CN101148477A - Streptavidin-interleukins 2 fusion protein - Google Patents
Streptavidin-interleukins 2 fusion protein Download PDFInfo
- Publication number
- CN101148477A CN101148477A CNA2007100301193A CN200710030119A CN101148477A CN 101148477 A CN101148477 A CN 101148477A CN A2007100301193 A CNA2007100301193 A CN A2007100301193A CN 200710030119 A CN200710030119 A CN 200710030119A CN 101148477 A CN101148477 A CN 101148477A
- Authority
- CN
- China
- Prior art keywords
- gly
- thr
- leu
- ala
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The present invention provides one kind of fusion protein, which consists of one chain avidin and one interleukin-2 connected through one junctional peptide in the amino acid sequence of SerSerGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGly Ser. The fusion protein has the activity of both chain avidin and interleukin-2, and can have its interleukin-2 anchored to the surface of biotinylated tumor cell by means of the powerful joint between the chain avidin and the biotin and exist stably on the surface of gamma ray deactivated tumor cell while maintaining the activity of interleukin-2. The tumor vaccine surface modified with the fusion protein has the functions of preventing and treating tumor.
Description
Technical field
The present invention relates to genetically engineered and protein engineering field, be specifically related to derive from the polypeptide, particularly interleukin II of animal.
Background technology
(Interleukin-2 is a kind of T cell growth factor and Signal Regulation molecule IL-2) to interleukin II, and very important immunoregulation effect is arranged.Following function is arranged: promote T cell proliferation, improve cytotoxic T cell, NK cell and monocytic activity; Induce growth of B cell and antibody to produce; The inducing peripheral blood lymphocyte is derived and is the LAK cell; Induce the cytokine secretion of secondary, as TNF α t, GM-CSF, IFN etc.; Strengthen the IL-2 receptor expression of T cell surface.Therefore, IL-2 has antiviral, antitumor and effect such as enhancing body immunologic function.The IL-2 gene is commonly used to modify tumour cell, and the preparation tumour-cell vaccine is to strengthen the immunogenicity of tumour antigen.Therapeutic strategy by original position gene transfection (or transduction) is expressed in tumor focus local implementation IL-2 continuous and effective demonstrates tempting prospect in the preclinical study of the shallow bladder cancer of table.But, be equipped with tumour-cell vaccine with the genetic modification legal system and have following inherent defect: modify efficient generally all lower (especially original position gene transfection or transduction), and depend on tumor cell type; More because of influence factor, the effective concentration of protein expression product that causes therapeutic gene is inaccessible and keep for a long time in the part, thereby actual antineoplastic clinical effectiveness is very limited; Because of individual difference and when obtaining tumor specimen tumour cell to survive state inconsistent, often some patient finally can not make the autologous tumor cell vaccine because of the state of surviving tumour cell preferably can't be provided; Potential virus vector safety issue (so-called " genetoxic ") and immunogenicity problem (using same virus vector can influence the expression efficiency of quiding gene repeatedly) are often arranged; Be difficult to efficiently express simultaneously and a plurality ofly have the synergistic immunostimulation factor, and their expression amount is accurately controlled.In addition, the autologous tumor cell vaccine production of genetic modification is more time-consuming, is difficult for carrying out on a large scale and being extensive use of.
Summary of the invention
The technical problem to be solved in the present invention provides a kind ofly can carry out the novel interleukin II that tumor cell surface was modified and can for good and all be anchored on to accelerated surface to tumour cell.
The technical scheme that the present invention solves the problems of the technologies described above is:
A kind of fusion rotein, this albumen connects a streptavidin by the joint peptide and an interleukin II constitutes, and the aminoacid sequence of wherein said joint peptide is Ser Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser.
Streptavidin in the fusion rotein of the present invention is positioned at the N end or the C end of joint peptide; Wherein the streptavidin specific activity streptavidin of fusion rotein (as SEQ NO.2) that is positioned at the N end of joint peptide is positioned at the fusion rotein (as SEQ NO.1) of C end of joint peptide more than the high twice.
Fusion rotein of the present invention can by with streptavidin gene, interleukin-2 gene and the joint polynucleotide that connect described streptavidin and interleukin II by gene recombination, transform and make up engineering bacterium expression and obtain, wherein the method for gene recombination and conversion is the technology that those of ordinary skills know well.
Separation and purification for the ease of fusion rotein, the end of the streptavidin of fusion rotein of the present invention part can also be connected with purification tag, and the N end that is connected with the streptavidin of histidine-tagged, of the present invention fusion rotein SEQ NO.4 as the C end of the streptavidin of fusion rotein SEQ NO.3 of the present invention is connected with histidine-tagged.
The present invention also provides a kind of polynucleotide of code book invention fusion rotein, and these polynucleotide are formed by connecting by TCG AGC GGG GGC AGC GGG GGC GGA GGC AGC GGCGGG GGC GGATCC by ripe streptavidin cDNA, plain-2 cDNA of eukocyte Jie; The end of ripe streptavidin cDNA can also be connected with CATCATCAC CATCAC CAT in these polynucleotide.
