CN101132694B - Medical device with coating for capturing genetically-altered cells and methods of using same - Google Patents

Abstract

Therapeutic and drug delivery systems are provided in the form of medical devices with coatings for capturing and immobilizing target cells such as circulating progenitor or genetically-altered mammalian cells in vivo. The genetically-altered cells are transfected with genetic material for expressing a marker gene and at least one therapeutic gene in a constitutively or controlled manner. The marker gene is a cell membrane antigen not found in circulating cells in the blood stream and therapeutic gene encodes a peptide for the treatment of disease, such as, vascular disease and cancer. The coating on the medical device may be a biocompatible matrix comprising at least one type of ligand, such as antibodies, antibody fragments, other peptides and small molecules, which recognize and bind the target cells. The therapeutic and/or drug delivery systems may be provided with a signal source such as activator molecules for stimulating the modified cells to express and secrete the desired marker and therapeutic gene products.

Description

Medical treatment device and using method thereof with coating of cell that can be capturing genetically-altered

The application requires to be filed in the U.S. Provisional Patent Application No.60/566 on April 30th, 2004, and 829 and be filed in the U.S. Provisional Patent Application No.10/835 on April 30th, 2004,767 priority.

Technical field

The present invention relates to be used to implant patient vessel or hollow organ's medical treatment device, for example be used for the treatment of support, stent graft, synthetic blood vessel graft, the cardiac valve through applying of various diseases, conduit and blood vessel are repaired screen (vascular prosthetic filter).Particularly, the present invention relates to surface that blood contacts on have coating medical treatment device, described coating can be used for the surface of cell capture in described device through engineered.Captured cell can form monolayer and can be used for many therapeutic use on the surface of described device, for example in drug delivery system and/or the treatment angiopathy.For example, the cell that is incorporated into the medical treatment device of implantation can be the natural endothelial progenitor cells of self-loopa blood and/or at external genetically modified cell, described cell has the molecule or the material of part or whole body therapeutic effect in patient's expression in vivo or secretion.

Background of invention

Atherosclerosis in the disease and cancer are two kinds of main causes that cause dead and disability in the world.Atherosclerosis produces relevant with the lip-deep fatty spew of lumen of artery.These fatty spews cause the lumen of artery narrow in cross-section.Finally cause blood flow to reduce, cause being subjected to the tissue generation ischemia injury of this tremulous pulse blood supply at the diseased region far-end.

Coronary artery is to heart blood supply.In the U.S., coronary atherosclerosis or coronary heart disease (CAD) are modal life-threatening severe chronic diseases, suffer from this sick number and surpass 1,100 ten thousand people.Society that coronary atherosclerosis causes and economic loss are considerably beyond most of other diseases.The narrow influence to cardiac muscle of coronary arterial lumen at first causes angina pectoris, is myocardial infarction then, causes death at last, has 300,000 people above just dead before arriving at hospital among these patients.(" HarrisonShi internal medicine principle", Harrison ' sPrinciples of Internal Medicine, the 14th edition, 1998).

For coronary atherosclerosis, can adopt through percutaneous transluminal coronary internal shaping art (PTCA) and treat.The annual above PTCA of 400,000 examples that implements of the U.S. performs the operation.In PTCA, balloon catheter is inserted in the peripheral arterial, be advanced to the coronary artery that is blocked along Arterial system.Make airbag inflation then, this section arterial is strutted, flatten the fatty speckle that blocks this place, thereby increase the blood flow in this impaired tremulous pulse cross section of flowing through.Yet this treatment can not make impaired coronary artery keep open configuration enduringly usually.Nearly 50% the needs of patients of accepting the PTCA treatment was accepted repetitive therapy to correct restenosis coronarius in 6 months.The narrow restenosis that medically is called that this PTCA of acceptance artery takes place once again.Acute restenosis relates to the resilience and the shrinkage of blood vessel.After blood vessel resilience and the shrinkage, propagation takes place to tackle by the caused arterial injury of PTCA in the middle level smooth muscle cell.The propagation part of smooth muscle cell is mediated by the various inflammatory factor that damage location discharges, and this class inflammatory factor comprises: thromboxane A2, platelet derived growth factor (PDGF) and fibroblast growth factor (FGF).Adopted multiple different technologies to overcome the restenosis problem, these technology comprise: the patient is treated or keep tremulous pulse to open with rack mechanical ground with various medicaments.(" HarrisonShi internal medicine principle ", Harrison ' s Principles of Internal Medicine, the 14th edition, 1998).

Proved that support is to overcome effective method in the various Therapeutic Method of restenosis.Support is to be placed in the metal supporting frames that produces the normal blood vessels inner chamber in the diseased arteries section.Can prevent the resilience of this tremulous pulse and the blood vessel graft that takes place then in the impaired tremulous pulse section with propping up to be placed on.Support can prevent that also this tremulous pulse from peeling off along medial part.By make arterial lumens keep having reduced nearly 30% restenosis with support greater than adopting the formed inner chamber of PTCA separately.But although obtain such success, support still can not be eliminated restenosis fully.(Suryapranata etc., 1998." for comparing at random of coronary artery bracket art in the patients of acute myocardial infarction through selecting and balloon angioplasty ", Randomized comparison ofcoronary stenting with balloon angioplasty in selectedpatients with acute

Stricture of artery also can occur in other blood vessels outside the coronary artery, comprises tremulous pulse under aorta bone tremulous pulse, the groin, the dark femoral artery in distally, Yuan Ce popliteal tremulous pulse, tibial artery, subclavian artery and Mesenteric artery etc.The atherosclerosis of peripheral arterial (PAD) prevalence depends on the impaired concrete region of anatomy, and used standard is blocked in diagnosis.Traditionally, the doctor adopts the intermittent claudication method of testing to judge whether to have PAD.Yet this method may have been underestimated the actual sickness rate of this disease among the crowd greatly.The sickness rate of PAD is different with the age, and the sickness rate of older individuals PAD increases.Estimate to have every year 55,000 routine male and 44,000 routine women to be diagnosed as chronic PAD first according to U.S.'s state hospital investigation data of leaving hospital; And have 60,000 routine male and 50,000 routine women to be diagnosed as acute PAD first.91% acute PAD case all relates to the lower limb position.In PAD patient, the ratio of the CAD that occurs together may surpass 50%.In addition, in PAD patient, the cerebrovascular disease sickness rate increases.

Can adopt percutaneous transluminal balloon angioplasty (PTA) to treat PAD.Adopt PTA and, can reduce the restenosis sickness rate in conjunction with support.Yet, at the postoperative effect that medical treatment device obtained that adopts such as support, the effect that is obtained not as the revascularization of employing standard (that is, adopt vein or repair and use the bypass material).(" The surgery Principle", Principles of Surgery, volumes such as Schwartz, the 20th chapter, " arterial disease ", Arterial Disease, the 7th edition, McGraw-Hill Health Professions Division, New York 1999).

The preferred method treatment PAD that sets up bypass that adopts walks around the obstructing arterial section with graft in the method and sets up bypass.(" Principles of surgery", Principles of Surgery, volumes such as Schwartz, the 20th chapter, " arterial disease ", Arterial Disease, the 7th edition, McGraw-Hill Health Professions Division, New York 1999).Described graft can comprise: autogenous vein section (for example, saphena) or synthetic graft (for example, the graft for preparing with polyester, polytetrafluoroethylene (PTFE) or expanded polytetrafluoroethyltoe (ePTFE) or other various polymeric materials).Its postoperative vessel open rate depends on multiple different factor, and these factors comprise: the intracavity of bypass graft footpath, as the synthetic material type of graft, and flow out the position.Yet even if adopted bypass graft, neointimal hyperplasia and thrombosis remain serious problem.For example, arterial bypass is after 3 years under the groin of employing ePTFE bypass graft, and the vessel open rate of burst-popliteal bypasses is 54%, and the bypass of thigh-shin then only is 12%.

Therefore, obviously need improve, with sickness rate and the case fatality rate of further minimizing CAD and PAD to support performance, synthetic bypass graft and other long-term blood contact surfaces and/or device performance.For example, can adopt to make the method for blood vessel radial dilatation (outside or positivity is moulded again) compensate the carrying out property growth of atheromatous plaque, thereby postpone the development of blood flow limited narrow (flow-limiting stenosis).

For support, the method that has adopted is to apply support with various anticoagulants or anti-restenosis agent, to reduce thrombosis and restenosis.For example, as if can suppress restenosis with the radioactive substance impregnated stents by migration and the propagation that is suppressed to myofibroblast.(U.S. Patent number 5,059,166,5,199,939 and 5,302,168).But the blood vessel that irradiation is treated can cause the edge restenosis problem that the patient is serious.In addition, irradiation is handled inhomogeneous to encroaching on blood vessel.

Perhaps, also adopted chemical agent to apply support, for example heparin, phosphocholine, rapamycin and taxol, all these medicines all show can extenuate thrombosis and/or restenosis.As if can obviously reduce the thrombosis of animal model in short-term though heparin and phosphocholine show, this class medicament does not have long-time effect to prevention of restenosis.In addition, heparin may bring out thrombocytopenia, causes serious thrombus complication, for example apoplexy.Therefore, in the practice mode of this treatment restenosis, also infeasible with the support that heparin of enough treating effective dose or phosphocholine load.

The restenosis and the thrombosis that have adopted synthetic graft to treat in many ways to reduce postoperative.(Boe etc., 1998." small diameter vascular shifting plant prothesis: present situation ", Small-Diameter Vascular GraftProstheses:Current Status, Archives Physio.Biochem,106:100-115).For example, it is reported that it is suitable with the ePTFE graft that polyurethane synthetic (for example, porous Merlon urethanes) reduces the effect of restenosis.Also adopted radio frequency glow discharge that modification is carried out on the surface of described graft, the dibenzoate graft has been fluoridized so that gather.Also adopted biomolecule to flood synthetic graft.Yet none can significantly reduce thrombosis or restenosis incidence rate over a long time these methods.

Endotheliocyte (EC) layer is a kind of important component of normal blood vessels wall, and it provides the interface between blood flow and the blood vessel wall surrounding tissue.Endotheliocyte also can participate in physiological activity, comprising: angiogenesis, inflammatory process and prevent thrombosis (Rodgers GM.FASSEB J 1988; 2:116-123).Discovering in recent years, endotheliocyte is except forming vascular system, and postnatal EC and endothelial progenitor cells (EPC) also circulate in peripheral blood.(Asahara T etc.Science, 1997; 275:964-967; Yin AH, etc.Blood, 1997; 90:5002-5012; Shi Q, etc.Blood, 1998; 92:362-367; Gehling UM, etc., Blood, 2000; 95:3106-3112; Lin Y etc., J Clin Invest, 2000; 105:71-77).It is believed that EPC can migrate to the impaired endodermis of blood circulation zone, comprises wound and ischemic injury position (Takahashi T etc., Nat Med, 1999; 5:434-438).In normal adult, the EPC concentration in the peripheral blood is 3-10/mm ³(Tkahashi T etc., Nat Med, 1999; 5:434-438; Kalka C, etc., Ann Thorac Surg, 2000; 70:629-834).Nowadays verified, each stage that blood vessel is replied for damage all is subjected to the influence (if not controlling) of endothelial tissue.It is believed that; rebuild functional endodermis rapidly at the blood vessel section of impaired and arrangement support and can protect the ability of the various materials of lower floor's layer of smooth muscle cells, and help to prevent these potential severe complications by harmful effect that the barrier to the circulating cells factor, anti-tampon are provided and the generation that they had.(Van Belle etc., 1997; " the interior dermatoplasty of support ", Stent Endothelialization, Circulation, 95:438-448; Bos etc., 1998." small diameter vascular shifting plant prothesis: present situation ", Small-Diameter Vascular Graft Prostheses:Current Status, Archives Physio. Biochem.106:100-115).

Behind implant frame,, can promote growth (Van Belle etc., 1997 of endotheliocyte at rack surface by local delivery vascular endothelial cell growth factor (VEGF, a kind of endotheliocyte mitogen); " the interior dermatoplasty of support ", Stent Endothelialization, Circulation,95:438-448).Bring out required action effect though can use the saline solution of recombinant protein growth factor VEGF at damaged part, VEGF can send with the passage balloon catheter behind implant frame.But this technology is unsatisfactory, and this is because it is confirmed that the too low effect that can not produce unanimity of the effect of single delivery dosage.Thereby this method can not accurately be reappeared effect at every turn.

Also adopted endothelial cell seeding synthetic material graft, but the clinical effectiveness of plantation endotheliocyte is all very poor usually, the tube chamber that is postoperative opens the low (Lio etc. of rate, 1998, " new ideas of blood capillary transplantation and new material: the endothelial cell seeding and the gene therapy of reparation property graft ", New concepts and Materials inMicrovascular Grafting:Prosthetic Graft Endothelial Cell Seeding and GeneTherapy, Microsurgery, 18:263-256), its reason is that cell is failed properly to be attached on the graft and/or because isolated operation causes cell to lose its EC function most probably.

Thereby in the adjusting of sticking, growing and breaking up of vascular injury site endotheliocyte, original position endothelial cell growth factor (ECGF) and environmental condition are vital.In view of the above, for restenosis and other angiopathy, be necessary to develop the new method and composition that is used to apply the medical treatment device that comprises support and synthetic graft, to promote and acceleration functional endothelium of formation on implanting device, thereby on the inner chamber of target vessel section or implantation, form successive EC monolayer, suppress the new intima hyperplasia thus.

About diseases such as cancers, present most of medicine can produce the whole body systemic reaction to the patient, owing to use the medicine of conventional oral or intravenous form, not only can influence cancerous cell, also can influence intravital any fissility cell (dividing cell).In many cases, because the character of the disease that need treat and the character (for example dissolubility, body internal stability, bioavailability etc.) of medicine, the general administration is ineffective.When the general administration, medicine is through blood circulation transportation and be distributed into the body area that comprises normal structure.At diseased region, originally drug level low and invalid, can bring up to toxic level after the frequent drug administration, and in non-lesion region, the existence of medicine then causes bad side effect.In some cases, medicine is easy to be subjected to metabolic degradation after administration.Therefore, often obtain drug effect and time expand by improving drug dose, this just cause the normal structure system burden increase and with the increase of patient's correlative charges.In other cases, because the toxic and side effects of some active drug can not be brought into play its treatment potential fully.

Therefore, done effectiveness and the targeting that many effort improve drug delivery system.For example, the advantage that adopts the liposome delivery medicine to have be usually their can prolong drug in blood circulation time, reduce side effect, reduce drug degradation, prolong therapeutical effect after each administration, reduce by free drug concentrations in the restriction of blood flow the demand of administration frequency and the amount that reduces required medicine.Yet present available liposome system shows that the effect that delivers drugs into target site in vivo is limited.Referring to Kaye etc., 1979, Poznansky etc., 1984, United States Patent (USP) 5,043,165 and United States Patent (USP) 4,920,016.

For realizing that efficiently the sending of therapeutic compound developed the viral vector that can mix transgenic DNA, yet the quantity of clinical practice success is still limited.The successful number that in external and animal model, is obtained, proposed gene transfer technique is combined with cell therapy.Ex vivo gene transfer is gone into might prove in the various cell types than direct body and function carrier transfer to have bigger treatment feasibility.Referring to Kohn etc., 1987, Bilbao etc., 1997 and Giannoukakis etc., 2003.

Recently, developed the localized drug delivery carrier, for example bracket for eluting medicament (drug elutingstent, DES).Referring to United States Patent (USP) 6,273,913, United States Patent (USP) 6,258,121 and United States Patent (USP) 6,231,600.Yet bracket for eluting medicament of the prior art is subjected to the restriction of many factors, for example, and the time of drug type, the medication amount that will discharge and release medicine.The other factors that need consider about bracket for eluting medicament is that medicine and other support apply the interaction between composition (for example polymeric material) and the character (for example integrity after lipotropy, molecular weight, the sterilization and activity and effectiveness and toxicity) of individual drugs.As for the polymeric material in the bracket for eluting medicament, what must consider is type, polymerization ratio, the ability of drug loading and the biocompatibility of this polymer of polymer, and the compatibility of drug-polymer (for example, the pharmacokinetics of medicine).

In addition, the drug dose in the bracket for eluting medicament is a preloaded, can not realize the drug dose of individual condition and demand is regulated.As for pharmaceutical release time, bracket for eluting medicament begins to discharge medicine after in a single day implanting immediately, and the real-time release that can not realize ideal.

Therefore, press for and develop a kind of effective general and local drug delivery system, to overcome the defective of current available technologies.The present invention just provided a kind of peace and and controlled way carry out the system of part or systemic delivery medicine.

Summary of the invention

An object of the present invention is to provide the method for a kind of curative drug delivery system and treatment patient disease.This treatment or drug delivery system comprise the medical treatment device with coating, this coating is by containing that at least one class can be discerned and form in conjunction with the substrate of the part of target cell, and described target cell is for for example: the mammalian cell of endothelial progenitor cells or hereditary change and the mammalian cell that has been subjected to the hereditary change of single or dual transfection.

Medical treatment device of the present invention can be any implantable patient's device.For example, in one embodiment, described device is the device that can insert intravascular space or hollow organ, repair screen, artificial heart, external and built-in left ventricular assist device (LVAD) and synthetic vessel graft as support, support implant, cardiac valve, conduit, blood vessel, they are used for the treatment of following disease: cancer for example; Angiopathy comprises restenosis, atherosclerosis, thrombosis, angiemphraxis; Or these install other any purposes that is covered.

In one embodiment, coating on the described medical treatment device comprises: biocompatible matrix and at least a substrate or part, described substrate or ligand specificity identification and in conjunction with target cell (for example endothelial progenitor cells), with for example prevention or treatment restenosis, or the mammalian cell that makes hereditary change adheres to the surface of described device, for example to treat vascular remodeling and cancer.

In addition, the coating of described medical treatment device can randomly comprise at least a engineered gene expression and the excretory reactive compound that can regulate the hereditary change cell.The example of the activator of energy activated compounds includes but not limited to: chemical molecular and peptide, for example somatomedin.Comprise in the embodiment of at least a chemical compound in coating, stimulus object, anakmetomeres or chemical compound can be used for the irritation cell expression and/or secrete at least a treatment of diseases thing for the treatment of.

In one embodiment, coating on the medical treatment device comprises the biocompatible matrix that has outer surface, described outer surface be used to adhere at least a part (for example, the combination of antibody, antibody fragment or antibody and antibody fragment) for the treatment of effective dose or at least a can be in conjunction with the molecule of the engineered labelling of genetically altered cell surface.The identification of antibody of the present invention or antibody fragment and in conjunction with the antigen on cell membrane or target cell surface or specificity through genetically engineered cell surface marker, thereby make the surface of cell fixation at described device.In one embodiment, what described coating can randomly comprise effective dose is used for the fixed at least a chemical compound of stimulating endothelial CFU-GM, if target cell is the circulation CFU-GM, then can promote the formation of maturation, functionalization endothelium, if perhaps target is the hereditary change cell on the surfaces of medical devices, then can stimulate the required gene outcome of bonded cellular expression justacrine.

