CN101153277A - Method for producing recombination human tumor necrosis factor-alpha - Google Patents

Abstract

The present invention provides a nucleotide sequence of recombinant human tumor necrosis factor-alpha as well as a high efficiency production method of the recombinant human tumor necrosis factor-alpha, and construction, expression and purification art of related engineered cells. The protein gene of the optimized recombinant human tumor necrosis factor-alpha is very suitable for expressing in prokaryotic cells and improves the yield by optimizing with ferment and purification art at the same time, and has the advantages of high expression and high stability. The present invention can efficiently and conveniently obtain the pure recombinant human tumor necrosis factor-alpha at lower cost.

Description

The production method of recombination human tumor necrosis factor-alpha

Technical field

The present invention relates to the genetically engineered field.More specifically, the invention provides a kind of method of High-efficient Production recombinant human recombination human tumor necrosis factor-alpha, and the nucleotide sequence of relevant recombination human tumor necrosis factor-alpha, the structure of engineering cell, the expression and the purifying process of recombination human tumor necrosis factor-alpha.

Background technology

Tumour necrosis factor (Tumor Necrosis Factor alpha, TNF-α) is the cytokine that a class has extensive biological action.It is made up of 157 amino-acid residues, and the SDS-PAGE molecular weight is 17,000 daltonian protein.Natural TNF-α is mainly secreted with some clones such as cells such as HL-60, U937 by activating macrophage.The gene of TNF-α has successfully been cloned in many laboratories after the eighties, has promoted the further investigation of TNF-alpha molecule 26S Proteasome Structure and Function, and the research that is applied to clinical treatment for TNF-α provides competent source.

The main biological function of TNF-α has:

1. tumor-inhibiting action.The data tentative confirmation that lot of experiments and clinical I and II phase are used TNF-α some tumour cell is had cell toxicant and suppresses the effect of growth.But be not that whole tumour cells are all had retarding effect.For example in people's epithelial cancer cells 1st/3rd, TNF-α is had obvious cytotoxic reaction, other three/ first show as growth is suppressed, and a pair of TNF-α of its excess-three branch is insensitive.In the human leukemia cell to the TNF-alpha reaction the most responsive be T LL cell, secondly be the leukemia cell for medullary system and grain, to TNF-α susceptibility the poorest then be B LL cell.In all kinds of tumour cells such as some ovarian cancers, mammary cancer, myelomatosis, lung cancer, liver cancer and fibroblastoma to the susceptibility of TNF-α also difference to some extent.Know that therefrom TNF-α is not a spectrographic to the tumor-inhibiting action of tumour, but selectively.

Suppress virus or the cell of virus infection is had lethal effect 2.TNF-α has.TNF-α can produce the inhibition virus replication effect of dose-dependently, it can suppress the DNA viroid as adenovirus-2 type (Ad-2), herpes simplex C-type virus C II types (HSV-2) etc. also suppress RNA viruses as encephalomyocarditis disease (EMCV), stomatitis herpesvirus (VSV) etc.TNF-α can also kill and wound the cell selective of virus infection, and this may be because the cell after being infected by the virus strengthens TNF-α susceptibility.Has tangible cytotoxicity as the B cell of TNF-α after to ebv infection.TNF-α also has the effect that suppresses ox common people's leukosis virus (BLV).

3.TNF-α has activation to the multinuclear neutrophil leucocyte.TNF-α can promote the phagocytic function of multinuclear neutrophil leucocyte, makes the antibody of multinuclear neutrophil leucocyte mediation rely on obviously enhancing of complementation cell poison (ADCC) effect simultaneously, causes the lethal effect to tumour cell or virus infected cell to strengthen.

