CN101147587B - Calcium-phosphorus mixture and its use - Google Patents
Calcium-phosphorus mixture and its use Download PDFInfo
- Publication number
- CN101147587B CN101147587B CN2007101338994A CN200710133899A CN101147587B CN 101147587 B CN101147587 B CN 101147587B CN 2007101338994 A CN2007101338994 A CN 2007101338994A CN 200710133899 A CN200710133899 A CN 200710133899A CN 101147587 B CN101147587 B CN 101147587B
- Authority
- CN
- China
- Prior art keywords
- calcium
- bone
- phosphorus
- mouse
- low
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention discloses a calcium-phosphorus mixture and its application. Its composition is formed from (by wt%) 1.2%-2.2% of calcium and 0.4%-0.67% of phosphorus. Said calcium-phosphorus mixture can be used for preparing food, health-care product or medicine for inhibiting bone absorption, promoting bone formation and curing bone metabolic abnormality due to PTH deficiency.
Description
Technical field
The present invention relates to a kind of calcium-phosphorus mixture and application thereof.
Background technology
The calcium agent is to be used for fracturing due to the prevention of osteoporosis preparation of simple and inexpensive at present, yet its effect exists dispute
[1,2]U.S. FDA has admitted that high calcium food is of value to the healthy of bone and can reduces the danger that osteoporosis takes place; But the relevant calcium agent that Shea etc. deliver 1966-2000 to bone density and menelipsis after the fracture data of influence of women carry out analysis-by-synthesis; The conclusion that draws is: though replenishing of calcium is influential to losing of bone; But this influence is little, and whether can reduce fracture rates and still not have final conclusion
[13]
The process that the normal bone metabolism of human body is a complicacy comprises that bone absorbs and bone forms two aspects: when bone formed, Gegenbaur's cell formed osteoid and mineralising earlier and forms new bone; When bone absorbed, osteoclast was removed the mineral matter of old bone.The bone metabolism receives the adjusting of numerous factors, is in a dynamic balance state thereby bone formation and bone are absorbed.The imbalance of this balance will cause different disease of skeletal system, and calcium is the requisite element of bone growth and development and calcification.For the mechanism of calcium increase bone amount, the previous absorption that can suppress bone that replenishes of discovering calcium
[4]The additional serum calcium that makes of calcium increases, and reduces serum parathormone (PTH) and 1 then, the 25-dihydroxyvitamin D
3(1,25 (OH)
2D
3) level, and then the bone of reduction osteoclast absorbs
[5]Can replenishing of calcium stimulate bone formation not appear in the newspapers as yet.
Phosphorus also is one of indispensable element of bone growth and development and calcification, yet it has been subjected to enough attention unlike calcium.Previous discovers, calcium absorbs to be increased simultaneously, and phosphorus absorbs and reduces.And the reduction of phosphorus can influence the absorption of calcium and increase osteoclastic bone and absorb
[6]But the high phosphorus diet can cause hypocalcemia, the high PTH mass formed by blood stasis of Secondary cases, and possibly cause that bone density reduces and risk of fractures increases
[7]
Because calcium phosphorus all is that bone calcification institute is necessary, they had both received calcium phosphorus to regulate hormone regulation, and also feedback is regulated calcium phosphorus and regulated hormone, regulate hormone-mediated influencing each other through calcium phosphorus between them, so the balance between the calcium phosphorus is for keeping the healthy most important of bone
[8]To how to improve puberty peak bone mass with prevent osteoporosis, have the scholar to propose: the calcium phosphorus preparation that should consider to use proper proportion.Previous report has been found that the calcium/phosphorus ratio in the rising diet possibly increase the absorption of intestines calcium and restrain losing of bone
[9]Yet the influence of calcium phosphorus ration to the bone metabolism only observed in this research, and the concentration of calcium is not added attention, promoting that bone forms middle effect thereby ignored the high calcium composition in the diet.
Prevent and treat osteoporosis and the growth that promotes children's bone though the calcium agent has been widely used in, calcium agent effect is not good enough separately.In view of phosphorus also is the indispensable composition of bone growth and calcification; Phosphorus diet that can be too high is the formation of possibility damaged bone again; The agent of present various domestic and imported calcium reaches kind more than 400, but the calcium-phosphorus mixture product that does not still have appropriate calcium phosphorus ration and concentration is used for aspects such as health care and the prevention of osteoporosis of bone.