Medical treatment device of the present invention can be any device that is used to implant the organ that comprises tract or body part, also can be but is not limited to: support, stent graft, synthetic blood vessel graft, cardiac valve, conduit, blood vessel is repaired screen, pacemaker, the pacemaker lead, defibrillator, in hole, the ovum garden patent (PFO) every closing device, vascular clamp, the vascular aneurysms dead lock, the hemodialysis graft, hemodialysis catheter, the chamber diverter, aortic blood tuberculation graft device or assembly, venous valve, suture, the vascular anastomosis folder, remain-type vein or ductus arteriosus, vagina vasorum and drug conveying mouth.According to the difference of device, described device can be made from a variety of materials.For example, support of the present invention can be made with rustless steel, Nitinol (NiTi) or evanohm and Biodegradable material.Synthetic blood vessel graft can be made with crosslinked PVA hydrogel, polytetrafluoroethylene (PTFE), expanded polytetrafluoroethyltoe (ePTFE), porous type high density polyethylene (HDPE) (HDPE), polyurethane and poly terephthalic acid vinyl acetate or Biodegradable material.

Form described medical treatment device biological compatibility of coating substrate including but not limited to synthetic material, for example, polyurethane, block polyurethane-carbamide/heparin, poly--L-lactic acid, cellulose esters, Polyethylene Glycol, polyvinyl acetate, glucosan or gelatin; And/or naturally occurring material, the basement membrane composition of collagen, elastin laminin, tropoelastin, laminin, fibronectin, vitronectin and so on for example, heparin, fibrin, cellulose and amorphous carbon or fullerene (fullerene).

In an embodiment of the invention, contain the biocompatible matrix that comprises fullerene in the described medical treatment device.In this embodiment, the carbon number of fullerene can be about C ₂₀-C ₁₅₀, more specifically, described fullerene is C ₆₀Or C ₇₀Fullerene of the present invention also can be arranged in nanotube (nanotube) on the surface of medical treatment device.

In an embodiment of the invention, described part is put on the surface that medical treatment device contacts with blood, described part can specific recognition and in conjunction with the lip-deep epi-position of required component or target cell in the circulation blood.In one embodiment, described part be specifically designed as by on the cell membrane of only discerning the hereditary change cell through genetically engineered labelled molecule, and can only discern and in conjunction with the mammalian cell of hereditary change.The combination of target cell with this cell fixation the device the surface on.

In one embodiment, according to the part of selecting through genetically engineered cell membrane labelled molecule to be used on the surfaces of medical devices in conjunction with genetically-altered cells.That is to say that described part only combines with the cell membrane labelled molecule or the antigen of being expressed by the extrachromosomal genetic element that offers this cell, thereby makes the part on the described surfaces of medical devices only discern genetically modified cell.In this way, have only genetically modified cell just to can be incorporated into the surface of medical treatment device.For example, if described mammalian cell is an endotheliocyte, described part can be at least a antibody, antibody fragment or their combination; Produce described antibody specifically at lip-deep specific target epi-position of target cell or labelled molecule.In this one side of the present invention, described antibody can be monoclonal antibody, polyclonal antibody, chimeric antibody or humanized antibody, it is by the only identification and combine the endotheliocyte of this hereditary change with the surface markers intermolecular reaction of the endotheliocyte of hereditary change, and regulates this cell thus so that it adheres to surfaces of medical devices.Antibody of the present invention or antibody fragment covalently or non-covalently can be connected in the surface of substrate, or pass through the covalently bound outermost layer that arrives the substrate of coated medical devices of linkers.In this embodiment, for example, monoclonal antibody also can comprise Fab or F (ab ') ₂Fragment.Antibody fragment of the present invention comprises the fragment of any size, for example, has kept antibody recognition and in conjunction with the macromole and the micromolecule of target antigen characteristic.

In another embodiment, the mammiferous antigen that antibody of the present invention or antibody fragment capable are discerned specifically and combination is treated, and their specificity does not depend on cell line.In one embodiment, for example, in the treatment restenosis when cell not genetically modified and contain the specific cell membrane marker and divide the period of the day from 11 p.m. to 1 a.m, described antibody or fragment can be selected and specifically in conjunction with the surface antigen of circulation endothelium progenitor cell, for example CD133, CD34, CDw90, CD117, HLA-DR, VEGFR-1, VEGFR-2, Muc-18 (CD146), CD130, stem cell antigen (Sca-1), stem cell factor 1 (SCF/c-Kit part), Tie-2, MHC (for example, H-2K ^kAnd HAD-DR).

In another embodiment, the coating of described medical treatment device comprises the above-mentioned biocompatible matrix of one deck at least, and this substrate contains and is useful on the outer surface that adheres at least a natural or synthesized micromolecule for the treatment of effective dose.Described micromolecule can for example be discerned, the endothelial progenitor cells in the treatment of restenosis, and with its interaction, thereby and this cell fixation is formed endodermis at apparatus surface.Described micromolecule can be used for and this medical treatment device therapeutic alliance various diseases, and can be derived from various sources (cell component for example, as fatty acid, protein, nucleic acid, saccharide etc.), and can produce result or the effect identical with the lip-deep AI of endothelial progenitor cells with antibody.Of the present invention this on the one hand, but the inclusion compound also of the coating on the medical treatment device for example is connected in the above-mentioned somatomedin of this paper on the coating that comprises antibody or antibody fragment.

In one embodiment, the chemical compound in the coating of the present invention (for example being used for treatment of restenosis) comprises stimulating or to promote growth of progenitor cells and differentiation to become any chemical compound of sophisticated functional endotheliocyte.In another embodiment, described chemical compound is used to stimulate the genetically modified required gene outcome of cellular expression justacrine.For example, the chemical compound that is used for the present invention can be somatomedin, for example VEGF (VEGF), basic fibroblast growth factor, the inductive somatomedin of platelet, transforminggrowthfactor-, acid fibroblast growth factor, osteonectin, angiogenin 1 (Ang-1), angiogenin 2 (Ang-2), insulin like growth factor, granulocyte macrophage colony stimulating factor, platelet derived growth factor AA, platelet derived growth factor BB, platelet derived growth factor AB and endothelium PAS albumen 1.

In another embodiment, for example when using the mammalian cell of hereditary change, can be used for irritation cell and express activator or the chemical compound of justacrine through genetically engineered gene outcome, include but not limited to: estrogen, tetracycline and other antibiotic, tamoxifen etc., can offer the patient through various route of administration, for example pass through percutaneous drug delivery with paster and subcutaneous form.

The present invention also is provided for treating the method for various diseases, and described disease is for for example: angiopathy, cancer, vascular remodeling, serious coronary heart disease, atherosclerosis, restenosis, thrombosis, aneurysm and angiemphraxis.In one embodiment, provide a kind of be used to keep or seal insert blood vessel wall medical treatment device (for example, support or synthetic blood vessel graft, cardiac valve, abdominal aortic aneurysm device and their parts) and set up environment in the blood vessel stable state, thus prevent method as the excessive neointimal hyperplasia in the restenosis.In the atherosclerotic the inventive method of treatment, described tremulous pulse can be coronary artery or peripheral arterial (for example femoral artery).Also available these technology and medical treatment device treatment vein.

For the treatment of restenosis, the present invention also provides a kind of engineered method that is used to induce healing reaction.In one embodiment, a kind of method that is used for the endodermis that rapid induction formation is merged on the luminal surface of the implanted device of grafting vessel target region is provided, and wherein said endotheliocyte can be expressed nitricoxide synthase and other antiinflammatory and inflammation regulatory factor.The present invention also provides a kind of medical treatment device, it has higher biocompatibility than prior-art devices, and can be by reducing or suppressing smooth muscle cell migration, smooth muscle cell differentiation and along the collagen deposition of the surface of internal cavity of medical treatment device implant site, the excessive neointimal hyperplasia and the restenosis that reduce or suppresses to organize.

In one embodiment, the method that is used for coated medical devices may further comprise the steps: will be at least one deck biocompatible matrix put on surfaces of medical devices, wherein said biocompatible matrix comprises at least a component that is selected from down group: polyurethane, block polyurethane-urea/heparin, poly--L-lactic acid, cellulose esters, Polyethylene Glycol, gather ethyl acetate, glucosan, gelatin, collagen, elastin laminin, tropoelastin, laminin, fibronectin, vitronectin, heparin, fibrin, cellulose and carbon and fullerene; And simultaneously or apply in succession: at least a antibody, antibody fragment or their combination of treatment effective dose, and the chemical compound of growth of at least a stimulating endothelial cell and differentiation to described biocompatible matrix.

The present invention also provides a kind of method for the treatment of mammal blood vessel disease, described method comprises: medical treatment device is implanted in mammiferous blood vessel or the pipe inner chamber, wherein said medical treatment device is coated with (a) biocompatible matrix, (b) at least a antibody, antibody fragment or their combination of treatment effective dose, and (c) at least a chemical compound; Wherein said antibody or antibody fragment capable identification and in conjunction with the lip-deep antigen of endothelial progenitor cells, thus endothelial progenitor cells is fixed on the stromal surface, and described chemical compound then is used to stimulate fixed endothelial progenitor cells to form endothelium on surfaces of medical devices.

Treatment/the drug delivery system of treatment patient disease also is provided in one embodiment.Described treatment or drug delivery system contain the mammalian cell of hereditary change and are used to implant patient's medical treatment device, and the mammalian cell of wherein said hereditary change comprises coding through the genetically engineered cell surface marker and the exogenous nucleic acid of at least a therapeutic gene product.In one embodiment, with the suitable described genetic engineering modified cell of the transfection carrier in-vitro transfection that comprises exogenous genetic material, for described cell provides required gene.In this embodiment, described cell can be any mammalian cell, no matter from body, allochthonous or xenogeneic, for example endotheliocyte, fibroblast, sarcoplast etc.In this embodiment, described medical treatment device applies with biocompatible matrix, described substrate comprises part, and described part passes through combination through genetically engineered cell membrane labelled molecule or the antigen on the cell surface, and only is incorporated into the mammalian cell of hereditary change.

In treatment of the present invention and/or drug delivery system, described genetically-altered cells has exogenous genetic material and has imported the gene of at least a Codocyte surface markers molecule or antigenic required gene and at least a coding therapeutic gene product.This system option ground comprises signaling system, for example can stimulate the mammalian cell expression of hereditary change and/or secrete the reactive compound or the molecule of required gene outcome and/or marker gene.

Therefore, in one embodiment, but with import in the mammal described exogenous genetic material through engineered be the cell membrane labelling of part on the codified specificity coupling apparatus.For example, when described device was used to insert intravascular space, this exogenous genetic material should be encoded except offering patient's the cell membrane labelling that does not all have in any cyclicity cell in auterblood through genetically engineered cell.

A kind of medical treatment device and method through applying that is used for the treatment of various diseases also is provided, and described disease is: angiopathy for example includes but not limited to atherosclerosis, cancer and rheumatoid arthritis.Medical treatment device of the present invention comprises and is used in vivo that specificity is caught and the fixing coating of the mammalian cell of hereditary change that the mammalian cell of described hereditary change is to import simultaneously or subsequently when described medical treatment device through applying is implanted the patient.

Also provide and be used for fixing expression and/or secrete at least a material of specific disease or the fixed hereditary change cell of therapeutic agent of being used for the treatment of.In this one side of the present invention, for example in the treatment cancer, make described cell (for example, endotheliocyte) that hereditary change take place by in described cell, importing exogenous genetic material.In one embodiment, in described hereditary material transfered cell nuclear, and it is DNA (a for example exchromosomal DNA).Described exchromosomal DNA can be carrier, for example adenovirus vector, plasmid (as the gymnoplasm grain), linearity or short dna etc.In one embodiment, described DNA comprises regulation and control/expression cassette that required labelling and/or therapeutic gene are expressed in control.In one embodiment, described regulation and control box can comprise the controlling element that is used for constructive expression's therapeutic gene, and maybe can comprise can be by needs of patients control or the element of expressing.

In one embodiment, the described medical treatment device that is used to implant the patient comprises coating; Described coating comprises can identification and in conjunction with the part of target cell by substrate load at least a.At cell is in the embodiment of genetically-altered cells, and described part is only discerned and in conjunction with through engineered and add the specific cell membrane marker molecule or the antigen of cell.Therefore in this embodiment, part is only discerned the mammalian cell of the hereditary change that has imported the patient, the mammalian cell of this hereditary change is incorporated on the described medical treatment device, expresses justacrine labelled molecule or antigen and at least a therapeutic gene product.

In another embodiment, described treatment or drug delivery system also can comprise activating molecules (activatingmolecula), and this activating molecules is used to stimulate the mammalian cell expression of described hereditary change and/or secretes required therapeutic gene product.In this one side of the present invention, can will supply with the patient such as the chemical compound of chemical irritant or peptide by several different methods, these methods comprise: oral route, warm paster (thermal patch), intravenous, intradermal injection etc.In this embodiment, the mammalian cell of described hereditary change can be from body or external source, for example mature endothelial cell, fibroblast, myocyte, epithelial cell etc., the exogenous nucleic acid that they comprise can be exchromosomal DNA.In one embodiment, described DNA provides with carrier format, for example adenovirus vector, naked plasmid dna, linear DNA etc.In one embodiment, described exchromosomal DNA comprises the regulation and control box, and promptly the gene of Codocyte membrane antigen and at least a coding are used for the treatment of the gene of the peptide of disease.In aspect of this embodiment, described cell membrane specific gene coding, for example BMP or prostatic cell memebrane protein.

In one embodiment, described extrachromosomal genetic element comprises the gene of the treatment/pharmaceutical product of encoding, and these products are for example to be used for the VEGF and the angiogenesis factor of vascular remodeling, or is used for the treatment of the anti-angiogenesis of cancer.

In another embodiment, provide a kind of method that is used for the treatment of disease.Described method comprises:

The mammalian cell of hereditary change is offered the patient; Described cell comprises coding through genetically engineered cell membrane labelled molecule and at least a therapeutic gene product exogenous nucleic acid;

The medical treatment device that will comprise coating is implanted the patient; The substrate of at least a part that described coating has comprised load, wherein this part can discern and in conjunction with on the mammalian cell of described hereditary change through genetically engineered cell membrane labelled molecule, the mammalian cell of wherein said hereditary change is incorporated into medical treatment device, and expresses and secrete described therapeutic gene product.In an embodiment of the invention, described therapeutic genes and gene outcome comprise for example VEGF, angiogenesis factor, anti-angiogenesis and fibroblast growth factor.

The present invention also provides the method for treatment patient disease, and described method comprises: the mammalian cell of hereditary change is offered the patient; Medical treatment device is implanted the patient; Described medical treatment device comprises coating, described coating comprises the substrate that load has at least a part, described part can specific recognition and in conjunction with at least a labelled molecule, the receptor on the mammalian cell of this hereditary change for example, the mammalian cell of wherein said hereditary change is incorporated on the described medical treatment device, comprises the exogenous nucleic acid that is used to express and secrete therapeutic gene product.

In another embodiment, provide a kind of method that is used in vivo cell being raised the surface that contacts blood.Described method comprises provides the surface that is arranged in object blood flow contact blood, and the surface of described contact blood is through setting up the surface that the cyclicity target cell in the object blood flow can be raised described contact blood; And the surface of described target cell being raised described contact blood.In this embodiment, the surface of described contact blood comprises the surface of internal cavity of the medical treatment device of implanting described object.In this embodiment of the present invention, the target cell of being raised on the surface (for example support or graft) of contact blood can recover the normal endothelial tissue with surface self endothelialization (self-endothelialize) of described device and at the damaged blood vessels position.The surface of described contact blood can be the biodegradable framework maybe can be coated with biodegradable biocompatible materials.In this one side of the present invention, described biodegradable framework will be degraded when implantable intravascular in position, and the newborn endothelium that forms on described device inner chamber has been rebuild the coherent blood vessel by the injury, thereby form functional new vessels.

In another embodiment, the present invention includes a kind of dummy, described dummy comprises: (a) have outer surface and the carrier film that contacts the blood surface; (b) be coated on the lip-deep ground floor cross-linked polymer compound of contact blood of described carrier film; (c) be coated on the second layer on the ground floor, the described second layer contains at least a part that in vivo target cell is had affinity.

In another embodiment, a kind of method that is used for generating in vivo self endothelialization graft is provided, described method comprises: (a) provide the function of setting up to be the framework as blood vessel graft, described framework has surface of internal cavity and outer surface, and described surface of internal cavity comprises specificity and is used for part in conjunction with endothelial progenitor cells; (b) described framework is implanted in the blood vessel of object; (c) the cyclicity endothelial progenitor cells is raised on the described surface of internal cavity of described framework to form newborn endothelium.

In another embodiment, provide a kind of method that is used for original position generation self endothelialization graft, described method comprises: the reparation construction that the surface with contact blood circulation (a) is provided; (b) described reparation construction is implanted object; (c) from blood, raise cyclicity cell (for example, the mammalian cell of endothelial progenitor cells and hereditary change) and make on its surface that is attached to described reparation construction, thereby form newborn endothelium thereon.

In another embodiment, provide the method for original position generation self endothelialization graft, described method comprises: (a) provide the function of setting up to be the biodegradable framework as interim blood vessel graft, described framework has surface of internal cavity and outer surface; (b) with in the described biodegradable framework implantable intravascular; (c) raise circulating cells (for example mammalian cell of endothelial progenitor cells and hereditary change) and make it to be attached on the surface of internal cavity of described dummy (for example graft, support or biodegradable framework), thereby form newborn endothelium; (d) make vascular tissue wrap up the outer surface of described framework to form outside hemostasis blood vessel structure; (e) in vivo under the condition, can make described newborn endothelial tissue and outside blood vessel structure form in the time period of functional new vessels, described biodegradable framework is degraded.

In one embodiment, provide a kind of biodegradable framework that original position forms the endothelialization blood vessel graft that is used for, described framework comprises: the porous biological degradable carrier film that (a) has surface of internal cavity and outer surface; (b) described surface of internal cavity comprises the ground floor of being made up of at least a polymerizable compound that is coated on the described carrier film, wherein said chemical compound can form covalent bond through the cross-linking agent self-crosslinking, described covalent bond can be subjected to enzymatic lysis or non-enzymatic hydrolysis under the condition and in vivo (c) to have the part of specificity affinity in the body in conjunction with the mammalian cell of hereditary change.

In another embodiment, provide a kind of method that original position produces self endothelialization graft that is used for, described method comprises: (a) provide to have the circulate reparation construction on surface of blood of contact patient; (b) described reparation construction is implanted object or patient; (c) mammalian cell with hereditary change gives described patient; (d) from blood, raise cyclicity cell (for example mammalian cell of hereditary change) and make on its surface that is attached to described reparation construction, thereby on the surface of described reparation construction, form one deck genetically-altered cells.