The polynucleotide of described code book invention fusion rotein are inserted in the prokaryotic expression carrier by gene recombination, and transformed into escherichia coli can obtain to efficiently express the engineering bacteria of fusion rotein of the present invention then; Described prokaryotic expression carrier can be pET24a or pET24d, and intestinal bacteria are BL21 (DE3).
Fusion rotein of the present invention main form with inclusion body in above-mentioned engineering bacteria exists, and after separation and purification albumen and renaturation are handled from inclusion body, can obtain fusion rotein of the present invention.
Fusion rotein of the present invention adopts the link peptide that is rich in glycine and Serine to be connected interleukin II and streptavidin, this 15 peptide is very flexible, help the independence of each unit protein molecule in the fusion rotein folding, thereby preserve biological activity separately, make fusion rotein have the double activity of streptavidin and interleukin II, can combine with the brute force of vitamin H by streptavidin interleukin II is anchored on biotinylated tumor cell surface, and can be, and still keep the activity of interleukin II at gamma-rays deactivation tumor cell surface stable existence.
Effect through the tumor vaccine of fusion rotein finishing of the present invention has prevention and treatment tumour can be used for preparing preventative and the vaccine therapeutic tumour.Tumor vaccine of the present invention is anchored on biotinylated tumor cell surface with fusion rotein of the present invention and obtains.
The preparation of tumor vaccine of the present invention has made full use of proteinic amino, and (promptly-NH2) easily biotinylation and vitamin H combine this two characteristics with the efficient and strong reversible hardly of streptavidin, with biotinylation reagent the vitamin H chemistry is linked to the tumor cell surface that desire is modified earlier, fusion rotein of the present invention then for good and all is anchored on tumor cell surface by the specific combination of streptavidin and vitamin H rapidly with interleukin II, thereby makes interleukin II reach the treatment concentration of continuous and effective in the part; Moreover because streptavidin albumen can be in conjunction with four vitamin Hs, so the amount that fusion rotein of the present invention anchors to tumour cell can accurately be controlled.
Description of drawings
Fig. 1 is the structure iron of IL2-L-SA-6His-pET24 recombinant plasmid.
Fig. 2 is the structure iron of 6His-SA-L-IL2-pET24 recombinant plasmid.
Fig. 3 is the SDS-PAGE electrophorogram of fusion rotein IL2-L-SA-6His, and wherein 1 is molecular weight standard, the 2nd, and before engineering bacteria is induced, the 3rd, after engineering bacteria is induced; The 4th, inclusion body, the 5th, behind the Ni-NTA column chromatography; The 6th, behind the 2-Iminobiotin affinity column chromatography.
Fig. 4 resists through flow cytometer being anchored on the result that fusion rotein of the present invention detects on the biotinylated B16.F10 surface with anti-IL-2 monoclonal antibody and fluorescently-labeled two, peak, a left side is the cell (negative control) of unmodified, and the cell that right peak is modified for fusion rotein grappling of the present invention.
Fig. 5 carries out the result of biological activity determination with PHA stimulation human peripheral blood lymphocyte mtt assay to the IL-2 that is anchored on fusion rotein of the present invention on the biotinylated B16.F10 surface, to be anchored on the negative contrast of GFP-L-SA on the biotinylated B16.F10 surface; Wherein
Represent fusion rotein of the present invention,
Expression fusion rotein GFP-L-SA.
Fig. 6 is the tumor growth situation graphic representation of the prophylaxis of tumours mouse model behind the inoculation tumor vaccine of the present invention, the B6.F10 tumour-cell vaccine of modifying with GFP-L-SA is an experiment contrast, wherein solid line is represented fusion rotein group of the present invention, and dotted line is represented the GFP-L-SA control group.
Fig. 7 is the mouse survival condition graphic representation of the prophylaxis of tumours mouse model behind the inoculation tumor vaccine of the present invention, the B6.F10 tumour-cell vaccine of modifying with GFP-L-SA is an experiment contrast, wherein solid line is represented fusion rotein group of the present invention, and dotted line is represented the GFP-L-SA control group.
Fig. 8 is the mouse survival condition graphic representation of the treatment mice with tumor model behind the inoculation tumor vaccine of the present invention, the B6.F10 tumour-cell vaccine of modifying with GFP-L-SA is an experiment contrast, wherein solid line is represented fusion rotein group of the present invention, and dotted line is represented the GFP-L-SA control group.
To further specify the technique effect that the present invention and the present invention have by embodiment below.
Embodiment
Following embodiment and used material and the equipment of experiment are as follows:
Cell strain, bacterial strain and plasmid: B16.F10 (strain of mouse melanoma cell); Bacterial strain Streptomyces avidinii (the avidin streptomycete, ATCC), DH5a and BL21 (DE3); Prokaryotic expression plasmid pET24a (Kana
r, Novagen).
