CN101144061B - Yeast engineering bacterium for producing human pepsinogen and its preparation method and application - Google Patents
Yeast engineering bacterium for producing human pepsinogen and its preparation method and application Download PDFInfo
- Publication number
- CN101144061B CN101144061B CN2007100940182A CN200710094018A CN101144061B CN 101144061 B CN101144061 B CN 101144061B CN 2007100940182 A CN2007100940182 A CN 2007100940182A CN 200710094018 A CN200710094018 A CN 200710094018A CN 101144061 B CN101144061 B CN 101144061B
- Authority
- CN
- China
- Prior art keywords
- yeast
- engineering bacteria
- human pepsinogen
- yeast engineering
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses a yeast engineering strain which can produce the human pepsinogen, the yeast strain is microzyme which is converted through a eukaryotic expression vector, and the eukaryotic expression vector contains the protogene of the human pepsinogen. The present invention also discloses the preparation method and the application of the yeast engineering strain. The yeast engineering strain of the present invention realizes the highly effective secretion expression of the human pepsinogen zymogen C in a methylotrophic yeast pichia pastoris, the expression quantity is above 600 mg/L, the recombination PGC of the present invention is consistent to the immunogenicity and the proteinase activity of the PGC abstracted from human gorge tissue, thus the present invention can be widely applied to a plurality of fields such as medicine, food and chemical engineering, etc., and have extremely good application value and market prospect.
Description
Technical field
The present invention relates to technical field of bioengineering, relate in particular to a kind of Yeast engineering bacteria that produces human pepsinogen.
Background technology
(pepsinogen is a pepsic precursor in the gastric juice PG) to propepsin, and molecular weight of albumen is about 43kD, is made up of 300 amino acid.According to biochemical different, can be divided into two big types of subgroup PGI (claim not only PGA) and PGII (but also claiming PGC) with the immunocompetence characteristic.Propepsin A (PGA) derives from the chief cell and the mucous neck cells of fundic gland; Propepsin C (PGC) (Genbank No.NM_002630) derives from full gastric gland (gastric cardiac gland, fundic gland, gastric antrum pylorus gland) and far-end duodenum BrunnerShi gland; Prostate gland and pancreas also produce a small amount of PGC, and stomach mucous membrane synthetic PGC is about 25% of total amount.The most of gastral cavity that gets into of PG after synthetic, activation becomes stomach en-under the acidic gastric juice effect, has only a small amount of (about 1%) PG to see through the stomach mucous membrane capillary vessel and gets into circulation of blood, its secretion level of serum PG concentration reflection.
The human pepsinogen purposes mainly contains two aspects, and the one, as the application of the characteristic of digestive ferment, a kind of is the application of the diagnosis marker that detects as gastritis and cancer of the stomach early warning.
One, as the proenzyme of main digestive ferment, propepsin can generate activated stomach en-through activation, and stomach en-is a digestive ferment main in the human stomach at hydrochloric acid in gastric juice, can make protein transduction turn to peptone.This characteristic can be widely used in food adds, leather processing, and can process oral liquid or tablet, be used to treat maldigestion.
The stomach en-traditional technology of above purposes is extracted in the animal stomach by sheep, pig etc., and cost is high and be prone to degraded, and the hidden danger in animality source is also arranged.
Two, another importance: prevention of recurrence is insoluble problem in the peptide ulceration non-operative treatment all the time, and the serum PG level changes with the recurrence of peptide ulceration closely related.Have report to show, gastric ulcer recurrence person PGC raises obviously; And duodenal ulcer recurrence patient's PGC all significantly raises.Matsushima discovers, accepts H
2Among the peptide ulceration patient of-receptor-blocking agent half-value dose treatment, recurrence group PGC value is higher than not recurrence group.Therefore serum PG is an effective judgement index of recurrent peptic ulcer, especially aspect the evaluation of keeping result of treatment.
Other there are some researches show that (pepsinogen PG) is the mark of atrophic gastritis to the human serum propepsin, because of atrophic gastritis is the precancerous lesion of cancer of the stomach, implements gastric cancer screening so the positive person of PG level variation genus can be used as the group of people at high risk of cancer of the stomach.