4.TNF-participating in immunity of organism, regulates α.Because TNF-α itself is the cytokine that a class has extensive biological effect, the variation of its generation and release and level affects the state and the function of other cytokine and effector directly or indirectly.Tumour cell generation cell toxicant or inhibiting TNF-α dosage are enough to cause the secretion of GM-CSF, IL-1, IL-2 and each parahormone and small molecules inflammation material, thereby cause the chain biological effect of a series of complexity.TNF-α has the effect of enhancement antigen inducing T cell propagation in immunity system, stimulate the growth of T cell clone, strengthens the antigenic expression of HLA-DR, also can be simultaneously that activated T cell surface IL-2 expression of receptor level increases.Someone thinks that also the graft versus host disease (GVH disease) (GVHD) in TNF-α and the organ transplantation has confidential relation, with the generation of the GVHD in the antibody prevention of organ transplant of anti-TNF-α with useful.

In numerous biological functions of TNF-α, its tumor-inhibiting action is people's attention extremely.1984, the cDNA of TNF cloned successfully, and its gene engineering product has been tried out in clinical.But distinct issues are that the TNF-α transformation period in vivo is short, and it is not remarkable that low dosage is injected anti-knurl effect.Reach the curative effect level, need to continue large bolus injection, considerably beyond people's tolerance dose, this tends to cause constitutional symptoms such as heating, shiver with cold, fatigue, headache, shock again, and clinical application effect is undesirable, thereby has limited widespread use clinically.Be to improve the anti-tumor activity of TNF-α, eliminate or reduce its toxic side effect, as early as possible TNF-α is applied to clinically, scientist has carried out unremitting effort both at home and abroad.The research of the novel TNF-α of preparation is on the research basis to hTNF2 α structure-function relationship on the one hand at present, and the TNF-alpha molecule is carried out structure of modification, obtains the derivative of TNF-α; Be that TNF-α can be merged with target cell specificity bonded protein or peptide with another on the other hand, construction of fusion protein increasing its concentration at the target cell position, thereby plays the effect that increases curative effect, reduces toxic side effect.

Its space structure of TNF-α of biologically active is the tripolymers of 3 TNF-α monomers with the approximate triangular pyramidal of opposite, limit form formation, and structure and functional study show, leave out N and hold preceding 7 amino-acid residues not influence TNF-α tripolymer space structure.When leaving out 7 amino-acid residues of N end, increase the basic aminoacids of N end, can strengthen forming active trimerical ability, thereby improve the anti-tumor activity of TNF-α.In addition, studies show that the hydrophobic amino acid that increases the C end can improve the anti-tumor activity of TNF-α.Based on TNF-α structure and function relationship, the investigator has carried out various rite-directed mutagenesises, and has obtained many novel and effective TNF-alpha derivatives the N end of TNF-α, the structure gene of C end both at home and abroad.

Based on TNF-α in vivo the transformation period weak point, less stable, to characteristics such as the specificity of target cell is not strong, many investigators will encode TNF-α with have the narrow spectrum protein gene of target cell by intermediate head or flexible arm connect into the coding single proteinic gene, the fusion protein expression vector that makes up and at expression in escherichia coli, the active detection confirms that these fusion roteins had both had the TNF-alpha active, has the guiding lethal effect again.

System of the present invention provides a kind of High-efficient Production reorganization humanTNF-'s method.By optimizing coding reorganization humanTNF-'s nucleotide sequence, adopt the humanization modified novel Pichia anomala expression system secreting, expressing humanTNF-of glycosyl, the combination of optimization expression carrier/host bacterium obtains high expression level, high yield, has a kind of reorganization humanTNF-production method of industrialization value.

Summary of the invention

Purpose of the present invention just provides a kind of efficient and/or easy production reorganization humanTNF-'s method.

Another object of the present invention just provides the proteic encoding sequence of recombinant human TNF-α and is used for the expression vector and the engineering cell of this method.

In a first aspect of the present invention, just provided a kind of proteic nucleotide sequence of coding reorganization humanTNF-of optimization, it is characterized in that the aminoacid sequence shown in the described nucleotide sequence coded SEQ ID NO:2.

In another preference, described nucleotide sequence contains the nucleotide sequence shown in the SEQ ID NO:1.

In a second aspect of the present invention, a kind of expression vector is provided, contain the described nucleotide sequence of claim 1.