Main biochemical reagents and material: DNeasy organize the preparation test kit (Qiagen) of test kit and plasmid DNA, synthetic (Sigma) of oligonucleotide, Trizol, SuperScript II reversed transcriptive enzyme, Platinum Pfx archaeal dna polymerase and T4 dna ligase (Invitrogen); IL-2 standard substance (R﹠amp; D Systems), agarose and SDS-PAGE (Biorad); 2-Iminobiotin (Sigma) and Ni-NTA (Qiagen) filler; Sulfo-NHS-LC-Biotin (Pierce) and anti-IL-2 monoclonal antibody (BDBiosciences Pharmingen).
The connection of dna fragmentation, conversion and transformant screening, restriction endonuclease analysis, the equal reference literature of ordinary method (Sambrook J such as SDS-polyacrylamide gel point swimming, et al.Molecular Cloning-A Laboratory Manual, ColdSpring Harbor Laboratory Press, New York, 2nd edition, 1989) or the product description that provides of producer; Dna sequence analysis is finished in the dna sequencing service centre of Dalian Bao Bio-Engineering Company.
The preparation of example 1 fusion rotein IL2-L-SA-6His
1, organizes test kit to go out the genomic dna of bacterium with DNeasy, use it then, carry out PCR by Platinum pfx archaeal dna polymerase and prepare ripe streptavidin cDNA as template from the extracting of avidin streptomycete.
Primer: 5 ' GGAATTCTCAAGCGGGGGCAGCGGGGGCGGAGGCAGCGGCGGGGGCGGATCCG CCGACCCCTCCAAGGACTCGAAGGCC 3 ' (78nt) and
5’GTGGTGCTCGAGCTGCTGAACGGCGTCGAGCGGGTTGCC?3’(39nt)。
Reaction conditions: 94 ℃ of sex change, 2min, circulation (94 ℃, 15s → 60 ℃, 30s) 25 take turns 15s → 68 ℃, and last 68 ℃, 5min.
2, play total RNA of PHA-activatory peripheral blood lymphocyte with the Trizol extracting, and with it as template, carry out RT-PCR and prepare ripe IL-2 cDNA.
Primer: 5 ' CATGCCATGGCTCCTACTTCAAGTTCTACAAAG 3 ' (33nt) and
5’GGAATTCAGTCAGTGTTGAGATGATGCTTTG?3’(31nt)
Reaction conditions: 94 ℃ of sex change, 2min, circulation (94 ℃, 15s → 60 ℃, 30s) 25 take turns 15s → 68 ℃, and last 68 ℃, 5min.
3, make up the IL2-L-SA-6His-pET24 recombinant plasmid
The IL-2 cDNA of preparation (does not contain stop code, two ends contain NcoI and EcoRI restriction endonuclease sites respectively) and SA cDNA (do not contain stop code, two ends contain EcoRI and XhoI restriction endonuclease sites respectively), above-mentioned IL-2 and SA gene fragment clone in the pET-24d carrier, are obtained IL2-L-SA-6His-pET24 recombinant expression plasmid (structure iron as shown in Figure 1).Wherein L is the connection peptides (17 peptide) that is rich in glycine, Serine.Recombinant expression plasmid is identified through dna sequence analysis, verifies that it is correct.
4, make up IL2-L-SA-6His-pET24/BL21 (DE3) engineering bacteria
After the IL2-L-SA-6His-pET24 recombinant expression plasmid transforms back BL21 (DE3) competent cell, with the LB plate screening that contains kantlex.Single colony inoculation on the picking conversion plate is in the LB substratum that is added with kantlex (20 μ g/ml).Being expanded to absorbance A 600 through 37 ℃ of shaking tables cultivations is 0.4～0.5 o'clock, adding final concentration is the IPTG of 0.1mmol/L, 37 ℃ of abduction delivering 4h, centrifugal (results of 8000g * 10min) thalline, with after the cytoclasis with 12% SDS-PAGE check and analysis Expression of Fusion Protein situation.
5, the expression of fusion rotein IL2-L-SA-6His
Fusion rotein 6His-SA-L-IL2 main form with inclusion body in thalline exists, and its expression amount reaches 20～30%.
6, from inclusion body, obtain fusion rotein IL2-L-SA-6His
A. prepare inclusion body: 5 gram thalline are suspended among the 100ml 1xPBS, ultrasonic in the ice bath (electric current 270mA), 30 seconds * 10 times (each 30 seconds at interval); Then in 4 ℃ centrifugal 10 minutes (8000g), precipitation is suspended among the 100ml 1xPBS (including 4mol/L urea, 0.5%Triton X-100,20mmol/L EDTA) carries out rinsing, centrifugal subsequently (1000g * 10 minute) collecting precipitation; After twice of the rinsing, be dissolved in the 100mmol/L sodium phosphate buffer, in the 8mol/L urea (pH 8.0), supernatant liquor is got in 15000g * 15 minute.
The b.Ni-NTA column chromatography: the supernatant liquor that step a is obtained is splined on the Ni-NTA post, and (2.6 * 5cm), (100mmol/L sodium phosphate buffer, 8mol/L urea pH8.0) wash to sample A with balance liquid
280Return to baseline; (100mmol/L sodium phosphate buffer, 8mol/L urea pH4.5) carry out wash-out, and elutriant is identified through SDS-PAGE, collects fusion rotein mass peak (molecular weight of fusion rotein IL2-L-SA-6His is 34KD) to use elutriant then.