In another embodiment, a kind of method that promotes vascular remodeling is provided, for example the girth that increases tremulous pulse by outside or positivity reconstruct to be partly or entirely compensating because of forming that atheromatous plaque causes or the injured back of tremulous pulse is occupied because of the inner chamber that the inner membrance paraplasm causes, thus prevent or suppress damaged blood vessels inwardly or negativity reconstruct.In this embodiment, for example providing aforesaid is covered and can be in conjunction with the support of genetic engineering modified cell by substrate and part, to be used to catch genetically modified autogenous cell (for example endothelial progenitor cells), these cells can be secreted at least a potent anticoagulant and vasodilation, for example: prostacyclin, as prostaglandin 12, PG12; Calcitonin-gene-related peptide is as α-CGRP etc.Can comprise nitric oxide (nitric oxide synthase gene), matrix metalloproteinase, acetylcholine, adenosine, 5-hydroxy tryptamine, P material (substance P), adrenomedullin etc. through engineered other product that produces by cell.Can adopt its product as vasodilation and/or anticoagulant or have vasodilation and/or the gene of anticoagulant characteristic, for example can cause the vasodilation of vascular smooth muscle relaxation.Can offer endothelial progenitor cells or endotheliocyte by will the encode gene (for example prostacyclin synthase gene) of vasodilation of gene transfer technique, described gene transfer technique can be the viral gene that for example adopts cistron (cistronic) gene constructs and shifts, with regard to prostacyclin, for example cistron cyclooxygenase-1/ prostacyclin synthase gene constructs can provide successive local prostaglandin to send.In this embodiment, prostaglandin local delivery system for example can be used for treatment, cerebral infarction and coronary vessels diseases.Also the positivity reconstruct of blood vessel can be generated (being ripe blood vessel, the formation of for example be grown up small artery and tremulous pulse) to form the Therapeutic Method of attached blood vessel as regulating tremulous pulse.

In another embodiment, the cell that the bicistronic mRNA carrier transfection of available code vasodilation chemical compound and unique cell surface marker (for example MHC-I of truncate) is suitable, as fibroblast, endotheliocyte or endothelial progenitor cells, described cell surface marker can be by part (for example being fixed in the antibody on the dummy in the blood vessel) identification.For example, the support that part (as antibody) can be applied is implanted in the patient's coronary artery, then genetically-altered cells (for example endotheliocyte of hereditary change) is implanted among the patient who needs the treatment angiopathy.In this embodiment that uses genetically-altered cells and other embodiment, can adopt the technique for gene engineering of standard for example to utilize plasmid vector before implanting cell exogenous gene to be sent into cell, described plasmid vector can be for example bicistronic mRNA pMACSK ^K.II plasmid vector (Miltenyi Biotec, Germany), it comprises multiple clone site and interested gene can be inserted wherein selected marker as used mammal cell line, described interested gene be for example prostacyclin synthase and marker gene (as the MHC I type molecule of truncate, H-2K).

In another embodiment, the exogenous gene delivery system that is used for transfection mammalian cell in being used for the treatment of can comprise, for example comprises the MHC I type antigen of truncate and the slow virus carrier of vasodilation transgenic (prostacyclin synthase and/or the α-CGRP gene that for example are used for the treatment of angiopathy).In this embodiment, describedly want transfected mammalian cell to can be endotheliocyte or endothelial progenitor cells from body, and the antigenic ligands specific of MHC I type of available this truncate of described reparation device (anti--H-2K for example ^kAntibody) apply.

The accompanying drawing summary

Figure 1A passes through the corsslinking molecular covalent coupling in the sketch map of substrate for antibody.Figure 1B is C ₆₀The O molecule is anchored on the sketch map on the substrate.Fig. 1 C is coated with the sketch map of the support of substrate for the present invention.

Fig. 2 A is the phase contrast microscope photo that sticks to the endothelial progenitor cells on the slide that is applied by fibronectin, contains from the enrichment medium isolated cells on the described slide.Fig. 2 B is the phase contrast microscope photo attached to the endothelial progenitor cells on the slide of fibronectin coating, contains the magnetic bead isolated cells of useful anti-CD34 antibody sandwich on the described slide.Fig. 2 D and 2F are the microphotograpies of having hatched 7 days and having carried out the endothelial progenitor cells of nuclear staining with PI.By these figure as seen, as respectively the antibody fluorescence of Tie-2 (Fig. 2 E and 2G) and VEGFR-2 (Fig. 2 C) antibody response being shown, shown in cellular expression the labelling of mature endothelial cell.

Fig. 3 A and 3B are 2% agarose gel sxemiquantitative RT-PCR photos of the ethidium bromide staining of endothelial nitric oxide synthase (eNOS) and glyceraldehyde phosphate dehydrogenase (GAPDH).After being incubated at last 3 day of slide (Fig. 3 B) and 7 days (Fig. 3 A) of fibronectin coating, endothelial progenitor cells begins to express eNOS mRNA.

Fig. 4 A-4E sticks to the HUVEC cell to cultivate and painted with iodate third ingot: CMDx and anti-CD34 antibody (4A); Gelatin and anti-CD34 antibody (4B); Barren rustless steel disk (4C); The photo of HUVEC on (4E) rustless steel disk that (4D) that CMDx applies and gelatin apply.

Fig. 5 A-5C is the microphotograph of the contrast that applies of the CMDx of the no antibody of hatching with human blood leukocyte's component.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.Fig. 5 D-5F is incorporated into the microphotograph of the contrast rustless steel disk that its surperficial gelatin applies with what human blood leukocyte's component was hatched by no antibody.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.

Fig. 6 A-6C is the microphotograph that is combined with the rustless steel disk that the CMDx substrate of anti-CD34 antibody applies on the surface of hatching with HUVEC.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.Fig. 6 D-6F is the microphotograph that is combined with antibody rustless steel disk with the gelatin coating surface that HUVECS is hatched.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.

Fig. 7 is the microphotograph that the surface combination of hatching altogether 24 hours with CFU-GM has the rustless steel disk that the CMDx of antibody applies.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.

Fig. 8 A and 8B are the microphotograpies that the surface combination of hatching altogether 7 days with CFU-GM has the rustless steel disk that the CMDx substrate of anti-CD34 antibody applies.Described cell is with the anti--KDR antibody staining of iodate third ingot and FITC labelling.

Fig. 9 A and 9B are the microphotograpies that the surface combination of hatching altogether 7 days with CFU-GM has the rustless steel disk that the CMDx substrate of anti-CD34 antibody applies.Described cell is with the anti-Tie-2 antibody staining of iodate third ingot and FITC labelling.

Figure 10 A-10C is the phase contrast microscope photo of hatching the rustless steel disk that the CMDx in 3 weeks applies in the endothelial cell growth culture medium with CFU-GM, has shown sophisticated endotheliocyte.

Figure 11 is the sketch map that is combined with the rack surface that the functional fullerene of the usefulness of the present invention of CFU-GM applies.

Figure 12 A-12D is the photo that has or do not have the sample that the fullerene of anti-CD34 antibody applies.Described sample and human leukocyte component are hatched altogether, and with anti-VEGFR-2 antibody staining of iodate third ingot and FITC labelling.

Figure 13 A-13D is the low power and the high magnification micrographs of coronary artery extract histology transverse section, sample (Figure 13 B and 13D) 4 weeks that described extract has been implanted exposed stainless steel stent (Figure 13 A and 13C) and applied with fullerene.The section hematoxylin-eosin staining.

Figure 14 A-14G is a scanning electron microscope microphotograph of implanting male yorker 1 and 48 hours after-poppet extracts.The extract of (Figure 14 A) and the glucosan that glucosan applies/(14B) support that anti-CD34 antibody applies is for implanting back 1 hour.Figure 14 C and 14D are depicted as the control sample extract, and Figure 14 E-G is for implanting the support that back 48 hours glucosan/anti-CD34 antibody applies.Figure 14 H-14M is cross section histology's microphotograph of coronary artery extract of taking from 4 weeks of implantation of male yorker: uncoated (blank rustless steel) (14H and 14I), glucosan apply (14L and the 14M) that contrast (14J and 14K) and glucosan/anti-CD34 antibody applies.

Figure 15 A, 15B and 15C are respectively the fluorescence micrograph of 48 hours 18mm of the implantation support that long glucosan with the no antibody in surface-blood plasma applies, glucosan-blood plasma coating/support that anti-CD34 antibody applies.

Figure 16 A and 16B are the microphotograpies of iodate third ingot and the link coupled sample of antiagglutinin/FITC.

Detailed Description Of The Invention

The invention provides a kind of implantable medical device (for example support or graft) of coating and the method and composition that is used to apply this medical treatment device, and the method for the treatment of angiopathy with the medical treatment device of described coating.The present invention also provides a kind of method that is used for the treatment of disease (for example restenosis and cancer), described method comprises the patient who the medical treatment device with coating is implanted the needs treatment, and for described patient provides through genetically engineered mammalian cell, described cell can be incorporated into the surface of described medical treatment device in vivo and can produce engineered and required therapeutic agent (for example gene outcome).Figure 1A-1C is the sketch map of medical device surface coatings of the present invention.Coating on the medical treatment device comprises: biocompatible matrix, it can promote on apparatus surface to form the fused cell layer (mammalian cell of hereditary change for example, as endotheliocyte or fibroblast) can prevent restenosis and/or thrombotic anti-angiogenesis or anticoagulant or produce the product that can suppress neointimal hyperplasia in the patient, to regulate or to produce required therapeutic effect, for example to produce.In one embodiment, the substrate that coating on the described prosthetic device comprises contains synthetic or naturally occurring material, comprise in the described material can promote cyclicity cell (for example the mammalian cell of hereditary change, as endotheliocyte, CFU-GM or stem cell) adhere to medical treatment device the treatment effective dose at least a antibody and can the stimulating endothelial cell growth and at least a chemical compound (for example somatomedin) of differentiation.After implanting described device, the cell transformation that is attached to described apparatus surface becomes functional cell layer ripe and that merge, for example forms endothelium at described medical treatment device surface of internal cavity.The endotheliocyte fused layer that exists on medical treatment device for example can reduce implant site restenosis and thrombosis.

As used herein, " medical treatment device " is meant temporarily or forever introduces in the mammal to prevent or to treat the device of a certain medical science condition of illness.These devices comprise any device in the inner chamber of introducing by subcutaneous, percutaneous or operation that is placed in organ, tissue or organ (for example tremulous pulse, vein, ventricle or atrium).Described medical treatment device can comprise: support, stent graft, the support that applies (for example is coated with polytetrafluoroethylene (PTFE), expanded polytetrafluoroethyl,ne (ePTFE) or other natural or synthetic coating), or synthetic blood vessel graft, artificial heart valve, artificial heart and can connect the organ of reparation and the fixture of systemic vascular, vein valve, abdominal aortic aneurysm (AAA) graft, postcava screen sheet, permanent infusion administering catheter, spiral shell volume embolus (emboliccoil), the embolism materials (for example, crosslinked PVA hydrogel) that when blood vessel embolism forms, uses, the blood vessel suture, the vascular anastomosis fixture, saturating myocardial vascular forms support and/or other various conduits again.

The coating of the medical treatment device that forms with the compositions and methods of the invention can stimulate in vivo and produces the mammalian cell layer that merges on the described apparatus surface.For example, when the part that is provided makes in conjunction with endotheliocyte on its blood contact surface at described device when forming functional endodermis, promptly formed endothelial layer on this surfaces of medical devices, thereby prevented restenosis, and can regulate local chronic inflammatory reaction and the thrombosis complication that causes by the implantation of described medical treatment device.

The substrate that covers medical treatment device can be made up of synthetic material, and for example, the polymerism gel foam is as the hydrogel of being made by polyvinyl alcohol (PVA), polyurethane, poly--L-lactic acid, cellulose esters or Polyethylene Glycol.In one embodiment, can comprise very hydrophilic chemical compound in the synthetic material of preparation substrate, for example dextran compound.In another embodiment, described substrate is made up of naturally occurring material, for example collagen, fibrin, elastin laminin, tropoelastin and/or amorphous carbon.Described substrate also can comprise multilamellar, and for example ground floor can be made up of synthetic material or naturally occurring material, and the second layer can contain for example part (as antibody).Each layer can be arranged in succession in turn, and ground floor directly contacts with medical treatment device (support or synthetic material graft) surface, and the second layer has a surface directly to contact with ground floor, and another surface then contacts with intravascular space.

Described substrate also can comprise at least a somatomedin, cytokine, vasodilation, anticoagulant etc.But the somatomedin of stimulating endothelial cell propagation and differentiation is for for example: VEGF (VEGF) and isoform thereof, basic fibroblast growth factor (bFGF), the inductive somatomedin of platelet (PIGF), transforminggrowthfactor-(TGF. β 1), acid fibroblast growth factor (FGF), osteonectin, angiogenin 1, angiogenin 2, insulin like growth factor (ILGF), platelet derived growth factor AA (PDGF-AA), platelet derived growth factor BB (PDGF-BB), platelet derived growth factor AB (PDGF-AB), granulocyte macrophage colony stimulating factor (GM-CSF) etc., or its functional fragment, they can be used among the present invention.Vasodilation comprises: prostacyclin, α-CGRP etc.

In another embodiment, described substrate can comprise fullerene, and the carbon number of described fullerene is about C ₂₀-C ₁₅₀Described fullerene also can be arranged in nanotube, wherein can mix molecule or protein.Described fullerene substrate also can be applicable to rustless steel, PTFE or ePTFE surfaces of medical devices, then this layer is carried out functionalization and at its surface-coated antibody and somatomedin.Perhaps, can be at first coated with PTFE or ePTFE layer on the rustless steel medical treatment device for example, and then apply second layer fullerene, add antibody and somatomedin.

This substrate can be non-covalent or the mode of covalency attached on the medical treatment device.Various antibody and somatomedin can by different base or with basic difunctional cross-linking reagent, covalent attachment be on this substrate.Can adopt standard technique that somatomedin is added in this substrate with antibody or after antibodies.

As used herein, term " antibody " is meant a class monoclonal, polyclone, humanization or mosaic antibody or their combination, wherein, described monoclonal, polyclone, humanization or chimeric antibody and a kind of antigen maybe the antigenic functional equivalents of this kind combine.The term antibody fragment comprises with antibody having any antibody fragment of same effect and effect (as Fab, F (ab ') ₂Deng), and can be any size, i.e. macromole or micromolecule.(include most antibody of antibody molecule separately, be equivalent to 6.022 * 10 ²³Individual molecule/mole antibody).

For example, in one embodiment, available biocompatible matrix applies support or synthetic graft, and this substrate comprises can regulate antibody, antibody fragment or their combination that circulating cells (for example the mammal therapeutic cell and the endothelial progenitor cells of hereditary change) adheres to described surfaces of medical devices.For example, the cell membrane labelled molecule of antibody recognition of the present invention and binding specificity, endothelial progenitor cells surface antigen and/or the membrane molecule that produces by the mammalian cell of hereditary change in the circulation blood for example, thus make described cell fixation on the surface of device, form functional cell layer (for example functional endothelial tissue).In one embodiment, described antibody comprise can with the monoclonal antibody of following substance reaction (identification and combine): the mammalian cell surface molecule of hereditary change, the endothelial progenitor cells surface antigen, perhaps CFU-GM or stem cell surface antigen, for example vascular endothelial growth factor receptor-1,-2 and-3 (VEGFR-1, the isoform of VEGFR-2 and VEGFR-3 and VEGFR receptor family), Tie-1, Tie2, CD34, Thy-1, Thy-2, Muc-18 (CD146), CD30, stem cell antigen-1 (Sca-1), stem cell factor (SCF or c-Kit part), CD133 antigen, the VE-cadherin, P1H12, TEK, CD31, Ang-1, Ang-2 or the antigen of on described cell surface, expressing.In one embodiment, can use antibody with a kind of antigen reactive single type.Perhaps, the multiple different antibody at different endothelial progenitor cells surface antigens can be mixed and adds in the substrate.In another embodiment, adopted the mixture of monoclonal antibody, improved the endothelium formation rate by the targeting specific cell surface antigen.In this embodiment, use for example capable of being combined is anti--CD34 and anti--CD133, maybe these and any or several antigen group listed above can be share in attached to the stromal surface on the medical treatment device (for example support or graft).Also available antibodies, antibody fragment and/or their combination apply described medical treatment device.

As used herein, the antibody of effective dose " treatment " is meant and can promotes the antibody consumption of cell attachment in medical treatment device, and wherein said cell for example is: the mammalian cell of natural or hereditary change comprises endotheliocyte, CFU-GM or stem cell.Implement antibody amount required for the present invention according to the character of used antibody and difference.For example, the amount of used antibody depend on antibody and with it the reaction antigen between binding constant and/or affinity.Those of ordinary skill in the art knows the treatment effective dose that how to be identified for concrete antigenic antibody.

As used herein, term " chemical compound " is meant mammalian cell expression that can stimulate hereditary change and/or any material of secreting therapeutic gene product.

As used herein, term " somatomedin " but be meant that irritation cell (for example hereditary change or unaltered endotheliocyte, stem cell or CFU-GM) grows and be divided into peptide, protein, glycoprotein, lipoprotein or their fragment or the variant or the synthetic property molecule of sophisticated functional endotheliocyte.Thereby sophisticated endotheliocyte can be expressed nitricoxide synthase nitric oxide is released into tissue.Following table 1 has been listed some somatomedin that can be used for applying described medical treatment device.

Table 1

The somatomedin endothelial cell specific

Acid fibroblast growth factor (aFGF) does not have

Basic fibroblast growth factor (bFGF) does not have

Dimension cell growth factor 3 (FGF-3) does not have

Fibroblast growth factor 4 (FGF-4) does not have

Fibroblast growth factor 5 (FGF-5) does not have

Fibroblast growth factor 6 (FGF-6) does not have

Fibroblast growth factor 7 (FGF-7) does not have

Fibroblast growth factor 8 (FGF-8) does not have

Fibroblast growth factor 9 (FGF-9) does not have

Angiogenesis factor 1 has

Angiogenesis factor 2 has

Hepatocyte growth factor/dispersion factor (HGF/SF) does not have

Platelet derived growth factor (PDE-CGF) has

Transforminggrowthfactor-(TGF-α) does not have

Transforming growth factor-beta (TGF-β) does not have

Tumor necrosis factor-alpha (TNF-α) does not have

VEGF 121 (VEGF121) has

VEGF145 (VEGF145) has

VEGF-165 (VEGF165) has

VEGF 189 (VEGF189) has

VEGF 206 (VEGF206) has

Vascular endothelial growth factor B (VEGF-B) has

Vascular endothelial growth factor C (VEGF-C) has

VEGF-D (VEGF-D) has

VEGF E (VEGF-E) has

VEGF F (VEGF-F) has

Placental growth factor has

Angiogenin-1 does not have

Angiopoietin-2 does not have

Thrombospondin (TSP) does not have

Proliferin has

Liver is joined albumen-A1, and (Ephrin-A1 B61) has

E-selects albumen to have

Chicken chemotactic and angiogenesis factor (cCAF) do not have

Leptin (Leptin) has

The heparin affinity is regulated peptide (HARP) not to be had

Heparin does not have

Granulocyte colony-stimulating factor does not have

Insulin like growth factor does not have

Interleukin 8 does not have

Thyroxine does not have

Sphingosine 1-phosphate ester does not have

As used herein, " VEGF " is meant any isoform of listed VEGF in the table 1, unless can differentiate it with this sequence number or letter abbreviations with the worker specifically to term.

As used herein, term " somatomedin of treatment effective dose " is meant and stimulates or inducing specific cell mass (for example natural or modified endotheliocyte, CFU-GM or stem cell) growth and differentiation, thus the maturation that formation is merged and the somatomedin consumption of functional cell layer (for example endotheliocyte forms functional endothelial tissue at the medical treatment device surface of internal cavity).Implement somatomedin consumption required for the present invention with the binding kinetics between the character of used somatomedin and somatomedin and its receptor in target cell and different.For example, but 100 μ g VEGF have shown that stimulating endothelial cell adheres to medical treatment device and forms the endothelium fused layer.Those of ordinary skill in the art knows the treatment effective dose of the somatomedin that how to be identified for irritation cell (for example, endotheliocyte) growth and differentiation.