At present, human pepsinogen all extracts from people's stomach-tissue, and there is restriction in the source, and is external import entirely, and cost is very high.
Tak etc. carries out the propepsin expression of gene of pig in intestinal bacteria in the world, but the low 9mg/L that is merely of the expression amount of propepsin.Compare with prokaryotic expression system, it is the foreign protein efficient expression system that has more advantage that pasteur is finished the Chi Shi methanol yeast.Utilizations such as Mark are finished the Chi Shi methanol yeast and have been carried out the former secretion type expression of porcine pepsin, express output and reach 30mg/L, the porcine pepsin gene engineering product are carried out pilot scale abroad.And domestic Qiao Xian phoenix etc. have reported that the porcine pepsin gene expresses in complete Chi Shi methanol yeast, but former protein sequencing, purifying, the expression amount of porcine pepsin of expressing all do not have data results, and biochemical characteristic also remains further research.
In sum, at present human pepsinogen is mainly from people's stomach-tissue separation and Extraction, but because problems such as short supply of people's stomach-tissue and insoluble blood contamination are difficult to realize industrialization, big limitations its development and application.
Summary of the invention
One of technical problem that the present invention will solve provides a kind of Yeast engineering bacteria that produces human pepsinogen, human pepsinogen is expressed in yeast, and obtain the above high expression level amount of 600mg/L.
Two of the technical problem that the present invention will solve provides a kind of preparation method who produces the Yeast engineering bacteria of human pepsinogen.
Three of the technical problem that the present invention will solve provides a kind of method that above-mentioned Yeast engineering bacteria is produced human pepsinogen of using.
Four of the technical problem that the present invention will solve provides the application of human pepsinogen in preparation digestants and people's stomach en-product that a kind of above-mentioned Yeast engineering bacteria is produced.
Five of the technical problem that the present invention will solve provides the application of human pepsinogen in gastropathy diagnosis and control that a kind of above-mentioned Yeast engineering bacteria is produced.
In order to solve the problems of the technologies described above, the present invention realizes through following technical scheme:
In one aspect of the invention, a kind of Yeast engineering bacteria that produces human pepsinogen is provided, this Yeast engineering bacteria is the yeast that is transformed by recombinant expression vector, and this recombinant expression vector comprises the human pepsinogen gene.
Said yeast is preferably finished Chi Shi methanol yeast GS115 for finishing Chi Shi methanol yeast bacterium (Picchia pastoris);
Said expression vector is preferably finished secretion expression's carrier pPIC9K of Chi Shi methanol yeast for finishing secretion expression's carrier of Chi Shi methanol yeast;
Said human pepsinogen gene is a human pepsinogen C gene.
Preferably; Said Yeast engineering bacteria is for finishing Chi Shi methanol yeast (Picchia pastoris) GS115; Be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (being called for short CGMCC) on August 1st, 2007, preserving number is: CGMCCNO.2123.
In another aspect of this invention, a kind of preparation method who produces the Yeast engineering bacteria of human pepsinogen is provided, has may further comprise the steps:
(1) with the human pepsinogen gene that the obtains expression vector of packing into, to constitute recombinant expression vector;
(2) recombinant expression vector with step (1) is transformed into yeast host cell, obtains the Yeast engineering bacteria of human pepsinogen gene transformation.
In said step (2) afterwards, also comprise: Yeast engineering bacteria is carried out resistance screening and abduction delivering, and preferably, said Yeast engineering bacteria carries out resistance screening by G418, and carries out abduction delivering by methyl alcohol.
Expression vector in the said step (1) is for finishing secretion expression's carrier of Chi Shi methanol yeast.
Yeast host cell in the said step (2) is for finishing Chi Shi methanol yeast host cell.
In another aspect of this invention, a kind of method of producing human pepsinogen is provided also, has may further comprise the steps:
(1) under the condition that is fit to growth, the above-mentioned Yeast engineering bacteria of fermentation culture;
(2) from substratum, isolate human pepsinogen.
In another aspect of this invention, the application of human pepsinogen in preparation digestants and people's stomach en-product that also provides a kind of above-mentioned Yeast engineering bacteria to produce.