C. the renaturation of dialysing: the IL2-L-SA-6His fusion rotein that the Ni-NTA column chromatography purification is obtained transfers to OD
280=0.2,4 ℃ of dialysis renaturation are 12 hours in greater than the dialyzate of 20 times of volumes (the 1mmol/L reduced glutathione, 0.2mmol/L oxidized form Triptide, pH 9.0 for 100mmol/L NaHCO3,1.0mol/L urea); At 50mmol/L NaHCO3,500mmol/L NaCl continues dialysis 6 hours among the pH 11 then; The centrifugal insolubles of removing is collected supernatant.
D.2-Iminobiotin affinity column chromatography: with balance liquid (50mmol/LNaHCO3,500mmol/LNaCl, pH 11) (column volume 0.5 * 2cm) with affinity column on the fused protein of the renaturation liquid of collecting, and is eluted to sample A with balance liquid behind 5 column volumes of wash-out
280Return to baseline; Then, use 50mmol/L NaAc, the pH4.0 wash-out is in charge of and is collected each elution peak, and (500mmol/L NaHCO3,5mol/L NaCl pH11) transfer to pH8.0 with the fused protein liquid of collecting, and the filtration sterilization packing, are stored in-20 ℃ with the 10x balance liquid.
Gained fusion rotein IL2-L-SA-6His identifies that with SDS-PAGE the result as shown in Figure 3.
7, utilize PHA stimulation human peripheral blood lymphocyte that the activity of IL-2 is measured, the IL-2 activity that records is 1 * 10
6U/mg.
The preparation of example 2 fusion rotein 6His-SA-L-IL2
1, the ripe streptavidin cDNA of preparation: method and example 1 are together.
Primer:
5 ' GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGCACCTGG3 ' (55nt) and
5’GGAATTCGGCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCGCTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC?3’(82nt)。
2, the ripe IL-2 cDNA of preparation: method and example 1 are together.
Primer:
5’GGAATTCATGGCTCCTACTTCAAGTTCTAC?3’(30nt)
With 5 ' CCCAAGCTTTCAAGTCAGTGTTGAGATGATGCTTTG 3 ' (36nt).
3, make up the 6His-SA-L-IL2-pET24 recombinant plasmid
The SA cDNA of preparation (does not contain stop code, two ends contain NdeI and EcoRI restriction endonuclease sites respectively) and IL-2 cDNA (two ends contain EcoRI and HindIII restriction endonuclease sites respectively), above-mentioned SA and IL-2 gene fragment clone in the pET-24a carrier, are obtained 6His-SA-L-IL2-pET24 recombinant expression plasmid (structure iron as shown in Figure 2).Wherein L is the connection peptides that is rich in glycine, Serine.Recombinant expression plasmid is identified through dna sequence analysis, verifies that it is correct.
4, make up 6His-SA-L-IL2-pET24/BL21 (DE3) engineering bacteria: method and example 1 are together.
5, the expression of fusion rotein 6His-SA-L-IL2
Fusion rotein 6His-SA-L-IL2 main form with inclusion body in thalline exists, and the molecular weight of 6His-SA-L-IL2 fusion rotein is 33KD, and its expression amount reaches 20～30%.
6, obtain fusion rotein 6His-SA-L-IL2 from inclusion body: method and example 1 are together.
7, utilize PHA stimulation human peripheral blood lymphocyte that the activity of IL-2 is measured, the IL-2 activity that records is 2 * 10
6U/mg is that the IL2-L-SA-6His fusion rotein is corresponding to 2 times that live.
The preparation of the tumor vaccine that example 3 IL2-L-SA-6His or 6His-SA-L-IL2 fusion rotein are modified
With 10
7Individual B16.F10 cell suspension is in 1ml 1 * PBS, and behind adding 0.5mg Sulfo-NHS-LC-Biotin and the mixing, effect is 30 minutes under the room temperature; Behind 1 * PBS washed cell 3 times, per 10
6Individual B16.F10 cell adds 200ngIL2-L-SA-6His or 6His-SA-L-IL2 fusion rotein, acts on 30 minutes on ice; Behind 1 * PBS washed cell 1 time, use gamma-rays deactivation (20000rad) to get final product then.
Example 4 fusion roteins of the present invention are to the modification effect and the Detection of Stability thereof of tumour cell
Anti-detect being anchored on lip-deep IL2-L-SA-6His of biotinylated B16.F10 or 6His-SA-L-IL2 fusion rotein with anti-IL-2 monoclonal antibody and fluorescently-labeled two through flow cytometer, the results are shown in Figure 4, almost 100% tumour cell is modified, and tumor cell surface has a large amount of IL-2.Stability to the IL2-L-SA-6His fusion rotein that is anchored on tumor cell surface is carried out analysis revealed through flow cytometer, and the fusion rotein of these grapplings does not have remarkable decline in the quantity of cell surface in a week.