List of references:
1.Kanis?JA，Passmore?R.Calcium?supplementation?of?the?diet--I.Bmj.Jan?211989；298(6667)：137-140.
2.Nordin?BE，Heaney?RP.Calcium?supplementation?of?the?diet：justified?by?presentevidence.Bmj.Apr21?1990；300(6731)：1056-1060.
3.Papadimitropoulos?E，Wells?G，Shea?B，et?al.Meta-analyses?of?therapies?forpostmenopausal?osteoporosis.VIII：Meta-analysis?of?the?efficacy?of?vitamin?Dtreatment?in?preventing?osteoporosis?in?postmenopausal?women.Endocr?Rev.Aug2002；23(4)：560-569.
4.Ricci?TA，Chowdhury?HA，Heymsfield?SB，et?al.Calcium?supplementation?suppressesbone?turnover?during?weight?reduction?in?postmenopausal?women.J?Bone?Miner?ResJun?1998；13(6)：1045-1050.
5.Rubinacci?A，Divieti?P，Polo?RM，et?al.Effect?of?an?oral?calcium?load?on?urinarymarkers?of?collagen?breakdown.J?Endocrinol?Invest.Dec?1996；19(11)：719-726.
6.Lotz?M，Zisman?E，Banter?FC.Evidence?for?a?phosphorus-depletion?syndrome?in?man.N?Engl?J?Med.Feb22?1968；278(8)：409-415.
7.Sax?L.The?institute?of?medicine′s″dietary?reference?intake″for?phosphorus：a?criticalperspective.J?Am?Coll?Nutr.Aug2001；20(4)：271-278.
8.Koshihara?M，Masuyama?R，Uehara?M，et?al.Reduction?in?dietary?calcium/phosphorusratio?reduces?bone?mass?and?strength?in?ovariectomized?rats?enhancing?bone?turnover.Biosci?Biotechnol?Biochem.Oct2005；69(10)：1970-1973.
9.Koshihara?M，Masuyama?R，Uehara?M，et?al.Effect?of?dietary?calcium：Phosphorusratio?on?bone?mineralization?and?intestinal?calcium?absorption?in?ovariectomized?rats.Biofactors.2004；22(1-4)：39-42.
Summary of the invention
Thereby the purpose of this invention is to provide a kind of through suppressing the bone absorption and stimulating bone to form the calcium-phosphorus mixture that double action increases the bone amount.
Another object of the present invention provides the application of above-mentioned calcium-phosphorus mixture.
The objective of the invention is to realize through following technical measures:
A kind of calcium-phosphorus mixture contains the component of following percentage by weight: 1.2%≤calcium≤2.2%, 0.4≤phosphorus＜0.67%.
Described calcium-phosphorus mixture is containing outside the above-mentioned calcium phosphorus content, and all the other can be components such as auxiliary material, food or food additives.
Described calcium-phosphorus mixture, contain following components in weight percentage: 2.0% calcium, 0.4% phosphorus, all the other are auxiliary material, food or food additives.
Described calcium-phosphorus mixture suppresses the application in bone absorption and stimulation of bone formation food, health products or the medicine in preparation.
The application of described calcium-phosphorus mixture in food, health products or the medicine of preparation promotion fetus or children's bone growth and development.
The application of described calcium-phosphorus mixture in food, health products or the medicine of preparation prevention of osteoporosis disease.
The application of described calcium-phosphorus mixture in food, health products or the medicine of the abnormal bone metabolism that preparation treatment PTH shortage causes.
Auxiliary material, food or food additives that the present invention uses can adopt not auxiliary material, food or the food additives of calcic phosphorus; If contain calcium phosphorus when higher (especially contain calcium phosphorus content) in the auxiliary material, food or the food additives that adopt, should institute's calcic, phosphorus be calculated in calcium at said calcium-phosphorus mixture, the phosphorus content scope.Auxiliary material, food or the food additives that adopt should not contain the material that the obstruction body absorbs and utilizes calcium, phosphorus; The material that these hinder calcium, phosphorus absorbs and utilize is that those of ordinary skills know; Like the material that combines to form slightly solubility calcium with calcium, the material that the inhibition enteron aisle absorbs calcium phosphorus etc., do not give unnecessary details one by one here.