People's stomach en-is as a kind of digestive ferment, after being usually used in treatment and having eaten albumen property food, lacks pepsic maldigestion, and convalescent after being ill digestive function goes down, and poor appetite and chronic atrophic gastritis etc.Containing the pepsic digestants of people has powder (being commonly called as medicinal powder), mixture, syrup and tablet etc., when ante cibum or meal, takes.
The human pepsinogen of Yeast engineering bacteria production of the present invention also can be used for producing peptone, promptly uses stomach en-(for example: pig blood, ox blood to decompose animal blood; Sheep blood; Horse blood etc.) the collagen protein matter that is rich in is produced the method for peptone, and it is easy to have technology, and processing ease is grasped; Low production cost, advantages such as remarkable in economical benefits.
People's stomach en-product can be used for food-processing, is example with bean product, can remove beany flavor with enzyme process, also can remove the bitter taste astringent taste.The enzyme facture is to add protein decomposition enzyme such as stomach en-in the soya-bean milk, by the effect of enzyme, makes soy-protein be degraded into little peptide or amino acid, and the unpleasant odor composition also separates with protein.Trypsin inhibitor SBTI is a peptide species or simple protein; Be to cause that soybean nutritional is difficult for the principal element that absorbs; Pepsic hydrolysis capable of using makes its structural modification, its active site is changed and inactivation, thereby improve digesting and assimilating of food.
Protein in the fish scale is through pepsin hydrolysis, and the enzymolysis solution that makes can be used for producing seasonings and foodstuff additive.Existing experiment showed, the fish scale protein hydrolyte have anti-oxidant, bring high blood pressure down, reduce blood total cholesterol, the anti-ageing effect of waiting for a long time.
In another aspect of this invention, the application of human pepsinogen in gastropathy diagnosis and control that also provides a kind of above-mentioned Yeast engineering bacteria to produce.The human pepsinogen of gene engineering expression of the present invention can be used as the protein quantification standard substance of diagnosing gastropathy and detects as antigen prepd uses antibody.When detecting the variation of human serum PG level, human pepsinogen of the present invention is the protein standard substance of the quantitative human serum PG of conduct just.With human pepsinogen of the present invention is that the antibody of antigen prepd can directly be used to detect human serum PG level.
The Yeast engineering bacteria of product human pepsinogen of the present invention; Realized PGC efficient secretory expression in complete Chi Shi methanol yeast; Expression amount is more than 600mg/L; But and consistent through western blotting experiment knowledge capital invention purified recombinant PGC with the PGC that people's stomach-tissue extracts, the enzyme activity experiment shows that also the PGC of the complete Chi Shi methanol yeast engineering bacteria preparation of the present invention keeps the enzymic activity of natural PGC.The present invention provides the foundation for activated pepsic a large amount of acquisitions; Can be widely used in various fields such as medicine, food, chemical industry; And, have good using value and application prospects for structure, function and the application in gastropathy diagnosis and control thereof of further exploring PGC lays the foundation.
Description of drawings
Fig. 1 is the construction of recombinant plasmid figure of the PGC of comprising gene of the present invention;
Fig. 2 is the SDS-PAGE electrophorogram of the PGC of gene engineering expression of the present invention;
Fig. 3 is that the present invention passes through the figure as a result that Western Blotting detects the PGC protein expression;
Fig. 4 is complete Chi Shi methanol yeast recombinant bacterial strain PGC expressing quantity of the present invention and time relation figure;
Fig. 5 is the SDS-PAGE electrophorogram of propepsin C behind the purifying of the present invention;
Fig. 6 is the recombinate enzyme dynamic curve comparison diagram of propepsin C and natural propepsin C of the present invention.
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is done further detailed explanation.
Following examples only be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions among the embodiment; Usually according to normal condition; People such as Sambrook for example; Molecular cloning: the condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to manufacturer.
The present invention packs human pepsinogen C (PGC) gene into and finishes on the secreted expression carrier of Chi Shi methanol yeast (P.pastoris); Finish Chi Shi methanol yeast host bacterium transforming after this recombinant expression vector linearizing; Utilize the reorganization bacterium to efficiently express; Supernatant obtains electrophoretically pure PGC albumen through ammonium sulfate precipitation, Q-Sepharose Fast Flow separation and purification.
