CN101133153A - Gene SMS 13 - Google Patents

Abstract

The present invention relates to newly identified microorganisms capable of direct production of L-ascorbic acid (hereinafter also referred to as Vitamin C). The invention also relates to polynucleotide sequences comprising genes that encode proteins which are involved in the synthesis of Vitamin C. The invention also features polynucleotides comprising the full length polynucleotide sequences of the novel genes and fragments thereof, the novel polypeptides encoded by the polynucleotides and fragments thereof, as well as their functional equivalents. The present invention also relates to the use of said polynucleotides and polypeptides as biotechnological tools in the production of Vitamin C from microorganisms, whereby a modification of said polynucleotides and/or encoded polypeptides has a direct or indirect impact on yield, production, and/or efficiency of production of the fermentation product in said microorganism. Also included are methods/processes of using the polynucleotides and modified polynucleotide sequences to transform host microorganisms. The invention also relates to genetically engineered microorganisms and their use for the direct production of Vitamin C.

Description

Gene SMS 13

The gene that the present invention relates to newly identify, the protein that relates to during its coding L-xitix (hereinafter being also referred to as vitamins C) is synthetic.The invention still further relates to: comprise the polynucleotide and the fragment thereof of the total length polynucleotide sequence of this novelty gene, the polypeptide of the novelty of described polynucleotide encoding and fragment thereof, and their function equivalent.The invention still further relates to described polynucleotide and polypeptide as the biotechnology instrument in the purposes from the microorganisms producing vitamins C, wherein the modification to described polynucleotide and/or the polypeptide that is encoded has direct or indirect influence to productive rate, output and/or the efficient of producing described tunning in described microorganism.The present invention also comprises method/technology of using described polynucleotide and modified polynucleotide sequence to transform host microorganism.The invention still further relates to the purposes of passing through genetically engineered microorganism and being used for direct production of vitamin C.

Vitamins C is an extremely important and requisite nutritional factor concerning the mankind.Vitamins C also is used for animal-feed, although some farming animals can be in health synthesise vitamins C.

In in the past 70 years, from D-glucose vitamins C has been carried out industrial production by known Reichstein method.In this technology all undertaken in steps by chemical mode, only except one of them step (conversion from the D-Sorbitol Powder to the L-sorbose), it is undertaken by microbial transformation.From to ascorbic industrial initial practice, just used number of chemical improvement and technique improvement, improve the efficient of Reichstein method.Recently the development to production of vitamin C is summarized in Ullmann ' s Encyclopedia of Industrial Chemistry, 5th Edition, and Vol.A27 (1996) is among the pp.547ff.

The different intermediate steps of production of vitamin C are in microorganism or therefrom carry out under the assistance of isolated enzyme.Therefore, can pass through zymotechnique, by belonging to Ketogulonicigenium for example belongs to or Gluconobacter belongs to bacterial strain from L-sorbose or the ancient Lip river acid (2-KGA of the initial 2-of production ketone group of D-Sorbitol Powder-L-, this is to be chemically converted to ascorbic intermediate product by alkaline rearrangement reaction), perhaps by belonging to the recombinant bacterial strain that Gluconobacter belongs to or Pantoea belongs to, carry out another kind of zymotechnique and produce the ancient Lip river acid of 2-ketone group-L-from D-glucose is initial.

The method that is used for VITAMIN is carried out chemical production at present has the undesired feature of some people, for example high energy consumption and will use a large amount of organic and inorganic solvents.Therefore, in the past in the many decades, people research more economically and environmental protection make ascorbic other method with microbial transformation.

Come direct production of vitamin C to be in the news multiple microorganism from a large amount of substrates (comprising D-Sorbitol Powder, L-sorbose and L-sorbosone), described microorganism is algae, yeast and acetic acid bacteria for example, has wherein used different cultural methods.The example of known bacterium that can direct production of vitamin C comprises, for example, and the bacterial strain that belongs to from Gluconobacter, Gluconacetobacter, Acetobacter, Ketogulonicigenium, Pantoea, Pseudomonas or Escherichia.The example of known yeast or algae comprises, for example Candida, Saccharomyces, Zygosaccharomyces, Schizosaccharomyces, Kluyveromyces or Chlorella.

Can absorb that microorganism that the D-Sorbitol Powder is used to grow has usually can be the enzyme that the assimilation of ubiquity absorbs substrate (for example D-fructose) with this compound oxidation.The microorganism that can grow on the L-sorbose also has a kind of enzyme---NAD (P) H-dependency L-sorbose reductase, and this enzyme can be reduced to this compound the D-Sorbitol Powder, and the D-Sorbitol Powder further is oxidized to D-fructose again.After D-fructokinase phosphorylation, D-fructose becomes the outstanding substrate of a lot of microorganism growth.

For example, (it is obligate aerobic gram-negative micro-organism at acetic acid bacteria, belonging to Acetobacter, Gluconobacter and Gluconacetobacter belongs to) situation under, these microorganisms can be transported the D-Sorbitol Powder into cytosol (cytosol), and are translated into D-fructose by the NAD-dependency D-SODH in the cytosol.Some individual bacterial strains, for example Gluconobacter oxydans IFO 3292 and IFO 3293 can also transport the L-sorbose into cytosol, and it being reduced to the D-Sorbitol Powder by the NAD in the cytosol (P) H-dependency L-sorbose reductase, the D-Sorbitol Powder further is oxidized to D-fructose again.In these bacteriums, Embden-Meyerhof-Parnas approach and tricarboxylic acid cycle do not have complete activity, are phosphopentose pathways with the sugar central metabolic main path that leads.Enter phosphopentose pathway by phosphorylation reaction from the D-fructose-6-phosphate that D-fructose obtains, it is produced reduction energy and the growth that exists with NAD (P) H form and keeps necessary three carboxylic compounds by further metabolism.

Acetic acid bacteria is that people are known because of the ability of the different substrates of its energy incomplete oxidation (for example alcohol, sugar, sugared alcohols and aldehydes).These processes are known and be commonly called oxidative fermentation or incomplete oxidation for people, and they have been applied in food and the chemical industry for a long time, especially in the production to vinegar and L-sorbose.Known can to carry out the useful products that incomplete oxidation obtains from D-Sorbitol Powder or L-sorbose be 2-KGA with belonging to bacterial strain that Gluconobacter belongs to.

Acetic acid bacteria is by being arranged on periplasmic space, all plasma membranes and the different desaturases of kytoplasm are finished the reaction of these incomplete oxidations.Different desaturases uses different cofactors, and modal is PQQ and the FAD that is used for membrane bound enzyme or pericentral siphon enzyme, and the NAD/NADP that is used for the kytoplasm enzyme.

Though all products of these oxidizing reactions all disperse to get back to extraneous water surrounding by outer membrane, some in them can be advanced cell by active or passive transport, and are further used for forming relevant pathways metabolism with growth and energy.In the cell, oxidation products can be reduced enzyme and repeatedly revert back their initial substrate, is directed to then and gets back to central metabolism.

Have active protein in the metabolism of D-Sorbitol Powder or L-sorbose, especially enzyme and translocator are called as in this article and relate to Sorbitol Powder/sorbose metabolic system (Sorbitol/Sorbose Metabolization System).This proteinoid is abbreviated as SMS albumen in this article, and it plays a role in the direct metabolism to D-Sorbitol Powder or L-sorbose.

The metabolism of D-Sorbitol Powder or L-sorbose comprises: on the one hand, these compounds are absorbed into cytosol, and further be converted into the metabolite that can be used for absorbing approach, described absorption approach is Embden-Meyerhof-Pamas approach, phosphopentose pathway, Entner-Doudoroff approach and tricarboxylic acid cycle for example, they all relate to for the growth of the cell of living and keeping the energy of necessary whole keys form and anabolic reaction.On the other hand, the metabolism of D-Sorbitol Powder or L-sorbose also comprises by so-called incomplete oxidation process these compounds is converted into product through further oxidation, for example L-sorbosone, 2-KGA and vitamins C.

An object of the present invention is to improve the productive rate and/or the throughput of production of vitamin C.

Surprisingly, we find that SMS albumen or this type of proteic relating to have vital role to the absorption or the conversion of D-Sorbitol Powder, L-sorbose or L-sorbosone or the active subunit that has at this in ascorbic biotechnology is produced.

In one embodiment, SMS albumen of the present invention is selected from oxydo-reductase [EC 1], and the oxydo-reductase that plays a role on the CH-OH group that is preferably selected from donor [EC 1.1] more preferably is selected from NAD ⁺Or NADP ⁺As the oxydo-reductase [EC 1.1.1] of acceptor and oxydo-reductase [EC 1.1.99] with other acceptor, most preferably be selected from the oxydo-reductase of the enzyme group that belongs to [EC 1.1.1.1], [EC 1.1.1.15] or [EC1.2.1.-], perhaps be preferably selected from the oxydo-reductase [EC 1.2] that on the aldehyde of donor or oxo group, plays a role, more preferably be selected from NAD ⁺Or NADP ⁺Oxydo-reductase [EC 1.2.1] as acceptor.

In addition, SMS albumen of the present invention can be selected from the dependent D-SODH with membrane-bound PQQ, with membrane-bound L-sorbose dehydrogenase, with membrane-bound L-sorbosone dehydrogenase, with the dependent D-SODH of membrane-bound FAD, the dependent D-SODH of kytoplasm NAD, the dependent D-SODH of NAD (P) (being also referred to as the dependent sorbose reductase of NADPH), the dependent xylitol dehydrogenase of NAD, the dependent alcoholdehydrogenase of NAD, with membrane-bound L-sorbose dehydrogenase, the dependent L-sorbose reductase of NAD (P) H, the dependent sorbosone dehydrogenase of kytoplasm NADP, the dependent L-sorbosone of kytoplasm NAD (P) H reductase enzyme, with membrane-bound aldehyde dehydrogenase, the kytoplasm aldehyde dehydrogenase, the glycerol 3-phosphate desaturase, the group that other enzyme that relates among glyceraldehyde 3-phosphate dehydro-genase and the SMS constitutes.

Especially, have now found that, SMS albumen with polynucleotide encoding of following nucleotide sequence has vital role in ascorbic biotechnology is produced, this nucleotide sequence can be under the rigorous condition of preferred heights and the sequence hybridization shown in the SEQ ID NO:1.Now also find,, can improve described microorganism largely ascorbic direct fermentation by carrying out hereditary change to expression level in the microorganism (for example Gluconobacter) of direct production of vitamin C according to Nucleotide of the present invention.

Subsequently, the present invention relates to be selected from following group the polynucleotide or the complementary strand of these type of polynucleotide, described group by:

(a) coding comprises the polynucleotide according to the polypeptide of the aminoacid sequence of SEQ ID NO:2;

(b) comprise polynucleotide according to the nucleotide sequence of SEQ ID NO:1;

(c) comprise the polynucleotide of following nucleotide sequence, described nucleotide sequence can use genomic dna from microorganism as template, and use obtains by nucleic acid amplification (for example polymerase chain reaction) according to the primer sets of SEQ ID NO:3 and SEQ IDNO:4;

(d) polynucleotide, it comprises coding by the fragment of the polypeptide of each polynucleotide encoding or the nucleotide sequence of derivative in (a) to (c), wherein, in described derivative, one or more amino-acid residues are replaced by conservative than described polypeptide, and described fragment or derivative have the activity of oxydo-reductase [EC 1], preferably, the activity that has the oxydo-reductase [EC 1.1] (SMS 13) that on the CH-OH of donor group, plays a role;

(e) coding oxydo-reductase [EC 1], preferably, be coded in the polynucleotide of the oxydo-reductase [EC 1.1] (SMS 13) that plays a role on the CH-OH group of donor, and its complementary strand can be under rigorous condition and (a) each defined polynucleotide complementation in (d); And

(f) coding oxydo-reductase [EC 1], preferably, be coded in the polynucleotide of the oxydo-reductase [EC 1.1] (SMS 13) that plays a role on the CH-OH group of donor, and itself and (a) extremely

(d) each defined polynucleotide at least 70% are identical in, and for example 85%, 90% or 95% is identical;

Constitute.

We find, be useful especially SMS albumen from Gluconobacteroxydans DSM 17078 isolating SMS albumen shown in the SEQ ID NO:2 of Miao Shuing herein, because seem that it is on microorganism (bacterium particularly, acetic acid bacteria for example, Gluconobacter for example, Acetobacter and Gluconacetobacter) in direct production of vitamin C in bring into play keying action.Therefore, the present invention relates to encode according to the polynucleotide of the polypeptide of SEQ ID NO:2.This albumen can be by shown in the SEQ ID NO:1 nucleotide sequence coded.Therefore the present invention also relates to the polynucleotide that comprise according to the nucleotide sequence of SEQ ID NO:1.

Above nucleotide sequence of Que Dinging and aminoacid sequence are used as " search sequence ", so that use the Biotechnology[NCBI from National Center for] BLAST or Blast2 program (version 2) search at database PRO SW-SwissProt (fully released version adds the renewal of increase).According to these Search Results, will be labeled as the subunit A of the membrane-bound PQQ-dependency D-SODH of coding according to SMS 13 polynucleotide of SEQ ID NO:1.

Can use cDNA, mRNA or genomic dna as template, use suitable Oligonucleolide primers (for example according to SEQ ID NO:3 and SEQ ID NO:4 nucleotide primer), according to Standard PC R amplification technique, obtain according to nucleic acid of the present invention by nucleic acid amplification.The nucleic acid that amplifies thus can be advanced suitable carriers by the clone, and by dna sequence analysis it is characterized.

The template that is used to react can be by to comprising or suspect that the mRNA that comprises according to the preparation of the bacterial strain of polynucleotide of the present invention carries out the cDNA that reverse transcription obtains from known.The PCR product can be represented the new nucleotide sequence as herein described or the sequence of its function equivalent with the sequence of guaranteeing to amplify by subclone and order-checking.

Can pass through multiple currently known methods then, separate full length cDNA clone with the PCR fragment.For example, but the fragment that mark amplifies, with its screening phage or clay (cosmid) cDNA library.Perhaps, the fragment through mark can be used for screening-gene group library.

Therefore, the present invention relates to comprise the polynucleotide of following nucleotide sequence, described nucleotide sequence can use genomic dna from microorganism as template, and use obtains by nucleic acid amplification (for example polymerase chain reaction) according to the primer sets of SEQ ID NO:3 and SEQ ID NO:4.

The invention still further relates to following polynucleotide, it comprises the fragment of polypeptide of the polynucleotide encoding as herein described of encoding or the nucleotide sequence of derivative, wherein, in described derivative, one or more amino-acid residues are replaced by conservative than described polypeptide, and described fragment or derivative have the activity of SMS polypeptide (preferably, SMS 13 polypeptide).