The medicine formation compound that calcium-phosphorus mixture provided by the invention also can promote calcium phosphorus to absorb with other and utilize is with absorption and the utilization of further enhancing body to calcium phosphorus.
Calcium-phosphorus mixture consumption provided by the invention can be between 200～1000mg with calcium content conversion consumption every day.
Except as otherwise noted, the percentage that the present invention relates to calcium, phosphorus content all is calcium, phosphorus percentage by weights in composition.
The effective effect of the present invention:
The inventor thinks that calcium phosphorus ration only maintains in the proper range and the concentration of calcium must reach the adjusting bone metabolism that high calcium level can be brought into play the best.The present invention utilizes mouse model; Adopt mouse to 4 monthly age after normal diet and the low-phosphorous diet of high calcium are fed female mouse or wean; Through the influence of blood urine biochemistry, tectology and the low-phosphorous diet of the biological analysis and observation high calcium of cellular elements, study of the effect of the low-phosphorous diet of high calcium respectively to the metabolism of bone growth and development and bone from integral body, cell and molecular level to the bone metabolism.The result shows that the low-phosphorous diet of high calcium (1.2%≤calcium≤2.2%, 0.4≤phosphorus＜0.67%) does not influence the level of blood calcium phosphorus, but increases the drainage of urine calcium, reduces serum PTH and 1,25 (OH)
2D
3Level; Increase the bone trabecula capacity; Through reducing the RANKL/OPG ratio, suppress the formation and the activity of osteoclast, suppressed the bone absorption then, reduced the metabolism of bone; Through promoting the collection of marrow Gegenbaur's cell precursor, differentiation (raising the Gegenbaur's cell expression of specific gene) increases the formation of Gegenbaur's cell bone and the bone formation rate is increased.These experimental datas show that the low-phosphorous diet of the high calcium of appropriate ratio and concentration absorbs through suppressing bone, increases the bone amount thereby stimulate bone to form double action.The PTH that we utilize the low-phosphorous diet of high calcium to feed pregnancy period and lactation respectively lacks female mouse, find by these female mouse feed 3 age in week newborn mouse bone volume and bone density obviously increase; Carry out the oophorectomize postoperative when the normal adult mouse, give the low-phosphorous diet of high calcium and fed for 8 weeks, find that equally their bone volume and bone density obviously increase.According to the result of this research, the inventor provides the calcium-phosphorus mixture of appropriate calcium phosphorus ration, but this calcium-phosphorus mixture pregnant women, women breast-feeding their children and children taking promote fetus and children's bone growth and development; Can for the preadolescence and puberty children taking, to increase the purpose that peak bone mass reaches prevention of osteoporosis; Can take for the elderly, especially women after the menelipsis prevents bone loss, the development of prevention of osteoporosis and the generation of fracture; Can lack the patient for PTH and take, correct the abnormal bone metabolism that causes because of the PTH shortage.
Annotate: 2 age in week mouse be underage mouse, also sucking the breast, be equivalent to human infancy to the childhood; 3 age in week mouse, past the breast, quite mankind childhood, is to the preadolescence; 4 ages to 6 in week, all ages, mouse was equivalent to human puberty; 6 ages (i.e. the 1 age 15th day of a month) in week, later mouse can carry out mating and breeding.
Description of drawings
Fig. 1: the low-phosphorous diet of high calcium is to serum and urine calcium, phosphorus level and serum 1,25 (OH)
2D
3Influence with the PTH level.
Fig. 2: the low-phosphorous diet of high calcium is to the influence of bone volume.
Fig. 3: the low-phosphorous diet of high calcium is to the influence of bone absorption index.
Fig. 4: the low-phosphorous diet of high calcium forms the influence of index to bone.
Fig. 5: the low-phosphorous diet of high calcium forms the influence of index to bone.
Fig. 6: the low-phosphorous diet of high calcium lacks the influence of newborn mouse bone volume and bone density to normal and PTH.
Fig. 7: the low-phosphorous diet of high calcium is to the influence of OO adult rats bone volume and bone density.
The specific embodiment
Below through embodiment the present invention is done further elaboration.