CDNA with the total RNA reverse transcription of people's stomach-tissue is that template obtains natural PGC gene fragment through pcr amplification; 5 ' end and 3 ' end at the PGC gene coded sequence are introduced restriction enzyme site XhoI and NotI respectively; Pack into behind the double digestion on secretion expression's carrier pPIC9k (available from Invitrogen company) of P.pastoris, obtain the recombinant expression plasmid (see figure 1).
(1) primer sequence of natural PGC gene fragment clone is:
5 ' direction primer: GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO:1)
3 ' direction primer: CTAGGCGGCAGTGGCAAAGC (SEQ ID NO:2)
(2) primer sequence of pPIC9K expression vector is:
5 ' direction primer
(GACCCAAT) CTCGAG (xhoI site) GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO:3) 3 ' direction primer
(GT) GC GGC CGC (NotI site) TTA (terminator codon) GGCGGCAGTGGCAAAGC (SEQ IDNO:4)
The expression plasmid pPIC9k-pgc that makes up is used the SalI linearization for enzyme restriction.Being cultured to OD available from the host bacterium P.pastoris GS115 (His mut+) of Invitrogen company is 1.6-1.8, and preparation electroreception attitude cell mixes with aforementioned linearization plasmid; Transform voltage 1500V wherein, electric capacity 50PF again with Biorad electricity conversion instrument electricity; Resistance 4kg adds the cold sorbyl alcohol of 0.5mmol/L in transforming cup, get 200 μ l and be applied to the MD flat board; 30 ℃ are cultured to single bacterium colony and a transformant surplus the result obtains 1000 occurs.
The high resistance of embodiment 3 screenings finishes Chi Shi methanol yeast recombinant bacterial strain
A transformant surplus 1000 is applied to successively contains on the YPD flat board that G418 is respectively 1mg/L, 2mg/L, 3mg/L, 4mg/L, 28-30 ℃ of cultivation, the result obtains 22 transformants containing on the 4mg/ml G418 flat board.Used YPD preparation is: 20g peptone, 10g yeast extract, 20g glucose are dissolved in the 0.9L water, after water is supplied volume and is 1L, and autoclaving.
Single bacterium colony of above-mentioned 22 plant height resistance bacterium is inserted respectively in the test tube that contains 3ml BMGY, and 28-30 ℃, 220rpm cultivates 24h; Draw 1.5ml respectively and insert the substratum that contains 40ml BMGY; Similarity condition is cultivated 24h down, centrifugal (6000rpm, 6min); Thalline is resuspended in 15ml BMMY substratum, and similarity condition is cultivated 96h (every 24h mends methyl alcohol 150 μ l) down.Fermented liquid is centrifugal, gets supernatant and does the SDS-PAGE electrophoresis, and the result is as shown in Figure 2; In Fig. 2,1 is molecular weight standard albumen, the 2 reorganization bacterium expressed products for empty carrier pPIC9K conversion; The secretory protein of 3 positive reorganization bacterium selects the result that the experimental bacteria of doing of obvious protein band is arranged about 43KD.
The Western-blot of embodiment 5 expression products identifies
SDS-PAGE gel behind the electrophoresis is peeled off, immersed rinsing 1 min in the electrotransfer damping fluid, 4 ℃ of electrotransfer 2 h.Take out transfer film, put into 5% skimmed milk confining liquid, 37 ℃ are slowly shaken 1 h.Slowly shake 1h with confining liquid dilution one anti-(being respectively mouse-anti people PGC antibody) 1/1000,37 ℃, wash film with the TBS damping fluid.Slowly shake 1 h with confining liquid dilution two anti-(anti-mouse, anti-mouse) 1/30000,37 ℃, wash film once with TBS, the AP substrate buffer solution is washed film twice.In 10mlAP (SEAP) substrate buffer solution, add BCIP (5-bromo-4-chloro-3-indoles phosphoric acid) 33 μ L, NBT (nitroblue tetrazolium(NBT)) 66 μ L, with film 30 min that develop the color, band cleans post rinsing, color development stopping.The result is as shown in Figure 3, and in Fig. 3,1 is natural PGC, and 2 is recombinant expressed PGC supernatant, and 3 is the PGC of purifying, 4 negative contrasts.