The invention still further relates to following polynucleotide, its SMS polypeptide (preferably, SMS 13 polypeptide) of encoding, the polynucleotide complementation that its complementary strand can define with this paper under rigorous condition.

The invention still further relates to following polynucleotide, its polynucleotide at least 70% with this paper definition are identical, and its coding SMS polypeptide; The invention still further relates to the polynucleotide of the complementary strand that is polynucleotide defined above.

The invention still further relates to following microorganism, wherein, (preferably, SMS 13 polypeptide) increased activity and/or raising makes from the ascorbic gain in yield of D-Sorbitol Powder or L-sorbose direct production the SMS polypeptide.This can be for example by will polynucleotide according to the present invention changing reorganization over to or non-recombinant microorganism is finished, described for the biological endogenous equivalent that can contain SMS 13 genes, perhaps can not contain.

The technician will know how to strengthen and/or the improve SMS albumen activity of (preferably, SMS 13 albumen).These can for example increase SMS albumen (preferably, SMS 13 albumen) specific activity, perhaps, finishes host living beings by being carried out genetic modification, described genetic modification carries out in the mode that produces the copy of more or more stable SMS albumen (preferably, SMS 13 albumen) than wild-type biology.

In following specification sheets, will the scheme that reach this purpose (that is, by increasing SMS 13 proteic activity, increasing ascorbic productive rate and/or output from D-Sorbitol Powder or L-sorbose direct production) be described in detail.After carrying out necessary correction, these schemes can be applicable to other SMS albumen.

For SMS 13 genes that obtain to produce multiple copied more (promptly, this gene of overexpression) and/or the modification carried out of proteic biology comprise: use strong promoter, perhaps to SMS 13 genes (part) or its controlling element suddenlyd change (for example, insertion, disappearance or point mutation).This can comprise that also the gene with a plurality of copies is inserted in the suitable microorganism.The increase of SMS 13 albumen specific activities also can be finished by methods known in the art.These class methods can comprise the sudden change (for example, insertion, disappearance or point mutation) to SMS 13 genes (part).If the gene transcription level strengthens to some extent than wild type gene, think that so this gene is by " overexpression ".This can by for example to the amount of mRNA in addition quantitative Northern engram analysis measure, the amount of mRNA is used as the indication to genetic expression.In this article, if the amount increase at least 1%, 2%, 5%, 10%, 25%, 50%, 75%, 100%, 200% of the mRNA that the amount of the mRNA that produces produces than wild type gene or even surpass 500%, gene is exactly an overexpression so.

In this area also known can by SMS 13 albumen are contacted with specific enhanser or with can contact with interactional other material of SMS 13 albumen generation specificitys, strengthen given protein active.For identifying this type of specific enhanser, can express SMS 13 albumen, and the activity when exist suspecting the compound that can strengthen SMS 13 protein-actives is tested.Also can carry out stabilization and increase SMS 13 proteic activity by messenger RNA(mRNA) to coding SMS 13.These class methods also are known in the art, see, Sambrook et al. for example, 1989, Molecular Cloning, ALaboratory Manual, Cold Spring Harbor Press, N.Y. and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley ﹠amp; Sons, N.Y.).

The present invention can carry out in any microorganism that carries SMS 13 genes or its autoploid.Suitable microorganism can be selected from the group that yeast, algae and bacterium constitute, and they can be the mutants which had and the recombinant bacterial strain of wild type strain or mutafacient system that passes through standard and system of selection acquisition.This type of zymic example can be, for example, and Candida, Saccharomyces, Zygosaccharomyces, Schizosaccharomyces or Kluyveromyces.The example of this type of algae can be, for example, and Chlorella.The example of this bacterioid can be, for example, Gluconobacter, Acetobacter, Gluconacetobacter, Ketogulonicigenium, Pantoea, Pseudomonas (for example, Pseudomonas putida) and Escherichia (for example Escherichia coil).Preferably Gluconobacter or Acetobacter aceti, for example, G.oxydans, G.cerinus, G.frateurii, A.aceti subsp.xylinum or A.aceti subsp.orleanus, preferably, G.oxydans DSM 17078.According to " budapest treaty ", on January 26th, 2005 with Gluconobacter oxydans DSM 17078 (being called Gluconobacter oxydans N44-1 in the past) preservation to Deutsche Sammlung vonMikroorganismen und Zellkulturen (DSMZ), Mascheroder Weg 1B, D-38124Braunschweig, Germany.

Can be used for microorganism of the present invention can be obtained from the difference source by the public, for example, DeutscheSammlung von Mikroorganismen und Zellkulturen (DSMZ), Mascheroder Weg1B, D-38124Braunschweig, Germany, American Type Culture Collection (ATCC), P.O.Box 1549, Manassas, VA 20108USA or Culture CollectionDivision, NITE Biological Resource Center, 2-5-8, Kazusakamatari, Kisarazu-shi, Chiba, 292-0818, Japan (be Institue for Fermentation in the past, Osaka (IFO), 17-85, Juso-honmachi 2-chome, Yodogawa-ku, Osaka 532-8686, Japan).The example that is saved in the preferred bacterium of IFO for example is Gluconobacter oxydans (being called as G.melanogenus in the past) IFO3293, Gluconobacter oxydans (being called as G.melanogenus in the past) IFO3292, Gluconobacter oxydans (being called as G.rubiginosus in the past) IFO3244, Gluconobacter frateurii (being called as G.industrius in the past) IFO3260, Gluconobacter cerinus IFO3266Gluconobacter oxydans IFO 3287 and Acetobacter aceti subsp.orleanus IFO 3259, above-mentioned these all on April 5th, 1954 by preservation; The Acetobacter aceti subsp.xylinum IFO13773 of the Acetobacter aceti subsp.xylinum IFO13693 of preservation on October 22 in 1975 and preservation on December 8 in 1977.Strains A cetobacter sp.ATCC 15164 also is the example of preferred bacterium, and it is preserved in ATCC.Bacterial strain Gluconobacter oxydans (being called as G.melanogenus in the past) N44-1 is another example of preferred bacterium, it is the derivative of bacterial strain IFO 3293, at Sugisawa et al., Agric, Biol.Chem.54:1201-1209 describes to some extent to it in 1990.

Microorganism of the present invention can be carried other modification (it is described to see above) on dna level or protein level, as long as this type of modification has direct influence to productive rate, output and/or efficient from substrate (for example D-Sorbitol Powder or L-sorbose) direct production of vitamin C.This type of other modification can for example influence coding proteic other gene of SMS mentioned above, particularly, coding is with membrane-bound L-sorbosone dehydrogenase (for example, L-sorbosone dehydrogenase SNDHai) or combine the gene of D-SODH with membrane-bound PQQ.The method of carrying out this type of modification is known in the art, and some examples further describe in this article.About being used for vitamins C is carried out SNDHai and the Nucleotide and the aminoacid sequence of direct production, referring to WO 2005/017159, it incorporates this paper by reference into.

According to another object of the present invention, the polynucleotide of this paper definition are provided or had carried out the purposes of genetically engineered microorganism in producing vitamins C with these type of polynucleotide.

The invention still further relates to the technology of in microorganism, expressing native gene, relate to the technology of in microorganism, producing polypeptide defined above, and produce the technology that can produce ascorbic microorganism.All these technologies all can comprise the step that changes microorganism, wherein, " change " used herein comprises following technology, and this technology is so that the mode that the productive rate of tunning and/or throughput increase than wild-type biology is carried out " hereditary change " or " composition and/or the change that change cell culture medium are used for cultured method "." productive rate of ascorbic raising " used herein expression is than wild-type microorganisms (that is, not by the microorganism of hereditary change) increase at least 5%, 10%, 25%, 30%, 40%, 50%, 75%, 100%, 200% or even surpass 500%.

Term " genetically engineered " or " hereditary change " expression change the science of genetic material structure in the organism that lives.This comprises produces and uses recombinant DNA.More particularly, this is used to describe from naturally occurring biology and through biology genetically engineered or that modify.Genetically engineered can being undertaken by several different methods known in the art, for example, gene is replaced, gene amplification, gene disruption, conversion, the transfection of using plasmid, virus or other carrier to carry out.Genetically modified biology, for example, it is biological that genetically modified microorganism is also called reorganization usually, for example recombinant microorganism.

According to a further aspect in the invention, provide and be used for producing ascorbic technology by direct fermentation.

Especially, the invention provides the technology that is used for direct production of vitamin C, described technology comprises that with substrate conversion be vitamins C.This can for example carry out in comprising the substratum of microorganism, and described microorganism can be the microorganism in static microorganism or the growth, preferably, and static microorganism.

Some kinds of substrates can be used as carbon source in technology of the present invention (that is, being used for given substrate is converted into ascorbic technology, for example mentioned above).The carbon source of particularly suitable is those that can be easily obtain from D-glucose or D-Sorbitol Powder pathways metabolism, for example, D-glucose, D-Sorbitol Powder, L-sorbose, L-sorbosone, 2-keto-L-gulonic acid salt/ester, maltonic acid salt/ester, 2-keto-D-gluconic acid salt/ester, or 2,5-diketo-gluconate/ester.Preferably, substrate is selected from, and for example, D-glucose, D-Sorbitol Powder, L-sorbose or L-sorbosone more preferably, are selected from D-glucose, D-Sorbitol Powder or L-sorbose, and most preferably, are selected from D-Sorbitol Powder, L-sorbose or L-sorbosone.Relating to when using microorganism to carry out above-mentioned technology, term " substrate " and " production substrate " are used interchangeably in this article.

Being used to use the substratum of the above-mentioned technology that microorganism carries out in this article can be to be used to produce ascorbic any suitable medium.Typically, this substratum is to comprise for example salt and (multiple) substrate, and the aqueous culture medium with certain pH.Wherein substrate is converted into ascorbic substratum and is also referred to as the production substratum.

" fermentation " used herein or " production " or " zymotechnique " can be: utilize substratum known to the skilled, condition and scheme, cell in the use growth or the so-called resting cell in the non-growth, this is under the condition of the product (for example vitamins C) wanted being suitable for suitable substrate conversion, and the known substratum of use technology personnel, condition and scheme are carried out after described resting cell is cultivated.Preferably, produce vitamins C with resting cell.

It can be specific product with certain substrate conversion by one or more biotransformation step that term " direct fermentation ", " direct production ", " directly transforming " etc. mean microorganism, and need not any extra chemical conversion step.For example, term " is converted into vitamins C with the D-Sorbitol Powder " and is intended to describe following process, wherein, the microorganisms producing vitamins C, and wherein, the D-Sorbitol Powder provides as carbon source, and need not intermediate product chemical conversion step.Can the ascorbic single kind microorganism of direct fermentation be preferred.Under the condition that this type of conversion that begins from substrate that allows this paper definition is carried out, cultivate described microorganism.

About use microorganism carry out above-mentioned technology aspect, be to be understood that, mentioned microorganism also comprises the different name with same physiological attribute (synonym) or the basinym (basonym) of this type of bacterial strain, and it defines as International Code of Nomenclature of Prokaryotes.Name to microorganism used herein is that International Committee on Systematicsof Prokaryotes and the Bacteriology and Applied Microbiology Division of theInternational Union of Microbiological Societies official accepts (when the submission date of priority application), and disclosed by its official publications International Journal of Systematic andEvolutionary Microbiology (IJSEM).Concrete reference is Urbance etal., IJSEM (2001) vol 51:1059-1070, and the revision notice on IJSEM (2001) the vol 51:1231-1233, wherein described as reclassifying on the taxonomy of the G.oxydansDSM 4025 of Ketogulonicigenium vulgare.

Resting cell used herein refers to following microbial cell, and described microorganism for example is survival but can not active growth, or with low specific growth rate growth, for example, be lower than 0.02h ^-1Growth velocity, preferably, be lower than 0.01h ^-1The cell that demonstrates above-mentioned growth velocity is called as " resting cell pattern ".

The technology of the present invention of using microorganism to carry out as mentioned above can be carried out with different steps or stage: preferably, in first step (being also referred to as step (a) or growth phase), under the condition that can grow microorganism is cultivated.Stop this stage by the change condition, wherein, described condition changing makes microbial growth speed reduce, cause resting cell to produce, this is also referred to as step (b), then is to produce vitamins C with the resting cell of (b) from substrate, and this is also referred to as the production phase.

Use the growth phase and the production phase of carrying out in the above-mentioned technology of microorganism in same container, to carry out, that is, a kind of container is only arranged, or in two or more different vessels, carry out, between two stages, have optional separating step.Can from cell, reclaim the vitamins C that obtains producing by any suitable means." recovery " refers to, for example, vitamins C can be separated from produce substratum.Alternatively, can further process consequent vitamins C.

With regard to the purpose of the present invention of carrying out above-mentioned technology about the use microorganism, term " growth phase ", " growth step " and " growth period " are used interchangeably in this article.This is equally applicable to " production phase ", " production stage ", " production period ".

A kind of approach that carries out the above-mentioned technology of use microorganism of the present invention can be following technology, wherein: microorganism growth is in first container (so-called growth container), they are as the source of resting cell, and at least a portion in the cell is transferred in second container (so-called production container).The condition of producing in the container can be: make the cell that migrates out from growth container become the condition of resting cell defined above.Vitamins C produces in second container, and from wherein being recovered.

About use microorganism carry out above-mentioned technology aspect, in one aspect, growth step can carry out in aqueous culture medium,, is supplemented with the suitable nutraceutical growth medium that is used under aerobic conditions growing that is.Cultivation can with, for example, in batches, fed-batch, semicontinuous or continuous mode carry out.Incubation time can for example change with used host, pH, temperature and nutritional medium, it can be for for example: with in batches or fed-batch mode when carrying out, between about 10 hours to about 10 days, be preferably between about 1 day to about 10 days, more preferably, about 1 to about 5 days, this depended on described microorganism.If cell is cultivated with continuous mode, residence time can for example be about 2 to about 100 hours, and preferably, about 2 to about 50 hours, this depended on described microorganism.If microorganism is selected from bacterium, cultivation can be carried out at about 3.0 to about 9.0 pH, is preferably about 4.0 to about 9.0, and more preferably, about 4.0 to about 8.0, further more preferably, and about 5.0 to about 8.0.If used algae or yeast, cultivation can be carried out at and be lower than under about 7.0 the pH, preferably is lower than approximately 6.0, more preferably less than about 5.5, most preferably, is lower than about 5.0.Be used to use suitable temperature range that bacterium cultivates can for, for example, about 13 ℃ to about 40 ℃, preferably, about 18 ℃ to about 37 ℃, more preferably, about 13 ℃ to about 36 ℃, most preferably, about 18 ℃ to about 33 ℃.If use algae or yeast, the suitable temperature range that is used to cultivate can for example be, about 15 ℃ to about 40 ℃, preferably, about 20 ℃ to about 45 ℃, more preferably, about 25 ℃ to about 40 ℃, further more preferably, about 25 ℃ to about 38 ℃, most preferably, about 30 ℃ to about 38 ℃.The substratum that is used to cultivate can contain following nutrition usually as can absorbed carbon source, for example, glycerine, D-N.F,USP MANNITOL, D-Sorbitol Powder, L-sorbose, erythritol, ribitol, Xylitol, arabitol, inose, melampyrum, D-ribose, D-fructose, D-glucose, sucrose and ethanol, preferably, L-sorbose, D-glucose, D-Sorbitol Powder, D-N.F,USP MANNITOL, glycerine and ethanol; And contain digestible nitrogenous source, and for example, organic substance, for example, peptone, yeast extract and amino acid.Described substratum can contain or not contain urea and/or corn leaching solution and/or bread yeast.Multiple inorganic substance also can be used as nitrogenous source, for example, and nitrate and ammonium salt.In addition, growth medium contains inorganic salt usually, for example, and sal epsom, manganous sulfate, potassiumphosphate and lime carbonate.Then can with roughly the same pattern mentioned above, temperature and pH condition under, when for example having substrate such as D-Sorbitol Powder, L-sorbose or D-glucose, further incubation uses the cell that such scheme obtains, so that described cell is converted into vitamins C with substrate.Incubation can carry out in being rich in the substratum of nitrogen, contain in the substratum, for example, organic nitrogen source, for example, peptone, yeast extract, bread yeast, urea, amino acid and corn leaching solution, or it is inorganic nitrogen-sourced, for example nitrate and ammonium salt, in this case, cell can produce ascorbic while further growth.Perhaps, incubation can carry out in the substratum of nitrogen poorness, and in this case, cell will not grown substantially, and it will be in the resting cell pattern, or the bio-transformation pattern.In all cases, the incubation substratum also can contain inorganic salt, for example sal epsom, manganous sulfate, potassiumphosphate and calcium chloride.

About use microorganism carry out above-mentioned technology aspect, in growth phase, specific growth rate for example is 0.02h at least ^-1For with in batches, for the cell of fed-batch or semicontinuous pattern growth, growth velocity depends on, for example, the composition of growth medium, pH, temperature etc.Usually, growth velocity can be for example about 0.05 to about 0.2h ^-1Scope in, preferably, about 0.06 to about 0.15h ^-1Scope in, most preferably, about 0.07 to about 0.13h ^-1Scope in.

Aspect another of the aforesaid method that uses microorganism to carry out, can provide resting cell by upward indivedual microorganisms being cultivated at agar plate (as growth container), wherein used substantially the same condition, for example, aforesaid incubation time, pH, temperature, nutritional medium, and be added with agar.

Use microorganism carry out above-mentioned technology aspect, if growth was carried out in two kinds of different containers with the production phase, can be gathered in the crops from the cell of growth phase so or concentrated, and be transferred in second container (so-called production container).This container can contain the aqueous culture medium that is supplemented with any suitable production substrate (can be converted into vitamins C by cell).Can gather in the crops or concentrate cell by any suitable operation from growth container, described operational example as, centrifugal, film crossing current (membrane crossflow) ultrafiltration or micro-filtration, filtration, decant, flocculation.Thus obtained cell can also be transferred to from growth container with the form of original culture and produce the container, and need not be by results, concentrate or washing, that is, be transferred with the form of cell suspending liquid.A kind of preferred embodiment in, cell is transferred to the production container with the form of cell suspending liquid from growth container, between them without any the washing or separating step.

Therefore, the above-mentioned technology of using microorganism to carry out a kind of preferred embodiment in, the step of the inventive method mentioned above (a) and (c) do not separated by any washing and/or separating step.

Use microorganism carry out above-mentioned technology aspect, if growth and production phase are carried out in the same container, cell can grow under the suitable condition, to reach the ideal cell density, then replaces growth medium with containing the production substratum of producing substrate.This type of replacement can for example be when regaining from container or gathering in the crops supernatant liquor, and with identical with it speed, will produce substratum and be added in the container.For resting cell is remained in the container, can use to be used for cell recovery or resident operation, for example, the cell recycling step.This type of recycling step for example includes but not limited to following method: film crossing current micro-filtration, membrane reactor, flocculation or the cell fixation on suitable porous, non-porous or polymeric matrix of using whizzer, strainer, ultrafiltration step.After transition phase, to the following processing condition of container application: with this understanding, cell exists with the resting cell pattern of definition as mentioned, and, produce substrate and can be converted into vitamins C effectively.

Use microorganism carry out above-mentioned technology aspect, the aqueous culture medium that is used in the production container of production stage is called as the production substratum hereinafter, it can only contain and will be converted into ascorbic production substrate, maybe can contain extra inorganic salt, for example, sodium-chlor, calcium chloride, sal epsom, manganous sulfate, potassiumphosphate, calcium phosphate and lime carbonate.Produce substratum and can also contain digestible nitrogenous source, organic substance for example, for example, peptone, yeast extract, urea, amino acid and corn leaching solution; And inorganic substance, for example, ammonia, ammonium sulfate and SODIUMNITRATE, its concentration are to make cell be retained as the concentration of resting cell pattern defined above.Substratum can contain or not contain urea and/or corn leaching solution and/or cure yeast.Production stage can, for example, with in batches, fed-batch, semicontinuous or continuous mode carry out.Under fed-batch, semicontinuous or continuous mode, can be added into continuously or off and on suitable feed rate from growth container and two kinds of cells producing substratum and be produced in the container.Perhaps, only producing substratum can be added in the production container continuously or intermittently, and is transferred to the production container simultaneously from the cell of growth container.Cell from growth container can be used as cell suspending liquid in producing container, perhaps can be used as: for example, go up flocculation or fixed cell in any solid phase (for example, porous or polymeric matrix).Growth period is defined as entering into the production container from substrate to begin, to gathering in the crops the period of containing between the ascorbic supernatant liquor (being so-called results stream), this period can basis, for example, the concentration of the cell that uses and kind, pH, temperature and nutritional medium and change, they are preferably between about 2 to about 100 hours.PH can be different with pH and the temperature in the growth step with temperature, but should with growth step in substantially the same.

Use that microorganism carries out above-mentioned technology a kind of preferred embodiment in, production stage can carry out with continuous mode, this means, contain to be added into continuously or intermittently and produce in the container from first kind of feed supplement stream of the cell of growth container and second kind of feed supplement stream containing substrate.First kind of stream can only contain from growth medium the cell that separates/separate, maybe can contain direct cell suspending liquid from growth step, that is, be suspended in the cell in the growth medium, and without any intermediary cellular segregation, washing and/or separating step.Needed all other feed supplements streams of Ding Yi second kind of feed supplement stream operation that can comprise production stage in this article, for example, with one or more not the production substratum that comprises substrate, the water that is used to dilute that exist of the form of homogeneous turbulence and the alkali that is used to control pH.

About use microorganism carry out above-mentioned technology aspect, when flowing all continuous feeding for two kinds, the ratio of the feed rate of the feed rate of first kind of stream and second kind of stream can change between about 0.01 to about 10, preferably, change between about 0.01 to about 5, most preferably, change between about 0.02 to about 2.This ratio depend in first kind and the second kind of stream separately cell and the concentration of substrate.

The another kind of approach that carries out the above-mentioned technology of use microorganism of the present invention can be: the technology of using the resting cell of certain cell density in growth container.By method known to the skilled, in the 600nm place, cell density is recorded as absorbance units (optical density (OD)).A kind of preferred embodiment in, cell density in the production stage is about at least 10, more preferably, between about 10 to about 200, further more preferably, between about 15 to about 200, further more preferably, between about 15 to about 120, most preferably, between about 20 to about 120.

About use microorganism carry out above-mentioned technology aspect, for during the production phase (for example, carry out with continuous or semicontinuous pattern), with the cell density of wanting cell is remained in the production container, any means known in the art can be used, and for example, the cell that is undertaken by the ultrafiltration of film crossing current, decant, the flocculation of centrifugal, filtration, micro-filtration utilizes again, resident by the cell that film device carries out, or cell fixation.In addition, under the situation that production stage carries out with continuous or semicontinuous pattern, from growth container, mend cell continuously or intermittently, the cell density of producing in the container can be held in the constant level, this for example, undertaken by a certain amount of cell of results from produce container, described amount is corresponding to the amount of mending the cell of going into from growth container.

About use microorganism carry out above-mentioned technology aspect, the vitamins C that produces that recoverys/results contain in so-called results flow from produce container.Results stream can comprise, for example, from the not celliferous aqueous solution of producing container or contain the aqueous solution of cell, wherein contains the vitamins C that obtains from the production substrate conversion by the resting cell of producing in the container.Can be by any operation known in the art, the cell that still is in the results stream is separated with vitamins C, for example, filter, centrifugal, decant, film crossing current ultrafiltration or micro-filtration, tangent line stream ultrafiltration or micro-filtration or dead end (dead end) filtration.After this cellular segregation operation, do not contain cell substantially in the results stream.

In yet another aspect, technology of the present invention is capable of being combined to have other component that contains in the vitamins C that will produce and the results stream to separate and/or the additional step of purifying, that is, and and so-called downstream procedure of processing.These steps can comprise any means known to the skilled, for example, concentrate, crystallization, precipitation, absorption, ion-exchange, electrodialysis, the two poles of the earth EDBM and/or reverse osmosis.The form that vitamins C can be used as free acid form or its known any salt is further purified, and this is undertaken by following operational means, for example, with gac handle, ion-exchange, absorption and wash-out, concentrate, crystallization, filtration and drying.Especially, vitamins C is separated any suitable combination that can be by for example following method with the first time of other component in the results stream or repeat to carry out, described method is for example: (it is carried out at for two compartments or three compartment electrodialysis, the two poles of the earth EDBM, reverse osmosis or absorption, for example, on the ion exchange resin or on the non-ionic resin).If the ascorbic form that obtains is the salt of L-xitix, this salt form is converted into free acid form can for example be passed through, and the two poles of the earth EDBM, ion-exchange, simulated moving bed chromatography technology wait and carry out.The combination of above-mentioned steps also can be used, and for example, electrodialysis and the two poles of the earth EDBM is combined as a step, and the combination of using a plurality of ion-exchange step of simulated moving bed chromatography method.Above-mentioned any scheme has just constituted the means easily that are used for separation and purified product (being vitamins C) alone or in combination.Thus obtained product also can further be separated (for example, by concentrating, crystallization, precipitation, crystalline washing and exsiccant mode being carried out) and/or is further purified (with activated carbon treatment, ion-exchange and/or recrystallization).

A kind of preferred embodiment in, come purifying vitamins C from results stream by a series of above-mentioned downstreams procedure of processing, and needn't any moment in this processing it be transferred in the non-aqueous solution, that is, all in aqueous environments, carry out in steps.This type of preferred downstream processing scheme can comprise, for example, by two compartments or three compartment electrodialysis the results stream from the production container is concentrated, by the two poles of the earth EDBM and/or ion-exchange the vitamins C that exists with the form of its salt in the concentrated solution is converted into its sour form, carry out purifying by for example method such as handling, then carry out further enrichment step and crystallization with gac, ion-exchange or non-ionic resin.These crystal can separated, washing and dry.If necessary, crystal also can be dissolved in the water again, with gac and/or ion exchange resin it is handled, and recrystallization.Can separate, wash and drying above-mentioned crystal then.

Favourable embodiment of the present invention is by dependent claims and apparent.According to instruction of the present invention, it will be appreciated by one of skill in the art that above-mentioned and others and above-mentioned and other embodiment of the present invention.

The sequence of the gene of the nucleotide sequence that comprises the SMS 13 proteic SEQ ID NO:1 that encode by the genomic clone that obtains from Gluconobacter oxydans DSM 17078 being checked order, measuring.

The invention still further relates at least one bioactive fragment of SMS 13 polypeptide shown in the coding SEQ ID NO:2 or the polynucleotide of derivative.

" bioactive fragment or derivative " used herein expression remains with and essentially identical biological function of polypeptide or the active polypeptide shown in the SEQ ID NO:2.Bioactive example can for example be that enzyme is lived, signal transmits activity or antibody reactivity.Term " identical biological function " or " function equivalent " represent when using in this article that the polypeptide shown in protein and the SEQ ID NO:2 has essentially identical biological activity, and for example, enzymic activity, signal transmit activity or antibody reactivity.

Polypeptide of the present invention and polynucleotide preferably provide with separated form, preferably, are purified to homogeneous.

Term " separated " expression: material is moved out of its original environment (for example, if its naturally occurring words are exactly natural surroundings).For example, the naturally occurring polynucleotide or the polypeptide that exist in the microorganism that lives are not separated, but with same polynucleotide or polypeptide that some or all coexisting substances in the natural system separate be exactly separated.These type of polynucleotide can be that the part of carrier and/or this type of polynucleotide or polypeptide can be the parts of composition, but still are separated, because examples of such carriers or composition are not the part of its natural surroundings.

Separated polynucleotide used herein or nucleic acid can be such DNA or RNA, they with the naturally occurring genome of the biology that therefrom obtains these polynucleotide or nucleic acid in closely adjacent two encoding sequences (5 ' terminal, 3 ' terminal) be not closely adjacent.Therefore, in one embodiment, nucleic acid comprises some or all of 5 ' non-coding (for example, the promotor) sequence closely adjacent with encoding sequence.Term " separated polynucleotide " therefore comprises; for example; join in the carrier, join in autonomously replicating plasmid or the virus; perhaps join the recombinant DNA in prokaryotic organism or the Eukaryotic genomic dna; perhaps conduct is independent of the recombinant DNA of independent molecule (for example, handling cDNA or the genomic DNA fragment that produces by PCR or the restriction enzyme) existence of other sequence.It also comprises the recombinant DNA of a part that is the heterozygote gene, and described genes encoding does not contain the extra polypeptide of cellular material, viral material or substratum (when producing by recombinant DNA technology) or precursor or other chemical substance (when synthesizing by chemical mode) substantially.In addition, " separated nucleic acid fragment " is such nucleic acid fragment: it is natural as the fragment existence, and will can not be found in native state.

Term used herein " polynucleotide ", " gene " and " recombination " refer to the nucleic acid molecule that can separate with chromosomal DNA, comprise the opening code-reading frame of coded protein (for example, G.oxydans DSM 17078SMS albumen).Polynucleotide can comprise, for example, the zone in the polynucleotide sequence shown in the SEQ IDNO:1 or its fragment and gene order upstream or downstream, described zone can comprise, for example, for by the suitable expression of the polypeptide of its acquisition and stable important promoter region, regulator zone and terminator zone.

Gene can comprise encoding sequence, non-coding sequence (for example, being positioned at genes encoding zone 3 ' terminal and 5 ' terminal non-translated sequence) and regulating and controlling sequence.In addition, gene refers to the separated nucleic acid molecule that this paper defines.The technician also will understand, and cause the dna sequence polymorphism of the variation of SMS Argine Monohydrochloride sequence can be present in the population (population), for example, and in the Gluconobacter oxydans population.This type of genetic polymorphism in SMS 13 genes can be present between the individuality of population owing to natural variation, perhaps is present in the cell of different population.Typically, this type of natural variation can cause the change degree of 1-5% in SMS 13 gene nucleotide series.As natural variation the result's and can not change any among the SMS 13 of the proteic functionally active of SMS and all this type of nucleotide diversity and the amino acid polymorphism that obtains thus are also included within the scope of the present invention.

Term used herein " polynucleotide " or " nucleic acid molecule " are intended to comprise dna molecular (for example, cDNA or genomic dna) and RNA molecule (for example mRNA) and use the DNA of nucleotide analog deposits yields or the analogue of RNA.Nucleic acid molecule can be strand or two strands, but double-stranded DNA preferably.Can use oligonucleotide analogs or derivative (for example, inosine or phosphorothioate Nucleotide) to come nucleic acid.This class oligonucleotide can be used for: for example, preparation has the nucleic acid to the resistance of nuclease of the base pairing ability of change or increase.

The sequence information that provides herein should be interpreted as by narrow sense need comprise the base of into being identified by mistake.Particular sequence disclosed herein can be used at an easy rate from given carbon source being converted into ascorbic reorganization or non-recombinant microorganism (Gluconobacter oxydans particularly, preferably, Gluconobacter oxydans DSM 17078) isolates complete genome in, can easily carry out further sequential analysis subsequently, identify the order-checking mistake thus this gene.

Unless specialize, herein by all nucleotide sequences that dna molecular checked order to determine all be with the automated DNA sequenator (mensuration, and all aminoacid sequences of the polypeptide of the dna molecule encode that this paper measures all are by inferring translating according to the dna sequence dna of mensuration mentioned above.Therefore, as known in the art, for any dna sequence dna of being measured by this automated method, any nucleotide sequence that this paper measured all may contain some mistakes.Typically, by about at least 90% homology of actual nucleotide sequence of automated method nucleotide sequence of measuring and the dna molecular that is checked order, more typically, about at least 95% to about at least 99.9% is identical.By other method, comprise artificial DNA sequence measurement well known in the art, can measure more accurately actual sequence.Also as known in the art, will cause reading frame displacement in the nucleotide sequence translation than the single insertion of actual sequence or disappearance in the nucleotide sequence that records, make: from the point of this type of insertion or disappearance, the nucleotide sequence coded expectation aminoacid sequence that records is different from the aminoacid sequence of the dna molecular actual coding that is checked order fully.

Those skilled in the art can identify this type of base of being identified by mistake, and know how to correct this type of mistake.

Can (for example only comprise nucleotide sequence provided by the invention according to nucleic acid molecule of the present invention, sequence shown in the SEQ ID NO:1) a part or fragment, for example, can be used as the fragment (for example SEQ ID NO:3 or SEQ ID NO:4) of probe or primer or coding according to the fragment of a proteic part of the present invention.Allow to produce from the nucleotide sequence that the clone of SMS 13 genes is measured and be designed to identify and/or clone other member of SMS 13 families and from the probe and the primer of the SMS13 autoploid of other species.Typically, this probe/primer comprises the oligonucleotide of basic purifying, it typically comprises and the nucleotide sequence shown in the SEQ ID NO:1 or its fragment or derivative about at least 12 or 15, preferably approximately 18 or 20, more preferably about 22 or 25, the further nucleotides sequence column region of more preferably about 30,35,40,45,50,55,60,65 or 75 or more a plurality of continuous nucleotide hybridization (preferably, hybridizing under highly rigorous condition).

Also can pass through polymerase chain reaction (PCR), use the synthetic oligonucleotide primer thing of the sequence information design that contains based on this paper, isolate all or part of nucleic acid molecule of the nucleotide sequence that comprises SEQ ID NO:1.

Can use cDNA, mRNA or genomic dna as template according to Standard PC R amplification technique, use suitable Oligonucleolide primers, nucleic acid of the present invention increases.Kuo Zeng nucleic acid can be advanced suitable carriers by the clone thus, and is characterized by dna sequence analysis.

Fragment according to polynucleotide of the present invention also can comprise the not polynucleotide of encoding function polypeptide.These type of polynucleotide can be used as probe or primer is used for the PCR reaction.

No matter its encoding function or NOT-function polypeptide all can be used as hybridization probe or polymerase chain reaction (PCR) primer according to nucleic acid of the present invention.The purposes of nucleic acid molecule of the present invention with SMS 13 active polypeptide of not encoding comprises: (1) (for example from other biology except that Gluconobacter oxydans) separates code book and invents proteic gene or its allelic variant from the cDNA library, and (2) be used to survey the Northern engram analysis of the expression of proteic mRNA described in the specific cells, or (3) are used for strengthening and/or improving function or the activity of homology SMS 13 genes at described other biology.

The transcript or the genome sequence that can be used for detecting coding same or homologous protein (for example, in other biology) based on the probe of nucleotide sequence provided herein.Can be based on the homology of itself and G.xoydans SMS 13 nucleic acid disclosed herein, use G.oxydans DNA or its part as hybridization probe, according to the standard hybridization technique, preferably under highly rigorous hybridization conditions, isolate corresponding to the natural variant of G.xoydans SMS 13DNA of the present invention or the nucleic acid molecule of non-G.oxydans autoploid, they are also included within the present invention.

In preferred embodiment, probe also comprises the labelling groups that adheres to it, and for example, labelling groups can be the cofactor of radio isotope, fluorescent chemicals, enzyme or enzyme.

For example, can use two cover degeneracy oligonucleotide primer storehouses, carry out PCR and separate the homologous gene sequence based on the nucleotide sequence design of this paper instruction.

The template that is used to react can be by to expressing or suspect and can express the cDNA that mRNA that the bacterial strain according to polynucleotide of the present invention prepares carries out the reverse transcription acquisition from known.The PCR product can be represented the new nucleotide sequence as herein described or the sequence of its function equivalent with the sequence of guaranteeing to amplify by subclone and order-checking.

Can pass through multiple currently known methods then, separate full length cDNA clone with the PCR fragment.For example, but the fragment that mark amplifies, with its screening phage or clay cDNA library.Perhaps, the fragment through mark can be used for screening-gene group library.

Round pcr also can be used for from other bioseparation full-length cDNA.For example, can be according to standard scheme, from suitable cell or tissue source isolation of RNA.Can carry out reverse transcription reaction on RNA, wherein use has specific Oligonucleolide primers with 5 ' least significant end of amplified fragments, and is synthetic to guide first chain.

Can use the terminal enzyme (DNA) reaction of standard then, to the RNA/DNA crossbred " tailing " (for example, using guanine) that obtains, available RNaseH digestion crossbred, guiding second chain is synthetic can (for example, to use the poly-C primer) then.Thus, the cDNA sequence that can easily separate the fragment upstream of amplification.About the summary of useful clone's strategy, referring to, Sambrook et al. for example mentioned above and Ausubel et al. mentioned above.

In addition, coding SMS other member of 13 families, have with according to the nucleic acid of the different nucleotide sequence of the nucleotide sequence of SEQ ID NO:1 also within the scope of the invention.In addition, coding from SMS 13 albumen of other species, have a nucleotide sequence different with the nucleotide sequence shown in the SEQ ID NO:1 nucleic acid also within the scope of the invention.

The invention still further relates to separated polynucleotide, it can (preferably, under the highly rigorous condition) be hybridized with polynucleotide of the present invention (for example, the polynucleotide shown in the SEQ ID NO:1) under rigorous condition.Advantageously, these type of polynucleotide can obtain from given carbon source being converted in the ascorbic microorganism (Gluconobacter oxydans particularly, preferably, Gluconobacteroxydans DSM 17078).

The term of using herein " hybridization " is used to describe hybridization and washing, under described hybridization and wash conditions, typically, mutually between homology be at least about 50%, at least about 60%, at least about 70%, more preferably at least about 80%, more preferably at least about 85% to 90%, most preferably be at least 95% nucleotide sequence and keep the state of phase mutual cross.

In one embodiment, the nucleotide sequence shown in nucleic acid of the present invention and the SEQ ID NO:1 or its complementary sequence at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology or more homology.

A preferred unrestriced example of this type of rigorous hybridization conditions is in 6x sodium chloride/sodium citrate (SSC), about 45 ℃ of hybridization down, subsequently in 1x SSC, 0.1%SDS, carry out the one or many washing under 50 ℃, washing is preferably under 55 ℃, more preferably under 60 ℃, further preferably under 65 ℃, carry out.

Highly rigorous condition comprises: through the dna probe of mark (for example use, dna probe with digoxin (DIG) mark) at 42 ℃ of incubation a couple of days (for example 2-4 days), then in 2xSSC and 0.1%SDS, under room temperature, wash one or many, and, in 0.5xSSC and 0.1%SDS or 0.1x SSC and 0.1%SDS, wash one or many at 65-68 ℃.Especially, highly rigorous condition comprises, for example, in solution, for example contain or do not contain in the DigEasyHyb solution (Roche Diagnostics GmbH) of the salmon sperm dna of 100 μ g/ml, or comprise 50% methane amide, 5x SSC (150mM NaCl, the 15mM trisodium citrate), 0.02% sodium laurylsulfonate, in the solution of 0.1%N-Sarkosyl L and 2% closed reagent (Roche Diagnostics GmbH), the dna probe that uses digoxin (DIG) mark is (for example by using RocheDiagnostics GmbH, 68298Mannheim, the DIG Mk system of Germany prepares) 42 ℃ of incubations 2 hours to 4 days, then in 2x SSC and 0.1%SDS, under room temperature, wash film twice, each 5 to 15 minutes, at 65-68 ℃, in 0.5x SSC and 0.1%SDS or 0.1x SSC and 0.1%SDS, wash twice then, each 15-30 minute.

Preferably, with the of the present invention separated nucleic acid of nucleotide sequence hybridization of the present invention (preferably under highly rigorous condition, hybridizing) corresponding to naturally occurring nucleic acid molecule." naturally occurring " used herein nucleic acid molecule refers to have the RNA or the dna molecular (for example, coding natural protein) of naturally occurring nucleotide sequence.In one embodiment, natural G.oxydans SMS 13 albumen of nucleic acid encoding.

The technician knows which kind of condition is suitable for rigorous hybridization conditions and highly rigorous hybridization conditions.Be easy to obtain other guidance in this area about this type of condition, for example, at Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; With Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley﹠amp; Sons, N.Y.) in.Certainly, only with poly (A) sequence (for example 3 ' of mRNA terminal poly (A) district) or only will can not be included in the polynucleotide of the present invention that are used for a part of specific hybrid of nucleic acid of the present invention with the polynucleotide of complementary extension of section (stretch) hybridization of T (or U) residue, because these type of polynucleotide will be hybridized with any nucleic acid molecule or its complementary sequence (for example, being actually the cDNA clone of any two strands) that contains poly (A) extension of section.

Adopt exemplary means, can be to from other biology, for example given carbon source can be converted into the DNA library that ascorbic microorganism (particularly other Gluconobacter species) makes up and screen.

For example, can come the bacterial strain of Gluconobacter is screened by Southern and/or Northern engram analysis.Detect with polynucleotide homologous transcript of the present invention after, can utilize to well known to a person skilled in the art standard technique, come the construction cDNA library by separating from the RNA of suitable bacterial strain.Perhaps, can use and to come with the probe of multi-nucleotide hybrid of the present invention the complete genome DNA library is screened.

Can use the Protocols in Molecular Biology and the sequence information provided herein of standard, separate nucleotide sequence of the present invention, for example the nucleic acid molecule shown in the SEQ ID NO:1 or its fragment or derivative.For example, can the use standard hybridization and clone technology (for example, Sambrook, J., Fritsh, E.F., and Maniatis, T.Molecular Cloning:A Laboratory Manual.2nd, ed., Gold SpringHarbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 is described), all or part of of the nucleic acid molecule shown in the use SEQ ID NO:1 separates according to nucleic acid molecule of the present invention as hybridization probe.

In addition, can pass through standard synthetic technology (for example, use automatic dna synthesizer) prepare corresponding to the oligonucleotide of nucleotide sequence of the present invention or can with the oligonucleotide of nucleotide sequence hybridization of the present invention.

Term " homology " or " homogeny per-cent " are used interchangeably in this article.With regard to purpose of the present invention, in this definition: be the homogeny per-cent of determining two aminoacid sequences or two nucleotide sequences, in line with optimum purpose relatively (for example, can list the introducing breach at article one aminoacid sequence or nucleotides sequence, to reach best comparison with second aminoacid sequence or nucleotide sequence), sequence is compared.Then amino-acid residue on corresponding amino acid position or the nucleotide position or Nucleotide are compared.If corresponding position identical on the amino-acid residue of certain position or Nucleotide and the second sequence on sequence article one, these molecules are exactly identical in this position so.Homogeny per-cent between two sequences is the function (that is the total x100 in the quantity/position of % homogeny=same position (being the lap position)) of the quantity of the total same position of described sequence.Preferably, this two sequences length is identical.

The technician can know has some computer programs can be used to determine homology between two sequences.For example, can use mathematical algorithm to finish to the comparison of sequence and determining to homogeny per-cent between two sequences.A kind of preferred embodiment in, use Needleman and Wunsch (J.Mol.Biol. (48): 444-453 (1970)) algorithm to determine two homogeny per-cents between aminoacid sequence, described algorithm be integrated into the GCG software package (can from Http:// www.accelrys.comAcquisition) in the GAP program, wherein use Blossom 62 matrixes or PAM250 matrix, the breach weight is 16,14,12,10,8,6 or 4, and the length weight is 1,2,3,4,5 or 6.The technician can be appreciated that: all above-mentioned different parameters will cause having the result of technicality, but the overall % homogeny of two sequences does not have remarkable change when being to use algorithms of different.

In another embodiment, use the GCG software package (can from Http:// www.accelrys.comAcquisition) GAP program is determined two homogeny per-cents between nucleotide sequence, wherein uses the NWSgapdna.CMP matrix, and the breach weight is 40,50,60,70 or 80, and the length weight is 1,2,3,4,5 or 6.In another embodiment, use E.Meyers and W.Miller (CABIOS, 4:11-17 (1989)) algorithm is determined the homogeny per-cent of two aminoacid sequences or nucleotide sequence, described algorithm be integrated into ALIGN program (2.0 editions) (can from Http:// vega.igh.cnrs.fr/bin/align-guess.cgiObtain) in, wherein use PAM120 weight residue table, notch length punishment (penalty) is 12, breach punishment is 4.

Nucleic acid of the present invention and protein sequence can be used as " search sequence " further and carry out search at public's database, for example, go to identify other member in correlated series or the family.Can use Altschul, the BLASTN of et al. (1990) J.Mol.Biol.215:403-10 and BLASTX program (2.0 editions) are carried out this type of search.Can use the BLASTN program, with mark=100, word length (word length)=12 is carried out the BLAST nucleotide search, to obtain and nucleic acid molecule homologous nucleotide sequence of the present invention.Can use the BLASTX program, with mark=50, the BLAST protein search is carried out in word length=3, to obtain and protein molecule homologous aminoacid sequence of the present invention.In line with purpose relatively, for obtaining comparison jaggy, can utilize Altschul et al., (1997) Nucleic Acids Res.25 (17): the Gapped BLAST that describes among the 3389-3402.When utilizing BLAST and Gapped blast program, can use the default parameter of each program (for example BLASTX and BLASTN).See Http:// www.ncbi.nlm.nih.gov

In another preferred embodiment, separated nucleic acid molecule of the present invention comprises the nucleic acid molecule of the complementary sequence that is nucleotide sequence of the present invention (for example, the sequence shown in the SEQ ID NO:1).With nucleotide sequence complementary nucleic acid molecule disclosed herein be such sequence: the nucleotide sequence shown in itself and the SEQID NO:1 is enough complementary, thus its can with described nucleotide sequence hybridization, form stable duplex (duplex) thus.

In another preferred embodiment, the nucleic acid of the present invention shown in the SEQ ID NO:1 or its complementary sequence contain the sudden change of at least one place, and described sudden change causes gene product to have modified function/activity.Described at least one place sudden change can be introduced by method as herein described.In one aspect, described at least one place sudden change causes producing such SMS 13 albumen: its function and/or activity strengthen to some extent or improve than the wild-type copy.The method that is used to introduce this type of sudden change is well known in the art.

Term used herein---active " increase " comprising: increase the activity of producing one or more polypeptide in the biology, described polypeptide is a corresponding polynucleotide encoding as herein described.Can obtain to be used to increase the active several different methods of given albumen (being SMS 13 albumen) in this area under the situation of this paper.Usually, can increase proteinic specific activity or can increase proteinic copy number.Term increases activity or the equivalent expression also comprises following situation: wherein, SMS 13 protein-actives do not contain this active cell before being introduced into, and this for example introduces the former cell that did not contain the cell of this gene equivalent or can not express the activity form of corresponding protein in the past by the gene of the SMS 13 that will encode and realizes.

For assisting this increase, can be increased corresponding to the copy number of the gene of polynucleotide described herein.Perhaps, can use strong promoter to instruct the expression of polynucleotide.In another embodiment, the promotor of gene, regulation and control zone and/or ribosome bind site can be changed, and express to increase.Can also strengthen or force expression by the relative half life that increases messenger RNA(mRNA).In another embodiment, can also can increase an active place or many places and suddenly change and increase the activity of polypeptide self by in polypeptid acid sequence, utilizing.For example, the affinity of change polypeptide substrate corresponding with it can cause active the raising.Similarly, can increase the relative half life of peptide.Under the situation that genetic expression enhancing or specific activity increase, composition that can be by changing cell culture medium and/or be used for cultured method and reach this raising." enhanced expression " used herein or " activity of raising " expression than wild-type protein, polynucleotide, gene or polynucleotide or polypeptide be enhanced and/or improve before the proteic activity and/or the concentration that exist, at least 5%, 10%, 25%, 50%, 75%, 100%, 200% or even surpass 500% increase.Also can increase SMS 13 proteic activity by the active specificity of albumen and its or general toughener are contacted.

Another aspect of the present invention relates to carrier, and described carrier contains code book invents proteinic nucleic acid or its function equivalent or a part.The term of Shi Yonging " carrier " refers to transport the nucleic acid molecule of another nucleic acid molecule that is connected thereto in this article.A kind of bearer type is " plasmid ", and " plasmid " refers to cyclic double-stranded DNA ring, and other dna segment can be connected on the described ring.The type of another kind of carrier is a virus vector, and wherein, other dna segment can be connected in the viral genome.Some carrier can carry out self-replicating (bacteria carrier that for example, has the replication orgin of bacterium) in the host cell that it is introduced into.Other carrier just is integrated in the genome of host cell after being introduced into host cell, so they and host genome are together duplicated.

In addition, some carrier can instruct the expression of gene that is operably connected on it.Examples of such carriers is called as " expression vector " in this article.Generally speaking, the expression vector of using in recombinant DNA technology is the form of plasmid normally.Term " plasmid " and " carrier " can exchange use in this article, because plasmid is the most frequently used carrier format that arrives.Yet the present invention also will comprise the expression vector of other form, virus vector (for example, replication defect type retrovirus, adenovirus and adeno associated virus) for example, and they can provide the function that is equal to.

Recombinant expression vector of the present invention comprises nucleic acid of the present invention, the form that described nucleic acid exists is suitable for the expression of this nucleic acid in host cell, this means that this recombinant expression vector comprises one or more snippets regulating and controlling sequence, described regulating and controlling sequence is based on selects the host cell that is used to express, and it is operably connected on the nucleotide sequence that will express.In recombinant expression vector, " be operably connected " and be used to represent: the interested nucleotide sequence of people is connected on the regulating and controlling sequence, described connection (is for example expressed to allow this nucleotide sequence, in in-vitro transcription/translation system, express, perhaps when carrier is introduced in the host cell, the expression in this host cell) mode is carried out.Term " regulating and controlling sequence " will comprise promotor, enhanser and other expression controlling elements (for example, attenuator).For example, at Goeddel; Gene Expression Technology:Methods inEnzymology 185, Academic Press, San Diego, CA is described this type of regulating and controlling sequence in (1990).Regulating and controlling sequence is included in and instructs the composing type of nucleotide sequence or the regulating and controlling sequence of inducible expression in a variety of host cells, also comprises the regulating and controlling sequence (for example, tissue specificity regulating and controlling sequence) that only instructs nucleotide sequence to express in some host cell.Those skilled in the art will recognize, may depend on following factor to the design of expression vector: for example: to being expected the protein expression level of acquisition etc. by the selection of transformed host cells.Expression vector of the present invention can be introduced into host cell, produce the protein or the peptide of nucleic acid encoding as herein described thus, it includes but not limited to: the mutant protein of nucleic acid encoding as herein described, its fragment, its variant or function equivalent and fusion rotein, for example, SMS 13 albumen, SMS 13 proteic mutant forms, fusion rotein etc.

In order in suitable microorganism, to express SMS 13 albumen, can be designed recombinant expression vector of the present invention.For example, can in bacterial cell, express, for example, in the bacterial strain that belongs to Gluconobacter, Gluconacetobacter or Acetobacter genus, express according to albumen of the present invention.Useful in the present invention expression vector comprises the carrier that is derived from karyomit(e), episome and virus, for example be derived from the carrier of bacterial plasmid, phage and be derived from the carrier of the combination of above-mentioned substance, for example be derived from the carrier of plasmid and phage genetic elements, for example clay and phagemid (phagemid).

DNA inserts and should be operably connected on the suitable promotor, and promotor can be constitutive promoter or inducible promoter.The technician knows how to select suitable promotor.Expression construct can contain and is useful on transcription initiation, terminated site, also can contain ribosome bind site transcribing the zone, to be used for translation.The encoding part of the ripe transcript of being expressed by construct can preferably include the initiator codon that is in starting point, and the terminator codon that is positioned polypeptide end to be translated rightly.

Can carrier DNA be introduced proper host cell by traditional conversion or rotaring dyeing technology.Term used herein " conversion ", " changeing bridging (transconjugation) " and " transfection " mean multiple technologies known in the art, that be used for exogenous nucleic acid (for example DNA) is incorporated into host cell, comprise transfection or electroporation that calcium phosphate or calcium chloride co-precipitation, the transfection of DEAE-dextran mediation, transduction, infection, lipofection, cationic lipid mediate.Be used for to host cell transform with the appropriate method of transfection can be at Sambrook, et al. (mentioned above), Davis et al. finds in Basic Methods in Molecular Biology (1986) and other laboratory manual.

For identifying and select that to foreign DNA being integrated into their genomic cells usually, the gene of the selective marker of will encoding (for example, to antibiotic resistance) is introduced host cell with interested gene.Preferred selective marker comprises gives those of medicine (for example card receive mycin, tsiklomitsin, penbritin and Streptomycin sulphate) resistance.The nucleic acid of coding selective marker is preferably introduced host cell on the carrier identical with coding proteic carrier according to the present invention, perhaps it can be introduced on independent carrier, and this carrier for example is the suicide carrier, and it can not duplicate in host cell.Can identify the nucleic acid stability cells transfected (for example, the cell that has been associated with selectable marker gene will be survived, and other cell can be dead) that process is introduced by medicament selection.

The present invention also provides separated polypeptide, and it has the aminoacid sequence shown in the SEQ ID NO:2 maybe can be by expressing the aminoacid sequence that polynucleotide of the present invention (for example, the polynucleotide sequence shown in the SEQ IDNO:1) obtain in appropriate host.

Can only contain one or more amino acid whose conservative replacements in the aminoacid sequence shown in the SEQ ID NO:2 according to polypeptide of the present invention, or to non-key amino acid whose replacement, insertion or disappearance.Therefore, non-key amino acid is the residue that can be changed and can not cause biological function substantial effect in the aminoacid sequence shown in the SEQ ID NO:2.For example, conservative amino-acid residue is expected to be changing insensitive especially between protein of the present invention.In addition, the amino acid of guarding between protein according to the present invention and other SMS 13 albumen is also not too responsive to changing.

Term " the conservative replacement " is used to represent following replacement, and wherein, the amino-acid residue that amino-acid residue is had similar side chain replaces.These families are known in the art, it comprises (for example having basic side chain, Methionin, arginine and Histidine), acid side-chain (for example, aspartic acid and L-glutamic acid), uncharged polar side chain (for example, glycine, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), non-polar sidechain (for example, L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane), band beta side chain side chain (for example, Threonine, Xie Ansuan, Isoleucine) and aromatic series side chain (for example, tyrosine, phenylalanine, tryptophane, Histidine) amino acid.

As mentioned above, polynucleotide of the present invention can be used for proper host cell is carried out genetically engineered, make its in fermentation better and more effective, for example, in to ascorbic direct fermentation technology better and more effective.

According to the present invention, provide through genetically engineered/host cell that reorganization produces (be also referred to as reconstitution cell or through transformant), it carries this type of modified polynucleotide, wherein, the proteic function that links to each other is significantly modified than wild-type cell, makes that productive rate, output and/or the efficient to the production of one or more tunnings (for example vitamins C) is enhanced.The microorganism, particularly Gluconobacter oxydans of one or more tunnings of carbon source direct production (for example vitamins C) that the optional Bai Nengcong of host cell is given, preferably, G.oxydans DSM 17078.

" through transformant " or " reconstitution cell " is to have introduced cell according to nucleic acid of the present invention by recombinant DNA technology in its (or its ancester cell), or wherein SMS 13 proteic activity have been increased and/or enhanced cell.Proper host cell comprises the microbial cell that can produce given tunning (for example, given carbon source can be converted into vitamins C).Especially, it comprises from Pseudomonas, Pantoea, Escherichia, Corynebacterium, the bacterial strain that Ketogulonicigenium belongs to, and acetic acid bacteria, Gluconobacter for example, Acetobacter or Gluconacetobacter, preferably, Acetobacter sp., Acetobacteraceti, Gluconobacter frateurii, Gluconobacter cerinus, Gluconobacterthailandicus, Gluconobacter oxydans, more preferably, G.oxydans, most preferably, G.oxydans DSM 17078.

Also can obtain the genetic expression that improves by modifying SMS 13 genes, for example, realize by SMS 13 genes are introduced in a place or many places sudden change, wherein, described sudden change causes SMS 13 albumen that significantly improve than the wild-type protein function.

Therefore, in another embodiment, obtain to carry the polynucleotide of at least one sudden change from the polynucleotide shown in the SEQ ID NO:1 or its equivalent.

Sudden change used herein can be any sudden change that causes with better function or more stable polypeptide (for example, with better function or more stable SMS 13 gene products).This can comprise, for example, following change in microbial genome: it has improved the synthetic of SMS 13, perhaps cause SMS 13 albumen to be expressed with the aminoacid sequence that changes, this change makes this proteic function be enhanced and/or strengthen than the wild-type copy with unaltered aminoacid sequence.Raising can take place on transcriptional level, translation skill or translation back level.

Change in the microbial genome can for example be recombinated by the single cross fork or many intersection reorganization are carried out with containing the dna sequence dna replacement wild-type dna sequence dna that changes.In order to select reformed microbial transformation of genome easily, this change can for example be the dna sequence dna of coding antibiotics resistance gene, and perhaps coding is supplied the dna sequence dna of the possible auxotrophic gene of microorganism.Sudden change can include but not limited to: disappearance-insertion sudden change.

Also can obtain to cause in the microbial genome change of polypeptide with better function by following method: for example use that chemical mutagen, radiation or transposon carry out random mutagenesis to microbial genome, and the mutant of selecting or filter out the better or more effective production bacterial strain that is one or more tunnings.The standard method that is used to screen and selects is known to the skilled.

In a kind of specific implementations, people need knock out or contain the repressor of SMS 13 genes of the present invention, promptly, wherein, when introducing proper host cell, its repressor expression of gene is manually contained, to improve productive rate, throughput and/or the efficient that tunning is produced.Be used to provide the method that knocks out and provide that to carry this type of method of microorganism of being contained gene be well known in the art.Can fall at least a portion in repressor gene or its regulation and control zone by disappearance, induce containment the repressor gene." to the containment of genetic expression " used herein comprises fully and the part containment, and containment under given conditions, also comprises the containment to any one expression in two allelotrope.

Be used for the gain in yield that SMS 13 proteic above-mentioned mutagenesis strategies can cause the compound (particularly vitamins C) wanted.These strategies list and do not mean that restriction; Variation to these mutagenesis strategies will be conspicuous to those skilled in the art.Can pass through these mechanism, produce microorganism with nucleic acid of the present invention and protein molecule, for example express through sudden change SMS 13 nucleic acid and the Gluconobacter oxydans of protein molecular or the relevant bacterial strain of bacterium, make that productive rate, throughput and/or the output to the production of the compound (for example vitamins C) wanted is enhanced.

About using microorganism to carry out aspect of above-mentioned technology, technology of the present invention causes ascorbic productive rate to be generally at least about being higher than 5.7g/l, for example, 10g/l, 20g/l, 50g/l, 100g/l, 200g/l, 300g/l, 400g/l or surpass 600g/l.In one embodiment, the ascorbic productive rate by explained hereafter of the present invention is being approximately higher than 5.7g/l greatly to the scope of about 600g/l.Ascorbic productive rate refers to directly from ascorbic concentration in the results streams (promptly comprising the ascorbic cell conditioned medium liquid that do not contain) of producing container.

In one aspect of the invention, providing can be from the microorganism (particularly Gluconobacter, Gluconacetobacter and Acetobacter belong to) of suitable carbon source (for example D-Sorbitol Powder and/or L-sorbose) direct production of vitamin C.When for example after 20 hours incubation period, measuring with the resting cell method, find these bioenergys with high level to 280mg/l and 670mg/l respectively from D-Sorbitol Powder or L-sorbose direct production of vitamin C.In another aspect of the present invention, following microorganism is provided, when from the D-Sorbitol Powder when initial, it can be with 300mg/l or more measures direct production of vitamin C, perhaps when from the L-sorbose when initial, it can be with 800mg/l or more measures direct production of vitamin C, and described amount is for example to measure after 20 hours incubation period with the resting cell method.This can obtain by the activity that increases SMS polypeptide (preferably, SMS 13 polypeptide).The ascorbic productive rate that produces from the D-Sorbitol Powder in addition can be up to 400,600,1000mg/l, perhaps in addition surpass 1.5,2,4,10,20,50g/l.The ascorbic productive rate that produces from the L-sorbose even can be up to 1000mg/l, perhaps in addition surpass 1.5,2,4,10,20,50g/l.Preferably, ascorbic this tittle can be for example to measure acquisition with the resting cell method after 20 hours incubation period.

The measurement of carrying out with " resting cell method " used herein comprises that (i) is by well known to a person skilled in the art any method culturing cell, (ii) from the growth medium harvested cell, and (iii) containing and to be converted in the substratum of the product of wanting (for example vitamins C), under the condition of wherein not regrowth of cell, the cell of incubation results (promptly, during this so-called step of converting, the increase on the biomass amount of not having).

Carry for example modified SMS 13 genes and can under aerobic condition mentioned above, be incubated at and be supplemented with in the suitable nutraceutical aqueous culture medium with the recombinant microorganism of significantly higher productive rate, throughput and/or efficient production tunning.

Nucleic acid molecule as herein described, polypeptide, carrier, primer and recombinant microorganism can be used for one or more in the following method: identify Gluconobacter oxydans and relevant biology; Draw the Genome Atlas of the biology relevant with Gluconobacter oxydans; Interested Gluconobacter oxydans sequence is identified and located; Study on Evolution; The SMS 13 albumen zones that measurement function is required; Regulate SMS 13 protein-actives or function; Regulate the activity of RCS approach; And regulate in the cell to the compound (for example, vitamins C) wanted and produce.

The invention provides screening and can regulate the method for the molecule of SMS 13 protein-actives, this adjusting or by with the interaction of albumen itself or substrate or SMS 13 proteic binding partners or by regulating transcribing or translating and realize of SMS 13 nucleic acid molecule of the present invention.In these class methods, will express one or more SMS 13 proteic microorganisms of the present invention and contact, and assess every kind of test compounds for SMS 13 protein expression levels or active influence with one or more test compounds.

Can measure the proteic biological activity of SMS, enzymic activity or other activity by technician's known method, described method is for example: exist its substrate, electron acceptor(EA) or donor (to comprise phenazine methosulfate (PMS), chlorophenesic acid-indoles phenol (DCIP), NAD, NADH, NADP, NADPH, can directly or indirectly measure its consumption by luminosity, colourity or fluorescent method) and other may be relevant with active development the situation of inorganic component under, incubation contains the proteic film fraction of SMS (membrane fraction).Therefore, for example, can in following test, measure the activity with membrane-bound D-SODH, in the described test, under the situation of the phosphate buffered saline buffer that has pH 6, D-Sorbitol Powder and artificial electron acceptor(EA) DCIP and PMS, incubation contains the film fraction of this enzyme.Can measure the wear rate of DCIP at the 600nm place, its with the film fraction in the D-SODH activity that exists directly be directly proportional.

May be obvious that from foregoing description: the tunning of the method according to this invention can be not limited only to vitamins C." compound of wanting " used herein or " tunning " can be any natural products of Gluconobacter oxydans, it comprises the end product and the intermediate product of biosynthetic pathway, for example, L-sorbose, L-sorbosone, maltonic acid salt/ester, 2-keto-D-gluconic acid salt/ester, 5-keto-D-gluconic acid salt/ester, 2,5-diketo-gluconate/ester and 2-keto-L-gulonic acid salt/ester (2-KGA) are particularly to ascorbic biosynthesizing production.

Therefore, the present invention relates to polynucleotide as herein described, polypeptide, carrier, primer and the recombinant microorganism purposes in producing vitamins C (be about to carbon source and be converted into vitamins C).A kind of preferred embodiment in, modified polynucleotide, polypeptide, carrier and recombinant microorganism as herein described is used to improve productive rate, throughput and/or the efficient to production of vitamin C.

Term " output " or " throughput " are known in the art, and it comprises the concentration (for example, the kg product of every liter per hour) of the tunning (for example vitamins C) that forms in given time and the given fermentation volume.Term " production efficiency " comprising: the needed time of the production of the specified level of acquisition (for example, how long the cell special speed output required time that reaches tunning has).Term " productive rate " is known in the art, and it comprises the efficient that carbon source transforms to product (for example, vitamins C).This writes usually, for example, and kg product/kg carbon source." productive rate and/or output and/or throughput " expression of " increase " compound, the amount of the useful molecule of this compound of this compound molecule that reclaims in the culture of specified rate in the given time or recovery increases.Term " biosynthesizing " or " biosynthetic pathway " are known in the art, and it comprises: by cell, may be the process that multistep is rapid and highly regulated and control, from middle product compound synthesizing compound (preferably, organic compound).Wording " metabolism " is known in the art, and it comprises the general name to the biochemical reaction that takes place in the biology.Then, the metabolism of specific compound (for example, the metabolism of amino acid (for example glycine)) comprises total biosynthesizing, modification and degradation pathway relevant with this compound in the cell.Wording " transhipment " or " being transported into " are known in the art, and it comprises that one or more molecules move through the cytolemma that this molecule can not pass through or can not efficiently pass through originally under assisting.

Vitamins C used herein can be any chemical species of the L-xitix found in the aqueous solution, for example non-dissociated, exist with its free acid form or dissociate into anionic.Being characterized as of the dissolved salt form of L-xitix: the negatively charged ion of the positively charged ion of any kind of in being typically found at fermented supernatant fluid (for example, potassium, sodium, ammonium or calcium) when existing.The isolating crystal of process of the free acid form that the L-xitix can be arranged that is also included.On the other hand, name the isolating crystal of process of the salt form of L-xitix with the title of its corresponding salt, i.e. sodium ascorbate, potassium ascorbate, calcium ascorbate etc.

A kind of preferred embodiment in, the present invention relates to produce ascorbic method, wherein, to introduce suitable microorganism according to Nucleotide of the present invention or modified polynucleotide sequence mentioned above, cultivate recombinant microorganism allowing to produce under the ascorbic condition with high productive capacity, productive rate and/or efficient, from substratum, separate the tunning that produces, and alternatively, be further purified.

To further set forth the present invention by following embodiment, described embodiment should not be understood that to provide constraints.The content of all reference mentioned in this article, patent application, patent and disclosed patent application is all incorporated this paper by reference into.

Embodiment

Embodiment 1 prepares chromosomal DNA and passes through the pcr amplified dna fragment

In the liquid mannitol substratum (MB) that constitutes by 25g/l mannitol, 5g/l yeast extract (Difco) and 3g/l bacto peptone (Difco), carry out one day cultivation in 30 ℃ of cells to Gluconobacter oxydans DSM 17078, by Sambrooket al (1989) " Molecular Cloning:A Laboratory Manual/S econd Edition ", the described method of ColdSpring Harbor Laboratory Press prepares the chromosomal DNA of Gluconobacter oxydans DSM 17078 from cultured cells.

Use is according to chromosomal DNA and one group of primer of preparation mentioned above---and Pf (SEQ IDNO:3) and Pr (SEQ ID NO:4) prepare dna fragmentation by PCR.According to manufacturers instruction, react with Expand High Fidelity PCR test kit (Roche Diagnostics) and 10ng chromosomal DNA cumulative volume with 10 μ l, obtained to contain the PCR product of SMS 13DNA sequence (SEQ ID NO:1).From reaction system, reclaim the PCR product, and verified its correct sequence.

Embodiment 2 is overexpression SMS 13 genes in G.oxydans DSM 17078

For SMS 13 expression of gene are raised, can use the overexpression system that adopts the plasmid construction body.Herein, SMS 13 genes are fused on the strong constitutive promoter, then construct are introduced G.oxydans DSM 17078.Can measure the overexpression of SMS 13 genes by standard method well known by persons skilled in the art, described method for example uses Northern blot hybridization, RT-PCR or other technology to carry out transcription analysis, use Western blot hybridization, two-dimensional gel electrophoresis to carry out protein expression and measure, use the specific enzymes test or carry out enzyme assay by direct measurement product formation or substrate conversion.

Promotor can be any promotor that shows strong constitutive activity in Gluconobacter oxydans, for example, from the tufB promotor of Escherichia coli, from the tufb promotor of Gluconobacteroxydans, from the dnaA promotor of Gluconobacter oxydans or from the sndh promotor of Gluconobacter oxydans.

Be used for plasmid based on the overexpression system of plasmid and can be all reproducible and any plasmid that can between these two species, shift at Escherichia coli and Gluconobacter oxydans.This plasmid can contain selected marker easily, makes that the transfer of this plasmid can be monitored, selected marker for example the antibiotics resistance mark, at the mark of supplying of prototroph.This type of plasmid can include but not limited to: pVK100, pGE1, pBBR1MCS-2, RSF1010 and their the derivative (carrier with catalog number (Cat.No.) or information source, pVK100=ATCC 37156, pGE1=J.Ferment Bioeng.79,95,1995, pBBR1MCS-2=NCCB 3434, and RSF1010=NCCB 3110).

Use primer to PsldhSMS 13+1 (SEQ ID NO:5) (containing complementary Psldh promotor overlap) and SMS 13HindIII-1 (SEQ ID NO:4 at 5 ' end, contain GAGAAGCTT at 5 ' end), go out whole piece SMS 13 genes by pcr amplification.Use primer to PsldhXhoI+1 (SEQ ID NO:7) and SMS 13Psldh-1 (SEQ ID NO:8) (containing complementary SMS 13DNA overlap), go out P by pcr amplification at 5 ' end _SldhPromotor (SEQ ID NO:6).As template, reaction conditions was extended by 30 seconds, 50 ℃ annealing of 94 ℃ of sex change of 35 round-robin in 30 seconds and 72 ℃ to be formed in 1 minute with Gluconobacter oxydans DSM 17078 genomic dnas.In both cases, all use GC-rich PCR test kit (Roche Molecular Biochemicals).Because two bar segment have complementary lap, therefore mix each bar PCR fragment, with primer PsldhXhoI+1/SMS 13HindIII-1 is increased once more, amplify full length product, thus selected promotor is inserted into the upstream of SMS 13 genes.It is such being used for the second PCR reaction conditions of taking turns reaction: 94 ℃ 2 minutes, 10 round-robin are [94 ℃ 30 seconds then, 63 ℃ 30 seconds, 68 ℃ 6 minutes], then be 20 round-robin [94 ℃ 30 seconds, 63 ℃ 30 seconds, extra 20 seconds of 68 ℃ of 6 minutes and each circulations] and 68 ℃ of last extensions 10 minutes.To PCR product purifying in addition, carry out double digestion with XhoI and HindIII, the clone advances the pVK100 carrier that digested with XhoI-HindIII.To connect mixture and transform into E.coli TOP10 cell, be 10 μ g ml containing final concentration ^-1The Luria-Bertani agar of tsiklomitsin on transformant is selected.Use primer that PsldhXhoI+1/SMS 13HindIII-1 is screened possible transformant by bacterium colony PCR.Pick positive transformant, the plasmid (plasmidminipreps) of preparation aliquot, segmental dna sequence dna is inserted in checking.The plasmid that shows correct sequence is transformed into competence G.oxydans DSM 17078 cells, is 10 μ g ml containing final concentration ^-1The mannitol of tsiklomitsin cultivate on the fundamental mode nutrient agar transformant selected.Observe several possible transformants, re-use primer to PsldhXhoI+1/SMS 13HindIII-1 by PCR to wherein two analyze, with checking the existing of plasmid.Find that two bacterial strains all contain SMS 13 overexpression plasmids, they are named as G.oxydans DSM 17078-SMS 13up1 and G.oxydans DSM 17078-SMS 13up2.

Embodiment 3 uses resting cell to produce vitamins C from the D-mannitol

Containing 70g/l D-Sorbitol Powder, 0.5g/l glycerine, 7.5g/l yeast extract (Difco), 2.5g/l MgSO ₄7H ₂The CaCO of O, 10g/L ₃On the No.3BD nutrient agar of 18g/l agar (Difco), carry out 3 days cultivation in 27 ℃ of cells to G.oxydans DSM 17078, G.oxydans DSM 17078-SMS 13up1 and G.oxydans DSM 17078-SMS 13up2.

Scrape cell from agar plate, it is suspended in the distilled water, be used for, the resting cell reaction that the 220rpm vibration is carried out down at 30 ℃.(also contain 0.3%NaCl and 1%CaCO with being in reaction mixture ₃) in the 2%D-Sorbitol Powder carry out series reaction (the 0.5ml reaction mixture is in the 5ml reaction tube), be OD with final concentration ₆₀₀=10 cell carries out incubation.Behind 20 hours the incubation, with having and Aminex-HPX-78H (300x7.8mm) post (Biorad, Reinach, Switzerland) LiChrospher-100-RP18 of Xiang Lianing (125x4.6mm) post (Merck, Darmstadt, Germany) Agilent 1100HPLC system (AgilentTechnologies, Wilmington, USA), come the reaction mixture sample is analyzed by high performance liquid chromatography (HPLC).Mobile phase is a 0.004M sulfuric acid, and flow velocity is 0.6ml/ minute.With UV detector (wavelength 254nm) combination specific refraction detector, note two signals.In addition, with have the nh 2 column that UV surveys (YMC-Pack Polyamine-II, YMC, Inc., Kyoto Japan) carries out evaluation to the L-xitix at the 254nm place.Mobile phase is 50mMNH ₄H ₂PO ₄And acetonitrile (40: 60).

System identifies the L-xitix with Agilent Series 1100HPLC-mass spectrum (MS).Under positive ion mode, operate MS with the electron spray(ES) interface.(Phenomenex, Torrance USA) separate with LUNA0C8 (2) post (100x4.6mm).Mobile phase is the mixture of 0.1% formic acid and methyl alcohol (96: 4).The L-xitix is come out by wash-out with 3.1 minutes residence time.Confirm the identity of L-xitix by the molecular weight of residence time and this compound.

The vitamins C that contains with the supernatant liquor of the reaction mixture of the cell incubation of G.oxydans DSM 17078-SMS 13up 1 and G.oxydans DSM 17078-SMS13up2 wants as many as to lack 20% than the supernatant liquor with the reaction mixture of G.oxydansDSM 17078 cell incubations.

Embodiment 4SMS 13 genes and the existence of equivalent in other biology

Can measure the existence of middle SEQ ID NO:1 of other biology (but not this paper front those disclosed, for example biology of mentioning in the table 1) and/or equivalent by simple DNA hybrid experiment.

Containing 5g/l bacto peptone (Difco), 5g/l yeast extract (Difco), 5g/l glucose, 5g/l mannitol, 1g/l MgSO ₄7H ₂On the No.350 substratum of O, 5ml/l ethanol and 15g/l agar,, strains A cetobacter aceti subsp.xylinum IFO13693 and IFO 13773 are carried out 3 days cultivation in 27 ℃.Containing on mannitol substratum (MB) the type nutrient agar of 25g/l mannitol, 5g/l yeast extract (Difco), 3g/l bacto peptone (Difco) and 18g/l agar (Difco), in 27 ℃, all other Acetobacter, Gluconacetobacter bacterial strain and all Gluconobacter bacterial strains are carried out 3 days cultivation.On Luria Broth nutrient agar, cultivate E.coli K-12.On the substratum that manufacturer is recommended or according to methods known in the art, cultivate other bacterial strain.According to for example Sambrook et al, 1989, " Molecular Cloning:A Laboratory Manual/Second Edition ", Cold SpringHarbor Laboratory Press is described, from suitable biology (for example table 1 is mentioned) extraction genomic dna.

With Restriction Enzyme (for example EcoRI or HindIII) digested genomic dna prepared product, isolate the dna fragmentation of 1 μ g by agarose gel electrophoresis (1% agarose).With 0.25N HCl gel is carried out 15 minutes processing, then handled 30 minutes with 0.5N NaOH again, according to manufacturers instruction, (BIO-RAD Laboratories AG Switzerland) prints to gel on nitrocellulose or the nylon membrane with Vacuum Blotter Model 785 then.Then with the trace that obtains and the solution contact or the hybridization that contain probe (for example have the dna fragmentation of SEQ ID NO:1 sequence, or contain the part or all of dna fragmentation of SEQ IDNO:1 sequence), from test organisms, to survey positive dna fragmentation.Can be according to embodiment 1, prepare the probe of DIG mark, for example SEQ ID NO:1 with PCR-DIG labelling kit (Roche Diagnostics) and primer sets SEQ ID NO:3 and SEQ ID NO:4.This blot hybridization the results are shown in the table 1.

Hybridization can be carried out under the rigorous condition of rigorous conditioned disjunction height.A preferred nonrestrictive example of this type of condition is in 6x sodium chloride/sodium citrate (SSC), about 45 ℃ of hybridization down, subsequently in 1x SSC, 0.1%SDS, carry out the one or many washing under 50 ℃, washing is preferably under 55 ℃, more preferably under 60 ℃, further preferably under 65 ℃, carry out.Highly rigorous condition comprises, for example, in solution, for example in the solution of the DigEasyHyb solution (Roche Diagnostics GmbH) of the salmon sperm dna that contains or do not contain 100 μ g/ml, or comprise 50% methane amide, 5x SSC (150mM NaCl, the 15mM trisodium citrate), 0.02% sodium laurylsulfonate, in the solution of 0.1%N-Sarkosyl L and 2% closed reagent (Roche Diagnostics GmbH), in 42 ℃ of incubations 2 hours to 4 days, then in 2x SSC and 0.1%SDS, under room temperature, wash film twice, each 5 to 15 minutes, then at 65-68 ℃, in 0.5x SSC and 0.1%SDS or 0.1x SSC and 0.1%SDS, wash twice, each 15-30 minute.For detecting the dna fragmentation that has low homogeny with dna probe, last washing step can carry out short washing time (for example 1-15 minute) at lesser temps (for example 50-65 ℃).

Can be by PCR method well known in the art, shown in the his-and-hers watches 1 in each biology the gene of positive signal correspondence cloned, this (for example uses this biological genomic dna and suitable primer sets, SEQ ID NO:3 and SEQ ID NO:4) under embodiment 1 described condition, carry out, perhaps according to carrying out like this: 5 to 100ng genomic dnas (cumulative volume 50 μ l) are used in each reaction.Available Expand High Fidelity PCR system (Roche Diagnostics), adopt following reaction conditions: 94 ℃ 2 minutes; 94 ℃ of denaturing steps of 15 seconds of 30 round-robin (i), (ii) 60 ℃ of annealing steps of 30 seconds, (iii) 72 ℃ 0.5 to 5 minutes (depends on target dna length, 1 minute/1kb) synthesis step; 72 ℃ were extended 7 minutes.Perhaps, can carry out PCR with degenerated primer, to the design of degenerated primer can based on SEQ ID NO:2 or based on as the aminoacid sequence of consensus sequence (by to by sequence search program (BLASTP for example, or when nucleotide sequence is used as " search sequence ", BLASTX) some aminoacid sequences of Huo Deing compare select), to find the albumen with the protein similar of SEQ ID NO:2.For the PCR that uses degenerated primer to carry out, the temperature of second annealing steps (seeing above) can be reduced to 55 ℃, perhaps even 50-45 ℃.This result of experiment is as shown in table 1.

Separate the sample that PCR reacts by agarose gel electrophoresis, after using for example bromination second pyridine dyeing, (transilluminator) observes band with transilluminator, from gel band separated, and verifies correct sequence.

Consensus sequence mentioned above can be the aminoacid sequence that belongs to some class of some protein domains/family's database, described database is PROSITE (database of protein families and structural domain), COGs (directly to autoploid group bunch), CDD (conserved structure regional data base), pfam (multiple sequence comparison and conceal the big collection of Markov model, cover a lot of common protein domain and families) for example.In case can from the albumen of the structural domain that contains this type of database or family, select some albumen that has identical/close function with albumen of the present invention, can use protein sequence or its nucleotide sequence (when can be when public's database obtains) to come this proteic corresponding DNA of amplification coding by PCR.

Embodiment 5 produces with doing from the overexpression of other biological SMS 13 genes and equivalent Vitamins C

For suitable microorganism (can from given carbon source direct production of vitamin C), improving ascorbic production, can in the overexpression system of embodiment 2, (for example use SMS 13 genes and equivalent, the PCR product that obtains among the embodiment 4, it is called as gene X in this article), perhaps above-mentioned SMS 13 genes and equivalent can be cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA), and be used for Transformed E .coli TG1, to obtain to carry the Apr transformant of pCR2.1-TOPO-gene X, promptly carry the Apr transformant of the PCR product that obtains among the embodiment 4.Use primer sets---PfNdeI[SEQ ID NO:3, but have CCCAT at 5 ' end] and PrHindIII[SEQ ID NO:4, but have CCAAGCTT at 5 ' end] by PCR this inset that increases.PCR product with NdeI and HindIII digestion obtain inserts fragment advance between the XhoI and HindIII site of pVK100 (ATCC 37156) with the PcrtE-SD that digested with XhoI and NdeI (Shine-Dalgarno) fragment (WO 02/099095).With connecting product Transformed E .coli TG1, to obtain to carry the Tc of plasmid pVK-PcrtE-SD-gene X ^rTransformant, and then transform appropriate host (for example G.oxydans DSM 17078) with it by electroporation, obtain, for example, Tc ^rG.oxydans DSM 17078/pVK-PcrtE-SD-gene X.

According to embodiment 3, use reconstitution cell (for example reconstitution cell of G.oxydans strain DSM 17078) and corresponding wild-type bacterial strain to carry out to ascorbic production.

In with of the resting cell reaction of 1%L-sorbosone as substrate, the comparable wild type strain as many as of vitamins C that reconstitution cell is produced few 20%.

Table 1: the equivalent of SMS 13 genes in other biology

Bacterial strain	Signal 1	Signal 2	Signal 3
				G.oxydans DSM 17078	++++	+	+
G.oxydans IFO 3293	++++	+	+
				G.oxydans IFO 3292	++++	+	+
G.oxydans ATCC 621H	++++	+	+
				G.oxydans IFO 12528	++++	+	+
G.oxydans G 624	++++	+	+
				G.oxydans T-100	++++	+	+
G.oxydans IFO 3291	++++	+	+
				G.oxydans IFO 3255	++++	+	+
G.oxydans ATCC 9937	++++	+	+

G.oxydans IFO 3244	++++	+	+
				G.cerinus IFO 3266	+++	+	+
G.frateurii IFO 3260	+++	+	+
				G.oxydans IFO 3287	+++	+	+
Acetobacter aceti subsp.orleanus IFO 3259	-	-	-
				Acetobacteracetisubsp.xylinumnIFO 13693	-	-	-
Acetobacter aceti subsp.xylinum IFO 13773	-	-	-
				Acetobacter sp.ATCC 15164	-	-	-
G.thailandicus NBRC 100600	+++	+	+
				Gluconacetobacter liquefaciens ATCC 14835	++	+	+
Gluconacetobacter polyoxogenes NBI 1028	-	-	+
				Gluconacetobacter diazotrophicus ATCC 49037	-	-	+
Gluconacetobacter europaeus DSM 6160	-	-	+
				Acetobacter aceti 1023	-	-	-
Acetobacter pasteurianus NCI 1193	-	-	-
				Pseudomonas putida ATCC 21812	-	-	-
Pseudomonas aeruginosaPAO 1	-	-	-
				Pseudomonas fluorescens DSM 50106	-	-	-
Pseudomonas syringae B728a	-	-	-
				Azotobacter vinelandii AvOP	-	-	-
Azotobacter chroococcum MCD 1	-	-	-
				Paracoccus denitrificans strain Pd 1222	-	-	-
Rhodopseudomonas palustris CGA009	-	-	-
				Pantoea citrea 1056R	-	-	-
E.coli K-12	-	-	-
				Saccharomycescerevisiae	-	-	-
Aspergillus niger	-	-	-
				Mouse	-	-	-

Signal 1:, test the detection of going up as the blot hybridization that carries out through label probe to DNA with SEQ ID NO:1 at the genomic dna that uses different strains.Signal 2: use primer to SEQID NO:3 and SEQ ID NO:4 detection in the PCR reaction to different strains DNA.Signal 3: use in the PCR reaction that degenerated primer carries out detection to different strains DNA.More explanations are referring to text.

Sequence table

＜110〉DSM IP Assets BV

＜120〉Xin Ying gene SMS 13

<130>24633

<160>8

<170>PatentIn version 3.2

<210>1

<211>2232

<212>DNA

<213>Gluconobacter oxydans DSM 17078

<400>1

atgcgcagat cccatcttct cgccaccgtt gcctgtgcca cgctggcctg cgcaccgctg 60

gctgccaatg cccagttcgc ccccgcaggc agcggtggct cgccaacctc ctccgtgccg 120

ggccccggca atgccagcgg caattccttc gagccgaccg agaacacgcc ggccgcgaag 180

agccgctttt ccggcccgtc cccctatgcg ccccaggctc cgggtgtgaa tgcggccaac 240

ctgccggata tcgggtccat ggatccgaac gacgttccgc agatggcccc gcagcagagt 300

gccagccccg cctccggaga ctgggccgcc tacggccatg acgacagcca gatgcgctat 360

tcgccgctgt ccgagatcac gccgcagaac gccgatcagc tcaaggttgc tttcgtctat 420

cacaccggca gctatccgcg tccgggccag acgaacaaat gggctgccga aaccaccccg 480

atcaaggtgg gtgacggcct ctacatgtgc tcggcacaga acgacatcat gaagctcgac 540

ccggcgacgg gtaaggagat ctggcgtcac aacatcaacg agaaatacga agccatcccc 600

tacaccgcag cgtgcaaggg cgtgacgtat ttcacgtcgt cgcaggtgcc tgaaggccag 660

ccctgccata accgtatcct tgaaggcacg ctcgacatgc gcctgatcgc ggttgatgcc 720

gcgaccggca atctgtgcga gggcttcggc aatggcggcc aggtcaacct gatgcagggt 780

cttggcgagt ccgtccccgg cttcgtctcc atgacgacgc cgccgccggt cgtgaacggt 840

gtggttgtgg tcaaccacga agttctggat ggtcagcgcc gctgggctcc gtcgggcgtg 900

atccgtggtt atgacgccga gagcggcaag ttcctgtggg cctgggacgt gaaccgcccc 960

gacgatcaca gccagccgac cggcaacaac cattacagcc gtggcacgcc gaactcctgg 1020

gctgcgatga ccggcgacaa tgcgctgggc ctcgtctacg tcccgaccgg caactcggct 1080

tccgactatt acagcgccct gcgtagccct gaagaaaaca aggtctcgtc cgcagttgtc 1140

gcgcttgacg tgaagacagg ttcgccgcgc tgggtcttcc agaccgttca caaggacgtc 1200

tgggactatg acatcggctc gcaggccacg ctcatggaca tgcccggcca ggatggtcag 1260

cctgtccccg cactcatcat gccggccaag cgcggccaga ccttcgtgct cgaccgtcgt 1320

gacggcaagc cgatcctgcc ggtcgaagag cgtcccgctc cgtcgccggg cgtgatcccg 1380

ggcgatccgc gttcgccgac gcagccctgg tccacgggaa tgccggccct gcgcgtgccg 1440

gacctgaaag agacggatat gtggggcatg tcccccatcg accagctctt ctgccgtatc 1500

aagttccgcc gtgcgaacta tacgggtgag ttcacgccgc cgagcgtcga caagccctgg 1560

atcgagtatc cgggctataa cggcggcagc gactggggct ccgtgtccta tgacccgcag 1620

agcggcatcc tgattgcgaa ctggaacatc accccgatgt acgaccagct cgtaactcgc 1680

aagaaggccg acgaacttgg cctgatgccg atcgatgacc cgaactacaa gccgggtggc 1740

ggtggcgccg aaggtaacgg cgccatggac ggcacgcctt acggtatcgt cgtgaccccg 1800

ttctgggatc agtatacggg catgatgtgc aaccgtccgc cctacggcat gatcacggcc 1860

atcgacatga agcacggcca gaaggtgctg tggcagcacc cgctgggaac ggcccgcgcc 1920

aacggtccgt ggggcctgcc gaccggtctt ccctgggaaa tcggtacgcc gaacaatggt 1980

ggctcggtcg tgacggccgg tggcgtggtg ttcatcgcgg cagctacgga taaccagatc 2040

cgtgccatcg acgagcacac cggcaaggtg gtctggagcg cggtcctgcc gggcggcggt 2100

caggccaacc cgatgaccta cgaggccaat ggtcatcagt acgtcgccat tatggcgggt 2160

ggtcatcact tcatgatgac gccggtcagc gatcagctgg tggtttacgc cctgcccgat 2220

cacaagggct ga 2232

<210>2

<211>743

<212>PRT

<213>Gluconobacter oxydans DSM 17078

<400>2

Met Arg Arg Ser His Leu Leu Ala Thr Val Ala Cys Ala Thr Leu Ala

1 5 10 15

Cys Ala Pro Leu Ala Ala Asn Ala Gln Phe Ala Pro Ala Gly Ser Gly

20 25 30

Gly Ser Pro Thr Ser Ser Val Pro Gly Pro Gly Asn Ala Ser Gly Asn

35 40 45

Ser Phe Glu Pro Thr Glu Asn Thr Pro Ala Ala Lys Ser Arg Phe Ser

50 55 60

Gly Pro Ser Pro Tyr Ala Pro Gln Ala Pro Gly Val Asn Ala Ala Asn

65 70 75 80

Leu Pro Asp Ile Gly Ser Met Asp Pro Asn Asp Val Pro Gln Met Ala

85 90 95

Pro Gln Gln Ser Ala Ser Pro Ala Ser Gly Asp Trp Ala Ala Tyr Gly

100 105 110

HiB Asp Asp Ser Gln Met Arg Tyr Ser Pro Leu Ser Glu Ile Thr Pro

115 120 125

Gln Asn Ala Asp Gln Leu Lys Val Ala Phe Val Tyr His Thr Gly Ser

130 135 140

Tyr Pro Arg Pro Gly Gln Thr Asn Lys Trp Ala Ala Glu Thr Thr Pro

145 150 155 160

Ile Lys Val Gly Asp Gly Leu Tyr Met Cys Ser Ala Gln Asn Asp Ile

165 170 175

Met Lys Leu Asp Pro Ala Thr Gly Lys Glu Ile Trp Arg His Asn Ile

180 185 190

Asn Glu Lys Tyr Glu Ala Ile Pro Tyr Thr Ala Ala Cys Lys Gly Val

195 200 205

Thr Tyr Phe Thr Ser Ser Gln Val Pro Glu Gly Gln Pro Cys His Asn

210 215 220

Arg Ile Leu Glu Gly Thr Leu Asp Met Arg Leu Ile Ala Val Asp Ala

225 230 235 240

Ala Thr Gly Asn Leu Cys Glu Gly Phe Gly Asn Gly Gly Gln Val Asn

245 250 255

Leu Met Gln Gly Leu Gly Glu Ser Val Pro Gly Phe Val Ser Met Thr

260 265 270

Thr Pro Pro Pro Va1 Val Asn Gly Val Val Val Val Asn His Glu Val

275 280 285

Leu Asp Gly Gln Arg Arg Trp Ala Pro Ser Gly Val Ile Arg Gly Tyr

290 295 300

Asp Ala Glu Ser Gly Lys Phe Leu Trp Ala Trp Asp Val Asn Arg Pro

305 310 315 320

Asp Asp His Ser Gln Pro Thr Gly Asn Asn His Tyr Ser Arg Gly Thr

325 330 335

Pro Asn Ser Trp Ala Ala Met Thr Gly Asp Asn Ala Leu Gly Leu Val

340 345 350

Tyr Val Pro Thr Gly Asn Ser Ala Ser Asp Tyr Tyr Ser Ala Leu Arg

355 360 365

Ser Pro Glu Glu Asn Lys Val Ser Ser Ala Val Val Ala Leu Asp Val

370 375 380

Lys Thr Gly Ser Pro Arg Trp Val Phe Gln Thr Val His Lys Asp Val

385 390 395 400

Trp Asp Tyr Asp Ile Gly Ser Gln Ala Thr Leu Met Asp Met Pro Gly

405 410 415

Gln Asp Gly Gln Pro Val Pro Ala Leu Ile Met Pro Ala Lys Arg Gly

420 425 430

Gln Thr Phe Val Leu Asp Arg Arg Asp Gly Lys Pro Ile Leu Pro Val

435 440 445

Glu Glu Arg Pro Ala Pro Ser Pro Gly Val Ile Pro Gly Asp Pro Arg

450 455 460

Ser Pro Thr Gln Pro Trp Ser Thr Gly Met Pro Ala Leu Arg Val Pro

465 470 475 480

Asp Leu Lys Glu Thr Asp Met Trp Gly Met Ser Pro Ile Asp Gln Leu

485 490 495

Phe Cys Arg Ile Lys Phe Arg Arg Ala Asn Tyr Thr Gly Glu Phe Thr

500 505 510

Pro Pro Ser Val Asp Lys Pro Trp Ile Glu Tyr Pro Gly Tyr Asn Gly

515 520 525

Gly Ser Asp Trp Gly Ser Val Ser Tyr Asp Pro Gln Ser Gly Ile Leu

530 535 540

Ile Ala Asn Trp Asn Ile Thr Pro Met Tyr Asp Gln Leu Val Thr Arg

545 550 555 560

Lys Lys Ala Asp Glu Leu Gly Leu Met Pro Ile Asp Asp Pro Asn Tyr

565 570 575

Lys Pro Gly Gly Gly Gly Ala Glu Gly Asn Gly Ala Met Asp Gly Thr

580 585 590

Pro Tyr Gly Ile Val Val Thr Pro Phe Trp Asp Gln Tyr Thr Gly Met

595 600 605

Met Cys Asn Arg Pro Pro Tyr Gly MetIle Thr Ala Ile Asp MetLys

610 615 620

His Gly Gln Lys Val Leu Trp Gln His Pro Leu Gly Thr Ala Arg Ala

625 630 635 640

Asn Gly Pro Trp Gly Leu Pro Thr Gly Leu Pro Trp Glu Ile Gly Thr

645 650 655

Pro Asn Asn Gly Gly Ser Val Va1 Thr Ala Gly Gly Val Val Phe Ile

660 665 670

Ala Ala Ala Thr Asp Asn Gln Ile Arg Ala Ile Asp Glu His Thr Gly

675 680 685

Lys Val Val Trp Ser Ala Val Leu Pro Gly Gly Gly Gln Ala Asn Pro

690 695 700

Met Thr Tyr Glu Ala Asn Gly His Gln Tyr Val Ala Ile Met Ala Gly

705 710 715 720

Gly His His Phe Met Met Thr Pro Val Ser Asp Gln Leu Val Val Tyr

725 730 735

Ala Leu Pro Asp His Lys Gly

740

<210>3

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>3

atgcgcagat cccatcttct 20

<210>4

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>4

tcagcccttg tgatcgggca 20

<210>5

<211>46

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>5

tttcagttct ggaggctttc accaatgcgc agatcccatc ttctcg 46

<210>6

<211>148

<212>DNA

<213>Gluconobacter oxydans DSM 17078

<400>6

agataacgcg catttgaatt tattgaagtg caaccgtgtt attacacgtt tttgttagaa 60

ttatattcaa caatattgaa aaagaaccgt agctttcctg aaagtctgga cttaccgtcc 120

ggactttcag ttctggaggc tttcacca 148

<210>7

<211>35

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>7

gagactcgag ataacgcgcatttgaattta ttgaa 35

<210>8

<211>46

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>8

cgagaagatg ggatctgcgc attggtgaaa gcctccagaa ctgaaa 46

Claims (21)

1. be selected from following group the polynucleotide or the complementary strand of these type of polynucleotide, described group by:

(a) coding comprises the polynucleotide according to the polypeptide of the aminoacid sequence of SEQ ID NO:2;

(b) comprise polynucleotide according to the nucleotide sequence of SEQ ID NO:1;

(c) comprise the polynucleotide of following nucleotide sequence, described nucleotide sequence can use genomic dna from microorganism as template, and use is according to the primer sets of SEQ ID NO:3 and SEQ IDNO:4, by the nucleic acid amplification acquisition of for example polymerase chain reaction;

(d) polynucleotide, it comprises coding by the fragment of the polypeptide of each polynucleotide encoding or the nucleotide sequence of derivative in (a) to (c), wherein, in described derivative, one or more amino-acid residues are replaced by conservative than described polypeptide, and described fragment or derivative have the activity of oxydo-reductase [EC 1], preferably, the activity that has the oxydo-reductase [EC 1.1] that on the CH-OH of donor group, plays a role;

(e) coding oxydo-reductase [EC 1] preferably, is coded in the polynucleotide of the oxydo-reductase [EC 1.1] that plays a role on the CH-OH group of donor, and its complementary strand can be under rigorous condition and (a) each defined polynucleotide complementation in (d); And

(f) coding oxydo-reductase [EC 1], preferably, be coded in the polynucleotide of the oxydo-reductase [EC 1.1] that plays a role on the CH-OH group of donor, and it is identical with each defined polynucleotide at least 70% in (a) to (d), for example 85%, 90% or 95% is identical;

Constitute.

2. the carrier that contains the described polynucleotide of claim 1.

3. carrier as claimed in claim 2, wherein, described polynucleotide operationally link to each other with the expression control sequenc that allows to express in prokaryotic organism host cell or eukaryote host cell.

4. with the described polynucleotide of claim 1 or with the microorganism of claim 2 or the genetically engineered mistake of 3 described carriers.

5. microorganism as claimed in claim 4, it can be with 300mg/l or more measures from D-Sorbitol Powder direct production of vitamin C, and described amount was measured with the resting cell method after the incubation at 20 hours.

6. microorganism as claimed in claim 5, it can be with 800mg/l or more measures from L-sorbose direct production of vitamin C.

7. the polypeptide of polynucleotide encoding as claimed in claim 1.

8. be used to produce the technology of the cell that can express the described polypeptide of claim 7, it comprises the steps: with claim 2 or 3 described carriers or carries out genetically engineered with the described polynucleotide pair cell of claim 1.

9. described polynucleotide of claim 1 or be used to produce ascorbic purposes with claim 2 or 3 described carriers.

10. purposes as claimed in claim 9, wherein said polynucleotide are operably connected with expression control sequenc, and are introduced into microorganism.

11. purposes as claimed in claim 10, wherein, described expression control sequenc comprises regulating and controlling sequence and/or promoter sequence and/or terminator sequence, and, at least a being changed in these sequences, described change is so that described microorganism carries out the productive rate of ascorbic production and/or the mode of efficient raising.

12. purposes as claimed in claim 11, wherein, described expression control sequenc comprises regulating and controlling sequence and/or promoter sequence and/or terminator sequence, and, at least a being changed in these sequences, described change is so that oxydo-reductase [EC 1], and preferably, the mode that the activity of the oxydo-reductase that plays a role on the CH-OH of donor group [EC 1.1] increases and/or improves is carried out.

13. microorganism as claimed in claim 4 or contain the microorganism of the native gene that comprises the described polynucleotide of claim 1, described microorganism is through hereditary change, and described change is so that described microorganism carries out the productive rate of ascorbic production and/or the mode of efficient raising.

14. microorganism as claimed in claim 13, it is produced has active, the described polypeptide of claim 7 of oxydo-reductase [EC 1] increase and/or that improve, the oxydo-reductase [EC 1.1] that described oxydo-reductase [EC 1] preferably plays a role on the CH-OH of donor group.

15. as any described microorganism among the claim 4-6,13 or 14, wherein, polynucleotide according to claim 1 are by overexpression.

16. as claim 4-6, any described microorganism among the 13-15, it is selected from Pseudomonas, Pantoea, Escherichia, Corynebacterium, Ketogulonicigenium and acetic acid bacteria, Gluconobacter for example, Acetobacter or Gluconacetobacter, preferably, Acetobacter sp., Acetobacter aceti, Gluconobacter frateurii, Gluconobacter cerinus, Gluconobacterthailandicus, the group that Gluconobacter oxydans constitutes, preferably, Gluconobacteroxydans, more preferably, Gluconobacter oxydans DSM 17078

17. in microorganism, produce the technology of the native gene of enhanced oxydo-reductase [EC 1], described microorganism comprises the described polynucleotide of claim 1, the oxydo-reductase [EC 1.1] that described oxydo-reductase [EC 1] preferably plays a role on the CH-OH of donor group, described technology comprise the steps: so that described microorganism changes described polynucleotide to the productive rate of ascorbic production and/or the mode of efficient raising.

18. be used to produce the technology that can produce ascorbic microorganism, described technology comprises the steps: to change described microorganism, make described microorganisms producing go out to have the active polypeptide of oxydo-reductase [EC 1] increase and/or that improve, preferably, have the active polypeptide of oxydo-reductase [EC 1.1] that on the CH-OH of donor group, plays a role, cause described microorganism that ascorbic production productive rate and/or efficient are improved.

19. be used to produce the technology of the microorganism that contains following native gene, described native gene comprises the polynucleotide of claim 1, described technology comprises the steps: to change described microorganism, make described native gene by overexpression, cause described microorganism that ascorbic production productive rate and/or efficient are improved.

20. as claim 18 or 19 described technologies, it is used for producing according to any described microorganism of claim 13 to 16.

21. use according to any ascorbic technology of described microorganisms producing in claim 13 to 16 or the claim 4 to 6, wherein, in the water-based nutritional medium, allowing vitamins C to be carried out to cultivate described microorganism under the condition of direct production from D-Sorbitol Powder or L-sorbose, and, alternatively, vitamins C is separated as tunning.