Effect embodiment 1: the low-phosphorous diet of high calcium is to the osteoplastic influence of normal adult mice
Animal used as test: three age in week 20 of C57/6J mouse
Experiment is divided into groups: 20 of wean back (three ages in week) C57/6J mouse, be divided into 2 groups at random, and 10 every group, one group is the normal diet group, gives normal diet (containing 1% calcium, 0.67% phosphorus), another group gives the low-phosphorous diet of high calcium (containing 2.0% calcium, 0.4% phosphorus).2 groups of mouse were fed to age in April, were used for following experiment.
Draw materials: age in April, experiment mice was got blood through sucking anesthesia through chambers of the heart puncture, and centrifuging and taking serum is frozen subsequent use; Get urine through punctio vesicae, frozen subsequent use; Get right side femur and shin bone through 70% alcohol fixation, keeping in Dark Place is used for little-CT analysis and preparation resin embedding semithin section; Get left side femur, shin bone and lumbar vertebrae body and function PLP fixer (concentration is 2% paraldehyde, contains 0.075M lysine and 0.01M sodium periodate) fixed overnight, the phosphate buffer washing is used to prepare paraffin section; Getting the left and right sides humerus-80 ℃ frozen RNA of being used for extracts.
The biochemical analysis of serum and urine: serum and urine calcium, phosphorus and UCr are measured through automatic analyzer analysis (Beckman), serum 1,25 (OH)
2D
3Measure through putting the method for exempting from the PTH level.
Little-CT analyzes: use the little CT scanner scanning of SkyScan1072 through the shin bone upper end of 70% alcohol fixation, through SkyScan, (Antwezp Belgium), rebuilds the tibial metaphysis 3-D view to software.
Histologic analysis: PLP fixed femoral lower end, shin bone upper end and lumbar vertebrae body are through the EDTA-G decalcifying Fluid
[10](14.5%EDTA, 10% glycerine) decalcification, (alcohol concentration is from 100% for gradient alcohol; 95%, 80%, reduce to 70%) dehydration; Conventional H E dyeing, alkaline phosphatase (ALP), anti-tartaic acid phosphatase (TRAP) and total collagen tissue chemical staining are made in FFPE and section, paraffin section respectively.
Calcein double staining mark: low-phosphorous to osteoplastic influence in order to check high calcium; Preceding 10 days of sacrifice of animal and 3 days difference lumbar injection 10 μ g calcein/g body weight; The proximal femur of 70% alcohol fixation uses ultramicrotome to cut 1 μ m slab through resin embedding.Under fluorescence microscope, observe and take pictures.Use Northern Eclipse6.0 analysis software to measure the spacing of dual calcein mark.Rock salt deposition (MAR) is calculated through formula.
MAR (μ m/d)=dual calcein mark spacing ÷ double injection is fate at interval
Bone marrow cell is cultivated: get aseptic separation femur of experiment mice in age in April and shin bone, use DMEM nutrient solution washes out marrow and is prepared into unicellular bone marrow cell suspension through blowing and beating repeatedly to reach through No. 22 syringe needles.2 * 10
6Individual bone marrow cell (contains 10% hyclone, 50 μ g/ml ascorbic acid, 10mM β-phosphoglycerol and 10 at 5ml DMEM nutrient solution
-8The M dexamethasone) cultivated 18 days in.Changed liquid 1 time in per 4 days, and after stopping cultivating, washed once through phosphate buffer, the PLP fixer is fixing after 15 minutes, successively carries out the dyeing of ALP cytochemical staining and methyl blue, takes pictures after the air drying.
The analysis of tectology: on the ALP stained, made the mensuration of the positive area of ALP through using Northern Eclipse image analysis software; On the TRAP stained, do the osteoclast quantitative analysis, in the collagen staining section, done the quantitative analysis of trabecular bone capacity; On ALP cytochemical staining and methyl blue dyeing culture dish, done of the quantitative analysis of ALP positive cell area respectively with the area of total cell.
RT-PCR: use Trizol (available from U.S. invitrogen company) from humerus, to extract RNA, and use QIAGEN one-step method RT-PCR kit to detect nuclear factor κ B receptor activation factor part (RANKL), protect ossein (OPG), ALP, type i collagen (α 1 (I) Procollagen) and BGP (OCN) be in the expression of bone tissue.PCR primer and condition are seen table 1.The RT-PCR operating procedure is a technology known to a person of ordinary skill in the art.