In another preference, described expression vector is pPIC9K/TNF-α.

In a third aspect of the present invention, a kind of engineering cell is provided, it is characterized in that, be integrated with the described expression vector of claim 3.

In another preference, described engineering cell is through the humanization modified pichia spp (Pichia Pastoris) of glycosyl.

In another preference of the present invention, be integrated with humanTNF-'s encoding sequence of 2-30 copy in the genome of described pichia spp host cell.

In a fourth aspect of the present invention, a kind of production reorganization humanTNF-is provided proteic method, the method comprising the steps of: under the expression condition that is fit to, cultivate host cell as claimed in claim 4, thereby give expression to humanTNF-'s albumen; Preferably, described host cell is a pichia spp.

In another preference of the present invention, the culture condition of described step comprises:

Cultivation is divided into cultivation stage and induction period, it is 40-200 that cultivation stage cultivation bacterial concentration reaches OD600, induction time is 24-100hr, fermentation and inducing temperature remain on 28-30 ℃, the amount of trace element is 0.1-2ml/L, the pH value of inductive phase is 3-9, and inductive phase, methanol concentration was controlled at 0.5-5%.

Description of drawings

The homology of theoretical sequence of Fig. 1 .TNF-α and TNF-α majorizing sequence relatively.Query: natural TNF-α gene order; Sbjct: the TNF-α gene order of optimization.

The structure route map of Fig. 2 .pPIC9K/TNF-alpha expression plasmid.

Fig. 3. express engineering bacterium expression figure.1. standard protein molecular weight, 2-10:1-9 transformant (wherein 1-6, No. 9 clonal expression TNF α)

Embodiment

The inventor is extensive studies by going deep into, optimization design by gene coded sequence, humanTNF-'s encoding sequence (SEQ ID NO:1) after optimizing changed over to through the humanization modified methyl alcohol of glycosyl utilize type pichia spp (P.pastoris), thereby realized humanTNF-'s efficient secretory expression, and the humanTNF-who gives expression to keeps very high biologic activity.Finished the present invention on this basis.

The present invention is according to humanTNF-'s natural acid sequence, press codon-bias, under the condition that does not change aminoacid sequence, the complete proteic target gene sequences of gene synthesizing recombined human TNF-α, with this gene clone in the pUC19 after the sequence verification, with the ordinary method of molecular cloning, be cloned into expression vector pPIC9K, transform, be integrated into the P.pastoris host cell chromosome, by applying the transformant that antibiotic-screening goes out multi-copy integration, and then filter out the high expression level engineering cell.

In an example of the present invention, made up the P.pastoris yeast expression engineering cell of producing the reorganization humanTNF-, methanol induction, high-level secretory expression does not need renaturation.

The invention has the advantages that:

What (1) select for use is through the humanization modified pichia spp host cell of glycosyl, has kept humanTNF-'s biologic activity well.

(2) the reorganization humanTNF-protein gene after the optimization is highly suitable in the pichia spp and expresses, and has the characteristics of high expression level, high stable.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

The structure of embodiment 1 expression plasmid and the acquisition of high expression engineering strain

According to humanTNF-'s natural acid sequence, press codon-bias, under the condition that does not change aminoacid sequence, the pcr amplification proteic target gene sequences of humanTNF-that obtains recombinating is introduced the codon sequence through optimizing on the PCR primer.

The expression vector establishment method is seen Fig. 2.Obtain purpose human interferon beta gene by pcr amplification, with XhoI+EcoRI double digestion (MBI, 2*Tango ^TM, 37 ℃) and PCR product and pPIC9 plasmid (available from Invitrogen company).Two fragments are connected with the T4DNA ligase enzyme, connect the product conversion and enter bacillus coli DH 5 alpha (available from Promega company), containing selected clone on the LB flat board of penbritin, prepare plasmid in a small amount, go out positive colony, sequence verification by double digestion/PCR evaluation and screening.The pPIC9/TNF-α plasmid of a large amount of amplification conclusive evidences is with BamH I+EcoR I (MBI, 2*Tango ^TM, 37 ℃) and double digestion, reclaim small segment; Plasmid pPIC9K (available from Invitrogen company) handles with identical enzyme, reclaims big fragment.Two fragments are connected with the T4DNA ligase enzyme, connect the product conversion and enter bacillus coli DH 5 alpha, select positive colony on the LB flat board of penbritin and carry out plasmid enzyme restriction and identify containing, prepare plasmid in a small amount, go out positive colony by double digestion/PCR evaluation and screening.Acquisition contains the recombinant plasmid pPIC9K/TNF-α of TNF-α.

Express matter and draw pPIC9K/TNF-α after sequence verification, use the SalI linearization for enzyme restriction, electroporation transforms and enters pichia spp GS115 (available from Promega company), is applied to be cultured to transformant in 30 ℃ on the MD flat board and to grow, and screens the high expression level bacterial strain.PPIC9K/TNF-α plasmid (first sequence verification) is transformed the high expression level bacterial strain that has screened, screening G418 resistant strain.Identify the TNF-α resistance of yeast transformant with the dibbling method.G418 concentration is 0.5,1,2,3, the high resistance transformant of YPD plate screening of 4mg/mL with containing successively, and carries out little megger and reach the engineering yeast strain that screening obtains TNF-α high expression level.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Xinshengyuan Medicine Research Co., Ltd.

＜120〉reorganization humanTNF-'s production method

<160>2

<210>1

<211>456

<212>DNA

＜213〉artificial sequence

<221>misc_feature

<222>(1)…(456)

＜223〉the reorganization humanTNF-gene of You Huaing

<400>

atgagcaaaagaaagcctgtagcccatgttgtagcaaaccctcaagctgaggggcagctccagtggctgaaccgccgggccaatgccctcc

tggccaatggcgtggagctgagagataaccagctggtggtgccatcagagggcctgtacctcatctactcccaggtcctcttcaagggcca

aggctgcccctccacccatgtgctcctcacccacaccatcagccgcatcgccgtctcctaccagaccaaggtcaacctcctctctgccatcaa

gagcccctgccagagggagaccccagagggggctgaggccaagccctggtatgagcccatctatctgggaggggtcttccagctggaga

agggtgaccgactcagcgctgagatcaatcggcccgactatctcgactttgccgagtctgggcaggtctactttggtatcattgccttctga

<210>2

<211>151

<212>PRT

＜213〉homo sapiens

<400>2

1 MSKRKPVAHV?VANPQAEGQL?QWLNRRANAL?LANGVELRDN

41 QLVVPSEGLY?LIYSQVLFKG?QGCPSTHVLL?THTISRIAVS

81 YQTKVNLLSA?IKSPCQRETP?EGAEAKPWYE?PIYLGGVFQL

121?EKGDRLSAEI?NRPDYLDFAE?SGQVYFGIIA?F.

Claims (4)

1. proteic method of high expression level human tumor necrosis factor-alpha is characterized in that it comprises step:

(a) dna sequence dna of the tumor necrosis factor-alpha of acquisition optimization;

(b) make up suitable expression vector;

(c) transformed host cell, screening obtains the engineering cell of high expression level.

2. the method for claim 1 is characterized in that, the aminoacid sequence of the dna sequence encoding of the tumor necrosis factor-alpha of the optimization described in the step (a) shown in SEQ ID NO:2, and preferably, it is the dna sequence dna shown in the SEQ ID NO:1.

3. the method for claim 1 is characterized in that, the dna sequence dna of the tumor necrosis factor-alpha of the optimization described in the step (a) is cloned into suitable expression vector.Preferably, the expression vector described in the step (b) is pPIC9K/TNF α.

4. the method for claim 1 is characterized in that, the engineering cell described in the step (c) contains the dna sequence dna of described expression vector of claim 3 or the described coding recombination human tumor necrosis factor-alpha of claim 2.Preferably, described engineering cell is a pichia spp.

Images