5 pairs of examples are anchored on the lip-deep fusion rotein of the present invention of biotinylated B16.F10 and carry out the bioactive mensuration of IL-2
At first with surface grappling IL2-L-SA-6His or 6His-SA-L-IL2 fusion rotein 10
6Individual B16.F10 is through ultrasonication, its insoluble film composition of centrifugal collection; Then it is suspended in the 100 μ l perfect mediums, with PHA stimulation human peripheral blood lymphocyte mtt assay wherein IL-2 is carried out biological activity determination, the result as shown in Figure 5, the growing multiplication of activated lymphocytes depends on the insoluble film dose of components that cell is modified in grappling, shows that IL2-L-SA-6His or 6His-SA-L-IL2 fusion rotein are anchored on the biological activity that still can keep IL-2 behind the cell surface.
The effect of the B6.F10 tumour-cell vaccine prophylaxis of tumours that example 6 fusion roteins of the present invention are modified
(1) material:
Tumor vaccine of the present invention: the preparation method sees embodiment 3; GFP-L-SA-6His (being the fusion rotein of green fluorescent protein and streptavidin) B6.F10 tumour cell that modify, gamma-rays deactivation (20000rad): as the negative control of experiment.
(2) method:
Respectively with 10
6Individual GFP-L-SA-6His B6.F10 tumour cell that modify, gamma-rays deactivation (20000rad) and tumor vaccine of the present invention are inoculated in the intracutaneous of C57BL/6 mouse left side rib belly, strengthen once after 14 days; After 7 days, with 10
5Without subcutaneous in the right rib belly of mouse of the B6.F10 tumor cell inoculation of any processing, observe growth of tumor situation and the mouse situation that survives in 40 days then
(3) result:
Have 20% immune mouse to obtain 100% protection (promptly not having tumor growth), negative control group all has tumor growth (Fig. 6).Simultaneously, the existence number of the preventive vaccination group of tumor vaccine of the present invention and be significantly higher than the negative control group (Fig. 7) that GFP modifies lifetime.
The effect of the B6.F10 tumour-cell vaccine treatment tumour that example 7 fusion roteins of the present invention are modified.
(1) material: see embodiment 6.
(2) method
With 10
5Individual B6.F10 tumor cell inoculation without any processing is subcutaneous in the right rib belly of mouse; After 4,11 and 18 days, respectively with 10
6GFP-L-SA-6His or IL2-L-SA-6His B6.F10 tumor cell inoculation that modify, gamma-rays deactivation (20000rad) is observed growth of tumor situation and the mouse situation that survives in 40 days then in the intracutaneous of C57BL/6 mouse left side rib belly.
(3) result
As shown in Figure 8, the existence number of tumor vaccine treatment group of the present invention and be significantly higher than the negative control group that GFP modifies lifetime.
SEQUENCE?LISTING
＜110〉Nanfang Medical Univ
＜120〉plain 2 fusion roteins of streptavidin/interleukin
<160>4
<170>PatentIn?version?3.3
<210>1
<211>310
<212>PRT
＜213〉artificial sequence
<220>
<221>CHAIN
<222>(1)..(136)
＜223〉the ripe IL-2 of people
<220>
<221>DOMAIN
<222>(137)..(151)
＜223〉the link peptide (L) of glycine and Serine, this 15 peptide is very flexible, helps the independence of each unit protein molecule in the fusion rotein folding, thereby preserves biological activity separately, finally improves the double activity of fusion rotein.
<220>
<221>CHAIN
<222>(152)..(310)
＜223〉the sophisticated total length streptavidin of streptomycete (SA)
<400>1
Met?Ala?Pro?Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu?Gln?Leu?Glu
1 5 10 15
His?Leu?Leu?Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile?Asn?Asn?Tyr
20 25 30
Lys?Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro
35 40 45
Lys?Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu
50 55 60
Lys?Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His
65 70 75 80
Leu?Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu
85 90 95
Leu?Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr
100 105 110
Ala?Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser
115 120 125
Ile?Ile?Ser?Thr?Leu?Thr?Glu?Phe?Ser?Ser?Gly?Gly?Ser?Gly?Gly?Gly
130 135 140
Gly?Ser?Gly?Gly?Gly?Gly?Ser?Asp?Pro?Ser?Lys?Asp?Ser?Lys?Ala?Gln
145 150 155 160
Val?Ser?Ala?Ala?Glu?Ala?Gly?Ile?Thr?Gly?Thr?Trp?Tyr?Asn?Gln?Leu
165 170 175
Gly?Ser?Thr?Phe?Ile?Val?Thr?Ala?Gly?Ala?Asp?Gly?Ala?Leu?Thr?Gly
180 185 190
Thr?Tyr?Glu?Ser?Ala?Val?Gly?Asn?Ala?Glu?Ser?Arg?Tyr?Val?Leu?Thr
195 200 205
Gly?Arg?Tyr?Asp?Ser?Ala?Pro?Ala?Thr?Asp?Gly?Ser?Gly?Thr?Ala?Leu
210 215 220
Gly?Trp?Thr?Val?Ala?Trp?Lys?Asn?Asn?Tyr?Arg?Asn?Ala?His?Ser?Ala
225 230 235 240
Thr?Thr?Trp?Ser?Gly?Gln?Tyr?Val?Gly?Gly?Ala?Glu?Ala?Arg?Ile?Asn
245 250 255
Thr?Gln?Trp?Leu?Leu?Thr?Ser?Gly?Thr?Thr?Glu?Ala?Asn?Ala?Trp?Lys
260 265 270
Ser?Thr?Leu?Val?Gly?His?Asp?Thr?Phe?Thr?Lys?Val?Lys?Pro?Ser?Ala
275 280 285
Ala?Ser?Ile?Asp?Ala?Ala?Lys?Lys?Ala?Gly?Val?Asn?Asn?Gly?Asn?Pro
290 295 300
Leu?Asp?Ala?Val?Gln?Gln
305 310
<210>2
<211>299
<212>PRT
＜213〉artificial sequence
<220>
<221>CHAIN
<222>(1)..(147)
＜223〉streptavidin; With sophisticated total length mutually this, lacked 13 amino acid at N-end.