Table 1. is used for primer and their sequence, the annealing temperature of the RT-PCR of this research, the length (bp) and the period thereof of amplicon
| Title | Justice/ | Primer sequence | Annealing | Amplicon | Period |
| Antisense strand | Temperature (℃) | Length (bp) | |||
| RANKLOPGALPα1(I)ProcollagenOCNGAPDH | Justice antisense justice antisense justice antisense justice antisense justice antisense justice antisense | ?CACACCTCACCATCAATGCTGC?GAAGGGTTGGACACCTGAATGC?TCCTGGCACCTACCTAAAACAGCA?CTACACTCTCGGCATTCACTTTGG?CTTGCTGGTGGAAGGAGGCAGG?CACGTCTTCTCCACCGTGGGTC?TCTCCACTCTTCTAGTTCCT?TTGGGTCATTTCCACATGC?CAAGTCCCACACAGCAGCTT?AAAGCCGAGCTGCCAGAGTT?CATGGAGAAGGCTGGGGCTC?CACTGACACGTTGGCAGTGG | 55 55 68 60 60 60 | 813 719 393 269 370 414 | 35 35 30 30 35 30 |
Experimental data
1, high calcium is low-phosphorous to serum and urine calcium, phosphorus level and serum 1,25 (OH)
2D
3Influence with the PTH level: compare with normal calcium phosphorus diet, the low-phosphorous diet of the high calcium serum calcium phosphorus level (Fig. 1 a and Fig. 1 b) that significantly do not raise, but increase the drainage of urine calcium, significantly reduce serum 1,25 (OH)
2D
3With PTH level (Fig. 1 c and Fig. 1 d).
2, the low-phosphorous influence to bone volume of high calcium: in order to observe the low-phosphorous influence to bone volume of high calcium, we utilize the change of the paraffin section of a little CT and total collagen staining through graphical analysis quantitative check bone volume.Compare with normal diet, no matter little-CT examination (Fig. 2 a) still through histological examination (Fig. 2 b), shows that the low-phosphorous diet of high calcium significantly increases the trabecular bone capacity of shin bone, femur and centrum (Fig. 2 c).
3, the low-phosphorous influence of high calcium to the bone absorption index: for the low-phosphorous influence of clear and definite high calcium to bone volume whether relevant with the change of bone absorption index; We are through the dyeing of TRAP groupization; Image quantitative analysis amount of osteoclast and mean size; Utilize RT-PCR to detect RANKL and OPG gene expression dose, observed the change of bone absorption index.The result shows all remarkable decline (Fig. 3 a of the normal diet group of positive osteoclast number of low-phosphorous group of TRAP of high calcium and mean size; B and c) the low-phosphorous RANKL gene expression dose that not only raises of high calcium; Also raising, (Fig. 3 a), and the rising of OPG is more obvious than the rising of RANKL, thereby causes that the RANKL/OPG ratio descends for the OPG gene expression dose; The formation and the activity that suppress osteoclast; Then suppressed the bone absorption, reduced the metabolism of bone, these results prove that the low-phosphorous diet of high calcium can increase the bone amount through suppressing the bone absorption.
4, the low-phosphorous influence that bone is formed index of high calcium: to form index relevant with bone for the low-phosphorous influence to bone volume of clear and definite high calcium; We are through utilization calcein double labelling and ALP histochemistry and graphical analysis and RT-PCR inspection Gegenbaur's cell specific gene ALP; Type i collagen and BGP expression are observed the change that bone forms index.The result shows that low-phosphorous group of MAR of high calcium and the positive normal diet group of Gegenbaur's cell of ALP all significantly raise (Fig. 4 a, b and c), and the result is consistent with morphological observation, and the low-phosphorous while of high calcium is also raised ALP, type i collagen and osteocalcin gene expression level.