As used herein, " neointimal hyperplasia " is meant the bad increase of smooth muscle cell proliferation in the blood vessel wall and/or apposition.As used herein, " restenosis " is meant that the recurrent of intravascular space is narrow.Blood vessel can block because of restenosis.Behind PTCA or PTA, breed from media and adventitia and the smooth muscle cell that is not present in the inner membrance usually, move to inner membrance justacrine protein, formation smooth muscle cell and stromatin gathers in inner membrance.This gathers and has caused arterial lumens blood flow narrow, that flow to the stenosis far-end to reduce.As used herein, " inhibition restenosis " is meant smooth muscle cell migration and inhibition of proliferation and prevents protein secreting simultaneously, thereby prevent restenosis and the complication that causes thereof.

The object of available medical treatment device of the present invention, method and composition treatment is a mammal, comprising: people, Canis familiaris L., cat, pig, horse, Rodents and monkey.

It is interior or external that Therapeutic Method of the present invention can be applicable to body.

Term " endothelial progenitor cells " is meant derived from bone marrow, blood or local organization and is in the endotheliocyte of any stage of development (from CFU-GM or stem cell to sophisticated functional endotheliocyte) that they are non-malignant cells.

The medical treatment device that can be described coating provides genetically modified mammalian cell, the endotheliocyte that for example can from stripped tremulous pulse or vein (for example human umbilical vein), separate the differentiation of the hereditary change that obtains, they have carried out hereditary change at the required nucleic acid construct thing of external use, and endothelial progenitor cells is then separable from peripheral blood or bone marrow.In one embodiment, can be by endotheliocyte and the medical treatment device that has applied substrate be hatched jointly, and described endotheliocyte can be combined with described medical treatment device, wherein said substrate has been mixed antibody and at least a somatomedin of choosing wantonly or other can be attached to the part of endotheliocyte.In another embodiment, described endotheliocyte can be the endotheliocyte of conversion.The endotheliocyte of transfection can comprise expresses somatomedin or other peptide or proteinic carrier, and these somatomedin, peptide or protein can directly or indirectly suppress thrombosis, restenosis or other any therapeutic outcome.

In another embodiment, the mammalian cell of available mammalian expression vector transfection endotheliocyte or other type-stable (for example fibroblast), described carrier comprise coding and are suitable for the protein of special-purpose or any clone gene of peptide.For example, can make up described carrier makes it contain expression cassette, described expression cassette comprises the gene of encode platelet derived growth factor (PDGF), fibroblast growth factor (FGF) or nitricoxide synthase (NOS), and available conventional method makes up described expression cassette, can be provided by the commercially available source of goods.(referring to for example, available from Stratagene, San Diego, the mammalian expression vector of CA and transfection reagent box).For example, method according to Rosengart etc., use the adenovirus expression carrier of VEGF expression cDNA, with the pig endothelial progenitor cells of VEGF (VEGF) gene transfection purification (" be used for the treatment of I phase of the angiogenesis gene therapy of the adenovirus vector that gives VEGF expression 121 cDNA in the direct cardiac muscle of coronary heart disease test assessments in six months ", Six-month assessment ofa phase I trial of angiogenic gene therapy for the treatment of coronaryartery disease using direct intramyocardial administration of an adenovirusvector expressing the VEGF121 cDNA; Ann.Surg.230 (4): 466-470,1999, include this paper in as a reference).In this embodiment, the source of described mammalian cell can be from body, allochthonous or xenogeneic.In case transfection contain the foreign DNA of required gene or rna expression box and make described cytogenetics change, the tissue culture technique of available standards is cultivated described cell.The cell sample of available standards technology required gene of frozen expression justacrine in liquid nitrogen.Before use, the tissue culture technique of available standards regrows refrigerated cell.Mammalian cell with hereditary change when implanting described device gives the patient at the implant site topical administration or through intravenous or intra-arterial, preferably gives after the medical treatment device of implanting described coating.Transformant also can comprise labelling or the reporter gene that gives to be used for accurately detecting and differentiating before this cell of patient described cell.

Can on any tremulous pulse or vein, implement the method that the present invention treats angiopathy.The atherosclerosis that comprises any tremulous pulse in the scope of the invention, described tremulous pulse comprise tremulous pulse under coronary artery, the groin, aorta iliac artery, subclavian artery, Mesenteric artery and renal artery.The present invention also comprises the angiemphraxis of other type, and what for example dissecting aneurysm caused blocks.

The mammiferous method that treatment suffers from angiopathy comprises: the medical treatment device that applies is implanted described patient's organ or blood vessel, for example, implant under the situation of the support that applies in revascularization.In case enter in the body, endothelial progenitor cells is by identification and be trapped in conjunction with cellular antigens (for example mammalian cell of genetic modification) on the surface of support of described coating, or is trapped in the CFU-GM surface that is present on the described device coating by the combination of independent antibody or antibody and other part.In case CFU-GM is attached to substrate, the somatomedin on the described coating just promotes new bonded endothelial progenitor cells growth and differentiation and forms the ripe functional endothelial tissue of fusion at the surface of internal cavity of described support.Perhaps, before implanting described medical treatment device, can apply described medical treatment device by mammalian cell (for example endotheliocyte) natural at external use or genetic modification, these cells can be CFU-GM, stem cell or the mature endothelial cell of separation from blood samples of patients, bone marrow or blood vessel.In both cases, the functional cell that exists on the described medical treatment device surface of internal cavity can produce required or through engineered function, for example suppresses or prevents neointimal hyperplasia and thrombosis.

Endotheliocyte

In some embodiments, according to Jaffe etc. (J.Clin.Invest., 52:2745-2757,1973, this include in this paper as a reference and be used for test) method, can obtain human umbilical vein's endotheliocyte (HUVEC) from people's umbilical vein.In brief, handle the cell of peeling off from blood vessel wall with collagenase, put into the tissue culture flasks that applies with gelatin, in the M199 culture medium of Hepar Sus domestica element, 20 mcg/ml endothelial cell growth supplement (ECGS) and the glutamine of the hyclone that contains 10% low endotoxin, 90 mcg/ml preservative frees, cultivate.

Can (be used for the separation of the endothelial progenitor cells of inferring of angiogenesis according to people's such as Asahara method, Isolation of putative progenitor endothelial cells for angiogenesis, Science.275:964-967,1997, include this paper in as a reference) from human peripheral, separate and obtain endothelial progenitor cells (EPC).The magnetic bead that is coated with the antibody of anti-CD34 is hatched with the isolating human peripheral liquid of process component.Through after hatching, the cell of elution of bound, with its be incubated at the EBM-2 culture medium (Clonetics, San Diego, CA) in.Perhaps, can adopt the enrichment medium partition method to separate these cells.In brief, obtain peripheric venous blood from the volunteer, adopt density to separate and obtain mononuclear cell, these cell inoculations are being coated with (Becton Dickinson) on the cultivation slide of fibronectin, the EC basal medium-2 (EBM-2) that replenishes 5% hyclone, people VEGF-A, human fibroblastic growth factor-2, human epidermal growth factor, insulin-like growth factor-i and ascorbic acid (Clonetics) in cultivation.Make endothelial progenitor cells growth 7 days, per 48 hours replacing culture medium.Selecting plain fluorescent antibody to carry out cell by anti-CD45, CD34, CD31, VEGFR-2, Tie-2 and E-identifies.

In another embodiment, can adopt conventional method, with any expression cassette that contains any following clone gene mammalian cell is carried out transfection, described clone gene can contain and is coded in uncommon specific marker molecule in the circulating cells (for example prostate specific antigen or osteocyte antigen), but and also expression of peptides and/or protein, for example platelet derived growth factor (PDGF), fibroblast growth factor (FGF) or nitricoxide synthase (NOS) etc.(referring to, for example available from Stratagene, San Diego, the mammalian expression vector of CA and transfection reagent box).For example, method according to Rosengart etc., adopt the adenovirus expression carrier of VEGF expression cDNA, with the pig endothelial progenitor cells of VEGF (VEGF) transfection purification (" be used for the treatment of I phase of the angiogenesis gene therapy of the adenovirus vector that gives VEGF expression 121 cDNA in the direct cardiac muscle of coronary heart disease test assessments in six months ", Six-month assessment of a phase I trial ofangiogenic gene therapy for the treatment of coronary artery disease usingdirect intramyocardial administration of an adenovirus vector expressingthe VEGF121 cDNA; Ann.Surg.230 (4): 466-470,1999, include this paper in as a reference).

Antibody

Can prepare the monoclonal antibody (" secretion pre-determines the continuous breeding method of the fused cell of specific antibody " that adopts in the method for the invention according to the standard technique of Kohler and Milstein, Continuouscultures of fused cells secreting antibody of predefined specificity, Nature, 265:495-497,1975, include this paper in as a reference), perhaps can be directly obtain be used for the monoclonal antibody of the inventive method from commercially available source.Endotheliocyte can be used as the original monoclonal antibody that produces anti-surface endothelial cell antigens of immunity.

HUVEC or purified endothelial progenitor cells can be injected into the monoclonal antibody that mice or rat prepare anti-endotheliocyte.Through after the sufficiently long time, put to death mice, get its splenocyte.Make the immortality cell by splenocyte being blended in myeloma cell or lymphoma cell, merge and in containing nonionic surfactant (for example Polyethylene Glycol), carry out usually.Make gained comprise that the cell of amalgamation hybridoma grows in selective medium (for example HAT-culture medium), and use the limiting dilution condition that the cell of survival is grown in this culture medium.Cell grows in the suitable container (for example microtiter well), and screening has required specificity in the supernatant, the monoclonal antibody that can react with endotheliocyte antigen.

The existing multiple technology that can be used for improving the monoclonal antibody productive rate, for example: hybridoma is injected into the mammalian hosts intraperitoneal of accepting these cells, gathers in the crops ascites then.In the time from ascites, can not collecting the monoclonal antibody of capacity, can from this host's blood, gather in the crops antibody.Thereby existing multiple can be used for separating with monoclonal antibody purification make the method that does not contain other protein or pollutant in the monoclonal antibody.

Scope of the present invention also comprises the useful binding fragment of antibody (for example anti-endotheliocyte monoclonal antibody), for example the Fab of the monoclonal antibody of these anti-endotheliocytes, F (ab ') ₂Can obtain described antibody fragment by routine techniques.For example, can prepare useful binding fragment by carrying out the peptide enzymic digestion with papain or pepsin antagonist.These fragments can be used separately, perhaps unite use with the antibody and the fragment thereof of its origin antibody or other type.

Antibody of the present invention can be Mus source property IgG antibody-like; Yet this does not become restriction.Specific antibody, for example above-mentioned antibody is with those antibody suitable with its function, no matter be Mus source property, mammal (comprising the humanized), or other sources, or their combination, all be included in the category of the present invention, also comprise other antibody-like that contains isotype, for example IgM, IgA, IgE etc.These antibody capable specific recognition and with high-affinity in conjunction with the target antigen on the target cell membrane, no matter be that this target antigen is on the natural molecule or on genetically engineered antigen.With regard to antibody, term " on the function quite " is meant two kinds of different antibody same antigen site on the conjugated antigen separately, and in other words, described antibody competition is in conjunction with identical antigen.Described antigen can be positioned on the identical or different molecule.

In one embodiment, can adopt can with surface endothelial cell antigens (for example, CD34) reaction monoclonal antibody and/or its fragment.Proved attached to the anti-CD34 monoclonal antibody on the solid phase carrier and can catch endothelial progenitor cells in the human peripheral.After catching, these CFU-GM can be divided into endotheliocyte.(Asahara etc., 1997, " being used for the separation of the endothelial progenitor cells of inferring of angiogenesis ", Isolation of putativeprogenitor endothelial cells for angiogenesis, Science 275:964-967.) the anti-CD34 monoclonal antibody that produces of hybridoma can available from U.S. typical organization collect the center (American TypeTissue Collection, Rockville, MD).In another embodiment, used can with the monoclonal antibody of surface endothelial cell antigens (for example VEGFR-1 and VEGFR-2, CD133 or Tie-2) reaction.In the embodiment that uses genetically-altered cells, available and mentioned above similar mode, adopt standard technique to produce anti-described antibody, after applying substrate, it is applied on described medical treatment device and the surface that blood contacts through genetically engineered gene outcome.

Also can use can with separate from the polyclonal antibody of accepting the homozoic anti-endotheliocyte phase reaction that this medical treatment device implants.

Support

Term " support " in this article refers to when insertion or implantable intravascular inner chamber, can enlarge any medical treatment device of intravascular space cross section.Term " support " comprising: stainless steel or other the alloy system commercial stents that applies with method of the present invention; Support through covering for example covers with PTFE or ePTFE.In one embodiment, comprise that dermal delivery treatment coronary occlusion or sealing spleen, carotid artery, bone portion are with Tui popliteal portion blood vessel otch or aneurysmal support.In another embodiment, described stent delivery is gone into the vein blood vessel.Described support can be made up of polymer or hardware, is coated with the substrate that contains antibody and chemical compound (for example somatomedin) on it.For example, can adopt the deformable wire support, as authorize disclosed support in the United States Patent (USP) 4,886,062 of Wiktor, this patent is included this paper in as a reference in full with it.Also can use elastic polymeric material self expandable support (self-expanding stent), for example name is called " inner chamber medicament elution prothesis ", the United States Patent (USP) 5 of IntraluminalDrug Eluting Prosthesis, 871,535 and disclosed International Patent Application WO 91/12779 in the support that disclosed, include these patents in this paper in full as a reference with it.Can use United States Patent (USP) 6,432, other support that is disclosed in 132 and 6,821,292 is included these patents in this paper as a reference in full with it.Also can use following material manufacture support: rustless steel, polymer, Ni-Ti, tantalum, gold, platinum-iridium, cobalt-base alloys or Elgiloy or MP35N and other iron-bearing materials.To prop up to be placed on the conduit and be delivered to therapentic part, support be discharged from conduit, and make described support expansion be direct contact blood vessel at this position by body cavity.In another embodiment, described support comprises Biodegradable scaffold (H.Tamai, coronary stent handbook, Handbook of Coronary stents, 297 pages, the 3rd edition, PW Serruys and MJBKutryk, Martin Dunitz (2000).Skilled in the art will recognize that and antibody of the present invention, somatomedin and substrate can be used with other self expandable support Design thing (for example elastic metal rack design thing).

Synthetic graft

Term " synthetic graft " is meant that with biocompatibility feature anyone produces and repairs complex.In one embodiment, described synthetic graft can be used polyethylene terephthalate (Dacron

, PET) or politef (Teflon

, ePTFE) preparation.In another embodiment, described synthetic graft is made of the biocompatible foam body of polyurethane, crosslinked PVA hydrogel and/or hydrogel.In another embodiment, synthetic graft is by netted Merlon urethanes (polycarbonate urethane) internal layer and the outer formation of netted polyethylene terephthalate.Those skilled in the art will know that and covering component of the present invention (for example antibody, somatomedin and substrate) can be used with the synthetic graft of any biocompatibility.(Bos etc., 1998, small-bore blood vessel repair materials: present situation, Small-Diameter Vascular Prostheses:CurrentStatus, Archives Physio Biochem.106:100-115 includes this paper in as a reference).Synthetic graft can be used for, for example end-the end of blood vessel, end to side, side-end, side-side or tube chamber are interior and anastomosis of blood vessel, or are used for the shunting of diseased vessel section, for example as the abdominal aortic aneurysm device.

Substrate

(A) Synthetic material---the described substrate that is used to cover support or synthetic graft can be selected from synthetic material, for example: biocompatible foam body or hydrophilic glucosan, for example Sensor Chip CM 5 of polyurethane, block polyurethane-urea/heparin, poly--L-lactic acid, cellulose esters, Polyethylene Glycol, crosslinked PVA hydrogel, hydrogel.

(B) Naturally occurring material---described substrate can be selected from naturally occurring material, for example: collagen, fibronectin, vitronectin, elastin laminin, laminin, heparin, fibrin, cellulose and carbon.For the basic demand of substrate is to have enough elasticity and pliability does not rupture on the contact surface of support or synthetic graft to guarantee it.

(C) Fullerene---described substrate also can comprise fullerene (term " fullerene " comprises multiple fullerene molecule).Fullerene is carbon-cage (carbon-cage) molecule.The excursion of the carbon in the fullerene (C) molecular number is C ₂₀-C ₁₅₀Fullerene is according to method well known to those skilled in the art, produces by at high temperature making carbon or carbon containing class substance reaction; For example, by carbon being carried out laser vaporization, in electric arc, heat carbon or generating the hydrocarbons that burns in the flame at carbon black.(authorize the United States Patent (USP) 5,292,813 of Patel etc.; Authorize the United States Patent (USP) 5,558,903 of Bhushan etc., its announcement is included this paper in as a reference in full with it).In all cases, carbonaceous deposit or flue dust have all been produced.Can from this flue dust, obtain different fullerenes by extracting with The suitable solvent (for example toluene).Separate fullerene with known method, especially by high performance liquid chromatography (HPLC).Can synthesize or from Dynamic Enterpri ses, Ltd. (Berkshire, England or SouthernChemical Group, LLC, Tucker, Georgia) or Bucky USA (Houston Texas) buy fullerene.

Available diverse ways with the fullerene deposition from the teeth outwards, described method comprises: distillation, laser vaporization, sputter, ion beam, spraying, dip-coating, roller coating or brushing are (as United States Patent (USP) 5,558, disclose in 903, include this paper in full in as a reference with it), or the derivatization by rack surface.

A key character of fullerene is that they can form " activated carbon ".The electronic structure of fullerene is eclipsed π rail system, thereby a plurality of bonding electrons is present in the surface around molecule jointly.(Chemical andEngineering News, Apr.8, include this paper in as a reference by 1991, the 59 pages).As the form with active carbon, fullerene demonstrates the basic Van der Waals force to weak interaction.The absorption property on fullerene surface makes it have the extra modification of guiding specific cell membrane interaction.For example, can be adsorbed onto the fullerene surface with having the specific molecular of selective binding in the chemical property of the cell membrane of particular cell types or specific cell membrane component (for example agglutinin or antibody).Can operate (for example to produce the different cell types of selective binding the adhesion of fullerene surface different molecular, endothelial progenitor cells, endotheliocyte, fibroblast, former generation explant or the T-cell subsets) the surface, for example authorize the United States Patent (USP) 5 of Richmond etc., 310,669, its announcement is included this paper in as a reference in full with it; Stephen R.Wilson, the biological characteristics of fullerene, Biological Aspects ofFullerenes, Fullerenes:Chemistry, Physics and Technology, volumes such as Kadish, John Wiley﹠amp; Sons, NY 2000, include this paper in as a reference.