The Chi Shi methanol yeast bacterial strain PGC that ferments is in a small amount finished in embodiment 6 reorganization
Select single bacterium colony from the YPD slant medium, insert the BMGY substratum that contains 3ml optimization and (wherein contain peptone 20%, yeast powder 10%, 1M phosphoric acid buffer 10%; Glycerine 10%, YNB (yeast amino) 13.6g/L) test tube, 28-30 ℃; 220r/min cultivates 24-28 h, gets 1.5ml and changes 40ml BMMY substratum growth 24h over to; It is centrifugal that (6000rpm 6min), abandons supernatant; The BMMY inducing culture that thalline is optimized with 15ml (wherein substituting the glycerine among the BMGY with 5ml/L methyl alcohol) suspends, and similarity condition is cultivated 24-72 h down, and every 24h mends methyl alcohol 15 μ l.Be SDS-PAGE from adding the every 12h sampling of BMMY cultivation beginning.
Chi Shi methanol yeast bacterial strain bulk fermentation PGC is finished in embodiment 7 reorganization
Seed liquor preparation: select single bacterium colony from the YPD slant medium, insert the bottle that shakes of the BMGY (prescription is with embodiment 6) that contains 40ml and optimize, 28-30 ℃, 220r/min cultivates 24-28 h.
The BMMY inducing culture that thalline is optimized with 200ml (prescription is with embodiment 6) suspends, and similarity condition is cultivated down, and every 24h mends methyl alcohol 200 μ l.Be SDS-PAGE from adding the every 12h sampling of BMMY cultivation beginning, the result sees Fig. 4, in Fig. 4; 1 is the lower molecular weight standard protein, and 2,3,4,5,6 represent that respectively bulk fermentation induces 24,36,48,60,72 hours PGC expression amounts, can be known along with the fermentation inducement time increases by Fig. 4; Methanol yeast recombinant bacterial strain PGC expressing quantity of the present invention also increases; About 60 hours, the PGC expressing quantity reaches the highest, and expression level reaches 600mg/L.Bulk fermentation condition: 30 ℃ of temperature; PH 6.0; Stirring velocity: 200-800r/min.
The proteic separation and purification of embodiment 8PGC
Fermented supernatant fluid stirs down, and slowly adding ammonium sulfate to saturation ratio is 60%, and it is centrifugal that ice bath stirs after 2 hours 16000rpm, abandons supernatant, and deposition use 50mM Tris-HCl, and pH8.5 dissolves.The lysate dialysed overnight, Q-SepharoseFast Flow IX column equilibration, the PBS gradient elution of 0-1.0M NaCl is collected elutriant with the distribution scoop, and 280nm detects, and collects main peak, and the dialysis back is concentrated freeze-dried.The PGC albumen of purifying is carried out the SDS-PAGE electrophoresis, and the result is as shown in Figure 5, and in Fig. 5,1 is the lower molecular weight standard protein, and 2 is PGC behind the purifying.The PGC product of purifying is carried out western blotting detection, and the result sees Fig. 3, and at the estimated molecular weight place, reorganization PGC and natural PGC have positive band, explain that molecular weight is consistent, and recombinant protein has and the identical immunogenicity of natural commercialization albumen.
Embodiment 9 reorganization PGC protein-actives detect
Genetically engineered propepsin C concentration of the present invention is 0.02nM; Natural propepsin C concentration also is 0.02nM, and under 4 ℃ of pH2.5 conditions, activation is after 24 hours; React down at 30 ℃ with various concentration KPAEFFeNO2TAL substrates (0.1M-0.25M) respectively; Detection changes in the absorbancy of 300nm wavelength, and carries out protease activity determination, and the result is as shown in Figure 6; This two proteic enzyme-substrate kinetic curves match is overlapping to be a curve, shows that the present invention propepsin C that recombinates has similar enzymic activity with natural propepsin C.In Fig. 6, transverse axis is concentration of substrate [S], and the longitudinal axis is speed of response V, ■ line representative reorganization propepsin C enzyme dynamic curve, ● line is represented natural propepsin C enzyme dynamic curve, dotted line be the match of two proteolytic enzyme kinetic curves overlapping be a curve.
Sequence table
< 110>Huaguan Biochip Co Ltd, Shanghai
< 120>Yeast engineering bacteria of product human pepsinogen
<130>NP-07-11625
<160>4
<170>PatentIn?version3.3
<210>1
<211>21
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(21)
< 223>primer
<400>1
<210>2
<211>20
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
< 223>primer
<400>2
<210>3
<211>35
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(35)
< 223>primer
<220>
<221>misc_signal
<222>(1)..(8)
< 223>protection base
<220>
<221>misc_signal
<222>(9)..(14)
< 223>XhoI restriction enzyme site
<400>3
<210>4
<211>30
<212>DNA
< 213>artificial sequence
<220>
<221>misc_feature
<222>(1)..(30)
< 223>primer
<220>
<221>misc_signal
<222>(1)..(2)
< 223>protection base
<220>
<221>misc_signal
<222>(3)..(10)
< 223>NotI restriction enzyme site
<220>
<221>terminator
<222>(11)..(13)
< 223>terminator codon
<400>4
Claims (8)
1. a Yeast engineering bacteria that produces human pepsinogen C is characterized in that, this Yeast engineering bacteria is the yeast that is transformed by recombinant expression vector, and this recombinant expression vector comprises human pepsinogen C gene.
2. Yeast engineering bacteria as claimed in claim 1 is characterized in that, said yeast is for finishing Chi Shi methanol yeast bacterium.
3. Yeast engineering bacteria as claimed in claim 1 is characterized in that, said expression vector is for finishing secretion expression's carrier of Chi Shi methanol yeast.
4. like each described Yeast engineering bacteria of claim 1 to 3, it is characterized in that said Yeast engineering bacteria is for finishing Chi Shi methanol yeast (Pichia pastoris) PGCXXJ-7, preserving number is: CGMCC NO.2123.
5. the preparation method of the said Yeast engineering bacteria of claim 1 is characterized in that, may further comprise the steps:
(1) with the human pepsinogen C gene that the obtains expression vector of packing into, to constitute recombinant expression vector;
(2) recombinant expression vector with step (1) is transformed into yeast host cell, obtains the Yeast engineering bacteria of human pepsinogen C gene transformation.
6. preparation method as claimed in claim 5 is characterized in that, step (2) also comprises afterwards: Yeast engineering bacteria is carried out resistance screening and abduction delivering.
7. a method of producing human pepsinogen C is characterized in that, may further comprise the steps:
(1) under the condition that is fit to growth, the described Yeast engineering bacteria of fermentation culture claim 1;
(2) from substratum, isolate human pepsinogen C.
8. the application of human pepsinogen C in preparation digestants and people's stomach en-product of the described Yeast engineering bacteria production of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100940182A CN101144061B (en) | 2007-08-14 | 2007-08-14 | Yeast engineering bacterium for producing human pepsinogen and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100940182A CN101144061B (en) | 2007-08-14 | 2007-08-14 | Yeast engineering bacterium for producing human pepsinogen and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101144061A CN101144061A (en) | 2008-03-19 |
| CN101144061B true CN101144061B (en) | 2012-05-02 |
Family
ID=39206797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100940182A Expired - Fee Related CN101144061B (en) | 2007-08-14 | 2007-08-14 | Yeast engineering bacterium for producing human pepsinogen and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101144061B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103387971B (en) * | 2013-07-29 | 2016-01-20 | 上海桂康生物科技有限公司 | A kind of recombinant human pepsinogen I I isozyme chimeric protein, preparation method and application thereof |
| CN109266564A (en) * | 2018-09-10 | 2019-01-25 | 武汉金开瑞生物工程有限公司 | A kind of integrated yeast recombinant expression system and application method |
| CN110004144B (en) * | 2019-03-06 | 2021-04-06 | 中国农业大学 | PGC promoter expressed by porcine small intestine epithelial cells and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6407206B1 (en) * | 1996-12-12 | 2002-06-18 | Ono Pharmaceutical Co., Ltd. | Peptides, methods for assaying human pepsinogen I or human pepsin I and assay kits |
| CN1757709A (en) * | 2005-07-15 | 2006-04-12 | 山东农业大学 | Saccharomyce engineering strain for expressing cbh2 gene and its construction method |
-
2007
- 2007-08-14 CN CN2007100940182A patent/CN101144061B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6407206B1 (en) * | 1996-12-12 | 2002-06-18 | Ono Pharmaceutical Co., Ltd. | Peptides, methods for assaying human pepsinogen I or human pepsin I and assay kits |
| CN1757709A (en) * | 2005-07-15 | 2006-04-12 | 山东农业大学 | Saccharomyce engineering strain for expressing cbh2 gene and its construction method |
Non-Patent Citations (3)
| Title |
|---|
| TAKUJI T, ET AL,.EXPRESSION OF SOLUBLE CLONED PORCINEPEPSINOGEN A IN ESCHERICHIA COLI.[J].BIO CHEM315.1996,315443-446. * |
| 乔宪凤，等，.猪胃蛋白酶原A基因cDNA的克隆及其表达.武汉大学学报（理学版）52 4.2006,52(4),508-512，具体参见第509页第1.6-1.9节. |
| 乔宪凤,等,.猪胃蛋白酶原A基因cDNA的克隆及其表达.武汉大学学报(理学版)52 4.2006,52(4),508-512,具体参见第509页第1.6-1.9节. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101144061A (en) | 2008-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101579132B (en) | Method for extracting proteins and chitin from heads and shells of prawns | |
| CN104664526B (en) | The extracting method of lotus flower ferment | |
| CN104082673A (en) | Method for simultaneously preparing low-protein rice and rice immunization peptide | |
| CN102450593A (en) | Preparation method of Tianma fermented bean curd | |
| CN107280014A (en) | It is a kind of to promote the compound probiotic protein powder of Instestinal motility | |
| Baumann et al. | Proteolysis during tempe fermentation | |
| CN104087511A (en) | Mucor racemosus strain and its application | |
| CN110241162A (en) | A kind of no fishy smell low molecular weight oyster peptide and its application | |
| CN101144061B (en) | Yeast engineering bacterium for producing human pepsinogen and its preparation method and application | |
| TW491894B (en) | DNA sequences encoding phytases of ruminal microorganisms | |
| CN101263226A (en) | Debaryomyces castellii phytase | |
| Weng et al. | Effect of two-step fermentation by Rhizopus oligosporus and Bacillus subtilis on protein of fermented soybean | |
| CN102181419A (en) | Trichoderma reesie protease as well as preparation method and application thereof | |
| RU2528017C2 (en) | Fermented natural product manufacture method | |
| CN105255771A (en) | Staphylococcus succinus for generating collagenase and application thereof | |
| CN107857812A (en) | A kind of preparation method of same human-like collagen amino acid, gene order and Argine Monohydrochloride | |
| CN102329766A (en) | Recombination food-grade lactic acid bacterium capable of being used for preventing or treating human ulcerative colitis as well as preparation method and application of recombination food-grade lactic acid bacterium | |
| Leh et al. | The effect of whey protein hydrolyzate average molecular weight on the lactic acid fermentation | |
| CN103798649A (en) | Preparation method of gelatin natto | |
| CN101768578B (en) | Eosinophilic lactase BGALA, gene and application thereof | |
| CN1360847A (en) | Prepn of chlorella extract | |
| CN100491533C (en) | Improved xylanase with high specific activity, its gene expression vector and recombinant yeast cell, and expression method | |
| CN104255914A (en) | Walnut milk fermentation agent, walnut milk lactobacillus fermentation beverage and preparation method of walnut milk lactobacillus fermentation beverage | |
| CN112293627A (en) | Vegetable protein functional peptide beverage and preparation method thereof | |
| CN101906391B (en) | S.thermophilus grx90 for fermenting soya-bean milk products and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120502 Termination date: 20140814 |
|
| EXPY | Termination of patent right or utility model |