For the increase that further clear and definite Gegenbaur's cell forms whether relevant with the increase of imposing the Gegenbaur's cell precursor from marrow; We use Ex vivo bone marrow cell culture technique; The ALP cytochemical staining, methyl blue dyeing and graphical analysis are observed low-phosphorous Gegenbaur's cell is imposed of high calcium.The result shows: the low-phosphorous CFU-f (the total colony of fibroblast) (Fig. 5 c and d) that not only increased of high calcium has also increased CFU-f
AP(the fibroblast colony that ALP is positive) (Fig. 5 e and f).
The low-phosphorous diet of these presentation of results high calciums increases the bone trabecula capacity through collection, differentiation, the formation of increase Gegenbaur's cell bone that promotes marrow Gegenbaur's cell precursor, proves that once more the low-phosphorous diet of high calcium can increase the bone formation rate through stimulating osteoblast formation.
Effect embodiment 2: the low-phosphorous diet of high calcium lacks the osteoplastic influence of mouse to normal and PTH
The pairing of parathormone (PTH) heterozygote parental generation mouse male and female; Feed respectively and (contain 1% calcium with normal diet; 0.67% phosphorus) or the low-phosphorous diet of high calcium (contain 2.0% calcium; 0.4% phosphorus) to generation mice wean (3 age in week), get the wild type (WT) and the PTH homozygote (PTH of female mouse lactation of normal diet or the low-phosphorous female mouse lactation of high calcium respectively
-/-) each 6 of generation mices, after sucking anesthesia, get shin bone and fix through PLP, through three-dimensional reconstruction analysis behind the photography of X line and the little-CT scan (SkyScan software, Antwezp, Belgium) 3 all ages generation mice bone density and bone volume.
Wild type (WT) and PTH homozygote generation mice are produced by the mating of PTH heterozygote parental generation mouse, and the mouse that is produced by the mating of PTH heterozygote parental generation mouse has three types, is respectively wild type (WT), PTH homozygote and PTH heterozygote generation mice.Wherein wild type (WT) and PTH heterozygote generation mice PTH are normal, and PTH homozygote generation mice PTH lacks.When PTH lacks, 3 age in week the mouse bone volume all reduce with bone density, show as and hang down the calcium hyperphosphatemia.Give the low-phosphorous diet of high calcium and not only correct low calcium hyperphosphatemia, and bone volume and bone density are increased.
Experimental data:
X-line photography is analyzed discovery with little-CT, still is all low than wild type newborn mouse by bone density and the bone volume of the PTH homozygote newborn mouse of the low-phosphorous diet mother of high calcium mouse lactation by normal diet.Yet obviously increase (Fig. 6) than the newborn mouse of normal diet lactation by the bone density of the WT of the female mouse lactation of the low-phosphorous diet of high calcium and PTH homozygote newborn mouse mouse and bone volume.The result shows and give pregnancy and lactation the growth that the low-phosphorous diet of high calcium can promote children's bone.
Effect embodiment 3: the low-phosphorous diet of high calcium is to the influence of oophorectomize mouse bone amount
After 12 4 ages in week, female mice was implemented bilateral oophorectomy, be divided into two groups at random.Feed with normal diet (containing 1% calcium, 0.67% phosphorus) for one group, another group was fed with the low-phosphorous diet of high calcium (containing 2% calcium, 0.4% phosphorus) to 12 ages in week.After sucking anesthesia, it is liquid-solid fixed through PLP to get femur, through three-dimensional reconstruction and bone trabecula capacity analysis behind the photography of X line and the little-CT scan (Skyscan, Antwezp, Belgium).
Experimental data:
The photography of X line finds that (Fig. 7 a) apparently higher than the normal diet group for the bone density of the low-phosphorous diet group of high calcium.Little-CT three-dimensional reconstruction and bone trabecula capacity analysis result show that the bone volume of the low-phosphorous diet group of high calcium is apparently higher than normal diet group (Fig. 7 b and c).
Preparation embodiment 1
In 100,000 ml, filling a prescription is calcium carbonate 4.99kg, potassium dihydrogen phosphate 1.143kg, auxiliary material: sucrose 5kg, and honey 5kg, flavor enhancement is an amount of, and all the other are for purifying waste water.Its method mainly is: each supplementary material is dissolved in water, mixes and dilute, and adjustment pH value 7～8, can is sterilized.
Get calcium carbonate 4.99kg, potassium dihydrogen phosphate 1.143kg, fructose 10kg, cornstarch 83.867kg, common process is prepared into tablet.