Fullerene also can form the nanotube that can mix other atom or molecule.(its announcement is included this paper in as a reference for Liu etc., Science 280:1253-1256 (1998)).Synthetic and the preparation method of CNT is well-known in the art.(authorize the United States Patent (USP) 5,753,088 of Olk etc. and authorize the United States Patent (USP) 5,641,466 of Ebbsen etc., both announcements are all included this paper in as a reference in full with it).Also can the inboard of CNT will be mixed such as protein-based molecule.For example, after cutting the nanotube two ends, available enzyme (Zn for example ₂Cd ₂-metallothionein, cytochrome C and C3 and beta-lactamase) filled with nanotubes.(Davis etc., Inorganica Chim.Acta 272:261 (1998); Full Sci.Tech.5 (4) such as Cook: 695 (1997), both all include this paper in as a reference).

Also can use three-dimensional fullerene structure body.Include this paper United States Patent (USP) 5 of authorizing Mirkin etc. as a reference in full in, disclosed the 3-dimensional multi-layered fullerene structure body that on substrate surface, forms by the following method in 338,571: (i) fullerene is carried out chemical modification and form material (bond-forming species) to produce key; (ii) chemical treatment is carried out on the surface of base material and is formed material so that key to be provided, described material be enough to solution in have the fullerene covalent bond that key forms material; And (iii) modified fullerene solution is contacted with treated substrate surface, be covalently bonded in the Fullerene layer of treated substrate surface with formation.

(D) Substrate is put on medical treatment device

Described substrate should be able to be securely attached to the medical treatment device surface of (comprising support or synthetic graft).In one embodiment, this realizes by applying successive thin-layer matrix.Perhaps, can be only with on the outer surface that antibody and somatomedin are applied in intravascular space directly contacts.Apply dissimilar substrate pantostrats serially.After being applied over substrate on the support, can be with described antibody covalently or non-covalently in conjunction with being coated on the substrate.

In order to cover medical treatment device, support for example, available moderately viscous matrix liquid solution impregnation or spray described support.After having applied each layer, under applying, make the support drying before one deck.In one embodiment, the gross thickness of paint sample matrix coating is no more than 100 microns.

In one embodiment, the surface of described medical treatment device at first through functionalization, has been added the rack surface of hypothallus for for example then.Antibody and other coating component (for example somatomedin) be coupled to stromal surface thereafter.At this on the one hand, the technology that substrate is applied over such as rack surface can produce functional chemical group.For example, described chemical group can be amino, it can be with the functional group reactions of polymer with fixing as discerning and the substrate intermediate layer of the carrier of the part (for example antibody, peptide and/or somatomedin) of acquisition target cell.

In another embodiment, can prepare suitable substrate coating solution in the following way: under aseptic condition, with 480 milligrams of (mg) pharmaceutical carriers, for example gather-D, the L-lactide is (as R203 available from Boehringer Inc., Ingelheim Germany) is dissolved in 3 milliliters of (ml) chloroform.Yet, can use blood-and the tissue-compatibility (biocompatibility) and solubilized, dispersion or emulsive biodegradability (or abiotic degradability) substrate in principle, as long as can be on medical treatment device after using dry quickly for from adhering to lacquer sample or coating sample coating.

For example, those of ordinary skill in the art knows usable fibers albumen coating support.Fibrin is condensed authorizing to have disclosed by Fibrinogen is contacted with thrombin in the United States Patent (USP) 4,548,736 of Muller etc. (it discloses in full and includes this paper in as a reference).Preferably, fibrin in the fibre-bearing albumen support of the present invention contains the XIII factor, and in condensing, there is calcium, (as authorize in the United States Patent (USP) 3,523,807 of Gerendas disclose, its announcement is included this paper in as a reference in full, or such as disclosed european patent application 0366564 announcement, its announcement is included this paper in as a reference in full), to improve the mechanical performance and the biological stability of implanting device.In this embodiment,, be used to prepare fibrinous Fibrinogen of the present invention and thrombin and derive from and the animal or human that will implant animal or human's identical type of this support for fear of any interspecies immunity reaction (for example anti-cattle of people).The fibrin product of producd fibers extract of protein fine film form in the following manner: blended Fibrinogen and thrombin are poured into thin film, from described thin film, remove moisture by the semipermeable membrane diafiltration then.(its announcement is included this paper in as a reference in full) disclosed base material (preferably have highly porous or thrombin or Fibrinogen are had high-affinity) contacted with thrombin solution with fibrinogen solution in european patent application 0366564.The result is by fibrinogenic polymerization, forms the fibrin layer on the surface of medical treatment device.The multi-layer fiber albumen that applies with this method can provide the fibrin layer of any desired thickness.Perhaps, can fibrin be condensed, be ground into powder then, this powder and mixed being incorporated in of water are embossed into required form (United States Patent (USP) 3,523,807) in the heated mold.Can produce the fibrin that is shaped and the stability that obtains to improve by fibrin is contacted with fixative (for example glutaraldehyde or formaldehyde).Can be used for preparation and form fibrinous these methods being used for the present invention with well known by persons skilled in the art with other method.

If apply described synthetic graft with collagen, prepare collagen and the method that forms coating is known, as authorize the United States Patent (USP) 5,851 of Weadock etc., disclose in 230, its announcement is included this paper in as a reference in full.This patent has been described the method that is used for applying with collagen synthetic graft.Be used for the method that collagen adheres to porous graft base material generally included the collagen dispersion liquid is applied over base material, make it dry and repeat this process.The preparation of collagen dispersion is normally by being mixed into insoluble collagen (about 1-2 weight %) dispersion liquid of acid pH (pH is 2-4).Usually described dispersion liquid is gone in the graft inner chamber with injector to inject, and rub to press with hands and make the collagen serosity cover whole inner surface area.Remove excessive collagen serosity from one of two openings of described graft.Repetitive coatings and drying steps are for several times to provide enough processing.

In another embodiment, apply support or synthetic graft with amorphous carbon.At United States Patent (USP) 5,198, in 263 (its announcement is included this paper in as a reference in full) described a kind of be used for through fluorinated gas or contain other halogen gas in the presence of, the method for producing height ratio low temperature depositing amorphous c film.The deposition of carrying out according to the method for this invention can be lower than under 100 ℃ the temperature (comprising ambient room temperature), and, chemical vapor deposition process auxiliary with radio frequency, plasma carries out.The amorphous c film of using method generation of the present invention can adhere to the base material of numerous species well, and described base material for example comprises: glass, metal, quasiconductor and plastics.

Fullerene molecule is combined with the reactive amino group site of amido polymer with to form fullerene-support, and containing amino polymer can be by United States Patent (USP) 5,292, and 813 (its announcement is included this paper in as a reference in full) are finished.The chemical modification of carrying out with this mode can make that fullerene directly mixes in the support.In another embodiment, can fullerene be deposited on the surface of support or synthetic graft as described above.(referring to, authorize the WO 99/32184 of Leone etc., its announcement is included this paper in as a reference in full).Fullerene (C for example ₆₀) also can be attached to (Yamago etc. on the stainless steel surfaces by epoxy bond, " organic property fullerene forms the chemically derived of reaction by oxidation, reduction and C-O and C-C bonding ", Chemical Derivatization of Organofullerenes through Oxidation, Reduction and C-O and C-C Bond FormingReactions, J.Org.Chem., 584796-4798 (1998), its announcement is included this paper in as a reference in full).This adheres to and is by finishing with the covalent bond of oxygen.Described chemical compound and coupling scheme can (BuckyUSA, Houston Texas) buy from BuckyUSA..

(E) Part (for example antibody, peptide and/or somatomedin) is added substrate---can promote the adherent antibody of endothelial progenitor cells and can promote the somatomedin of cell growth and differentiation covalently or non-covalently to be incorporated in the substrate.Can be in the following way with part coating (for example antibody, antibody fragment, hormone, peptide, somatomedin and/or like that) doped matrix layer: part is mixed with matrix coating solution, then described solution is applied on the surface of device.In some embodiments, with antibody, fragment or their combination and/or somatomedin outermost surface attached to the substrate that is applied over the device surface of internal cavity, thereby make part (for example antibody) give prominence on this surface and can contact, and keep their affinitys target cell with blood circulation.In these embodiments, can adopt standard technique that described part (for example antibody) is applied on the stromal surface.

In one embodiment, described antibody adding is contained in the solution of substrate.For example, with the concentration of 500-800mg/dl, the Fab fragment and the solution that contains the human fibrinogen of anti-CD34 monoclonal antibody are hatched jointly.Should understand the segmental concentration of anti-CD34Fab can be different, and those of ordinary skill in the art need not just can determine optium concentration through undue experimentation.Support is added in the Fab/ fibrin mixture, add spissated thrombin (concentration is at least 1000U/ml) again and come activated fiber albumen.Gained is contained the segmental polymer fiber mixed liquid of protein of Fab directly add substrate, on the surface of support or synthetic graft, be pressed into thin film (being thinner than 100pm).In fact, before applying support or synthetic graft, in this way can antibody or antibody fragment doped matrix solution with any kind in.

For example, in another embodiment, the whole antibody and the somatomedin that have or do not have antibody fragment are that covalent coupling is in substrate.In one embodiment, by heterogeneous or homogeneity bifunctional linker molecule described antibody and one or more somatomedin are covalently attached to substrate.As used herein, term " connect (tethered) " is meant by linkers the antibody covalent coupling in substrate.Adopt using of linkers related to the present invention to be usually directed to before substrate is attached to support, with the linkers covalent coupling in described substrate.After substrate, linkers provides many functional activity groups that can be used for one or more antibody of covalent coupling for substrate at covalent coupling.In an embodiment of this embodiment, Figure 1A provides by the link coupled example of corsslinking molecular.Endotheliocyte 1.01 is incorporated into antibody 1.03 by surface antigen 1.02.Described antibody is connected in substrate 1.05-1.06 by corsslinking molecular 1.04.Substrate 1.05-1.06 is attached to support 1.07.Described linkers can directly be connected on the substrate and (that is, pass through carboxyl), or the coupling chemical reaction by knowing, for example esterification, amidation and acylation.Described linkers can be two or the triamido functional compound, and they are connected with substrate by direct formation amido link, and provide can with the amido functional group of antibody response.For example, described linkers can be the polyamines functional polymer, as polymine (PEI), polyene propyl amides (PALLA) or Polyethylene Glycol (PEG).Can (Birmingham Alabama) have bought the scheme of multiple polyethyleneglycol derivative (for example, mPEG-succinyl imidodicarbonic diamide base propionic ester or mPEG-N-N-Hydroxysuccinimide) and covalent coupling by Shearwater Corporation.(also can referring to, Weiner etc., the Polyethylene Glycol sept is for the influence by the immobilized antibody capture antigen, Influence of a poly-ethyleneglycol spacer on antigen capture byimmobilized antibody, J.Biochem.Biophys.Methods 45:211-219 (2000) includes this paper in as a reference).Be understood that the selection of concrete coupling agent can be depending on the type of used antibody, and this type of selection need not can make through too much examination.Also can use these mixture of polymers.These molecules contain multiple drapability amido functional group, and these functional groups can be used for the surface and fix one or more antibody, peptide, protein, hormone and other coating composition.

In one embodiment, antibody can be attached to the C that directly is deposited on the rack surface ₆₀Fullerene layer.Cross-linking agent can be covalently attached to fullerene.Make antibody be attached to cross-linking agent then, and then adhere to support.Figure 1B provides by fullerene C ₆₀Link coupled example.Endotheliocyte 2.01 is incorporated into antibody 2.03 by cellular antigens 2.02, and then covalently or non-covalently is incorporated into substrate 2.04.Substrate 2.04 is passed through C ₆₀2.05 covalent coupling is in support 2.06.

Micromolecule of the present invention can comprise synthetic or naturally occurring molecule or the peptide that is used to replace antibody, antibody fragment, somatomedin etc.For example, agglutinin is a kind of naturally occurring non-immunogenicity sugar binding peptide.(Schatz etc. 2000 for the agglutinin antigen of endothelial cell specific (Ulex Europaeus Uea 1), people's endometrium endotheliocyte: tissue factor separates with 1 type blood plasminogen activator inhibitor, characterized and inflammation mediated expression, Human Endometrial Endothelial cells:Isolation, Characterization, and Inflammatory-Mediated Expression of Tissue Factor andType 1 Plasminogen Activator Inhibitor., Biol Reprod 62:691-697), for example alternative cell surface that is incorporated into endothelial progenitor cells.

Createed synthetic " micromolecule " of the different cell surfaces of energy targeting, protein, glycoprotein, polysaccharide and receptor.The surface molecular that these molecular energy selective binding are specific, and can the specific cell type of targeting, for example endothelial progenitor cells.Synthetic micromolecule can be discerned endothelial cell surface labelling, for example VEGF.SU11248 (SugenInc.) (Mendel etc., 2003, " with vascular endothelial growth factor receptor and platelet derived growth factor receptor is a kind of novel tyrosine kinase inhibitor SU11248 anti-tumor activity in vivo of target: the mensuration of pharmacokinetics/pharmacodynamics mutual relation ", In vivo antitumor activity of SU11248, a novel tyrosine kinase inhibitor targeting vascular endothelial growthfactor and platelet-derived growth factor receptors:determination of apharmacokinetic/pharmacodynamic relationship, Clin Cancer Res.Jan; 9 (1): 327-37), PTK787/ZK222584 (Drevs J. etc., 2003, " receptor tyrosine kinase: some new main targets of anticancer disease treatment ", Receptor tyrosine kinases:the maintargets for new anticancer therapy, Curr Drug Targets.Feb; 4 (2): 113-21) and SU6668 (Laird, AD etc., 2002, " SU6668 is causing the decline of rapid apoptosis of the intravital tumor vessel of mice system and tumor to the inhibitory action of Flk-1/KDR and PDGFR-β in vivo ", SU6668 inhibitsFlk-1/KDR and PDGFRbeta in vivo, resulting in rapid apoptosis of tumorvasculature and tumor regression in mice.FASEB J.May; 16 (7): 681-90) be micromolecule in conjunction with VEGFR-2.

Another subclass synthesized micromolecule of targeting endothelial cell surface is α (v) β (a 3) integrin inhibitors.SM256 and SD983 (Kerr JS. etc., 1999, " new small molecule material α v integrates plain antagonist: compare with the anticancer disease effect of known various angiogenesis hormone class mortifiers ", Novel small molecule alpha vintergrin antagonists:comparative anti-cancer efficacy with knownangiogenesis inhibitors.Anticancer Res Mar-Apr; 19 (2A): 959-68) being can targeting and be incorporated into α on the endothelial cell surface (the v) synthesized micromolecule of β (3).

The invention provides a kind of drug delivery system, it comprises: the medical treatment device of coating, for example support, stent graft, cardiac valve, conduit, blood vessel are repaired screen, artificial heart, external and built-in left ventricular assist device (LVADs) and synthetic blood vessel graft, they can be used for treating disease, these diseases comprise: tumor and angiopathy, for example: restenosis, atherosclerosis, thrombosis, angiemphraxis etc.In one embodiment, the coating on the medical treatment device of the present invention comprises: the substrate of biocompatibility; At least a antibody, antibody fragment or their combination; And/or at least a chemical compound, as part or therapeutic agent (as estradiol, angiogenesis factor, FGF etc.).

In one embodiment, transgenic cell is mixed with at least a metastatic gene, and described metastatic gene can import described cell by the genetic method based on virus or non-virus.At least a medicine of described metastatic gene codified, but continuous expression or expression under the inducing that stimulates.In one embodiment, described medicine can be hormone, peptide, protein etc.Also have at least a antigen on the surface of described transgenic cell, described antigen can be coated on the antibody of surfaces of medical devices and discern and combination.

As used herein, " antibody " is meant antibody or antibody fragment, or antibody and segmental combination, and they can be monoclonal antibody, polyclonal antibody, chimeric antibody or humanized antibody.Antibody fragment of the present invention comprises the antibody fragment (for example macromole and micromolecule) of any size, and these fragments keep the identification identical with this antibody and in conjunction with the characteristic (Figure 1A, 1B and 11) of target antigen.

As used herein, " part " is meant can be in conjunction with the molecule of another kind of molecule (for example receptor on the mammalian cell).For example, part can be antibody, antibody fragment (Figure 1A, 1B, 11 and 17), cell adhesion molecule or basement membrane composition, and they can be discerned and in conjunction with specificity epitope on the target cell membrane or structure.In the embodiment of the mammalian cell that adopts hereditary change, be used for that part on the medical treatment device coating can be discerned through special the selection and in conjunction with by the gene outcome that foreign DNA produced that imports in the transgenic cell.

As used herein, " protein " is meant the amino acid polymer of any length.Described polymer can be straight or branched, can comprise modified aminoacid, also can between be inserted with non-aminoacid.Described polymer can be naturally occurring peptide, protein, or its modification and synthesized form, comprises it: bioactive fragment, derivant, congener, analogies and do not have function or dominant negative mutant.

Described medical treatment device can be the organ that is used for the implantation belt chamber or any device of body area, and it can include but not limited to: support, stent graft, synthetic blood vessel graft, cardiac valve, conduit, blood vessel is repaired screen, pacemaker, the pacemaker lead, defibrillator, in hole, the ovum garden patent (PFO) every closing device, vascular clamp, the vascular aneurysms dead lock, the hemodialysis graft, hemodialysis catheter, the chamber diverter, aortic blood tuberculation graft device or assembly, venous valve, suture, the vascular anastomosis folder, remain-type vein or ductus arteriosus, vagina vasorum and drug conveying mouth.According to the difference of device, described device can be made from a variety of materials.For example, support of the present invention can be made with rustless steel, Nitinol (NiTi) or evanohm.Synthetic blood vessel graft can be made with crosslinked PVA hydrogel, polytetrafluoroethylene (PTFE), expanded polytetrafluoroethyltoe (ePTFE), porous high density polyethylene (HDPE) (HDPE), polyurethane and poly terephthalic acid vinyl acetate.

Forming apparatus of the present invention biological compatibility of coating substrate comprises: synthetic material, for example polyurethane, block polyurethane-urea/heparin, poly--L-lactic acid, cellulose esters, Polyethylene Glycol, poly-ethyl acetate, glucosan and gelatin; Naturally occurring material, basement membrane components for example is as collagen, elastin laminin, tropoelastin, laminin, fibronectin, vitronectin, heparin, fibrin, cellulose; And amorphous carbon or fullerene etc.

In one embodiment, described medical treatment device comprises the biocompatible matrix that contains fullerene.In this embodiment, the carbon number of described fullerene can be about C ₂₀-C ₁₅₀, more particularly, described fullerene is C ₆₀-C ₇₀Fullerene of the present invention also can be arranged as nanotube on surfaces of medical devices.

The antibody that offers described medical treatment device coating comprise at least a can identification and in conjunction with the antibody of transgenic cell surface antigen, this antigen can be expressed and can be regulated the adhesion of described cell to surfaces of medical devices by exogenous gene or metastatic gene.Described antibody can be covalently or non-covalently attached in stromal surface, or is covalently attached to the outermost layer of the substrate that covers medical treatment device by linkers.Of the present invention this on the one hand, for example, described monoclonal antibody also can comprise Fab or F (ab ') ₂Fragment.

Described antibody can be discerned and the subject mammiferous antigen of combination butt joint specifically, and their specificity does not depend on cell line.In one embodiment, described antibody has specificity to people's endothelial progenitor cells surface antigen, and described surface antigen is for for example: CD133, CD14, CD34, CDw90, CD117, HLA-DR, VEGFR-1, VEGFR-2, Muc-18 (CD146), CD130, stem cell antigen (Sca-1), stem cell factor 1 (SCF/c-Kit part), Tie-2, HAD-DR and other antigen (anti--H-2K for example ^kAntibody).