<220>
<221>DOMAIN
<222>(148)..(165)
＜223〉connection peptides, and its 3 ' end contains the restriction enzyme site of BamHI and EcoRI.
<220>
<221>CHAIN
<222>(166)..(299)
＜223〉the ripe IL2 of people.
<400>2
Met?Glu?Ala?Gly?Ile?Thr?Gly?Thr?Trp?Tyr?Asn?Gln?Leu?Gly?Ser?Thr
1 5 10 15
Phe?Ile?Val?Thr?Ala?Gly?Ala?Asp?Gly?Ala?Leu?Thr?Gly?Thr?Tyr?Glu
20 25 30
Ser?Ala?Val?Gly?Asn?Ala?Glu?Ser?Arg?Tyr?Val?Leu?Thr?Gly?Arg?Tyr
35 40 45
Asp?Ser?Ala?Pro?Ala?Thr?Asp?Gly?SerGly?Thr?Ala?Leu?Gly?Trp?Thr
50 55 60
Val?Ala?Trp?Lys?Asn?Asn?Tyr?Arg?Asn?Ala?His?Ser?Ala?Thr?Thr?Trp
65 70 75 80
Ser?Gly?Gln?Tyr?Val?Gly?Gly?Ala?Glu?Ala?Arg?Ile?Asn?Thr?Gln?Trp
85 90 95
Leu?Leu?Thr?Ser?Gly?Thr?Thr?Glu?Ala?Asn?Ala?Trp?Lys?Ser?Thr?Leu
100 105 110
Val?Gly?His?Asp?Thr?Phe?Thr?Lys?Val?Lys?Pro?Ser?Ala?Ala?Ser?Ile
115 120 125
Asp?Ala?Ala?Lys?Lys?Ala?Gly?Val?Asn?Asn?Gly?Asn?Pro?Leu?Asp?Ala
130 135 140
Val?Gln?Gln?Ser?Ser?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly
145 150 155 160
Gly?Ser?Ala?Glu?Phe?Met?Ala?Pro?Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr
165 170 175
Gln?Leu?Gln?Leu?Glu?His?Leu?Leu?Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn
180 185 190
Gly?Ile?Asn?Asr?Tyr?Lys?Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe
195 200 205
Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys
210 215 220
Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln
225 230 235 240
Ser?Lys?Asn?Phe?His?Leu?Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn
245 250 255
Val?Ile?Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu
260 265 270
Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile
275 280 285
Thr?Phe?Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu?Thr
290 295
<210>3
<211>316
<212>PRT
＜213〉artificial sequence
<220>
<221>CHAIN
<222>(1)..(136)
＜223〉cDNA of the ripe IL-2 of people
<220>
<22l>DOMAIN
<222>(137)..(151)
＜223〉richness is closed the link peptide (L) of glycine and Serine, and this 15 peptide is very flexible, helps the independence of each unit protein molecule in the fusion rotein folding, thereby preserves biological activity separately, finally improves the double activity of fusion rotein.
<220>
<221>CHAIN
<222>(152)..(3l0)
＜223〉the sophisticated total length streptavidin of streptomycete.
<220>
<221>PEPTIDE
<222>(311)..(318)
＜223〉histidine-tagged
<400>3
Met?Ala?Pro?Thr?Ser?Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu?Gln?Leu?Glu
1 5 10 15
His?Leu?Leu?Leu?Asp?Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile?Asn?Asn?Tyr
20 25 30
Lys?Asn?Pro?Lys?Leu?Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro
35 40 45
Lys?Lys?Ala?Thr?Glu?Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu
50 55 60
Lys?Pro?Leu?Glu?Glu?Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His
65 70 75 80
Leu?Arg?Pro?Arg?Asp?Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu
85 90 95
Leu?Lys?Gly?Ser?Glu?Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr
100 105 110
Ala?Thr?Ile?Val?Glu?Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser
115 120 125
Ile?Ile?Ser?Thr?Leu?Thr?Glu?Phe?Ser?Ser?Gly?Gly?Ser?Gly?Gly?Gly
130 135 140
Gly?Ser?Gly?Gly?Gly?Gly?Ser?Asp?Pro?Ser?Lys?Asp?Ser?Lys?Ala?Gln
145 150 155 160
Val?Ser?Ala?Ala?Glu?Ala?Gly?Ile?Thr?Gly?Thr?Trp?Tyr?Asn?Gln?Leu
165 170 175
Gly?Ser?Thr?Phe?Ile?Val?Thr?Ala?Gly?Ala?Asp?Gly?Ala?Leu?Thr?Gly
180 185 190
Thr?Tyr?Glu?Ser?Ala?Val?Gly?Asn?Ala?Glu?Ser?Arg?Tyr?Val?Leu?Thr
195 200 205
Gly?Arg?Tyr?Asp?Ser?Ala?Pro?Ala?Thr?Asp?Gly?Ser?Gly?Thr?Ala?Leu
210 215 220
Gly?Trp?Thr?Val?Ala?Trp?Lys?Asn?Asn?Tyr?Arg?Asn?Ala?His?Ser?Ala
225 230 235 240
Thr?Thr?Trp?Ser?Gly?Gln?Tyr?Val?Gly?Gly?Ala?Glu?Ala?Arg?Ile?Asn
245 250 255
Thr?Gln?Trp?Leu?Leu?Thr?Ser?Gly?Thr?Thr?Glu?Ala?Asn?Ala?Trp?Lys
260 265 270
Ser?Thr?Leu?Val?Gly?His?Asp?Thr?Phe?Thr?Lys?Val?Lys?Pro?Ser?Ala
275 280 285
Ala?Ser?Ile?Asp?Ala?Ala?Lys?Lys?Ala?Gly?Val?Asn?Asn?Gly?Asn?Pro
290 295 300
Leu?Asp?Ala?Val?Gln?Gln?Leu?Glu?His?His?His?His?His?His
305 310 315
<210>4
<211>305
<212>PRT
＜213〉artificial sequence
<220>
<221>PEPTIDE
<222>(2)..(7)
＜223〉histidine-tagged
<220>
<221>CHAIN
<222>(8)..(153)
＜223〉streptavidin; With sophisticated total length mutually this, lacked 13 amino acid at N-end.
<220>
<221>DOMAIN
<222>(154)..(171)
＜223〉connection peptides, and its 3 ' end contains the restriction enzyme site of BamHI and EcoRI.
<220>
<221>CHAIN
<222>(173)..(305)
＜223〉the ripe IL2 of people
<400>4
Met?His?His?His?His?His?His?Glu?Ala?Gly?Ile?Thr?Gly?Thr?Trp?Tyr
1 5 10 15
Asn?Gln?Leu?Gly?Ser?Thr?Phe?Ile?Val?Thr?Ala?Gly?Ala?Asp?Gly?Ala
20 25 30
Leu?Thr?Gly?Thr?Tyr?Glu?Ser?Ala?Val?Gly?Asn?Ala?Glu?Ser?Arg?Tyr
35 40 45
Val?Leu?Thr?Gly?Arg?Tyr?Asp?Ser?Ala?Pro?Ala?Thr?Asp?Gly?Ser?Gly
50 55 60
Thr?Ala?Leu?Gly?Trp?Thr?Val?Ala?Trp?Lys?Asn?Asn?Tyr?Arg?Asn?Ala
65 70 75 80
His?Ser?Ala?Thr?Thr?Trp?Ser?Gly?Gln?Tyr?Val?Gly?Gly?Ala?Glu?Ala
85 90 95
Arg?Ile?Asn?Thr?Gln?Trp?Leu?Leu?Thr?Ser?Gly?Thr?Thr?Glu?Ala?Asn
100 105 110
Ala?Trp?Lys?Ser?Thr?Leul?Val?Gly?His?Asp?Thr?Phe?Thr?Lys?Val?Lys
115 120 l25
Pro?Ser?Ala?Ala?Ser?Ile?Asp?Ala?Ala?Lys?Lys?Ala?Gly?Val?Asn?Asrn
130 135 140
Gly?Asn?Pro?Leu?Asp?Ala?Val?Gln?Gln?Ser?Ser?Gly?Gly?Ser?Gly?Gly
145 150 155 160
Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Ala?Glu?Phe?Met?Ala?Pro?Thr?Ser
165 170 175
Ser?Ser?Thr?Lys?Lys?Thr?Gln?Leu?Gln?Leu?Glu?His?Leu?Leu?Leu?Asp
180 185 190
Leu?Gln?Met?Ile?Leu?Asn?Gly?Ile?Asn?Asn?Tyr?Lys?Asn?Pro?Lys?Leu
195 200 205
Thr?Arg?Met?Leu?Thr?Phe?Lys?Phe?Tyr?Met?Pro?Lys?Lys?Ala?Thr?Glu
210 215 220
Leu?Lys?His?Leu?Gln?Cys?Leu?Glu?Glu?Glu?Leu?Lys?Pro?Leu?Glu?Glu
225 230 235 240
Val?Leu?Asn?Leu?Ala?Gln?Ser?Lys?Asn?Phe?His?Leu?Arg?Pro?Arg?Asp
245 250 255
Leu?Ile?Ser?Asn?Ile?Asn?Val?Ile?Val?Leu?Glu?Leu?Lys?Gly?Ser?Glu
260 265 270
Thr?Thr?Phe?Met?Cys?Glu?Tyr?Ala?Asp?Glu?Thr?Ala?Thr?Ile?Val?Glu
275 280 285
Phe?Leu?Asn?Arg?Trp?Ile?Thr?Phe?Cys?Gln?Ser?Ile?Ile?Ser?Thr?Leu
290 295 300
Thr
305
Claims (10)
1. fusion rotein, this albumen connects a streptavidin by the joint peptide and an interleukin II constitutes, and the aminoacid sequence of wherein said joint peptide is Ser Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala.
2. a kind of fusion rotein according to claim 1 is characterized in that described streptavidin is positioned at the N end of joint peptide.
3. a kind of fusion rotein according to claim 2, its aminoacid sequence are SEQ.NO2.
4. a kind of fusion rotein according to claim 1 is characterized in that described streptavidin is positioned at the C end of joint peptide.
5. fusion rotein according to claim 1 is characterized in that the end of described streptavidin part is connected with purification tag.
6. gene, this genes encoding claim 1,2,3 or 4 fusion roteins.
7. expression vector, this expression vector contains the described gene of claim 5.
8. engineering bacteria, this project bacterium has transformed the described expression vector of claim 6.
9. claim 1,2, the application of 3 or 4 described fusion roteins in the preparation tumor vaccine.
10. tumor vaccine, this tumor vaccine anchor to claim 1,2,3 or 4 described fusion roteins through biotinylated surface of tumor cells and obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100301193A CN101148477A (en) | 2007-09-06 | 2007-09-06 | Streptavidin-interleukins 2 fusion protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007100301193A CN101148477A (en) | 2007-09-06 | 2007-09-06 | Streptavidin-interleukins 2 fusion protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101148477A true CN101148477A (en) | 2008-03-26 |
Family
ID=39249188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007100301193A Pending CN101148477A (en) | 2007-09-06 | 2007-09-06 | Streptavidin-interleukins 2 fusion protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101148477A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112154153A (en) * | 2018-03-28 | 2020-12-29 | 百时美施贵宝公司 | Interleukin-2/interleukin-2 receptor alpha fusion proteins and methods of use |
-
2007
- 2007-09-06 CN CNA2007100301193A patent/CN101148477A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112154153A (en) * | 2018-03-28 | 2020-12-29 | 百时美施贵宝公司 | Interleukin-2/interleukin-2 receptor alpha fusion proteins and methods of use |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100366742C (en) | IL-2 selective agonists and antagonists | |
| TWI228128B (en) | Tumor antigenic peptides derived from cyclophilin B | |
| GB2580228A (en) | Immunostimulatory fusion molecules and uses thereof | |
| CA2451353A1 (en) | Methods and pharmaceutical compositions for immune deception, particularly useful in the treatment of cancer | |
| CN103201284A (en) | Polypeptides derived from IL-2 having agonist activity, for the therapy of cancer and chronic infections | |
| US20230265150A1 (en) | A fusion proteon of stromal cell-derived factor-1 (sdf-1) and interleukin-2 (il-2) and applications thereof | |
| EA021867B1 (en) | Immunomodulating polypeptides derived from il-2 and use thereof in cancer and chronic infections | |
| RU2398776C2 (en) | Thymus-specific protein | |
| CN101376891B (en) | Preparation of novel tuberculosis vaccine and use thereof | |
| CN109134640A (en) | GM-CSF and IL-4 conjugates, composition and relative method | |
| EP2118128B1 (en) | Fusion proteins comprising the tumor rejection antigens ny-eso-1 and lage-1 | |
| CA2431188A1 (en) | Pharmaceutical compositions enhancing the immunogenicity of poorly immunogenic antigens | |
| CN101508721A (en) | Limited simulation CTL epitope of tumor antigen Ran HLA-A*0201 and uses thereof | |
| CN116970058B (en) | Tumor neoantigen polypeptide aiming at TP53 gene R249S mutation and application thereof | |
| CN101698852A (en) | Protein or polypeptide with function of CD137L, and gene and application thereof | |
| CN103626877A (en) | NY-ESO-1-containing fusion protein as well as preparation method and application thereof | |
| KR20220052987A (en) | TCR constructs specific for EBV-derived antigens | |
| CN101148477A (en) | Streptavidin-interleukins 2 fusion protein | |
| CN101492508A (en) | Streptavidin/interleukins 15 amalgamation protein | |
| CN101942020A (en) | Streptavidin/interleukin-7 fusion protein | |
| CN101981187A (en) | Partial peptide of Survivin presented on MHC class II molecule and use thereof | |
| JP2008526686A (en) | Formulation for immunotherapy having neutralizing ability of interleukin-2 | |
| JP2009520472A (en) | Immunogenic polypeptides composed of optimized latent peptides derived from tumor antigens and uses thereof | |
| CN1727362B (en) | Preparation and application of vaccine for curing tumor in positive carcino-embryonic antigen | |
| CN101899117A (en) | Streptavidin/interleukin 21 fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080326 |