Preparation embodiment 3
Get calcium carbonate 4.99kg, potassium dihydrogen phosphate 1.143kg, fructose 8.867kg, cornstarch 85kg, common process is prepared into capsule.
Preparation embodiment 4
Get calcium carbonate 3.2kg, potassium dihydrogen phosphate 1.143kg, fructose 20.65kg, rice ground rice 75kg, VD4 0000IU, common process is prepared into granule.
Sequence table
< 110>Miao Dengshun
< 120>a kind of calcium-phosphorus mixture and application thereof
<160>12
<210>1
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse RANKL positive-sense strand primer sequence
<400>1
cacacctcac?catcaatgct?gc?22
<210>2
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse RANKL antisense strand primer sequence
<400>2
gaagggttgg?acacctgaat?gc?22
<210>3
<211>24
<212>DNA
< 213>C57/6J mouse OPG positive-sense strand primer sequence
<400>3
tcctggcacc?tacctaaaac?agca?24
<210>4
<211>24
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse OPG antisense strand primer sequence
<400>4
ctacactctc?ggcattcact?ttgg?24
<210>5
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse ALP positive-sense strand primer sequence
<400>5
cttgctggtg?gaaggaggca?gg?22
<210>6
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse ALP antisense strand primer sequence
<400>6
cacgtcttct?ccaccgtggg?tc?22
<210>7
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse α 1 (I) Procollagen positive-sense strand primer sequence
<400>7
tctccactct?tctagttcct?20
<210>8
<211>19
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse α 1 (I) Procollagen antisense strand primer sequence
<400>8
ttgggtcatt?tccacatgc?19
<210>9
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse OCN positive-sense strand primer sequence
<400>9
caagtcccac?acagcagctt?20
<210>10
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse OCN antisense strand primer sequence
<400>10
aaagccgagc?tgccagagtt?20
<210>11
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse GAPDH positive-sense strand primer sequence
<400>11
catggagaag?gctggggctc?20
<210>12
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>C57/6J mouse GAPDH antisense strand primer sequence
<400>12
cactgacacg?ttggcagtgg?20
Claims (6)
1. a calcium-phosphorus mixture is characterized in that this calcium-phosphorus mixture contains the component of following percentage by weight: 2.0% calcium, 0.4% phosphorus.
2. calcium-phosphorus mixture according to claim 1 is characterized in that this calcium-phosphorus mixture contains following components in weight percentage: 2.0% calcium, and 0.4% phosphorus, all the other are auxiliary material, food or food additives.
3. claim 1 or 2 described calcium-phosphorus mixtures suppress the application in bone absorption and stimulation of bone formation food, health products or the medicine in preparation.
4. the application of the described calcium-phosphorus mixture of claim 3 in food, health products or the medicine of preparation promotion fetus or children's bone growth and development.
5. the application of the described calcium-phosphorus mixture of claim 3 in food, health products or the medicine of preparation prevention of osteoporosis disease.