In another embodiment, the coating of described medical treatment device comprises the aforesaid biocompatible matrix of one deck at least, and this substrate comprises the micromolecular outer surface that is used to adhere at least a natural or synthetic source for the treatment of effective dose.Described micromolecule can discern the transgenic cell surface antigen and with its interaction, thereby transgenic cell is fixed on the surface of device, and induce the expression of metastatic gene.Described micromolecule can for example from cellular component, as fatty acid, protein, nucleic acid, saccharide etc., and can interact with the transgenic cell surface receptor from various sources.In this embodiment of the present invention, the coating on the medical treatment device also can comprise chemical compound, for example with the bonded part of the coating that contains antibody.

Genetic method based on virus and non-virus all can be used for importing metastatic gene to produce transgenic cell.Transgenic cell of the present invention can be expressed the medicine of justacrine by the of short duration or stable metastatic gene coding that mixes.Also can be in conjunction with other metastatic gene to give its survival, selectivity and/or growth vigor.Can to various cells modify with produce non-regeneration or again propagation transgenic cell, these cells are for for example: endotheliocyte or granulocyte, comprise neutrophil cell, eosinophile granulocyte, basophilic granulocyte, mononuclear cell and lymphocyte or somatic cell, or the combination of these cells.Can be at the In vitro culture transgenic cell, it is collected and preserves.Can generate the transgenic cell that can produce various medicines by mixing different metastatic genes, to be used for different therapeutic purposes.Can pass through whole body or local approach, give transgenic cell with single or mixed cellularity group.At individual condition of illness, can give not commensurability transgenic cell with the not commensurability medicine of secretion.In one embodiment, the renewable endothelial progenitor cells of described transgenic cell.In another embodiment, can use based on the mode of sending of conduit or with two airbag inflation method (dual balloon inflation method) topical administrations and give the transgenic endothelial progenitor cells.

In one embodiment, transgenic cell also comprises other metastatic gene of expressing exogenous cell surface antigen, and these antigens can be coated on ground identification of described antibody specificity and the combination in the medical treatment device substrate.The expression of metastatic gene and the secretion of product can be to be recurred or activates inducibility promoter and temporary transient the generation at exogenous stimulation.

Therapeutic compound by metastatic gene coding of the present invention can be any molecule with required physiological action, it can be but is not limited to: defined protein-based, comprise that somatomedin, chemotactic factor and cytokine, part and receptor and other functional protein and nonprotein can secrete chemical compound.In one embodiment, therapeutic compound is the protein that is selected from down group: endothelial nitric oxide synthase (eNOS), VEGF (VEGF), the anti-inflammatory factor and inflammation regulatory factor.

Medicine, for example in the embodiment of the mammalian cell that adopts hereditary change, be to stimulate metastatic gene to express and the excretory chemical compound of target product, can be part or other composition in the described medical treatment device coating, they can and activate the downstream signal pipeline of extrachromosomal nucleic acid (for example import target cell in DNA construction) in conjunction with the transgenic cell surface antigen.In another embodiment, the metastatic gene of the mammalian cell of hereditary change is expressed and can be activated by for example part or medicine, and described part or medicine can be taken in by described transgenic cell and be expressed by inducibility promoter stimulated gene.In one embodiment, described part or medicine are the general administrations.In another embodiment, described part or medicine are to be coated in the substrate of implanting device and topical.

The invention provides the method that is used for the treatment of multiple disease, described disease can be but is not limited to: tumor, angiopathy and healing reaction.Described method relatively and the progress of prior art be as required various medicines are carried out target site send with aequum.

The invention provides a kind of method for the treatment of tumor and transfer thereof.In this embodiment, described metastatic gene codified (1) anti-angiogenesis, for example interferon (IFN), thrombospondin (TSP), angiostatin, Endostatin, oncostatin M (OSM) and Rho, they can suppress to generate as the new vessels of carrying out property of tumor growth precondition; Or (2) tumor suppressor protein, for example kinases (CDK) of the antibody of p53, Rb, E1, BRCA1, cell growth activator (for example somatomedin) or dominant negative mutant or cyclin dependence or cyclin, E2F, NFKB; Or the combination of these genes.In one embodiment, described metastatic gene can comprise the gene of the following material of encoding: for example, and prostacyclin and/or cyclooxygenase, α-CGRP, matrix metalloprotease and/or endothelial nitric oxide synthase.

As used herein, phrase " anti-angiogenesis " is meant the molecule that can suppress angiogenesis or angiogenic growth.

The present invention also provides the method that is used for the treatment of angiopathy.In one embodiment, a kind of method for the treatment of ischemic disease is provided, metastatic gene is used to the angiogenesis factor of encoding in the method, for example the antibody or the dominant negative mutant of the multiple-effect factor (pleiotrophin), angiogenesis factor, angiogenin, the plain stimulating factor of integration and/or anti-angiogenesis.

As used herein, phrase " angiogenesis factor " is meant the molecule that can stimulate angiogenesis or angiogenic growth.

In another embodiment, described invention is used for the treatment of atherosclerosis, restenosis, thrombosis, aneurysm or angiemphraxis.In this embodiment of the present invention, metastatic gene is used for eNOS or the VEGF that coding (a) promotes that endothelium is rebuild; Or (b) anti-inflammatory or inflammation regulatory factor, for example IFN-β, IFN-α, TGF-β or interleukin 10 (IL-10); Or (c) be used to suppress smooth muscle cell growth, migration or the differentiation inhibitors of neointimal hyperplasia; Or the combination of these genes.

The present invention also provides the engineered method that is used to induce healing reaction.In one embodiment, provide a kind of implanting device surface of internal cavity rapid induction in being placed in implantable intravascular target lesion to merge the method that endodermis forms, transgenic cell wherein is the endothelial progenitor cells of expressing eNOS, VEGF or the anti-inflammatory factor or inflammation regulatory factor.In this embodiment, compare with prior-art devices, the biocompatibility of medical treatment device of the present invention increases, can be deposited on the implant site of medical treatment device along surface of internal cavity by reducing or suppressing smooth muscle cell migration, smooth muscle cell differentiation and collagen, and reduce or suppress excessive neointimal hyperplasia and restenosis based on tissue.

In one embodiment, the method that is used for coated medical devices may further comprise the steps: one deck biocompatible matrix is applied over the surface of medical treatment device at least, wherein said biocompatible matrix can comprise at least-kind be selected from down the component of group: and polyurethane, block polyurethane-urea/heparin, poly--L-lactic acid, cellulose esters, Polyethylene Glycol, poly-ethyl acetate, polysaccharide (glucosan for example, gelatin), collagen, elastin laminin, tropoelastin, laminin, fibronectin, vitronectin, heparin, fibrin, cellulose and carbon and fullerene, and simultaneously or on described biocompatible matrix, apply at least a antibody and the optional a kind of chemical compound that can induce metastatic gene to express successively.

The present invention also provides a kind of method that is used for the treatment of disease, and described disease is for for example, mammiferous tumor, angiopathy and wound healing.The present invention includes medical treatment device is implanted in mammiferous blood vessel or the pipe, wherein said medical treatment device is coated with: (a) biocompatible matrix; (b) at least a antibody; (c) a kind of compositions randomly; Transgenic cell is imported the described mammal that needs described treatment, and randomly give chemical compound, wherein be coated on the antibody recognition in the medical treatment device substrate and be combined in the antigen of expressing on the transgenic cell surface, thereby described transgenic cell is fixed on the surface of substrate, and by by the activated described cellular expression that is fixed of chemical compound, described chemical compound is for for example medicine with at the excretory therapeutic gene product in appointment site by at least a medicine of metastatic gene coding.

The present invention also provides a kind of method that is used for the treatment of mammal medium vessels disease, and described method comprises: medical treatment device is implanted described mammiferous blood vessel or pipe, and wherein said medical treatment device is coated with: (a) biocompatible matrix; (b) at least a antibody; (c) a kind of compositions randomly; Transgenic cell is imported the described mammal that needs described treatment, and randomly give chemical compound, wherein be coated in the medical treatment device substrate antibody recognition and in conjunction with the antigen of only on transgenic cell film surface, expressing, thereby described transgenic cell is fixed on the surface of substrate.Described transgenic (hereditary change) cell also can comprise the hereditary material of at least a therapeutic gene product of encoding, and described gene outcome can be continuous expression or expresses when signal (chemical compound that for example comprises hormone and peptide) activates.

Transgenic cell of the present invention can comprise at least a effable metastatic gene, this gene can be used for coding (but being not limited to): (1) somatomedin, comprise its family member: platelet derived growth factor (PDGF) for example, transforming growth factor (TGF), endothelial cell growth factor (ECGF) (EGF), fibroblast growth factor (FGF), insulin like growth factor (IGF), VEGF (VEGF), heparin-bounding somatomedin, the deutero-somatomedin of hepatocarcinoma (HDGF), hepatocyte growth factor/dispersion factor (HGF), placental growth factor (PIGF), platelet-derived endothelial cell growth factor (ECGF) (PD-ECGF), stem cell factor (SCF), and their other albumen form; (2) chemotactic factor: for example CXC family, CC family, C family, and their other albumen form; (3) cytokine: for example adam protein (ADAM), annexin V, B7﹠amp; The CD28/CTLA-4 receptor family, bone morphogenetic protein (BMP), caspase, CD44, CD44H, endothelin-1 (ET-1), eph, erythropoietin (Epo), intercellular adhesion molecule-3/CD50 (ICAM-3), macrophage stimulating protein (MSP), matrix metalloproteinase (MMP), neurotrophic factor, endothelial nitric oxide synthase (eNOS), NKG2D, PECAM-1 (PECAM-1/CD31), the multiple-effect factor/midkine (PTN/MK), TfR (sTfR), protection peptide (hedgehog peptide), STAT, stem cell labeling, Th1/Th2, thrombopoietin (Tpo), tnf family cytokines, VCAM-1/CD16, the non-specific inhibitive factor β of monoclonal (MNSF β), 6Ckine (SLC), B-lymphocyte chemotactic inducer (BCA-1/BLC), leukaemia inhibitory factor, the peptide of the neutrophil activation of monocyte derived (GRO), and their other albumen form; (4) participate in other functional protein of signal conduction adjusting, Cycle Regulation, cell division and/or cell differentiation, they are for for example: part, receptor, phosphorylase, kinases, transcription factor, and their other albumen form.

In one embodiment, be used for anti-angiogenesis of the present invention for for example: interferon (IFNs), thrombospondin (TSP), angiostatin and Endostatin, oncostatin M (OSM), integrate the antibody of the plain blocker of arranging, inhibitors of metalloproteinase, endotheliocyte phosphorylation inhibitor, the dominant receptor that is used for blood vessel generation derivant, blood vessel generation derivant, the protein by the alternate manner effect, and their other albumen form.Other angiogenesis factor comprises angiogenesis factor, angiogenin, the plain stimulating factor (for example Del-1) of integration, and their other albumen form.

Be used for other somatomedin of the present invention for for example: the multiple-effect factor, midkine, VEGF family (comprises VEGF-2, VEGF-C and VEGF-D), FGF family (comprises FGF-1, FGF-2, FGF-5 and FGF-18), the deutero-somatomedin of hepatocarcinoma (HDGF), hepatocyte growth factor/dispersion factor (HGF), endothelial cell growth factor (ECGF) (EGF) family member (comprises transforming growth factor, EGF and TGF-α-HIII and platelet derived growth factor (PDGF) (comprise AA, AB and BB hypotype).

Experimental example

The present invention will be described in following tentative detailed description part.These following parts are in order to understand the present invention, rather than and should not be construed as the scope of the invention that limits by any way by described in the claims behind the embodiment.

Embodiment 1

The phenotype of endothelial progenitor cells

Separate endothelial progenitor cells (EPC) by the following method: by CD34+ magnetic bead partition method (Dynal Biotech) or enrichment medium partition method (Asahara T as describing recently, Murohara T, Sullivan A etc., " feeder vessels generates the separation method of the endothelial progenitor cells of inferring of usefulness ", I solation of putativeprogenitor endothelial cells for angiogenesis, Science 1997; 275:964-7).In brief, obtain peripheric venous blood from healthy male volunteers, and by density gradient centrifugation acquisition mononuclear cell component, then with this cell inoculation (Becton Dickinson) on the cultivation slide that is coated with people's fibronectin, culture medium be EC basal medium-2 (EBM-2) (Clonetics), wherein be supplemented with 5% hyclone, people VEGF-A, human fibroblastic growth factor-2, people's endothelial cell growth factor (ECGF), insulin-like growth factor-i and ascorbic acid.Make EPC growth 7 days, per 48 hours replacing culture medium.The results are shown among Fig. 2 A and the 2B of these tests.Fig. 2 A and 2B have shown that anti-CD34 isolated cells seems more seemingly spindle sample, and this just shows that these cells just are being divided into endotheliocyte.

Measure the phenotype of EC by immunohistochemical method.In brief, EPC (Sigma) is fixed 10 minutes with 2% paraformaldehyde (PFA) phosphate buffered solution (PBS) (Sigma), with PBS washing 3 times, and with the dyeing of different EC specific marker: rabbit human VEGFR-3 resistant-2 (Alpha Diagnostics Intl.Inc.), mouse-anti-human T ie-2 (Clone Ab33, Upstate Biotechnology), mouse-anti people CD34 (Becton Dickinson), EC-agglutinin (Ulex Europaeus Ueal) are (Sigma) and mouse-anti people 8 factors (Sigma).Make cells contacting Fluorescein isothiocyanate (FITC) bonded two resist the existence of verifying antibody.Iodate third ingot (PI) is used as the nuclear labelling.These tests the results are shown in Fig. 2 C-2G.Fig. 2 C shows has VEGFR-2 to express after 24 hours in the culture, this has just confirmed that described cell is an endotheliocyte.Fig. 2 D and 2F are depicted as 7 days and hatch the nuclear staining of back in conjunction with cell, and Fig. 2 E and 2G are depicted as the cell of using the link coupled anti-Tie-2 antibody staining of FITC in the same visual field.

ENOS mRNA is carried out reverse transcriptase-polymerase chain reaction (rt-PCR) measure the ability that EPC expresses endothelial nitric oxide synthase (eNOS, a kind of EC function sign).EPC was grown 7 days in the EBM-2 culture medium, use the total RNA test kit of GenElute mammal (Sigma) to separate total RNA then, and quantitative by absorbance under 260nm.With 1 μ g random primer the total RNA of 20 μ L is carried out reverse transcription with Omni script RT test kit (Qiagen).For each RT product, end reaction volume (2-10 μ L) to equal portions in two parallel PCR reactions increases, used eNOS Auele Specific Primer (299bp product, justice 5 '-TTCCGGGGATTCTGGCAGGAG-3 ' is arranged, SEQ IDNO:1, antisense 5 '-GCCATGGTAACATCGCCGCAG-3 ', SEQ ID NO:2) or GAPDH Auele Specific Primer (343bp product, justice 5 '-CTCTAAGGCTGTGGGCAAGGTCAT-3 ' is arranged, SEQ ID NO:3, antisense 5 '-GAGATCCACCACCCTGTTGCTGTA-3 ', SEQ ID NO:4) and Taq polymerase (Pharmacia BiotechAmersham).PCR circulation is as follows: 94 ℃ 5 minutes, 65 ℃ 45 seconds, 72 ℃ 30 seconds (to eNOS is 35 circulations, then is 25 circulations to GAPDH).Analyze the rt-PCR product by 2% agarose gel electrophoresis, with the ethidium bromide colour developing, and the optical density standard measure.This test the results are shown in Fig. 3 A and 3B.By Fig. 3 A and 3B as seen, cell has been expressed nitricoxide synthase (eNOS) after hatching 3 days under the condition that has or do not exist oxygen in culture medium.Cultivate and still continue to express eNOS mRNA after 7 days.The expression of eNOS mRNA shows that described cell has been divided into sophisticated endotheliocyte in 3 days, and begins to exercise the function that is similar to the endotheliocyte that breaks up fully.

Embodiment 2

Catch endotheliocyte with the rustless steel disk that anti-CD34 (antibody) applies: in process of the test, (American type culture collection, American Type CultureCollection) is incubated in the endothelial cell growth culture medium with Human umbilical vein endothelial cells (HUVEC).Cell is hatched with sample or barren rustless steel (SST) sample with CMDX and gelatin coating that the surface contains or do not contain binding antibody.After hatching, remove culture medium, and with PBS washing sample 2 times.Fixed cell is 10 minutes in 2% paraformaldehyde (PFA), and with PBS washing 3 times, each 10 minutes to guarantee to remove all fixatives.At room temperature, each sample was hatched 30 minutes with lock solution, to seal all non-specific binding.With PBS washing sample 1 time, and 1: 100 diluent of contact VEGFR-2 antibody is cultivated and is spent the night.Use the PBS washing sample then 3 times, one anti-to guarantee to remove all.Add in each sample that to make 1: 100 the FITC link coupled two of dilution with lock solution anti-, incubated at room is 45 minutes on Belly Dancer device.After hatching, use PBS washing sample 3 times, with the PBS washing that contains 0.1%Tween 20 once, reuse PBS washing.With iodate third ingot (PI) fixed sample, and under Laser Scanning Confocal Microscope, observe.

Fig. 4 A-4E has applied CMDX and anti-CD34 antibody (Fig. 4 A), gelatin and anti-CD34 antibody (Fig. 4 B) as mentioned above, blank SST (Fig. 4 C), CMDX coating but has not had antibody (Fig. 4 D) and gelatin coating but do not have the SST sample microphotograph of antibody (Fig. 4 E).Accompanying drawing is depicted as and demonstrates the sample that only applies antibody by PI dyeing and comprise many cells that adhere to sample surfaces.Blank SST contrast dish shows that few cell adhesion is in its surface.

Fig. 5 A-5C has applied CMDX and has not had the microphotograph that antibody is incorporated into its surperficial control sample.Fig. 5 A shows by the visible few cell adhesion of PI dyeing in the surface of sample.Fig. 5 B shows that adherent cell is the VEGFR-2 positive, and this shows that they are endotheliocytes, and Fig. 5 C is depicted as the combination of painted nuclear and the positive green fluorescence of VEGFR-2.Fig. 5 D-F has applied gelatin and the microphotograph of not having the control sample of antibody in its surface.Fig. 5 D shows acellular existence, and this is because this sample does not have the green fluorescence (referring to Fig. 5 E and 5F) that PI dyeing is not also launched.

Fig. 6 A-6C is the microphotograph that has applied CMDX and had the SST sample of the anti-CD34 antibody that is incorporated into its surface.These accompanying drawing show samples comprise many adherent cell, as green fluorescence shows they set up approaching fusion monolayer (Fig. 6 A), be VEGFR-2 positive cell (Fig. 6 B and 6C).Similarly, the microphotograph of the sample of Fig. 6 D-6F gelatin that is the coating that anti-CD34 antibody is arranged of its surface combination.These accompanying drawings are many red staining nuclears and the green fluorescence by producing from VEGFR-2/FITC antibody also, has shown that HUVEC adheres to sample surfaces (Fig. 6 E and 6F).

Embodiment 3

The VEGFR-2 of endothelial progenitor cells dyes with Tie-2: separate the CFU-GM that obtains in the human blood as described in example 1 above, incubated in vitro 24 hours, 7 days and 3 weeks in culture medium.After hatching, remove growth medium, use PBS washing sample 2 times.With 2% paraformaldehyde (PFA) fixed cell 10 minutes, with PBS washing 3 times, each 10 minutes, guarantee to remove all fixatives then.Each sample was hatched at room temperature 30 minutes with sheep (for VEGFR-2) or horse (the being used for Tie-2) confining liquid of 440 μ l, to seal all non-specific binding.With PBS washing sample 1 time, add VEGFR-2 or the Tie-2 antibody of doing dilution in 1: 100 with confining liquid then, hatch sample and spend the night.Then with PBS washing 3 times, anti-all by flush away to guarantee all one.In each sample, add the FITC link coupled two anti-(200 μ l) that does 1: 100 dilution with horse or sheep confining liquid, and on Belly Dancer device, at room temperature hatched 45 minutes.After hatching, use PBS washing sample 3 times, with the PBS washing that contains 0.1%Tween 20 once, wash among the reuse PBS.With iodate third ingot (PI) fixed sample, and under Laser Scanning Confocal Microscope, observe.

Fig. 7 be contain on its surface CD34 antibody coating the microphotograph of sample of CMXD, this sample was hatched 24 hours with cell, showed that CFU-GM is trapped in the surface of sample, this point can be bright by the authentication of the red staining that exists on the sample surfaces.This accompanying drawing has shown that also about 75% cell is the VEGFR-2 positive, and form is circular.

Fig. 8 A and 8B are the sample of hatching with cell 7 days.Shown in Fig. 8 A, the nuclear of red staining shows that cell is present on the sample, and these cells are the VEGFR-2 positive (Fig. 8 B, 100%), and by the endothelialization more structurally of these cells shown in the spindle of cell.Fig. 9 A and 9B be comprise in its surface CD34 antibody coating the sample microphotograph of CMXD, this sample was hatched 7 days with cell, after hatching, made this sample contact Tie-2 antibody.Shown in Fig. 9 A, the nuclear of red staining has shown has many cell adhesions in sample surfaces.As the green fluorescence of cell emission as seen, the cell that adheres to sample also is the Tie-2 positive (100%) (Fig. 9 B).Generally speaking, shown in the VEGFR-2 and Tie-2 receptor that exists in sample surfaces and adherent cell surface by many cell adhesions: after cell hatched 7 days with sample, the sample that has applied CD34 antibody can be trapped in endotheliocyte their surface.In addition, on sample surfaces, exist 100% endotheliocyte to show that non-endotheliocyte may come off in the time of 7 days, or all adherent cell have all begun to express endothelial cell marker in the time of the 7th day.

Figure 10 A-10C is the phase contrast microscope photo that is grown in the endothelial progenitor cells in 3 weeks in the endothelial cell growth culture medium.Figure 10 A showed cell has been broken up becomes sophisticated endotheliocyte, and this point can be proved by the intravascular space of the two-dimentional tubular structure at arrow place.There is multiwalled three-dimensional cell stack in Figure 10 B demonstration, and promptly a cell is positioned on another cell, and this begins to form the report that is positioned at the layer on another layer with regard to the endotheliocyte that has confirmed growth in time expand.Figure 10 C is depicted as the CFU-GM of cultivating for 3 weeks behind kind of the plate, and these cells have the outward appearance of endotheliocyte, and as CD34/FITC antibody green fluorescence of their surface existence proves, this accompanying drawing has confirmed that these cells are endotheliocyte.

The leukocyte that above-mentioned data show is separated from human blood contains the positive CFU-GM of CD34, and these cells can be grown for mature endothelial cell and are easy to express surface endothelial cell antigens.(VEGFR-2 and Tie-2).These data also show can adopt at CFU-GM or the antigenic antibody of stem cell surface with these cell captures on the surface of the medical treatment device that the present invention applies.

Embodiment 4

Applied fullerene and applied fullerene and had anti-CD34 antibody

And/or endothelial cell growth factor (ECGF) (Ang-2, body of stainless steel VEGF)

Adopt following method to come with the stainless steel stent and the disk that produce functional Fullerene layer with binding antibody and/or somatomedin (that is, VEGF or Ang-2):

In the first step, with the surface of 0.5M HCl activation SST support or disk, described HCl has also removed lip-deep any passivation pollutant simultaneously.From activating bath, take out metal sample, use distilled water flushing, the dry and oven dry under 75 ℃ of methanol.Then described support be impregnated in and contain oxidation fullerene (C ₆₀In-O) the toluene derivative solution maximum 24 hours.Described oxidation fullerene can be incorporated into support by the Fe-O on the support, Cr-O and Ni-O.Support is taken out from the bath of deriving,, placed Soxhlet Extractor then 16 hours, remove the C of any physical absorption with fresh toluene with the toluene flushing ₆₀Take out support, and oven dry is spent the night under 105 ℃.This reaction has produced complete deutero-support or the disk with fullerene monolayer.

In step 2, make decanedioic acid and thionyl chloride or sulfur oxychloride (SOCl ₂) reaction formation sebacoyl chloride, to form the dialdehyde molecular solution.Gained sebacoyl chloride and the LiAI[t-O butyl of making as follows] ₃H and diethylene glycol dimethyl ether reaction are to obtain 1, the 10-decanedioyl:

In step 3, on available from the support of step 1 or disk, form N-methylpyrrole alkane derivatives.As follows, come fullerene molecule is further derived by following reaction: under the nitrogen, in the toluene solution that refluxes, with 1 in the fullerene of equimolar amounts and sarcosine and the step 2,10-decanedioyl product reaction 48 hours is to obtain deutero-fullerene stainless steel stent of N-crassitude or disk.

Wash deutero-stainless steel stent or disk to remove any chemical residue, be used for standard method binding antibody and/or (VEGF or Ang-2).As the CFU-GM in the separation human blood as described in the embodiment 1, make the fullerene disk of its contact with anti-CD34 antibody coating.After hatching, remove growth medium, use PBS washing sample 2 times.With 2% paraformaldehyde (PFA) fixed cell 10 minutes, with PBS washing 3 times, washed 10 minutes, then to guarantee to remove all fixatives at every turn.Each sample was at room temperature hatched 30 minutes with lock solution, to seal all non-specific binding.With PBS washing sample 1 time, the VEGFR-2 antibody incubation that adds dilution in 1: 100 spends the night.Use the PBS washing sample then 3 times, one anti-to guarantee to remove all.The FITC link coupled two that adds in each sample with the dilution in 1: 100 of confining liquid do resists, and incubated at room is 45 minutes on Belly Dancer device.After hatching, use PBS washing sample 3 times, with the PBS washing that contains 0.1%Tween 20 once, reuse PBS washing.With iodate third ingot (PI) fixed sample, and under Laser Scanning Confocal Microscope, observe.Figure 11 shows that the present invention combine CFU-GM coating the sketch map of rack surface of functional fullerene.Figure 12 A-12B respectively for the coating of PI dyeing (12A) and anti-VEGFR-2/FITC-coupling antibody staining fullerene do not have the microphotograph of the control sample of antibody.Figure 12 C and 12D are the microphotograpies that has applied the sample of fullerene/anti-CD34 antibody coating.As shown in the figure, the sample that is coated with anti-CD34 antibody contains the VEGFR-2 positive cells that adhere to the surface more.

As described in embodiment 5, will contain or not contain antibody coating the sample of fullerene implant yorker.Take out support and make histologic analysis,, fix up to processing with 10% formalin buffer then with 10% formalin buffer flushed zone support section 30 seconds.From each support, cut following 5 sections; Close on support 1mm place, support and close on terminal 1mm place, support middle section, rack far end 1mm place and support end 1mm place.Use Su Mujing ﹠amp; Yihong (HE) and trichroism elastin laminin stained.Figure 13 A-13D is the support cross section microphotograph of implanting for 4 weeks of taking out from coronary artery.The support that data show has applied fullerene (Figure 13 B and 13D) has suppressed the neointimal hyperplasia (blank support, Figure 13 A and 13C) at support position of living in compared with the control.

Embodiment 5

Pig air bag damage research: the structural transplantation that will apply antibody is gone into yorker childhood of heavy 25-30kg.Take care of animal according to " management of laboratory animal and guide for use " (Guide for the Care and Use of LaboratoryAnimals, NIH publication number 80-23 revises in 1985).Behind the overnight fasting, make animal calmness (20mg/kg) with ketalar.Use penthiobarbital (12mg/kg) induced anesthesia then, animal is carried out intubate, and connect the snorkel give oxygen and nitrogen mixture (1: the 2[volume/volume]).Isoflurane with 0.5-2.5 volume % is kept anesthesia.Intramuscular injection 1,000mg procaine benzylpenicillin-G and benzathine benzylpenicillin-G (streptomycin) mixture is to provide the prevention of antibiosis disposition.

Under aseptic condition, carry out the left neck artery otomy, the 8F guide sheath is placed left neck artery.Give all animal 100IU heparin/kg body weight.In the whole surgery process, regularly append 2, the heparin medicine group (boluse) of 500IU is to remain on activated clotting time more than 300 seconds.The 6F guiding tube is imported by carotid sheath, be advanced to coronary ostium.After giving 200 μ g nitroglycerine in the coronary artery, carry out angiography, with quantitative coronary angioradiographic system analysis image.The 3F Embolectomy catheters inserted near-end coronarius and be advanced into and select to be used for implant frame and the exposed section of endothelium to far-end.The R support through applying that adds anti-CD34 antibody is inserted by guiding tube, and in the exposed section of coronary artery, launch.With blank stainless steel stent or applied substrate but the support that do not contain antibody in contrast.Be that 1.1 ratio is implanted left anterior descending coronary artery (LAD) or right coronary artery (RCA) or circumflex branch of coronary artery (Cx) with support with support to tremulous pulse.With the size and the position of angiography evaluation support, take out guide sheath, closed two-layer skin.In process of the test, give the ASA of animal 300mg.

Behind implant frame, put to death animal 1,3,7,14 and 28 day the time.Calm and the anesthesia with animal earlier as mentioned above.Take out the coronary artery of implant frame, have the unsupported blood vessel of 1cm at its near-end and far-end.Handle the blood vessel of implant frame with three kinds of methods: histology, SABC method or scanning electron microscope method.

Detect for SABC, softly wash the support 30 seconds of incision, place 10% formalin/PBS solution until processing with 10% formalin.Specify with the PBS solution flushing that contains 2% paraformaldehyde (PFA) and to be used for the support 30 seconds that SABC detects, placed 2%PFA solution then 15 minutes, and detecting until the SABC of using rabbit human VEGFR-3 resistant-2 or mouse-anti-human T ie-2 antibody with PBS washing and storage.

Prepare to be used for the support of SEM by the following method:, in containing the 0.1M sodium cacodylate buffer liquid of 2.5% glutaraldehyde and 2%PFA, fixedly spend the night then with 10% formalin buffer flushing 30 seconds.Use dimethyl arsenic acid buffer liquid washing sample three times then, and its cleaning is spent the night.Finish fixedly post processing by following steps: the 0.1M dimethyl arsenic acid buffer liquid with 1% Osmic acid. (Sigma) is handled, and uses ethanol dehydration (30% ethanol, 50%, 70%, 85%, 95%, 100%, 100%) then, uses CO subsequently ₂Carry out critical point drying.After the drying, sample is carried out metal spraying, and under SEM, observe.(" coronary artery to normal pig adopts the Palmatz-Schatz support that applies through heparin to reduce or remit thrombotic support mould bases ", Reduction in thromboticevents with heparin-coated Palmaz-Schatz stent in normal porcine coronaryarteries, Circulation 93:423-430 includes this paper in as a reference).

Be used for the support section 30 seconds of histologic analysis with 10% formalin buffer flushing, fix until processing with 10% formalin buffer then.Cut following 5 sections from each support; Close on support 1mm place, support and close on terminal 1mm place, support middle section, rack far end 1mm place and support end 1mm place.Use Su Mujing ﹠amp; Yihong (HE) and trichroism elastin laminin stained.

Figure 14 A-14G is for implanting back 1 hour (Figure 14 A and 14B) and 48 hours (Figure 14 C-14G) observed taking-up support under scanning electron microscope.Microphotograph has clearly shown the support (14B with glucosan/anti-CD34 antibody applies, 14E-G) caught endothelial progenitor cells, this point can by with the contrast that applies with glucosan by contrast, section in 48 hours than high power (400X) down cell be spindle outward appearance (14A, 14C and 14D).

The transverse section of porcine coronary separator also shows compared with the control (blank rustless steel 14H and 14I; 14J and 14K with the glucosan coating), apply (14L, 14M) with glucosan-anti-CD34 antibody and make neointimal hyperplasia (thickness of arterial smooth muscle layer) be subjected to significant inhibition.The stent graft that applies with fullerene has suppressed neointimal hyperplasia (shown in Figure 13 B-13D) better than the blank stainless steel stent.

Figure 15 A and 15B are respectively long the applying but the support separator of the no antibody in surface and with copolymerization Jiao microphotograph of the anti-CD34 antibody support of glucosan-blood plasma coating with glucosan-blood plasma through the 18mm that takes out after 48 hours.Described support was once implanted the coronary artery of male York children pig.The support that takes out is carried out SABC processing and VEGFR-2 dyeing, resist with FITC link coupled two then and handle and under Laser Scanning Confocal Microscope, study.Figure 15 B has shown that with 15C lacking endothelium fully with the support that does not contain antibody compares, and the support that contains antibody is covered by endotheliocyte, and this green fluorescence by this section is confirmed (Figure 15 A).

Embodiment 6

Endothelial cell growth factor (ECGF) is mixed the substrate of antibody that put on fixing of support: following the step that the antibody that will resist the endothelial progenitor cells surface antigen is fixed in the biocompatible matrix that puts on endovascular stent described, endothelial cell growth factor (ECGF) be adsorbed in subsequently support with promote circulation endothelium progenitor cell adhere to and when contacting with blood maturation be functional endothelium.

Apposition: adopted method known to those skilled in the art, handled stainless steel stent to import amino functional at rack surface with plasma deposition technique.Employing is called the standard method of water-soluble carbodiimide coupling chemical method, under aqueous conditions, carboxyl group functional glucosan layer is incorporated into the amino-functional layer that is deposited on the support, between plasmasphere and functionality CDMX, forms amido link at the amino that is positioned under the described aqueous conditions on the plasma deposition layer by activatory glucosan (CMDX) carboxyl.

Antibody immobilization: by in the acidic buffer solution of moisture water-soluble carbodiimide chemical reagent, hatching, with antibody (for example Mus monoclonal anti-human CD34) covalent coupling of anti-endothelial progenitor cells surface antigen in the support that applies with CDMX.

The absorption of somatomedin: after monoclonal anti-human CD34 is fixed on the CMDX substrate that puts on support, with described device be incubated in contain suitable concentration endothelial cell growth factor (ECGF) (for example, angiogenin 2) in the aqueous solution, make somatomedin be absorbed into CMDX substrate.With the treated device of normal saline solution flushing, and be stored in the Hydrazoic acid,sodium salt preservative agent.

Employing standard angiography technology, when said apparatus being implanted porcine coronary and contacting human blood, produced and strengthen circulation endothelium progenitor cell and catch and be attached to treated or apply rack surface and promote that cell maturation is the effect of functional endothelial tissue.The quick foundation of functional endothelial tissue can reduce device thrombosis that causes and the degree of regulating neointimal hyperplasia.

Embodiment 7

Endothelial cell growth factor (ECGF) and antibody are fixed on the support: the following antibody and the somatomedin that will resist the endothelial progenitor cells cell surface antigen described is fixed on the biocompatible matrix that puts on endovascular stent, thereby promotes adhering to maturation of circulation endothelium progenitor cell to be functional endothelial tissue step when contacting with blood.

Apposition: apposition has used method known to those skilled in the art, handles stainless steel stent to import amino functional on rack surface with plasma deposition technique.Employing is called the standard method of water-soluble carbodiimide coupling chemical method, under aqueous conditions, carboxyl group functional glucosan layer is incorporated into the amino-functional layer that is deposited on the support, between plasmasphere and functionality CDMX, forms amido link at the amino that is positioned under the described aqueous conditions on the plasma deposition layer by activated dextran (CMDX) carboxyl.

The immobilization of antibody and somatomedin: by under acid condition, with etc. the antibody (for example Mus monoclonal anti-human CD34) of anti-endothelial progenitor cells surface antigen of molar concentration and endothelial cell growth factor (ECGF) (for example, angiopoietin-2) hatches in the water-soluble carbodiimide reagent solution, make itself and the support covalent coupling that applies with CDMX.With the treated device of normal saline solution flushing, and be stored in the Hydrazoic acid,sodium salt preservative agent.

Employing standard angiography technology, when said apparatus being implanted porcine coronary and contacting human blood, produced and strengthen circulation endothelium progenitor cell and catch and be attached to treated or apply rack surface and promote that cell maturation is the effect of functional endothelial tissue.The quick foundation of functional endothelial tissue can reduce device thrombosis that causes and the degree of regulating neointimal hyperplasia.

Embodiment 8

The micromolecule functionalization of support: obtain endothelial progenitor cells as separation as described in the embodiment 1.The slide that cell inoculation is covered in fibronectin also grew 7 days it in the EBM-2 culture medium.Fixed cell is also used iodate third ingot (PI) and the link coupled endothelial cell specific agglutinin dyeing of FITC (Ulex Europaeus Ueal).The results are shown among Figure 16 A and the 16B of these tests.These accompanying drawings have shown that endothelial progenitor cells is incorporated into the slide that fibronectin applies, and these cells are expressed the part that this agglutinin is arranged on their surface.

Embodiment 9

Bicistronic mRNA carrier transfection pig endothelial progenitor cells (EPC) with the coding vasodilation chemical compound and the cell surface marker (MHC-I of truncate) of uniqueness.MHC-I can be fixed in the identification of the specific antibody on the dummy in the blood vessel.The support that antibody applies is implanted in the porcine coronary, and the EPC with hereditary change implants pig then.Because antibody-AI, EPC are trapped on the support of coating, and form endothelial cell monolayer on stent strut.Captive cell can be secreted vasodilation, the increase far-end blood flow of expressing and trigger positivity and mould.

The selection of plasmid: Miltenyi Biotec (Germany) has developed and has contained pMASCSK ^kThe MACSelect K System of plasmid vector.Described pMACSK.II plasmid is a kind of bicistronic mRNA carrier (5229bp) that contains multiple clone site (MCS), and the clone has the cDNA of coding prostacyclin synthase and the gene of coding Mus MHC I type molecule H-2K therein.Develop this system and be in order to select to be used for cells transfected, with the MHC molecule of truncate as selected marker.The expression of natural H-2K is limited to (for example, AKRiJA or CBNJ) in some rare Mus strain, therefore at H-2K ^kIrrelevant reaction should can not take place with other surface antigen in the monoclonal antibody of surface protein (Miltenyi Biotec) basically.

The assessment with The cross reactivity of whole blood: in order to ensure anti-H-2K ^kAntibody not with the pig whole blood in cellular component generation cross reaction, make the link coupled anti-H-2K antibody response of whole blood and FITC, and carry out whole blood facs analysis (BeckmanCoulter Cytomics FC 500).With expressing H-2K ^k(whole blood of ATCC) " reinforcement " (" spiked ") is as positive control for American type culture collection, American Type Culture Collection for the Mus spleen fibroblast strain AKRIJASp of surface antigen.

Fibroblastic cultivation: the AKR/JA.Sp fibroblast is incubated in the T-75 plastic bottle of uncoated (Sarstedt, Montreal), condition of culture is: 37 ℃, 5%CO ₂, culture medium is Da Erbaike (family name) improvement Iger (family name) culture medium (DMEM) that contains 4mM L-glutamine, 4500mg/L glucose, 1mM Sodium Pyruvate, 1500mg/L sodium bicarbonate and 10% hyclone.Carry out cell separation with trypsin/EDTA (Invitrogen).By immunohistochemical analysis, use fluorescently-labeled H-2K ^kAntibody has confirmed H-2K ^kExpression.In brief, with 0/5 * 10 ⁶Individual cell/cm ²Cell inoculation is gone in the band chamber slide (chamber slide) of 2 hole uncoated.In the time of the 1st, 2,3 and 4 day, with 2% paraformaldehyde fixed culture, and with the link coupled H-2K antibody of FITC (Miltenyi Biotec, Germany) and nuclear labelling iodate third ingot (PI) (Vectashield Mounting Medium, Vector Laboratories) dyeing.Adopt Laser Scanning Confocal Microscope (Nikon Eclipse E800-BioradRadiance 2 100) to analyze with quantitative.Human fibroblasts is used as negative control.

The analysis of adherent cell: H-2K not ^kThe reservation of surface protein is the feature of the AKRIJA.Sp cell of non-cohesive form, is used to confirm to adopt when blood exists the feasibility of this system.As mentioned above with cell culture in the T-75 of uncoated bottle.Made adherent cell detachment at the 4th day with trypsin/EDTA, and with the link coupled H-2K of FITC ^kAntibody and facs analysis (Beckman Coulter Cytomics FC500) are measured and are expressed H-2K ^kThe cell quantity of surface protein.With the Mus IGg2 α isotype of FITC labelling as negative control.

The structure of plasmid: utilize will the encode cDNA of prostacyclin synthase of BamHl in the multiple clone site and the restricted sequence of HindIII to be cloned into bicistronic mRNA carrier pMACS K ^k.II (Miltenyi Biotec, Germany).Used the cDNA of 1153 base pairs that contain prostacyclin synthase gene and pVAX-1 that are arranged in the plasmid construction thing.In the presence of selective agent ampicillin (50ng/ml), carry out the colibacillary conversion of HG70.

Be used for open biosystem (Open Biosystems, the classification number #MHS 1768-9 1,441 17 of the full-length cDNA of people α-CGRP available from plasmid vector pPCR-Script Amp SK (+); Huntsville AL).Then this fragment and BamHl/EcoRl are connected into bicistronic mRNA plasmid vector pMACS K.II.Transform the JM109 escherichia coli to obtain a large amount of described plasmids.

The transfection of EPC: use Ficoll gradient centrifugation enrichment pig mononuclear cell from the pig whole blood, and separate EPC with above-mentioned enrichment medium.Cultivate after 7 days, with the method (Amaxa Nucleofector, Germany) of nuclear perforation, with the bicistronic mRNA plamid vector transfection EPC that contains metastatic gene, described metastatic gene comprises α-CGRP or prostacyclin synthase.Utilize reporter gene and endothelial nitric oxide synthase (eNOS) in the pVAXt plasmid, obtained＞70% EPC electroporation transfection efficient (data not shown goes out).To successful transfection and express H-2K ^kThe EPC of surface protein carries out purification, and removes test kit (MACS Dead cell removal kit), MACSelect K with the MACS dead cell ^kMicroballon (MACSelect K ^kMicroBead) separate with MS detached dowel (MS Separation Column) (Miltenyi Biotec).MACSelect K ^kMicroballon is biodegradable, and it disappeared with cell culture in 24 hours.

The mensuration that vasodilation is expressed:

The active mensuration of prostacyclin synthase: after 2 days, keep cultivating EPC through transfection in transfection.Change culture medium, and assess the activity of prostacyclin synthase according to manufacturer's explanation with the level of prostacyclin synthase metabolite 6-ketone-PGF1 (6-keto-PGFIcu) in radio immunoassay (Amersham Corp.) the mensuration culture medium.

The active mensuration of α-CGRP: measure the expression of α-CGRP in the transfectional cell with SABC method color reagent box (Bachem USA).Under-10 ℃ with methanol fixing cultivate 3 days through EPC5 minute of transfection.Wash described cell and air-dry.Fixed cell is hatched 7 minutes with deactivation endogenous peroxide activity in the PBS of 0.5% hydrogen peroxide solution.Cell is hatched in the serum confining liquid 20 minutes with the sealing non-specific binding.Anti-(rabbit monoclonal is Bachem) with three kinds of dilution factors: handled cell 2 hours in 1: 100,1: 200 and 1: 500 with anti-α-CGRP one then.Wash slide then, make it contact biotinylated two and resist 30 minutes.Wash cell then and use HRP-streptavidin complex to handle 30 minutes.With after the PBS washing, made cells contacting substrate-chromogen mixture 3 minutes.Add deionized water with cessation reaction.With MayerShi haematoxylin redyeing slide 3 minutes.Wash slide with tap water then, place PBS, use the distilled water rinsing until becoming blue.Reuse 95% and 100% ethanol and dimethylbenzene dewater to slide.Check in covered on the slide and under light microscopic.

Support with the antibody coating: foregoing with glucosan and anti-H-2K ^kAntibody applies stainless steel stent (9mm is long).

Cells in vivo is caught: all tests all in the children pig of male York (＞carry out in 30kg).Obtain arterial passageway by the arteriotomy of on left neck artery, carrying out.After in coronary artery, giving 200pg nitroglycerine, obtain coronary angiography, and carry out online quantitative coronary angiography and measure.With 1.1: 1 supports to blood vessel than support is circled round or the proximal section of right coronary artery is launched at LAD at random.After implanting, just give 200pg nitroglycerine in the intravascular.Carry out intravascular ultrasound (IVUS) then measuring external caliber, with the distally of stent prop up with remote edge as far-end and near-end reference.Utilize prototype series connection balloon catheter (CordisCorporation) to finish through the giving of transfectional cell, described cell is with the bicistronic mRNA carrier transfection of coding prostacyclin synthase or α-CGRP.This conduit constitutes by being positioned at two of apparatus adjacent far-end air bags of highly fitting, by same air-filled pore this two air bags that expand.In case after expanding, separate the long blood vessel section of 1.0cm between two air bags, to produce a regional perfusion chamber.Provide the far-end blood flow by central chamber, and be fed into solution or pass through two isolating chambeies the whole chamber of solution suction.Filling cavity end at the far-end air bag near, discharge side then ends at a near opening of proximal balloon.The series connection balloon catheter is reached the position of implant frame forward, and with airbag inflation to 25psi (1.7 atmospheric pressure).Send saline by fill orifice, in isolating section, do not contain blood.The tremulous pulse section of implant frame is carried out random packet to accept perfusion of saline or cell is sent.In 10 minutes, be total up to the 2ml cell suspension of 3 * 10 EPC with 200pL/ minute irrigation rate, hatched then 10 minutes.Closed then position of implementing arteriotomy is restored animal.Handled the back letting animals feed 28 days at cell.Coprocessing 34 animals (10 is saline control, and 14 is prostacyclin synthase, and 14 is α-CGRP).Delivery of cells after 1 hour is killed two animals of every group.The section that separates implant frame, and prepare to be used for the tremulous pulse of SEM by following steps: fix 30 seconds at 10% formalin buffer PBS, further in the 0.1M sodium cacodylate buffer liquid (Sigma) that contains 2.5% glutaraldehyde (BDH Inc.) and 2%PFA, fixedly spend the night then through the implant frame of flushing.Finish fixedly post processing by following steps: the 0.1M arsenate buffer with 1% Osmic acid. (Sigma) is handled, and with the dehydration of ethanol gradient, carries out critical point drying with CO2 subsequently then.After the drying, sample is carried out metal spraying and whether has the cell that is incorporated into stent strut in the following observation of scanning electron microscope (SEM).Behind implant frame the 5th day put to death two animals of prostacyclin synthase group and two animals of α-CGRP group.The tremulous pulse section that contains implant frame that takes out is placed 10% formalin/PBS solution, until carrying out the normal structure chemical analysis.Cut 5 sections from each support; Close on support 1mm place, support and close on terminal 1mm place, support middle section, rack far end 1mm place and support end 1mm place.Use Su Mujing ﹠amp; Yihong (HE) and trichroism elastin laminin dye to section.Measure inflammation [section's Milunovich index, Kornowski Score (0-3)] index with the rejection sign of assessment to the input cell.After carrying out exponential process (about 28 days), anesthetized animal also carries out coronary angiography by the right coronary artery angiotomy.Carry out the quantitative coronary angiography, utilize IVUS to carry out the blood vessel inquiry, with the variation of standard clinical algorithm record external caliber.

Embodiment 10

Be used for the mammalian cells in vitro transfection of vascular remodeling: to endothelial progenitor cells, described plasmid comprises coding and is responsible for the protein of adenosine generation and the gene of prostate specific epicyte protein the method for employing electroporation with the bicistronic mRNA plasmid transfection.Two kinds of genes are subjected to them to initiate self the control of son separately, thereby make gene be able to the constructive expression.

Make up following carrier with being similar to above-mentioned method, described carrier comprises the gene of coding prostate specific membrane albumen and its natural promoter, and the gene of coding VEGF, and these two kinds of genes are arranged in series in same expression vector.This plasmid construction thing can be used for the cell that is used for the patient described in the transfection embodiment 9, mammalian cell.

Sequence table

＜110〉Orbus Medical Technologies Inc

(ORBUS?MEDICAL?TECHNOLOGIES，INC.)

 

＜120〉have the medical treatment device and the using method thereof of the coating of cell that can be capturing genetically-altered

 

<130>ORB-101(PCT)

 

<140>TBA

<141>2005-04-29

 

<150>US60/566,829

<151>2004-04-30

 

<150>US?10/835,767

<151>2004-04-30

 

<160>4

 

<170>PatentIn?version?3.3

 

<210>1

<211>21

<212>DNA

＜213〉homo sapiens (Homo sapiens)

 

<220>

<221>primer_bind

<222>(1)..(21)

＜223〉the nitricoxide synthase sequence in endotheliocyte source has an adopted PCR primer

 

<400>1

ttccggggat?tctggcagga?g 21

 

<210>2

<211>21

<212>DNA

＜213〉homo sapiens (Homo sapiens)

 

<220>

<221>primer_bind

<222>(1)..(21)

＜223〉the antisense PCR primer of the nitricoxide synthase sequence in endotheliocyte source

 

<400>2

gccatggtaa?catcgccgca?g 21

 

<210>3

<211>24

<212>DNA

＜213〉homo sapiens (Homo sapiens)

 

<220>

<221>primer_bind

<222>(1)..(24)

＜223〉glyceraldehyde phosphate dehydrogenase gene has an adopted PCR primer

 

<400>3

ctctaaggct?gtgggcaagg?tcat 24

 

<210>4

<211>24

<212>DNA

＜213〉homo sapiens (Homo sapiens)

 

<400>4

gagatccaccaccctgttgc?tgta 24

Claims (32)

1. therapy system for the treatment of patient disease, described system comprises the following ingredient that independently gives described patient:

(i) mammalian cell of hereditary change, described cell comprises coding through the genetically engineered cell surface marker molecule and the exogenous nucleic acid of at least a therapeutic gene product, the mammalian cell of wherein said hereditary change can be expressed described cell surface marker molecule and therapeutic gene product, and thereby described cell gives in the circulation blood that described patient is present in described patient, and wherein said cell surface marker molecule is selected from BMP, prostatic cell memebrane protein or H-2K ^kSurface protein;

(ii) be used to implant described patient's medical treatment device, described device comprises coating; Described coating comprises the substrate that load has at least a part, wherein said at least a ligand specificity identification and in conjunction with the described cell surface marker molecule of the mammalian cell of described hereditary change, and described at least a part is selected from antibody, antibody fragment or their compositions

Wherein, when this therapy system is used, the mammalian cell original position that independently gives described patient's the described hereditary change that is arranged in circulation is incorporated into described medical treatment device, and express and secrete described at least a therapeutic gene product, described therapeutic gene product is selected from: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

2. therapy system as claimed in claim 1, it also comprises and is used to the medicine or the chemical compound that stimulate the mammalian cell expression of described hereditary change and/or secrete described therapeutic gene product.

3. therapy system as claimed in claim 1 is characterized in that, the mammalian cell of described hereditary change is from body, allogeneic or heterogenous cell.

4. therapy system as claimed in claim 3 is characterized in that, described is endothelial progenitor cells or mature endothelial cell from body, allogeneic or heterogenous cell.

5. therapy system as claimed in claim 1 is characterized in that, the described exogenous nucleic acid that is present in the mammalian cell of described hereditary change comprises DNA or RNA molecule, and described molecule comprises at least a gene of at least a therapeutic gene product of encoding.

6. therapy system as claimed in claim 1 is characterized in that described exogenous nucleic acid is an exchromosomal DNA.

7. therapy system as claimed in claim 5 is characterized in that described dna molecular comprises plasmid.

8. therapy system as claimed in claim 6 is characterized in that, described exchromosomal DNA comprises that regulation and control box, cell membrane specific gene and at least a coding are used for the treatment of the gene of the peptide of disease.

9. therapy system as claimed in claim 8 is characterized in that, described cell membrane specific gene is encoded into bone protein, prostatic cell memebrane protein or H-2K ^kSurface protein.

10. therapy system as claimed in claim 5, it is characterized in that described at least a gene code is selected from down the therapeutic gene product of group: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

11. the mammalian cell of hereditary change and the medical treatment device purposes in the cover box of preparation treatment patient disease, wherein:

The mammalian cell of described hereditary change comprises coding through the genetically engineered cell surface marker and the exogenous nucleic acid of at least a therapeutic gene product, and described cell surface marker molecule is selected from BMP, prostatic cell memebrane protein or H-2K ^kSurface protein; Described medical treatment device comprises coating, described coating comprises the substrate that load has at least a part, described part identification and in conjunction with the described cell surface marker of the mammalian cell of described hereditary change, and described part is selected from: antibody, antibody fragment or their combination

Wherein, the mammalian cell of described hereditary change is incorporated into described medical treatment device and expresses and secrete described at least a therapeutic gene product, and described therapeutic gene product is selected from: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

12. also comprising, purposes as claimed in claim 11, wherein said coating be used to stimulate the mammalian cell expression of described hereditary change and/or the medicine or the chemical compound of secretion specific gene product.

13. purposes as claimed in claim 11 is characterized in that, the mammalian cell of described hereditary change is from body, allogeneic or heterogenous cell.

14. the mammalian cell of hereditary change and medical treatment device are used for the treatment of purposes in the cover box of cancer in preparation, wherein said cell comprises coding through the genetically engineered cell surface marker and the exogenous nucleic acid of at least a therapeutic gene product, and described cell surface marker molecule is selected from BMP, prostatic cell memebrane protein or H-2K ^kSurface protein; Described medical treatment device comprises coating, and described coating comprises the substrate that load has at least a part, and wherein said part is selected from antibody, antibody fragment or its combination, and identification and in conjunction with the described cell surface marker of the mammalian cell of described hereditary change,

Wherein, the mammalian cell original position of the described hereditary change of circulation is incorporated into described medical treatment device, and express and secrete described at least a therapeutic gene product, described therapeutic gene product is selected from: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

15. purposes as claimed in claim 14, described cover box also comprise the mammalian cell expression that stimulates described hereditary change and/or secrete the medicine or the chemical compound of described therapeutic gene product.

16. purposes as claimed in claim 14 is characterized in that, the mammalian cell of described hereditary change is from body, allogeneic or heterogenous cell.

17. purposes as claimed in claim 16 is characterized in that, described is mature endothelial cell from body, allogeneic or heterogenous cell.

18. purposes as claimed in claim 13 is characterized in that, described genetically-altered cells comprises exogenous DNA that gives or RNA molecule, and described molecule comprises at least a gene of at least a therapeutic gene product of encoding.

19. therapy system as claimed in claim 5 is characterized in that, described dna molecular is a plasmid.

20. therapy system as claimed in claim 6 is characterized in that, described exchromosomal DNA comprises that regulation and control box, cell membrane specific gene and at least a coding are used for the treatment of the gene of the peptide of disease.

21. therapy system as claimed in claim 8 is characterized in that, described cell membrane specific gene is encoded into bone protein, prostatic cell memebrane protein or H-2K ^kSurface protein.

22. therapy system as claimed in claim 5, it is characterized in that described at least a gene code is selected from down the therapeutic gene product of group: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

23. a drug delivery system, described system comprises:

The mammalian cell of hereditary change, described cell comprise coding through the genetically engineered cell surface marker and the exogenous nucleic acid of at least a therapeutic gene product, and described cell surface marker molecule is selected from BMP, prostatic cell memebrane protein or H-2K ^kSurface protein;

Be used to implant described patient's medical treatment device, described device comprises coating; Described coating comprises the substrate that load has at least a part, and wherein said part is selected from antibody, antibody fragment or their combination, and identification and in conjunction with the described cell surface marker of the mammalian cell of described hereditary change,

Wherein, the mammalian cell of described hereditary change can be incorporated into described medical treatment device and express and secrete described at least a therapeutic gene product, and described therapeutic gene product is selected from: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

24. drug delivery system as claimed in claim 23, it also comprises and is used to the activating molecules or the inducible promoter that stimulate the mammalian cell expression of described hereditary change and/or secrete described therapeutic gene product.

25. therapy system as claimed in claim 23 is characterized in that, the mammalian cell of described hereditary change is from body, allogeneic or heterogenous cell.

26. drug delivery system as claimed in claim 25 is characterized in that, described is mature endothelial cell from body, allogeneic or heterogenous cell.

27. drug delivery system as claimed in claim 23, it is characterized in that, the described exogenous nucleic acid that is present in the mammalian cell of described hereditary change comprises foreign DNA or RNA carrier, and described foreign DNA or RNA carrier comprise at least a gene of at least a therapeutic gene product of encoding.

28. drug delivery system as claimed in claim 23 is characterized in that, described exogenous nucleic acid is an exchromosomal DNA.

29. drug delivery system as claimed in claim 23 is characterized in that, described dna vector comprises plasmid.

30. drug delivery system as claimed in claim 28 is characterized in that, described exchromosomal DNA comprises that regulation and control box, cell membrane specific gene and at least a coding are used for the treatment of the gene of the peptide of disease.

31. drug delivery system as claimed in claim 30, it is characterized in that described cell membrane specific gene coding prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis and fibroblast growth factor.

32. drug delivery system as claimed in claim 27, it is characterized in that described at least a gene code is selected from down the therapeutic gene product of group: prostacyclin, calcitonin-gene-related peptide, VEGF, angiogenesis factor, anti-angiogenesis or fibroblast growth factor.

Images