMSA/ p-cresol/thioanisole=60/25/10/10) from the deprotection of the protecting group Mts base of the excision of solid phase carrier MBHA and Arg.MALDI-TOF MS：calcd.3653.53(M+H ⁺)，found 3654.57。

Embodiment 2Synthesizing of compound shown in the general formula (1-B)

Compound (1-B) shown in the general formula below synthetic (below, be designated as compound (1-B)).

Specifically, according to standard tBoc method (cf.Koch, T.; Hansen, H.F.Andersen, P.; Larsen, T.; Batz, H.G; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier MBHA (120mg, 73.2 μ mol) is used as connecting the Boc-HN-C of base with omega-amino acid ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out condensation reaction (room temperature, 30 minutes) (reaction process r2-1).By TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes) (reaction process r2-2 and r2-3).

Then; by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after (reaction process r2-4), use condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) to make Boc-Lys (Fmoc)-OH (53.4mg; 109.8 condensation μ mol) (room temperature, 30 minutes).Should operate and repeat 5 times (reaction process r2-5 and r2-6).

Carry out piperidines and handle (the DMF solution of 20% piperidines, room temperature 5 minutes) Fmoc base deprotection (reaction process r2-7) thereafter.Then, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L) to make Fmoc-Arg (Mts)-OHIPE (747mg, 1098 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r2-8～r2-10) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; carry out obtaining target compound (compound (1-B)) (reaction process r2-11) with well-established law (TFA/TFMSA/ p-cresol/thioanisole=60/25/10/10) from the deprotection of the protecting group Mts base of the excision of solid phase carrier MBHA and Arg.MALDI-TOF MS：calcd.3228.00(M+H ⁺)，found 3227.91。

Embodiment 3Synthesizing of compound shown in the general formula (1-C)

Compound (1-C) shown in the general formula below synthetic (below, be designated as compound (1-C)).

Specifically, according to standard tBoc method (cf.Koch, T.; Hansen, H.F.; Andersen, P.; Larsen, T.; Batz, H.G; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier MBHA (120mg, 73.2 μ mol) is used as connecting the Boc-HN-C of base with omega-amino acid ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out condensation reaction (room temperature, 30 minutes) (reaction process r3-1).By TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes) (reaction process r3-2 and r3-3).

Then; by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after (reaction process r3-4); use condensing agent HATU (41.7mg; 109.8 μ mol) and DIEA (50 μ L) make the compound (58.6mg shown in the above-mentioned formula (13); 109.8 condensation μ mol) (room temperature, 30 minutes).Should operate and repeat 5 times (reaction process r3-5 and r3-6).

Carry out piperidines and handle (the DMF solution of 20% piperidines, room temperature 5 minutes) Fmoc base deprotection (reaction process r3-7) thereafter.Then, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L) to make Fmoc-Lys (Boc)-OH (534mg, 1098 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r3-8～r3-10) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; carry out obtaining target compound (compound (1-C)) (reaction process r3-11) with well-established law (TFA/TFMSA/ p-cresol/thioanisole=60/25/10/10) from the deprotection of the protecting group Boc base of the excision of solid phase carrier MBHA and Lys.MALDI-TOF MS：calcd.3233.32(M+H ⁺)，found 3233.60。

Embodiment 4Synthesizing of compound shown in the general formula (1-D)

Compound (1-D) shown in the general formula (1-D) below synthetic (below, be designated as compound (1-D)).

Specifically, according to standard tBoc method (cf.Koch, T.; Hansen, H.F.; Andersen, P.; Larsen, T.; Batz, H.G.; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier MBHA (120mg, 73.2 μ mol) is used as connecting the Boc-HN-C of base with omega-amino acid ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out condensation reaction (room temperature, 30 minutes) (reaction process r4-1).By TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (34.3mg, 109.8 μ mol), condensing agent HATU (41.7mg, 109.8 μ mol) and DIEA (50 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes) (reaction process r4-2 and r4-3).

Then; by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after (reaction process r4-4); use condensing agent HATU (41.7mg; 109.8 μ mol) and DIEA (50 μ L) make the compound (58.6mg shown in the above-mentioned formula (13); 109.8 condensation μ mol) (room temperature, 30 minutes).Should operate and repeat 5 times (reaction process r4-5 and r4-6).

Carry out piperidines and handle (the DMF solution of 20% piperidines, room temperature 5 minutes) Fmoc base deprotection (reaction process r4-7) thereafter.Then, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L) to make Fmoc-Lys (Boc)-OH (534mg, 1098 μ mol) condensations (room temperature, 30 minutes) (reaction process r4-8).Then, handle Fmoc base deprotection, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L) to make Fmoc-Arg (Mts)-OHIPE (747mg, 1098 μ mol) condensations (room temperature, 30 minutes) (reaction process r4-9) by piperidines.And then, handle Fmoc base deprotection by piperidines, use condensing agent HATU (417mg, 1098 μ mol) and DIEA (192 μ L) to make Fmoc-Ser (Trt)-OH (415mg, 1098 μ mol) condensations (room temperature, 30 minutes) (reaction process r4-10).

At last; handle behind the Fmoc base deprotection by piperidines; carry out the deprotection of protecting group Trt base of protecting group Mts base, the Ser of protecting group Boc base, Arg from the excision of solid phase carrier MBHA and Lys with well-established law (TFA/TFMSA/ p-cresol/thioanisole=60/25/10/10), obtain target compound (compound (1-D)) (reaction process r4-11).MALDI-TOF MS：calcd.3167.92(M+H ⁺)，found 3166.89。

Embodiment 5Synthesizing of compound (1L-A)

Compound (1L-A) shown in the general formula below synthetic.

Specifically, according to standard Fmoc method (cf.Carpino, L.A.; Han, G.Y.J.Org.Chem.1972,37; 3404-9.), at first, with solid phase carrier PAL (5-(4 '-aminomethyl-3 '; 5 '-dimethoxy phenoxy group)-and valeric acid) (180mg, 72 μ mol) carry out that piperidines is handled (the DMF solution of 20% piperidines, room temperature 5 minutes) and with Fmoc base deprotection.This carrier is used condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L), make as connecting the Fmoc-HN-C of base with omega-amino acid ₁₀H ₂₀-COOH (305mg, 720 μ mol) condensations (room temperature, 30 minutes) (reaction process r5-1).

Then, carry out piperidines and handle, use condensing agent HATU (137mg, 360 μ mol) and DIEA (63 μ L) to make compound (11) (193mg, 360 μ mol) condensations (room temperature, 30 minutes) behind the Fmoc base deprotection.Should operate and repeat (reaction process r5-2～r5-4) 5 times.

Then, carry out piperidines and handle, use Fmoc-HN-C behind the Fmoc base deprotection ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) condensation (room temperature, 30 minutes) (reaction process r5-5).

Then, carrying out piperidines handles Fmoc base deprotection (reaction process r5-6)., use DMF/DIEA (1mL/50 μ L) solution, make phosphatide active ester body DOPE-NHS (DOPE-N-hydroxy-succinamide) (90.5mg, 92.3 μ mol) condensation (reaction process r5-7) thereafter.

Then, with Pd (PPh ₃) ₄The CHCl of [four (triphenylphosphines) close palladium (0)] ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection (reaction process r5-8).Then, use condensing agent HATU (410mg, 1080 μ mol) and DIEA (188 μ L) to make Fmoc-Arg (Pbf)-OH0.3IPE (733mg, 1080 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r5-9～r5-11) 3 times.

At last; after handling by piperidines with Fmoc base deprotection; handle (95%TFA/5% m-cresol) by TFA then, carry out obtaining target compound (compound (1L-A)) (reaction process r5-12) from the deprotection of the protecting group Pbf base of the excision of solid phase carrier PAL and Arg.MALDI-TOF MS：calcd.4632.90(M+H ⁺)，found 4632.63。

Specifically, according to standard Fmoc method (cf.Carpino, L.A.; Han, G.Y.J.Org.Chem.1972,37,3404-9.), at first, solid phase carrier PAL (180mg, 72 μ mol) carried out that piperidines is handled (the DMF solution of 20% piperidines, room temperature 5 minutes) and with Fmoc base deprotection.This carrier is used as connecting the Fmoc-HN-C of base with omega-amino acid ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes).(reaction process r6-1)

Then, carry out piperidines and handle, use condensing agent HATU (137mg, 360 μ mol) and DIEA (63 μ L) to make compound (11) (193mg, 360 μ mol) condensations (room temperature, 30 minutes) behind the Fmoc base deprotection.Should operate and repeat (reaction process r6-2～r6-4) 4 times.

Then, carry out piperidines and handle, use Fmoc-HN-C behind the Fmoc base deprotection ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes) (reaction process r6-5).

Then, carrying out piperidines handles Fmoc base deprotection (reaction process r6-6)., use DMF/DIEA (1mL/50 μ L) solution, make phosphatide active ester body DOPE-NHS (DOPE-N-hydroxy-succinamide) (90.5mg, 92.3 μ mol) condensation (reaction process r6-7) thereafter.

And then, with Pd (PPh ₃) ₄CHCl ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection (reaction process r6-8).Then, use condensing agent HATU (410mg, 1080 μ mol) and DIEA (188 μ L) to make Fmoc-Lys (Boc)-OH (525mg, 1080 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r6-9～r6-11) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; handle (95%TFA/5% m-cresol) by TFA, carry out obtaining target compound (compound (1L-B)) (reaction process r6-12) from the deprotection of the protecting group Boc base of the excision of solid phase carrier PAL and Lys.MALDI-TOFMS：calcd.3614.91(M+H ⁺)，found 3611.60。

Embodiment 7Synthesizing of compound shown in the general formula (1L-C)

Compound (1L-C) shown in the general formula below synthetic (below, be designated as compound (1L-C)).

Specifically, according to standard Fmoc method (cf.Carpino, L.A.; Han, G.Y.J.Org.Chem.1972,37,3404-9.), at first, solid phase carrier PAL (180mg, 72 μ mol) carried out that piperidines is handled (the DMF solution of 20% piperidines, room temperature 5 minutes) and with behind the Fmoc base deprotection.This carrier is used as connecting the Fmoc-HN-C of base with omega-amino acid ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes).(reaction process r7-1)

Then, carry out piperidines and handle, use condensing agent HATU (137mg, 360 μ mol) and DIEA (63 μ L) to make compound (11) (193mg, 360 μ mol) condensations (room temperature, 30 minutes) behind the Fmoc base deprotection.Should operate and repeat (reaction process r7-2～r7-4) 5 times.

Then, carry out piperidines and handle, use Fmoc-HN-C behind the Fmoc base deprotection ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes) (reaction process r7-5).

Then, carrying out piperidines handles Fmoc base deprotection (reaction process r7-6)., use condensing agent HATU (54.6mg, 144 μ mols) and DIEA (25 μ L), make oleic acid (40mg, 144 μ mol) condensation (reaction process r7-7) thereafter.

And then, with Pd (PPh ₃) ₄CHCl ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection (reaction process r7-8).Then, use condensing agent HATU (410mg, 1080 μ mol) and DIEA (188 μ L) to make Fmoc-Arg (Pbf)-OH0.3IPE (733mg, 1080 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r7-9～r7-11) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; handle (95%TFA/5% m-cresol) by TFA, carry out obtaining target compound (compound (1L-C)) (reaction process r7-12) from the deprotection of the protecting group Pbf base of the excision of solid phase carrier PAL and Arg.

Embodiment 8Synthesizing of compound shown in the general formula (1L-D)

Compound shown in the general formula (1L-D) below synthetic (below, be designated as compound (1L-D)).

Specifically, according to standard Fmoc method (cf.Carpino, L.A.; Han, G.Y.J.Org.Chem.1972,37,3404-9.), at first, solid phase carrier PAL (180mg, 72 μ mol) carried out that piperidines is handled (the DMF solution of 20% piperidines, room temperature 5 minutes) and with Fmoc base deprotection.This carrier is used as connecting the Fmoc-HN-C of base with omega-amino acid ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes).(reaction process r8-1)

Then, carry out piperidines and handle, use condensing agent HATU (137mg, 360 μ mol) and DIEA (63 μ L) to make compound (11) (193mg, 360 μ mol) condensations (room temperature, 30 minutes) behind the Fmoc base deprotection.Should operate and repeat (reaction process r8-2～r8-4) 5 times.

Then, carry out piperidines and handle, use Fmoc-HN-C behind the Fmoc base deprotection ₁₀H ₂₀-COOH (305mg, 720 μ mol), condensing agent HATU (274mg, 720 μ mol) and DIEA (126 μ L) carry out condensation (room temperature, 30 minutes) (reaction process r8-5).

Then, carrying out piperidines handles Fmoc base deprotection (reaction process r8-6)., use DMF/DIEA (1mL/50 μ L) solution, make phosphatide active ester body Ole-PEG-NHS (oleic acid-polyoxyethylene glycol-N-hydroxy-succinamide) (306mg, 144 μ mol) condensation (reaction process r8-7) thereafter.

And then, with Pd (PPh ₃) ₄CHCl ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection (reaction process r8-8).Then, use condensing agent HATU (410mg, 1080 μ mol) and DIEA (188 μ L) to make Fmoc-Arg (Pbf)-OH0.3IPE (733mg, 1080 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r8-9～r8-11) 3 times.

At last; handle behind the Fmoc base deprotection by piperidines; handle (95%TFA/5% m-cresol) by TFA, carry out obtaining target compound (compound (1L-D)) (reaction process r8-12) from the deprotection of the protecting group Pbf base of the excision of solid phase carrier PAL and Arg.

Synthesizing of embodiment 9 compounds (1-E)

Compound (1-E) shown in the general formula below synthetic.

Specifically, according to standard tBoc method (cf.Koch, T.; Hansen, H.F.; Andersen, P.; Larsen, T.; Batz, H.G.; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier MBHA (100mg, 61 μ mol) is used as connecting the Boc-HN-C of base with omega-amino acid ₅H ₁₀-COOH (6.93mg, 30 μ mol), condensing agent HATU (11.4mg, 30 μ mol) and DIEA (10 μ L) carry out condensation reaction (room temperature, 120 minutes) (reaction process r9-1).

Then, handle (95%TFA/5% m-cresol) with Boc base deprotection (reaction process r6-6) by TFA., use condensing agent HATU (13.7mg, 60 μ mols) and DIEA (12.5 μ L), make (19.9mg, the 60 μ mol) condensations of the compound shown in the following general formula (91) (room temperature, 30 minutes) thereafter.Should operate and repeat 5 times (reaction process r9-7 and r9-8).

Then, carry out piperidines and handle (the DMF solution of 20% piperidines, room temperature 5 minutes) Fmoc base deprotection (reaction process r9-9).Then, use condensing agent HATU (85mg, 225 μ mol) and DIEA (39 μ L) to make Fmoc-Arg (Mts)-OHIPE (153mg, 225 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat (reaction process r9-10～r9-12) 3 times.

Then, by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (13.9mg, 60 μ mol), condensing agent HATU (22.8mg, 60 μ mol) and DIEA (20 μ L) carry out condensation reaction (room temperature, 30 minutes) (reaction process r9-2 and r9-3).

And then, handle behind the Boc base deprotection by TFA, DIEA/DMF (26.7mL/1.5mL) solution of FITC (29.2mg, 75 μ mol) was at room temperature stirred 14 hours and fluorescent markization (reaction process r9-13).

At last; handle behind the Fmoc base deprotection by piperidines; carry out obtaining target compound (compound (1-E)) (reaction process r9-14) with well-established law (TFA/TFMSA/ p-cresol/thioanisole=60/25/10/10) from the deprotection of the protecting group Mts base of the excision of solid phase carrier MBHA and Arg.MALDI-TOF MS：calcd.4041.40(M+H ⁺)，found 4042.91。

Embodiment 10Synthesizing of compound shown in the general formula (1a-1)

According to the reaction process shown in following, the compound (1a-1) shown in the synthetic following general formula.

Specifically, according to standard tBoc method (cf.Koch, T.; Hansen, H.F.; Andersen, P.; Larsen, T.; Batz, H.G.; Otteson, K.; Orum, H.J.Peptide Res.1997,49,80-88.), at first, solid phase carrier Oxime (100mg, 120 μ mol) is used as connecting the Boc-HN-C of base with omega-amino acid ₅H ₁₀-COOH (181mg, 480 μ mol), condensing agent DCC (124mg, 480 μ mol) carry out condensation reaction (room temperature, 15 hours).By TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (68mg, 180 μ mol), condensing agent HATU (68mg, 180 μ mol) and DIEA (83 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes).

Then, handle (95%TFA/5% m-cresol) with Boc base deprotection by TFA., use condensing agent HATU (41mg, 180 μ mols) and DIEA (37.5 μ L), make (19.9mg, the 180 μ mol) condensations of the compound shown in the following general formula (101) (room temperature, 30 minutes) thereafter.Should operate and repeat 5 times.

Then, by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Boc-HN-C ₅H ₁₀-COOH (68mg, 180 μ mol), condensing agent HATU (68mg, 180 μ mol) and DIEA (83 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes).

And then, with Pd (PPh ₃) ₄CHCl ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection.Then, use condensing agent HATU (340mg, 900 μ mol) and DIEA (157 μ L) to make Alloc-Arg (Pbf)-OH (459mg, 900 μ mol) condensations (room temperature, 30 minutes).Should operate and repeat 2 times.

And then, with Pd (PPh ₃) ₄CHCl ₃/ AcOH/N-methylmorpholine solution (312mg, 2.8mL, 1.5mL, 0.75mL, room temperature 30 minutes) carries out secondary treatment, with Alloc base deprotection.Then, use condensing agent HATU (340mg, 900 μ mol) and DIEA (157 μ L) to make Boc-Arg (Pbf)-OHIPE (474mg, 900 μ mol) condensations (room temperature, 30 minutes).

At last, carry out excision (room temperature, 5 minutes), after the neutralization, obtain target compound (compound shown in the general formula (1a-1)) from solid phase carrier Oxime with the two  alkane aqueous solution (70% 2  alkane/30% water) of 1N NaOH.

Embodiment 11Synthesizing of compound shown in the general formula (1a-2)

According to the reaction process shown in following, the compound (1a-2) shown in the synthetic following general formula.

Then, handle (95%TFA/5% m-cresol) with Boc base deprotection by TFA., use condensing agent HATU (41mg, 180 μ mols) and DIEA (37.5 μ L), make (19.9mg, the 180 μ mol) condensations of the compound shown in the following general formula (111) (room temperature, 30 minutes) thereafter.Should operate and repeat 5 times.

Then, by TFA handle (95%TFA/5% m-cresol) with Boc base deprotection after, use Fmoc-HN-C ₅H ₁₀-COOH (64mg, 180 μ mol), condensing agent HATU (68mg, 180 μ mol) and DIEA (83 μ L) carry out reaction of propagation one by one (room temperature, 30 minutes).

At last, carry out excision (room temperature, 5 minutes), after the neutralization, obtain target compound (compound shown in the general formula (1a-2)) from solid phase carrier Oxime with the two  alkane aqueous solution (70% 2  alkane/30% water) of 1N NaOH.

Embodiment 12Synthesizing of compound shown in the general formula (1a-3)

According to the reaction process shown in following, the compound (1a-3) shown in the synthetic following general formula.

Reference test example 1Nucleic acid imports experiment (few chain DNA level)

With the RPMI substratum that contains 10%FBS (PC3 cell, NIH-3T3 cell, T24 cell) or contain the DMEM substratum (UMUC cell) of 10%FBS, in 12 orifice plates, cultivate PC3 (human lung adenocarcinoma) cell, UMUC3 (human bladder cancer) cell, T24 (people's uropoiesis bladder cancer) cell or NIH-3T3 (mouse embryo fibroblast) cell in advance, make it to become the state of 60-70% adhesion.

With the compound shown in the table 1 [compound (1-A) or (1-B) be mixed with 0.37,0.13 respectively, the solution of 0.04mM] 1 μ L is added among the serum free medium 50 μ L, mixes incubated at room temperature 5 minutes with flagellation.Then, import with in the substratum of carrier to the above-mentioned synthetic nucleic acid that contains, add FITC labeled ssdna (20mer) (FITC-TAATACGACTCACTATAGGG:Proligo society system) 0.3 μ g, mix, cultivate 30 minutes (tapping in per 10 minutes mixing) at 37 ℃ with flagellation.In the above-mentioned hole after the gained mixed solution adding cell cultures, cultivated 4 hours at 37 ℃ the even back of jog.Reclaim cell,, calculate DNA to intracellular importing efficient (%) by measuring the FITC positive cell with FACS.In addition, in order to carry out importing comparison with carrier (Lipofectamine 2000, TransIt-TKO, Fugene 6) with in the past nucleic acid, use each company to importing the suggested design of nucleic acid amount 0.3 μ g, the siRNA that obtains same as described above is to the intracellular importing efficient of PC3 (%).

Gained the results are shown in table 1.Can confirm by this result, compound (1-A) or the effect excellence that (1-B) nucleic acid is seen through in cell, it is useful importing with carrier as nucleic acid.

[table 1]

DNA is to intracellular importing efficient (%)

Target cell	Compound
	Compound						The compounds of this invention			Comparative compound
	Compound concentration	Compound (1-A)	Compound (1-B)	Lipofectamine 2000	TranslT-TKO	FuGene 6	The compounds of this invention			Comparative compound
	Compound concentration	Compound (1-A)	Compound (1-B)	Lipofectamine 2000	TranslT-TKO	FuGene 6	PC3	0.37mM 0.13mM 0.04mM	86.0 61.8 80.4	83.8 76.1 65.0	35.75	44.73	0.52
UMUC3	0.37mM 0.13mM 0.04mM	21.6 49.8 49.6	61.5 77.2 61.7	-	-	-	PC3	0.37mM 0.13mM 0.04mM	86.0 61.8 80.4	83.8 76.1 65.0	35.75	44.73	0.52
UMUC3	0.37mM 0.13mM 0.04mM	21.6 49.8 49.6	61.5 77.2 61.7	-	-	-	T24	0.37mM 0.13mM 0.04mM	16.3 10.4 10.6	31.4 26.0 13.4	-	-	-
NH-3T3	0.37mM 0.13mM 0.04mM	87.1 93.1 94.7	87.0 93.2 84.0	-	-	-	T24	0.37mM 0.13mM 0.04mM	16.3 10.4 10.6	31.4 26.0 13.4	-	-	-

Lipofectamine 2000:Invitrogen corporate system

The TransIT-TKO:Mirus corporate system

FuGene 6:Roche corporate system

Reference example 1-17Nucleic acid imports the preparation with carrier

The lipid and the above-mentioned cationic-liposome that will be dissolved in organic solvent constitute in the suitably big or small Glass Containers (pyriform flask or test tube etc.) of unit (formation is shown in table 2) adding, steam with Rotary Evaporators to desolventize (preparation of film).After (more than 6 hours) were removed fully and desolvated under vacuum condition, (the PBS damping fluid, pH7.4) to make ultimate density be 2.0mM in hydration, the film that forms peeled off fully the preparation lipid suspension with phosphoric acid buffer.This suspension is alternately immersed the dry ice bath and warm water, carry out so-called " freeze thawing " operation 10 times repeatedly, preparation multilamellar liposome (MLV:multilamellar vesicle).

Then, MLV is adjusted into LUV (large unilamellarvesicle) about particle diameter 200～100nm or the SUV (small unilamellar vesicle) about particle diameter 20nm.LUV prepares by standard fabrication device (Avanti corporate system Mini-Extruder).In addition, SUV is by sonde-type ultrasonoscope (TOMY corporate system UD-220) preparation.

[table 2]

	Form (%)						Particle diameter (nm)
	Form (%)							Compound (1L-A)	Compound (1L-B)	DOPE	POPC	Compound (1L-D)	Compound (1L-C)
	Contrast	---	---	50	50	---		Compound (1L-A)	Compound (1L-B)	DOPE	POPC	Compound (1L-D)	Compound (1L-C)	---	100
Reference example 1	Contrast	---	---	50	50	---	10	---	40	50	---	---	100	---	100
Reference example 1	Reference example 2	1	---	49	50	---	10	---	40	50	---	---	100	---	100
Reference example 3	Reference example 2	1	---	49	50	---	50	---	50	---	---	---	100	---	100
Reference example 3	Reference example 4	30	---	70	---	---	50	---	50	---	---	---	100	---	200
Reference example 5	Reference example 4	30	---	70	---	---	30	---	70	---	---	---	100	---	200
Reference example 5	Reference example 6	10	---	70	---	20	30	---	70	---	---	---	100	---	100
Reference example 7	Reference example 6	10	---	70	---	20	10	---	70	---	---	20	100	---	100
Reference example 7	Reference example 8	10	---	90	---	---	10	---	70	---	---	20	100	---	100
Reference example 9	Reference example 8	10	---	90	---	---	50	---	50	---	---	---	SUV	---	100
Reference example 9	Reference example 10	30	---	70	---	---	50	---	50	---	---	---	SUV	---	SUV
Reference example 11	Reference example 10	30	---	70	---	---	15	15	70	---	---	---	SUV	---	SUV
Reference example 11	Reference example 12	---	30	70	---	---	15	15	70	---	---	---	SUV	---	SUV
Reference example 13	Reference example 12	---	30	70	---	---	30	10	60	---	---	---	SUV	---	SUV
Reference example 13	Reference example 14	30	20	50	---	---	30	10	60	---	---	---	SUV	---	SUV
Reference example 15	Reference example 14	30	20	50	---	---	30	30	40	---	---	---	SUV	---	SUV
Reference example 15	Reference example 16	100	---	---	---	---	30	30	40	---	---	---	SUV	---	100
Reference example 17	Reference example 16	100	---	---	---	---	100	---	---	---	---	---	Maintain the original state	---	100

DOPE:1,2-two oleoyls-sn-glycerine-3-phosphatidylethanolamine

POPC:1-hexadecanoyl-2-oleoyl-sn-glycerine-3-phosphatidylcholine

Reference test example 2Nucleic acid imports experiment (siRNA level)

Import the day before yesterday with PC3 (human lung adenocarcinoma) cell, UMUC3 (human bladder cancer) cell or T24 (people's uropoiesis bladder cancer) cell inoculation in 6 orifice plates and at 37 ℃, 5%CO ₂Incubator cultivate so that it becomes the 50-60% connection growing state when siRNA imports.

The Opti-MEM that in the test tube of 1.5ml, adds 100 μ L, import PBS solution with carrier (each nucleic acid importing be adjusted to make compound (1L-A) be 0.067mM) 1 to wherein adding the nucleic acid contain reference example 3 or 8 with the amount of having of carrier, 3 or 10 μ L, after room temperature leaves standstill about 10 minutes, further interpolation FITC mark siRNA[fluorescent mark siRNA ((justice is arranged) Fluo-GACCCGCGCCGAGGUGAAGUU/ (antisense): the CUUCACCUCGGCGCGGGUCUU:Proligo corporate system)] 0.5 μ g, left standstill 15 minutes, and formed siRNA and gene and import the complex body of using carrier.

In addition, the Opti-MEM that in the test tube of 1.5ml, adds 50 μ L in addition, contain compound (1-A) or 1,3, the 10 μ L of PBS solution (1-B) to what wherein add 0.6mM, tapping mixes, after at room temperature leaving standstill 5 minutes, further add FITC mark siRNA (same as described above) 0.5 μ g, left standstill 30 minutes, form siRNA and gene and import the complex body of using carrier.

The liquid that contains that synthetic like this siRNA and gene are imported with carrier is added in each hole that cell exists with the 50-60% connection growing state, with plate all around behind the jog at 37 ℃, 5%CO ₂Cultivated 2 hours under the condition.After the cultivation,, calculate siRNA to intracellular importing efficient (%) by with cells were tested by flow cytometry FITC positive cell.In addition, (Lipofectamine 2000 in order to carry out using carrier with nucleic acid importing in the past, TransIt-TKO, Metafectene, oligofectamline) comparison, use each company to importing the suggested design of nucleic acid amount 0.5 μ g, the siRNA that obtains same as described above is to intracellular importing efficient (%).

Gained the results are shown in table 3.By this result as can be known,, compare with carrier, can in cell, import siRNA efficiently with known nucleic acid importing in the past by using compound (1L-A).

[table 3]

SiRNA is to intracellular importing efficient (%)

Target cell	The compounds of this invention					Comparative example
	The compounds of this invention					Comparative example				Addition (μ l)	Reference example 3	Reference example 8	Compound (1-A)	Compound) (1-B)	Lipofect amine 2000	Metafect ene	TransI t-TKO	Oligofec tamine
	PC3	1	72.7	83.2	4.3	3.5	63.4	82.2	99.4	Addition (μ l)	Reference example 3	Reference example 8	Compound (1-A)	Compound) (1-B)	Lipofect amine 2000	Metafect ene	TransI t-TKO	Oligofec tamine	39.3
3		1	72.7	83.2	4.3	3.5				92.3	89.9	4.0	10.1
3		10	90.9	89.6	16.1	42.0				92.3	89.9	4.0	10.1
UMUC3		10	90.9	89.6	16.1	42.0				1	89.9	80.3	5.7	5.3	22.3	87.4	93.9	61.5
	3	94.5	82.1	5.4	4.4					1	89.9	80.3	5.7	5.3
	3	94.5	82.1	5.4	4.4	10	90.3	85.3	5.4	7.0
	T24	1	53.5	75.2	12.7	10	90.3	85.3	5.4	7.0	11.6	75.0	83.7	-					70.9
3		1	53.5	75.2	12.7	87.4	81.3	18.5	19.2		11.6
3		10	89.7	80.6	60.7	87.4	81.3	18.5	19.2	60.7

Lipofectamine 2000:invitrogen corporate system

The TransIt-TKO:Mirus corporate system

The Metafectene:Biontex corporate system

The Oligofectamine:Invitrogen corporate system

Test example 3 nucleic acid import experiment (plasmid DNA level)

Import the day before yesterday with PC3 (human lung adenocarcinoma) cell inoculation in 6 orifice plates and at 37 ℃, 5%CO ₂Condition under cultivate so that it becomes the 60-70% connection growing state when plasmid DNA imports.Nutrient solution in each hole is replaced into serum free medium (RPMI substratum) before importing 2 hours.

The Opti-MEM that in the test tube of 1.5ml, adds 250 μ L, import PBS solution with carrier (each nucleic acid importing be adjusted to make compound (1L-A) be 0.133mM) 5 μ L to wherein adding the nucleic acid contain reference example 3 with the content of carrier, after at room temperature leaving standstill about 10 minutes, further to wherein adding the Opti-MEM (concentration of pEGFP-N3: 250 μ l 5.0 μ g/250ml) that contains EGFP recombinant plasmid dna (pEGFP-N3), left standstill after the tapping 15 minutes, and formed plasmid DNA and nucleic acid and import the complex body of using carrier.

The liquid that contains that synthetic like this siRNA and gene are imported with carrier is added in each hole that cell exists with the 60-70% connection growing state, with plate all around behind the jog at 37 ℃, 5%CO ₂Cultivate after 2 hours under the condition, be replaced into substratum fully, at 37 ℃, 5%CO ₂Further cultivate 45 hours (adding up to 47 hours) under the condition.After the cultivation,, calculate plasmid DNA to intracellular importing efficient (%) by positive cell with cells were tested by flow cytometry GFP (egfp).

In addition, for carry out with in the past nucleic acid import with carrier (FuGene 6, Lipofectamine2000, comparison Metafectene), the scheme according to each company is recommended imports plasmid DNA in cell, same as described above obtaining imports efficient (%).

Gained the results are shown in table 4.By this result as can be known, by using compound (1L-A), can in cell, import plasmid DNA.

[table 4]

Plasmid DNA is to intracellular importing efficient (%)

Nucleic acid imports uses carrier	The present invention's product	Product relatively
	The present invention's product	Product relatively			Reference example 3	Fugene 6	Lipofectamine 2000	Metafectene
	Import efficient (%)	26.11	5.78	29.84	Reference example 3	Fugene 6	Lipofectamine 2000	Metafectene	31.8

Reference test example 4Nucleic acid imports experiment (siRNA level)

Importing that be inoculated in 6 orifice plates with PC3 (human lung adenocarcinoma)/Bcl-2 cell (having imported the cell of the plasmid that is inserted with Bcl-2 to PC3) the day before yesterday and at 37 ℃, 5%CO ₂Incubator in cultivate so that it becomes the 50-60% connection growing state when siRNA imports.

The Opti-MEM that in the test tube of 1.5ml, adds 100 μ L, import PBS solution with carrier (each nucleic acid import amount with carrier be adjusted to make compound (1L-A) be 0.067mM) 6 μ L to wherein adding the nucleic acid contain reference example 3, at room temperature carry out cultivation in advance in 10 minutes.To the siRNA[siRNA corresponding that wherein adds 13.5-450pmol with bcl-2 ((justice is arranged) GACCCGCGCCGAGGUGAAGUU/ (antisense): CUUCACCUCGGCGCGGGUCUU:Proligo society system)], left standstill 15 minutes, and formed siRNA and gene and import the complex body of using carrier.This complex body is splashed in each hole that cell exists with the 50-60% connection growing state, cultivated about 48 hours at 37 ℃.After the cultivation, by the Western blotting detection bcl-2 protein expression of standard.

In addition, compare with carrier (Roche corporate system XtremeGene) in order to import with in the past nucleic acid, use each company to importing the suggested design of nucleic acid amount 0.5 μ g, the efficient (swimming lane 2,3) of measuring in the cell importing siRNA corresponding same as described above with bcl-2.In addition, proved that also the siRNA corresponding with GFP that promptly uses complex body will not contain target sequence imports, and also can not cause the inhibition effect (swimming lane 4) of bcl-2 protein expression.The detailed importing condition of each swimming lane is as shown in the table.

Gained the results are shown in Fig. 1.By this result as can be known,, compare with carrier, be imported into intracellular siRNA and shown that protein expression suppresses effect efficiently with known nucleic acid importing in the past by using compound (1L-A).

Applicability on the industry

Compound shown in the general formula of the present invention (1) has amino acid or oligopeptides at side chain, can more effective performance based on the useful activity of these amino acid or oligopeptides. Particularly in the compound shown in the general formula (1), be selected from the amino acid in arginine, lysine and the serine or contain these amino acid whose oligopeptides by possessing, can effectively bring into play film and see through function.

In addition, the compound shown in the general formula of the present invention (1a), the protected base protection of free amine group, and have free carboxy on the end of repetitive C. Therefore, the compound shown in the general formula (1a) can easily carry out condensation reaction with the target compound with amino or hydroxyl, can give useful activity based on amino acid or oligopeptides to this target compound.

Claims

1. the compound shown in the following general formula (1):

In the formula (1), n1 represents 0～10 integer, and n2 represents 1～50 integer, and n3 represents 1～10 integer;

M1 represents 0～100 integer, and m2 represents 0～100 integer, and m3 represents 0～100 integer, and m4 represents 0 or 1 integer, and m5 represents 0～100 integer, and m6 represents 0～100 integer;

Y represents hydroxyl or amino;

E represents N or CH;

N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C.

2. the described compound of claim 1 is characterized in that, in the formula (1), L is the group with phosphatide base.

3. the described compound of claim 1 is characterized in that, in the formula (1), R is the amino-acid residue that is selected from arginine residues, lysine residue and the serine residue, or has at least a kind peptide residue in these amino-acid residues.

4. the described compound of claim 1, it is characterized in that, in the formula (1), R is a peptide residue, described peptide residue by be selected from that the amino-acid residue more than a kind or 2 kinds in arginine residues, lysine residue and the serine residue constitutes and amino-acid residue add up to 2～20.

5. the described compound of claim 1 is characterized in that, in the formula (1), and the peptide residue of R for constituting by 2～5 arginine residues.

6. the described compound of claim 1 is characterized in that, in the formula (1), n1 is 0～2 integer, and n2 is 1～10 integer, and n3 is 0～2 integer.

7. the described compound of claim 1 is characterized in that, in the formula (1), E is N, and m2 is 2, and m3 and m4 are 1, and m5 is 5.

8. the described compound of claim 1 is characterized in that, in the formula (1), E is CH, and m2, m3 and m4 are 0, and m5 is 4.

9. the compound shown in the following general formula (1a):

N1～n3, m1～m6, E and R are same as described above,

Y represents hydroxyl;

X represents protecting group;

10. the described compound of claim 9 is characterized in that, in the formula (1a), X is tertbutyloxycarbonyl or 9-fluorenylmethyloxycarbonyl.

11. the described compound of claim 9, it is characterized in that, in the formula (1a), R is the amino-acid residue that is selected from arginine residues, lysine residue and the serine residue, or for containing 2～20 the peptide residue of ading up to of in these amino-acid residues at least a kind and amino-acid residue.

12. the described compound of claim 9, it is characterized in that, in the formula (1a), R is a peptide residue, described peptide residue by be selected from that the amino-acid residue more than a kind or 2 kinds in arginine residues, lysine residue and the serine residue constitutes and amino-acid residue add up to 2～20.

13. the described compound of claim 9 is characterized in that, in the formula (1a), and the peptide residue of R for constituting by 2～5 arginine residues.

14. the described compound of claim 9 is characterized in that, in the formula (1a), n1 is 0～2 integer, and n2 is 1～10 integer, and n3 is 0～2 integer.

15. the described compound of claim 9 is characterized in that, in the formula (1a), E is N, and m2 is 2, and m3 and m4 are 1, and m5 is 5.

16. the described compound of claim 9 is characterized in that, in the formula (1a), E is CH, and m2, m3 and m4 are 0, and m5 is 4.

17. complex chemical compound is characterized in that, synthesizes by described compound of claim 9 and the condensation reaction with compound of amino or hydroxyl.

18. the described complex chemical compound of claim 17 is characterized in that, described compound with amino or hydroxyl is PNA monomer or PNA oligomer.

19. the preparation method of the compound shown in the following general formula (1), it comprises following 1-1 operation～the 1st～5 operation:

In the formula (1), n1 represents 0～10 integer, and n2 represents 1～50 integer, and n3 represents 1～10 integer; M1 represents 0～100 integer, and m2 represents 0～100 integer, and m3 represents 0～100 integer, and m4 represents 0 or 1 integer, and m5 represents 0～100 integer, and m6 represents 0～100 integer; Y represents hydroxyl or amino; E represents N or CH; R represents amino-acid residue or the peptide residue that is made of 2～100 amino-acid residues; L represents hydrogen atom, have the group of lipid, have the group of fatty acid residue or have the group of fluorescence group; N1 is 2 when above, and the m1 among the repeating unit A can be the same or different between each repeating unit A; N2 is 2 when above, and m2～m5 among the repeating unit B and R can be the same or different between each repeating unit B; N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C;

1-1 operation: make the compound shown in the following general formula (I)

Condensation behind solid-phase resin or solid-phase compound, by carry out n3-1 condensation in the protecting group X of the compound of solid-phase resin or solid-phase compound remove and general formula (I) shown in the polycondensation of compound, obtain the operation of the compound shown in the following general formula (i),

In the formula (I), m6 is same as described above,

In the formula (i), n3, m6 and X are same as described above; " solid phase " expression solid-phase resin or solid-phase compound;

Condensation reaction, obtain the operation of the compound of following general formula shown in (ii),

In the formula (II), m2～m5 and X are same as described above, and Za represents the protecting group different with X, formula (ii) in, n2, n3, m2～m6, X, Za and " solid phase " are same as described above;

Condensation reaction, obtain the operation of the compound of following general formula shown in (iii),

In the formula (III), m1 and X are same as described above,

Formula (iii) in, n1～n3, m1～m6, X, Za and " solid phase " are same as described above;

The 1-4 operation: carry out in the functional group beyond the carboxyl that is incorporated into α position carbon atom, being combined with for 1～100 time the amino acid whose condensation reaction of protecting group Za by the compound of mutual-through type shown in (iii), obtain the operation of the compound of following general formula shown in (iv),

Formula (iv) in, n1～n3, m1～m6, X, RZa and " solid phase " are same as described above;

20. the preparation method of the compound shown in the following general formula (1a), it comprises following 3-1 operation～the 3rd～5 operation:

N1～n3, m1～m6, E, X and RZ are same as described above; Y is a hydroxyl; N1 is 2 when above, and the m1 among the repeating unit A can be the same or different between each repeating unit A; N2 is 2 when above, and m2～m5 among the repeating unit B and RZ can be the same or different between each repeating unit B; N3 is 2 when above, and the m6 among the repeating unit C can be the same or different between each repeating unit C;

3-1 operation: make the compound shown in the following general formula (I)

Polycondensation is after having amino solid-phase resin or solid-phase compound, by carrying out n3-1 polycondensation removing and, obtain the operation of the compound shown in the following general formula (i) in the protecting group X of the compound of solid-phase resin or solid-phase compound with the polycondensation of the compound shown in the general formula (I);

In the formula (I), m6 is same as described above,

In the formula (i), n3, m6 and X are same as described above, " solid phase " expression solid-phase resin or solid-phase compound;

Condensation reaction, obtain the operation of the compound of following general formula shown in (ii);

In the formula (II), m2～m5, X and Za are same as described above,

Formula (ii) in, n2, n3, m2～m6, X, Za and " solid phase " are same as described above;

Condensation reaction, obtain the operation of the compound of following general formula shown in (iii);

In the formula (III), m1 and X are same as described above,

3-4 operation: carry out on amino, being combined with for 1～100 time the amino acid whose condensation reaction of protecting group Z by the compound of mutual-through type shown in (iii), obtain the operation of the compound of following general formula shown in (iv);

Formula (iv) in, n1～n3, m1～m6, X, RZa and " solid phase " are same as described above,