6. claim 1 or the 2 described calcium-phosphorus mixtures application in food, health products or the medicine of the abnormal bone metabolism that preparation treatment PTH shortage causes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101338994A CN101147587B (en) | 2007-10-24 | 2007-10-24 | Calcium-phosphorus mixture and its use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101338994A CN101147587B (en) | 2007-10-24 | 2007-10-24 | Calcium-phosphorus mixture and its use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101147587A CN101147587A (en) | 2008-03-26 |
| CN101147587B true CN101147587B (en) | 2012-07-04 |
Family
ID=39248376
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101338994A Expired - Fee Related CN101147587B (en) | 2007-10-24 | 2007-10-24 | Calcium-phosphorus mixture and its use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101147587B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109425523A (en) * | 2017-09-05 | 2019-03-05 | 上海新培晶医学检验所有限公司 | Marrow specimen processing method, decalcifying Fluid and purposes |
| CN110123836A (en) * | 2019-05-20 | 2019-08-16 | 昆明朗盛生物科技有限公司 | The application of calcium zinc vitamin D pantothenic acid piece |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1100603A (en) * | 1993-09-22 | 1995-03-29 | 王农钢 | Prescription and method for producing nutrition additives for promoting the formation of calcium protein salt |
| CN1284335A (en) * | 1999-11-14 | 2001-02-21 | 刘文升 | Flour and special food containing calcium phosphate |
| CN1314096A (en) * | 2000-03-16 | 2001-09-26 | 邓忠元 | Calcium (phosphate-iron) supplment food for different ages |
| CN101015356A (en) * | 2007-01-11 | 2007-08-15 | 余群力 | Calcium nutrition reinforcer and its production process |
-
2007
- 2007-10-24 CN CN2007101338994A patent/CN101147587B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1100603A (en) * | 1993-09-22 | 1995-03-29 | 王农钢 | Prescription and method for producing nutrition additives for promoting the formation of calcium protein salt |
| CN1284335A (en) * | 1999-11-14 | 2001-02-21 | 刘文升 | Flour and special food containing calcium phosphate |
| CN1314096A (en) * | 2000-03-16 | 2001-09-26 | 邓忠元 | Calcium (phosphate-iron) supplment food for different ages |
| CN101015356A (en) * | 2007-01-11 | 2007-08-15 | 余群力 | Calcium nutrition reinforcer and its production process |
Non-Patent Citations (1)
| Title |
|---|
| Moyuru Koshihara等.Effect of dietary calcium：Phosphorus ratio on bone mineralization and intestinal calcium absorption in ovariectomized rats.《BioFactors》.2001,(第22期),39-42. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101147587A (en) | 2008-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fu et al. | Effect of 1, 25-dihydroxy vitamin D3 on fracture healing and bone remodeling in ovariectomized rat femora | |
| CN1193751C (en) | Therpauetic agent of osteoporisis comprising active ingredient of quercetin derivatives | |
| CN103251671B (en) | A kind of composition and method of making the same containing Chinese medicine increasing bone density | |
| CN109364194A (en) | It maintains bone health and treats the composition of the osteoarthropathy in osteoarthritis and joint | |
| AU2010212456B2 (en) | Formulas comprising calcium, magnesium, zinc, and vitamin D3, for the prevention and amelioration of osteoporosis | |
| CN101036691B (en) | Health-caring product for improving bone density and immunity | |
| CN100379359C (en) | Preparation method of vinegar-egg powder, compound containing vinegar-egg powder and application thereof | |
| JP4332659B2 (en) | Drugs for preventing and treating fractures and osteoporosis | |
| Tomaszewska et al. | White tea is more effective in preservation of bone loss in adult rats co-exposed to lead and cadmium compared to black, red or green tea | |
| Xu et al. | Bone microstructure and metabolism changes under the combined intervention of ketogenic diet with intermittent fasting: an in vivo study of rats | |
| Wu et al. | The antiosteoporotic effects of Cheonggukjang containing vitamin k2 (menaquinone-7) in ovariectomized rats | |
| CN104146260B (en) | A kind of health food increasing bone density and preparation method thereof | |
| CN101147587B (en) | Calcium-phosphorus mixture and its use | |
| Tao et al. | Silibinin can promote bone regeneration of selenium hydrogel by reducing the oxidative stress pathway in ovariectomized rats | |
| Sakat et al. | Osteoporosis: The brittle bone | |
| CN100348207C (en) | Use of sea-buckthorn fruit oil and/or fruit slag oil in preparing medicine for treating osteoporosis | |
| CN107969649A (en) | One kind is replenished the calcium composition and preparation method | |
| CN101692907A (en) | High-activity yak marrow bio-calcium compound capsule | |
| JP2014152129A (en) | Bone formation accelerating agent, and foods and drinks, oral products and feeds for animals combined with bone formation accelerating agent | |
| CN101485774A (en) | Oral liquid for treating osteoporosis | |
| CN101167754A (en) | Application of sea bone peptide in preparing medicine, health-care food or food for preventing osteoporosis | |
| CN102824504A (en) | Chinese medicinal composition for invigorating kidney and strengthening bones | |
| KR101318210B1 (en) | Composition comprising Foeniculum vulgare Miller seed extract for preventing or treating osteoporosis | |
| CN105287563A (en) | Application of pyrroloquinoline quinone to preparation of products for preventing and treating osteoporosis | |
| CN113082059B (en) | Composition for preventing and treating osteoporosis and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20211024 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |