CN101120092A - Co-expression of multiple protein chains or subunits - Google Patents

Abstract

A recombinant genetic construct is provided that includes at least two expression cassettes. Each cassette encodes for a chain or subunit of a target protein. The genetic construct preferably targets any expressed protein to the secretory pathway of the host cell. An application of present invention is found in expressing the two chains of human insulin through two separate expression cassettes on the same methylotrophic yeast expression vector. Mature, bioactive human insulin molecules are secreted through this method without resorting to any post-translational cleavage process.

Description

Co-expression of multiple protein chains or subunits

The relevant patent of having applied for

This patent requires for declaring on November 3rd, 2004, and number of patent application is that the whole and relevant content of 200410061039.0 Chinese patent application has senior interest.

Technical field

This invention is one and produces proteinic process and relevant structure and system about using recombinant DNA technology.Host cell compound two and plural polypeptide chain that gives expression to target protein respectively and simultaneously used in this invention, and subunit or other analogue, such as insulin human are expressed by single recombinant vectors.Host cell through screening requires the ground secretion to provide activated protein as designing institute.This invention has many-sided advance of using, especially aspect the large-scale medicine suitability for industrialized production.

Background technology

Produce pharmaceutical grade protein, regard optimize as the key of effectively controlling cost as based on the bio-pharmaceuticals process on the gene recombination technology basis.After all, the preparation process of the step of production and raw material is few more good more.The production process of existing biotechnology industry is generally following problem and perplexs: at first be that intermediate steps before obtaining end product is too many; Next is that the life cycle of the intermediate that biology produced used in producing or end product is wayward, so caused the reduction of productive rate; The 3rd, this intermediate or end product always need expensive and purification step repeatedly.

Recently, the method for a kind of industrial production polypeptide chain or oligomeric protein is that they are produced respectively, and purifying is then modified and at external synthetic end product.Polypeptide chain in end product or many subunits must could form the structure of natural biologically active external according to certain ratio and correct form assembling when synthetic.This correct form is included in the correct redox state on the amino-acid residue of polypeptide chain or subunit so that form crosslinked required and make protein be able to stable disulfide linkage.Caused the insoluble or inactivation of end product in the incorrect ratio between polypeptide chain or the subunit under this condition, and the serious drop of productive rate and quality.

Another kind method is to create at polypeptide chain or subunit such as same wire polypeptide, and no matter whether it has disulfide linkage.The benefit of this method is the problem that has solved the incorrect ratio between top said polypeptide chain or the subunit; But before can correctly synthesizing end product, polypeptide chain or subunit must increase the step of a chain rupture.The step of chain rupture this chemistry or enzymolysis, and follow-up modification step is time-consuming expensive equally.

With Regular Insulin is example, and the insulin molecule of a stable biologically active is made up of two polypeptide that are called A chain and B chain.With people's Regular Insulin is that the insulin molecule of representative has one 21 amino acid whose A chains and 30 amino acid whose B chains.They connect by two disulfide linkage each other, and other has the 3rd disulfide linkage in A chain inside (G.Bell, etal.1979Nature 282:525-527).Two chains of the insulin molecule under the state of nature are by a strand mRNA coding, and are translated as a polypeptide.And then the enzymolysis chain rupture becomes two polypeptide chains.So the A of insulin molecule, the B chain is different with other some macromolecular subunit, and it is a wire polypeptide originally, just just separates through chain rupture after translation.On the manufacturing process of relevant Regular Insulin, also to be further described below two kinds of above-mentioned methods.

The example of the polypeptide with subunit that this class polypeptide chain of another and Regular Insulin is different is il-1 2 (IL-12).Il-1 2 is formed (p35 and p40) by two polypeptide subunits, but these two subunits are being represented two complete differences and incoherent gene respectively, 3p12-3q13.2 (p35) and the expression product of 5q31-q33 (p40), and respectively by a plurality of disulfide linkage connect (Gubler U.et al.1991Co-Expression Of Two DistinctGenes Is Required To Generate Secreted Bioactive CatatonicLymphocyte Maturation Factor.Proc.Natl.Acad.Sec.USA, 88:4143-47).

Also always face above problem when its scale operation as medicinal polypeptide with polypeptide chain or subunit.Therefore press for development simply a kind of and efficiently production technique express the back and modify in order to reduce significantly, purifying, enzyme is cut, and meanwhile reaches the high-quality product of high yield, regardless of its formation of polypeptide and subunit.The Regular Insulin industry is exactly a good example.

As everyone knows, Regular Insulin is by the beta emiocytosis in the Lang Gehan corpusculum of pancreas, unique natural hormone with function of polysaccharide, the specifics of treatment diabetes.Diabetes cause a series of severe complications.In the U.S. 18,200,000 patients are arranged, account for population 6.3%.In state-owned 30,000,000 patients.Because Regular Insulin the absolute or glucose usage degree that caused of disappearance is low relatively, make the concurrent hypertension of patient, hyperglycemia, serious atherosclerosis, and neural system, kidney and microcirculation disease.Be the 7th lethal disease of the U.S..It also is the primary cause of disease that causes blind and renal failure among 20-74 year crowd.Moreover, the diabetic subject also is faced with gangrenous amputation, the risk occurred frequently of cardiovascular disorder and shock.

Diabetes are divided into I type and II type.Type i diabetes is because the beta cell degradation causes human body self can not make enough Regular Insulin.This class patient must rely on the exogenous insulin survival.The function of type ii diabetes patient's beta emiocytosis Regular Insulin is normal, but somatocyte but can not normal reaction to Regular Insulin.Perhaps, it is necessary equally that insulinize overcomes insulin resistance for the type ii diabetes patient.Being diagnosed as among the patient of diabetes about 30% at all needs every day and passes through injection, and insulin pump or other approach are taken in Regular Insulin.Diabetes are a kind of chronic diseases, also do not have the way of radical cure at present.

The Regular Insulin of pig and ox is used for treating diabetes already.But the life-time service animal insulin will cause tangible drawback: will produce the antibody of anti-animal insulin in patient's body of diabetes, the curative effect of animal insulin descends thereby cause not only, and the inflammatory reaction of injection site.The production of animal insulin also can't be satisfied the demand of whole world sustainable growth in addition.

The genetically engineered insulin human that nineteen eighty-two gets permission to go on the market has many advantages.It does not have the side effect of animal insulin, is easy to controlling quality, and raw material sources are abundant.Recently designed insulin analog by some amino acid that change natural insulin.The biological activity of some analogue even surpass natural insulin wherein.And because it is not easy polymerization, so in clinical application, have bigger advantage.

In natural product, human insulin gene at first is expressed as preproinsulin.It can be expressed as: preproinsulin-B-C-A.The signal peptide of preproinsulin has 24 amino acid, has the function of start signal sequence.The C peptide is 31 amino acid whose connection peptides between A chain and B chain.Enter endoplasmic owing to the attraction that is subjected to its signal peptide acceptor on the endoplasmic reticulum in kytoplasm guides newborn peptide chain to pass endoplasmic reticulum, in endoplasmic, have a kind of and membrane-bound proteolytic enzyme that signal peptide is excised.Rest parts is called proinsulin, cuts the C peptide at continuous two basic aminoacids sequence places by way of golgi body the time under a series of effects that are similar to trypsinase/protaminase.A chain and B chain are correctly tortuous, and finally synthetic sophisticated insulin molecule.The early existing many document records of the biological process that these natural insulins produce, for example article of Steiner (Steiner et al.Clin.Invest.Med.9:328-36. (1986) .).

At present, mainly contain two kinds of methods in the pharmacy industry and produce Regular Insulin.First method is that the A chain and the B chain of human insulin gene is expressed in host bacteria respectively, as intestinal bacteria (Escherichia coli).Two peptide species that the later host bacteria of process purifying is expressed are via oxidizing reaction, and chemistry forms A chain and B interchain disulfide linkage, external synthetic insulin human.There are a lot of shortcomings in this method.Wherein topmost problem is to form at random owing to A chain and B interchain disulfide linkage.Therefore the molecule that produces often has incorrect three-dimensional structure.This molecule that forms at random is so many, so that cause normal insulin human's productive rate of biologically active to descend, and production cost significantly increases.Moreover, because intestinal bacteria are too little, be difficult to accept smoothly to have caused intestinal bacteria potential productive rate to be restricted as host cell such as the so relatively large gene of insulin human.

Second method, proinsulin gene is cloned in bacterium, and is expressed as one and contains A chain and B chain, and the single chain polypeptide (B-C-A) that connects for the C peptide.This method is based on C peptide institute role in the natural insulin synthetic process: it makes aminothiopropionic acid on A chain and the B chain become to be suitable for forming correct disulfide linkage (Bell et al., Nature 284:26-32 (1980)) on the space structure most.Through expression and secretion after the C peptide digestedly fall external, thereby the A chain is separated with the B chain.Although existing various methods seek to shorten the C peptide, the enzyme after this expression is cut and is remained this method necessary procedure.This be one time-consuming and expend the technological process of cost.The details of aforesaid method can be consulted the United States Patent (USP) 20030104607 of N.Annibali.In a word, genetically engineered drug is still being sought a kind of simple and economic novel method such as the production of Regular Insulin and derivative thereof so far.

Summary of the invention

The present invention had both related to method and had also related to a single reorganization of genetic structure and a system that comprises at least two expression cassettes.Each expression cassette is the peptide chain or the subunit coding of target protein.Each expression cassette has the 5 ' control region of oneself, and the peptide chain no matter its is encoded or the dna sequence dna of subunit are identical or different.

The reorganization of genetic structure of the present invention is expressed in host cell and has been produced at least two peptide chains or subunit.Each expression cassette in reorganization of genetic structure all has a homing sequence, it incites somebody to action the polypeptide of translation separately, each peptide chain or the subunit of this target protein of the part of the polypeptide chain that i.e. conduct is translated are processed justacrine to born of the same parents by predetermined path in cell.

As a specific examples, the host cell of Xuan Zeing has the ability that a plurality of peptide chains or the subunit of target protein are expressed the back modification here.The polypeptide of Chan Shenging is come out by secretory host cell with a kind of form of biologically active like this.Perhaps, this needs polypeptide chain is folded into correct three-dimensional structure, for example forms disulfide linkage in correct position.Perhaps, this needs target protein carrying out degradation process and glycosylation by the host cell internal secretion before extracellular fluid.

As another specific examples, this invention provide one simple and valid approach is produced a kind of target protein with at least two polypeptide chains.This target protein is to form by the enzyme digestion reaction after expressing under native state.This invention is then according to the quantity of peptide chain that is comprised in the target protein or subunit, makes up a carrier with the expression cassette of same quantity.The present invention has confirmed what these were expressed simultaneously, and different separately peptide chain or subunit produce desired target protein according to correct proportions through the cell processing mechanism.In a word, the present invention causes fundamentally having removed in order to keep any connection peptides of the correct space structure between the peptide chain.Thereby also just avoided the endonuclease reaction of each peptide chain of translation back disconnection, and relevant repeatedly purifying, modification step.In a word, be example with the production of Regular Insulin, the present invention has significantly been simplified production process, has improved productive rate.

Use the present invention and be not only applicable to those and under native state, could produce sophisticated protein, and be applicable to that those have many subunits, normally distinguish expressed protein through translation back endonuclease reactions.With the interleukin 12 is example, and the present invention can adopt each subunit of the vector encoded interleukin 12 of two expression cassettes structures.

Therefore, on the one hand, the present invention has caused a kind of reorganization of genetic structure to contain the target protein of plural peptide chain in order to expression, has replaced translation back enzyme and has cut the method that generates natural product.This reorganization of genetic structure comprises at least two expression cassettes.Each expression cassette contains a sequence and is a peptide chain encoding of target protein specially.Avoided endonuclease reaction after the essential translation of natural product by the target protein of this reorganization of genetic structure accurate translation.With regard to natural mammiferous target protein, the reorganization of genetic structure of the present invention is to be made of DNA or RNA.

On the other hand, the present invention has caused the novel method based on a kind of protein translation expression of this reorganization of genetic structure.

In addition, the present invention relates to a kind of cell that is transformed by above-mentioned reorganization of genetic structure.This cell can be expressed the target protein of biologically active, such as its natural folding characteristic, and and for example it does not need to translate the back endonuclease reaction as natural product.In a specific examples, at least one disulfide linkage has been present between the recombinant expressed peptide chain when target protein is secreted out.In another specific examples, hexose-based change when target protein is secreted out.

Again on the other hand, the present invention has caused producing the novel method of the target protein of biologically active.This novel method comprises provides the above-mentioned a kind of cell that is transformed by reorganization of genetic structure, and the target protein biologically active that passes through the expression in this cell, but need not to translate as natural product the back endonuclease reaction.

Again on the other hand, the present invention relates to a recombinant dna fragment that comprises following sequence:

Pm ₁-Ld ₁-Pt ₁-Y ₁-Tm ₁-Pm ₂-Ld ₂-Pt ₂-Y ₂-Tm ₂，

Above each listed element be operably connected to adjacent element.Pm is the Yeast promoter sequence.Ld is the yeast homing sequence.Pt is a protease recognition sequence.Tm is the yeast terminator sequence.In a specific examples, Y1 and Y2 are insulin human's the B chain and the dna sequence dna of A chain encoding.In another specific examples, Y1 and Y2 are respectively two protein subunit coded DNA sequences for interleukin 12.

In addition, the present invention relates to recombinant human insulin's molecule of producing in the following manner: a kind of eukaryotic cell that has reorganization of genetic structure is provided; This reorganization of genetic structure comprises first expression cassette that contains for the dna sequence dna of A chain encoding in the human insulin molecule, and is second expression cassette of the dna sequence dna of B chain encoding in the human insulin molecule; It also relates to this eukaryotic cell that is used to express, and this reorganization of genetic structure, recombinant human insulin's molecule and secreting, expressing thereof are to the periphery nutrient solution, until all processes of results recombinant human insulin molecule from the periphery nutrient solution.Recombinant human insulin's molecule of secreting, expressing is a biologically active in a specific examples.The eukaryotic cell of enumerating in the specific examples is a yeast cell.

Description of drawings

Noted earlier, this invents its its feature and advance and invention itself and will be able in the following description and the drawings further comprehensively understand.

Fig. 1 is the dna sequence dna (SEQ IDNo:1) (up) that illustrates natural human insulin's precursor B-C-A one by one and the comparison of the encoding sequence (SEQ ID No:2) (descending) of the human insulin precursor of yeast preference, is distinguished with the underscore of different colours.In 5 ' and 3 ' zone of overstriking is to be respectively proinsulin human's the B chain and the dna sequence dna of A chain encoding.At the region intermediate of overstriking not, be dna sequence dna for the C chain encoding.

Fig. 2 be the diagram polynucleotide " 5 '-USAp " (on) and " 3 '-USAp " (descending) be used for example 1 because of having the nucleic acid that complementarity mutually combines.When PCR, expect and to indicate with dotted line to the part that extend at two ends.

Fig. 3 is the first step of illustrated example 1, the sepharose image of the molecular weight of PCR product.The standard marker of PCR has shown and has laid respectively at 1K, 0.75K, 0.5K, 0.3K, the band of 0.15K and 50bp.First and second bands are the samples by the dna sequence dna of PCR synthetic human insulin precursor B-C '-A.The the 3rd and the 5th band is the sample of polynucleotide " 5 '-USAp ".The the 4th and the 6th band is the sample of polynucleotide " 3 '-USAp ".

Fig. 4 be illustrate a kind of based on the structure of zymic shuttle vectors pPIC9K and the dna sequence dna of expression of insulin precursor B-C '-A.This expression vector pPIC9K that describes (B-C '-A) be a kind of intermediate structure.

For next step vector construction is prepared.

Fig. 5 is that diagram has been described a kind of strategy that is used for example 1: with interstitial granules pPIC9K (B-C '-A) carrier construction pPIC9K (+B+A).

Fig. 6 be interstitial granules pPIC9K in the width of cloth (+B) in order to the restriction map (being labeled as " B ") of expressing human insulin B chain.

Fig. 7 be interstitial granules pPIC9K in the width of cloth (+A) in order to the restriction map (being labeled as " A ") of expressing human INSULIN A chain.

Fig. 8 be the final expression plasmid pPIC9K of a width of cloth (+B+A) in order to the restriction map of expressing human insulin B chain and A chain.

Fig. 9 is a Dot Blot photo.

The IN1 of left, normal man's Regular Insulin that on behalf of three kinds of concentration, IN3, IN5 increase progressively.Remaining is representative with the plasmid pPIC9K (+B+A) sample of the outer liquid of cell transformed.On behalf of the positive baryon through filtering out, each row transform the same of bacterial strain respectively and is cloned in the different fermentations time: 0 hour, and 24 hours, 48 hours, 72 hours, 96 hours, the extracellular fluid sample of collecting in 120 hours.Next line 9K representative is with the outer liquid sample of plasmid pPIC9K cell transformed.

Figure 10 is a Westurn Blot photo.

The IN display standard insulin human of left.Band 1,2,3,4 represent the sample of 24,48,72 and 96 hours the extracellular fluid of not representing through filtering out of positive baryon conversion strain fermentation respectively.

Figure 11 comprises three width of cloth high pressure liquid chromatography (HPLC) analysis charts

Last figure is labeled as 2 positive recombinant conversion strain fermentation 96 hour the extracellular fluid elution curve of sample representative through filtering out.

Middle figure is labeled as 2+IN and represents above-mentioned sample 2 to add the elution curve of normal man's Regular Insulin sample IN.

Figure below is labeled as IN and represents normal man's Regular Insulin sample elution curve.

Unless embodiment is indicated in addition, the implication of the conventional classical noun in the used here whole nouns of the present invention and other patent in the past is identical.Especially with reference to below with reference to the definition and the explanation of book: Sambrook et al. (1989) Molecular Cloning:ALaboratory Manual (Second Edition), Cold Spring Harbor Press, Plainview, N.Y.and Ausubel FM et al. (1989) Current Protocols inMolecular Biology, John Wiley﹠amp; Sons, New York, N.Y..Be appreciated that definition and explanation that the present invention is used are not limited to specific method, experimental arrangement and reagent.

Here the compound that constitutes by strand amino acid that said " polypeptide " or " peptide chain " or " subunit " relate to that peptide bond connects.Here said " protein " is made up of " polypeptide " or plural " polypeptide ".Here said " subunit " is a proteinic part.It is to be produced by single-minded natural mRNA.Different therewith is said here " peptide chain " though also be a proteinic part, also is to be produced by same natural mRNA, the endonuclease reaction after natural " peptide chain " needs to translate for the insulin human.

Here said " biological activity " is the structure that had of expression a recon or corresponding synthetic protein or polypeptide with its natural product, regulation and control, biochemical and physiological function.

Here said in the statement of nucleic acid " heterology " is that this nucleic acid of expression is not the endogenic or genomic composition of cell.This nucleic acid generally is by conversion, microinjection, method transfered cells such as electrotransfer.General this nucleic acid all has at least one encoding sequence, but this encoding sequence may not all be expressed.

Here said " genetic construction " is that expression any structure or sequence relate to genetic sequence, the polynucleotide of for example any amount of RNA or dna form, and mRNA, cDNA, the RNA of synthetic and DNA, cDNA, natural gene group DNA and RNAs and other sense-rnas and DNA derivative.This genetic construction can be two strands or strand, if strand, it can be a coding strand, also can be noncoding strand (antisense, complementary strand).This genetic construction also can be whole or part expression vector.

Here said " expression vector " is meant to have and enters and at the carrier of host cell inner expression extraneous nucleotide ability.

" expression cassette " is meant a kind of transcription unit.Here said expression cassette is a unit of expression vector.It comprises one section and is normally ectogenic protein or protein component nucleotide sequence coding.Its normally regulatable sequence can influence the expression at host cell of this ectogenic protein or protein component.In general, eukaryotic regulating and controlling sequence comprises the ribosome bind site and and the transcription termination sequence of transcripting promoter and suitable transcript mRNA.

" be operably connected " or the Nucleotide zone of " operationally associating " is meant the Nucleotide zone that function is relevant.For example: the nucleotide sequence of a promotor is exactly that the nucleotide sequence relevant with transcriptional control is associated; Same, a ribosomal binding site then is associated with one section coded protein translation.Generally speaking, be operably connected be meant in abutting connection with or approaching, not only be connected with each other in the guidance field and also connect at read area.Certainly, all elements that are operably connected also can be spaced.

Here said " C peptide " is meant the connection portion in the B-C-A polypeptide of insulin precurosor strand linear molecule.The C peptide is connected with the 30th amino acids of B chain and the 1st amino acids of A chain respectively.

The present invention provides a high yield easy, the pharmacy novel process of the improved cell base of exploitation of innovation gene expression technique.One of characteristics, the expression vector of structure contains many expression cassettes.Each expression cassette is the different components coding of target protein.Selected host cell has each component of expression, and makes it by being processed into the cytology function of biologically active form.Thereby omitted many existing industrial production steps,, modified and enzyme is cut step etc. such as purifying repeatedly.

Expression vector

In order to adopt gene recombination method production to contain the target protein of a plurality of polypeptide chain components, the target protein of natural form is sought and provided or copied to the present invention, synchronously, expresses each component (polypeptide chain or subunit) according to correct ratio.Attempted to adopt the trial of the proteinic compound expression of single promotor control polycomponent to run into a lot of difficulties in the past.Productive rate is just disappointing from the beginning.This may be because the ectogenic dna sequence dna of single promotor control has been subjected to the restriction of inner expression efficiency.Moreover, expressed single polypeptide chain (as the Regular Insulin) exogenous protein of single promotor or expression cassette must be cut step through complicated enzyme and makes the single polypeptide chain of this wire become some peptide chains or subunit and remove any connection peptides.

Therefore, this invention has made up a kind of expression vector that contains two above expression cassettes.Each expression cassette is expressed the polypeptide chain or the subunit sequence of target protein respectively.Since each peptide chain or subunit be respectively one independently promotor control, so no matter whether identical its promotor is, its expression efficiency all can improve significantly.Above-mentioned expression cassette can be at interval in carrier, also can be adjacent.In an object lesson, a plurality of expression cassettes contain identical promotor.So it is identical that each expression cassette is expressed the efficient of each polypeptide chain or subunit.

The final part or all of target protein of vector encoded.For example, a sophisticated target protein molecule has three different components (polypeptide chain or subunit) A, B, and C.An expression vector contains two expression cassettes, the component of encoding respectively A and B, i.e. 2/3rds target protein.If contain three expression cassettes with expression vector in the example, the component of encoding respectively A, B, and C, then expression vector is expressed whole albumen.In the object lesson of this invention, the structure of expression cassette is consistent with the polypeptide chain component quantity of target protein.If component A is the twice of B component in ripe target protein, then in the expression vector of this invention, will contain two expression cassette coding component A, an expression cassette coding B component.

Each expression cassette should comprise the regulation and control composition of various expression.Expression cassette is initial and affect the expression of downstream sequence by 5 ' regulation and control zone.Generally speaking, transcripting promoter and ribosome binding sequence are contained in eukaryotic cell regulation and control zone.And expression cassette also can be finished by the sequence (terminator) of one section control Transcription Termination.The desired polypeptide fraction of coding is and 5 ' regulation and control zone and 3 ' terminator sequence cognation under the perfect condition of this invention.Simultaneously, each expression cassette can comprise one or more enhancement sequences to strengthen the expression of encoding sequence.Many enhancement sequences can Individual existence.It can be present in other position of the expression vector upstream and downstream outside the expression cassette.Part or all of regulation and control composition, as whole 5 ' regulation and control zones, promotor, homing sequence, key elements such as terminator sequence and optional enhancement sequences in many expression cassettes can be identical also can be different.5 ' regulation and control zone in particular instance, promotor all is identical with the mRNA ribosome bind site at each expression cassette.The control of transcribing with translating to each component coding of polypeptide also all is identical.This that is to say that the compound expression that acts in agreement is optimal.

Host cell is by the polypeptide expression that expression vector carried out, and wherein each expression cassette can comprise the part of a homing sequence as it.This homing sequence is translated as signal peptide, thereby impels ectogenic polypeptide fraction to enter processing approach in the desired cell.For example the polypeptide with translation is transferred to endoplasmic reticulum, enters golgi body then and finally secretes external.Under ideal state, in case signal peptide is discerned and processed by host cell, this polypeptide just is secreted into external substratum as target protein.Signal peptide is in this process or afterwards soon by enzymolysis.Errorless for guaranteeing, the expression cassette sequence of can encoding makes a kind of proteolytic enzyme to discern and cuts away it.A kind of protease recognition sequence is to rely amino acid-arginine, can be discerned by restriction endonuclease Kex2 and enzymolysis between arginine and adjacent downstream amino acid.This signal peptide-coding homing sequence, and in this invention genetic construction any other composition with respect to produce proteinic host microorganism both can be homology also can be heterology.

In case obtain suitable target protein clone's polypeptide fraction (peptide chain or subunit), no matter it is to come from cDNA or genome, adopts general recombination and expression techniques, and its sequence is inserted expression cassette.Preferably allow these clones' coding and host cell mate.In an object lesson, the component of all expression cassettes all is identical except the sequence of exogenous polypeptid component.This has just caused the expression condition of each polypeptide fraction of target protein to reach synchronization to greatest extent and homogeneity, so that reach simultaneously, carries out compound expression equally.

According to the direction of this invention, the genetic construction of specific examples contains many expression cassettes.Each expression cassette has following sequence:

Pm _n-Ld _n-Pt _n-Y _n-Tm _n

Pm represents promoter sequence, and Ld represents homing sequence, and Pt represents protease recognition sequence, and Y represents each peptide chain of target protein or the encoding sequence of subunit, and Tm represents terminator sequence, and n represents exponent sign.Each listed component all is end to end.Clearly, has the sequence that also may not add in the formula between each component.A component may be overlapping with adjacent component.For example, protease recognition sequence (Pt) may be the part of homing sequence (Ld).

If a protein has two or more different polypeptide chains or subunits, then the concrete implication in the expression cassette of this invention (two) is:

Pm ₁-Ld ₁-Pt ₁-Y ₁-Tm ₁-Pm ₂-Ld ₂-Pt ₂-Y ₂-Tm ₂，

Y wherein ₁And Y ₂Representing proteinic separately peptide chain or subunit.

Any suitable expression vector all can be born in this invention in order to express the task of genetic recombination structure.Many protokaryons or Eukaryotic expression vector are by commercialization.Be contained within the ken of the present invention in order to attempt to make up the knowledge that a genetic construction starting point expression vector selects.Generally speaking, be plasmid in order to implement common carrier of the present invention, virus (comprising phage), the dna segment that can integrate (being the segment that available genetic recombination mode is integrated into the host).Can say that perhaps this expression cassette can have one or more copy stably to be inserted into the special site of host cell, it also may be integrated on extrachromosome or the little karyomit(e) element.

Most of plasmids all include various controlling elements.For example, outstanding yeast vector all has by primary endogenous 2 microns yeast plasmid or ARS this plasmid is bred in yeast cell with high copy number.Kinetochore (CEN) sequence has then limited the ability that plasmid duplicates, number of copies is bred in yeast cell.Should also be noted that its terminator sequence.

These carriers can solely be positioned at the host and duplicate comprehensively, and as plasmid, it also can be incorporated on the karyomit(e), as the dna segment of integrating.Under the best condition, its carrier contains and duplicates and regulating and controlling sequence, and these sequences then derive from desirable expressive host.For example, in host cell, can exercise promotor be one section can be in conjunction with one section sequence of the RNA polymerase of this host cell, it can also be used as this host cell rrna bonded sequence.

First-selected expression plasmid also will have one or more selectable marker genes.Thus, can provide the selection of the kenel of conversion, they can be the resistance characteristics of Eukaryotic Tetrahydrofolate dehydrogenase or Xin Meisu; It also can be the resistance feature of tsiklomitsin or the cyanomycin of prokaryotic organism E.coli.Inserting the expression cassette that makes up is known recombinant expressed important technology to expression plasmid, and it can describe in detail in the example afterwards.Suitable be used for the introduction that protokaryon and eukaryote host clone and expression vector also are found in Sambrook etc.

What stress in the concrete technical description of this invention is a kind of yeast vector.The promotor of any functionating in Yeast system all may be made.Promotion sequence useful in the yeast vector comprises following promotor, and they are: metallothionein(MT), 3-phosphoglycerate kinases, or other carbohydrate-splitting enzyme, as enol glyceraldehyde-3-phosphate dehydrogenase, hexokinase, decarboxylase, phosphofructokinase, glucose-6 phosphoric acid isomerase, 3-phosphoglycerate mutase, pyruvate kinase, 3 phosphoric acid isomerases, glucose phosphate isomerase, these terminator sequences are connected with heterogeneous 3 '-end, so that Poly (A) is provided and impels the termination of mRNA.When preparation good expression vector of the present invention, the zero position of translation can (be seen Cigan, M.andDonanne, T.F. with reference to the nucleotide sequence that awards effective expression in most of yeast cell, Cene, the description of relevant outstanding translation initiation site among the 59:1-18 (1987)).

Host cell

The present invention has suitably adopted eukaryotic expression system.Because prokaryotic system does not have modification and folding cell mechanism after the translation, aspect known modification content, what wherein have is addressed, but is not limited to these.They are acetylizes, acetylizing, amidation; ADP-riboseization (ribosylation); glycosylation, the GPI-ancora forms, the covalent attachment of ester number and ester derivative; methylate; myristlyation, pegylation, prenylation; phosphorylation, ubiguitination or other similar process arbitrarily.

In concrete practice, this expression vector is introduced into eukaryotic cell, entrained on it is the coded protein chain of various expression cassettes or subunit Secretory Pathway by himself existing in this cell, the correct folding mature protein of secretion, one of them, what use is exactly with the cell of yeast as the host.

Yeast has mechanism of secretion, and its this mechanism of secretion is consistent with mammiferous excretory system, comprising its folding ability of mind, and the proteolysis process, glycosylations etc. are consistent with the Mammals mode.When using appropriate carriers, yeast then can be sent expressed proteins in the extracellular, reclaims also similarly to Mammals with the employed program of these protein in nutrient solution of purifying, even its yield compares from Mammals recovery and purifying, and they are higher.In addition, this excretory system also provides the suitable environment (Smith etc., schenee 229:1219 (1985)) that protein disulfide bond forms that obtains

Cereuisiae fermentum has been used to produce many kinds of protein in each primary yeast.Generally speaking, cereuisiae fermentum utilizes its maturation factor (α-factor) to make protein expression, and this maturation factor is made up of signal peptide (pre) and presequence thereafter.Signal peptide sequence is made up of 19 amino acid, and presequence then is made up of 66 amino acid, comprising the enzyme action site (waters etc., JBC, 263:6209-14 (1988)) of the Kex2 restriction endonuclease of N-sugar side group and two basic aminoacidss of tool.Yet the existing method of utilizing cereuisiae fermentum often faces because the problem of the promotor of more weak ability and proteolytic enzyme effect too early.

As the Pichia pasteris of methanol yeast, demonstrate unique advantage in this invention, these single celled organisms have the ability of mass production exogenous protein.They can utilize methyl alcohol to make sole carbon source and grow lacking under the situation of glucose, and keep high-density growth in jumbo fermentor tank, and according to different protein, can obtain in this expression system than other is the result of high 10-100 times output.For example, Pichia pasteris cell can grow into high-density, utilizes its sub-AOXI of alcohol dehydrogenase promoter, and this startup is controlled by the strictness of methyl alcohol.As a result, under the situation that does not influence its growth heterologous protein since methyl alcohol induce the acquisition high expression level.In addition, methanol yeast has the ability that the many higher organism cells of generation carry out posttranslational modification, and these are repaiied and comprise protease hydrolysis, protein folding, and the formation of disulphide bridges and glycosylation, this just makes this system become the ideal expression system of suitability for industrialized production.

Pichia Pastoris is a primary yeast (Cregg:J. etc., Biol Technology 11:905-910 (1993)) that can utilize methyl alcohol in 4 genus of 12 kinds.Its mechanism of secretion, P.Pasteris is identical (Wang, Y. etc., BiotechnologylBioengineering 73:74-79 (2001)) with cereuisiae fermentum.Another yeast expression system that can effectively utilize methyl alcohol is Hansenula polymorpha, and these 4 can be utilized the yeast belong of methyl alcohol to be: Pichia, Candida, Hansenula and Torulopsis.Note that except that above-mentioned methanol yeast the yeast of other kind is cereuisiae fermentum and Kluyvoromyces lactis, they also can be used among the present invention.

When a clone selected as expression system or host, or a plurality of carrier units that carry the constructed reorganization of genetic structure of the present invention are when introducing host cell, this means that also used host cell is also transformed by the carrier that makes up through genetic technique of the present invention among the present invention, and can be produced as protein or the polypeptide that recombinant technology makes up.Host cell is also by genetic modification (i.e. transduction transforms transfection).Situation is preferably, and this expression vector has one or more selectable marker gene, therefore can select in an easy manner through genetically engineered host cell.

Host cell through genetically engineered mistake can be grown in traditional nutritional medium, and this nutrition base is transformed to be suitable for activating promotor, selects the gene of the transformant or the heterogeneous sequence encoding of increasing.As temperature, be elected to be the host cell culture condition of expression before pH is similar in the culture condition, they will be as content of the present invention.Collect and identify the technology of these expressed protein or polypeptide, comprise separation, purifying, modify and assembling etc. also belongs to routine techniques of the present invention.

The present invention is by following experimental verification, but is not limited to these experiments.

Experiment 1

In order to obtain the bioactive insulin human of tool, in a kind of yeast host, introduce plasmid by expressing respectively by tool A, B chain, this primary yeast, the shuttle plasmid of bacterium are pPIC9K, wherein available following formulate:

Pm-Ld-Pt-Y1-Tm-Pm-Ld-Pt-Y2-Tm

Here, Y1 is the dna sequence dna of coding A chain, and Y2 then is the dna sequence dna of coding B chain, because used host is methanol yeast P.Pasporis, so Y1 and Y2 are yeast preference codon, and other element such as following formula:

Aox1Pm-YeastLd (s)-Kex2 site-Y ₁-Aox1Tm-

Axo1Pm-YeastLd (s)-Kex2 site-Y ₂-Aox1Tm,

Here, Yeast Ld sequence is translated as signal (peptide) (preceding) sequence, then is former sequence.Its carboxylic end is the short sequence of " Lys-Arg ", and it is the restriction enzyme site of Kex2.

1. the structure of carrier

The summary of the strategy of vector construction as:

The first step: contain restriction endonuclease SnaB1 respectively like 5 ' and 3 ' end of sequence and the Notl site is synthetic by PCR with proinsulin human the B-C '-category-A of yeast preference coding.Wherein " C ' " be the analogue of insulin human natural " C " chain, utilize their SnaBI and NotI site, this B-C '-A encoding sequence can be inserted on the specific expression cassette, this expression cassette is positioned at after the Aox1 promotor of pPIC9K plasmid, obtain expression plasmid pPIC9K (B-C '-A).

Second step: with pPlC9k (B-C '-A) be template, the synthetic B fragment of PCR of the product of XhoI and EcoRI recognition site is arranged respectively with two ends, after enzyme is handled, be inserted into pPIC9K, obtain the plasmid of expression B chain expression cassette, be called pPIC9K (+B).

The 3rd step: " B " in second step is that " A " replaces the gained plasmid respectively to be: pPIC9K (+A)

The 4th step: with pPIC9K (+A) be template, be two products that Aat II recognition site is an end, the fragment of the complete A chain of PCR anamorphic zone expression cassette with two ends.

The 5th step: handle with Aat II by the 4th step and second step synthetic fragment and the plasmid and connect, transform, the screening plasmid gets pPIC9K (+B+A), wherein contain the expression cassette of two molecules, an expression B chain, another expression A chain.

Some step is carried out with different orders in this literary composition, is the molecular biology program of standard but this example adopted, sees Ausnbel, and F.M. waits " molecular cloning experiment guide " second edition (1992) of compiling, and specific procedure is as follows:

＜the first step: intermediate plasmid pPIC9K (B-C '-A) structure.

See that Fig. 1 SEQ ID NO:1 is the dna sequence dna that natural pancreas islet former (B-C-A) derives from the online database of NCB1, SEQ ID NO:2 is a yeast preference sequence, and its both different following horizontal lines mark.

5 ' and 3 ' end solid line part is marked as B and A chain-ordering respectively among Fig. 1, and the fine rule part then is the C chain-ordering in the middle of each.

In order to simplify procedures, its C chain indicates with " C ' ", the present invention with two amino acid code filial generations it, i.e. " AAAAGA ", certainly, the C chain can also be different lengths or different amino acid coding.Accordingly, two single strain oligonucleotides, SEQ ID NO:3 and 4 is respectively the encoding sequence of B and A chain, comprising C ' sequence is arranged.Its result, this paired oligonucleotide can synthesize purpose B-C '-A chain as template and primer with the PCR form mutually.Its two oligonucleotides are respectively:

5’-USAp(100nt)(SEQ ID NO：3)

5’-

TTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTT T CTTCTACACTCCAAAGACT-3’，

3’-USAp(100nt)(SEQ ID NO：4)

5’-ATAT

TTAGTTACAGTAGTTTTCCAATTGGTACAAAGAACAAATAGAAGTACAACATTGTTCAACAATACCTCT T TTAGTCTTTGGAGTGTAGAAGA-3’

Above-mentioned two oligomer last 3 ' end 20 (following horizontal line are) that Nucleotide is complimentary to one another, these complementary portions in PCR by this as primer.Consequently obtain the proinsulin analogue of B-C '-A.5 ' the end of 5 '-USAp has restriction endonuclease snaB1 site, with two marks of horizontal line down is.5 ' of 3 '-USAp-end then has the restriction enzyme site of enzyme NotI, also is that two horizontal lines down illustrate.

Above-mentioned two polynucleotide 5 '-USAp and 3 '-USAp are synthetic by Integrated DNATechaologies Iac (Coralville, IA USA).(B-C '-A) PCR is synthetic: in the miniature centrifuge tube of the 0.5ml that is cooler than ice bath in advance, adds in the following order: the damping fluid of 10 times of concentration of 5ul, 8.5ul every kind of dNTP that contains 1.25mM concentration, 5 ' the USAp (50-100ng) of 10ul, 3 ' the USAp (50-100ng) of 10ul, 0.5ul Taq archaeal dna polymerase (5u/ul) adds ddH20 to 50ul.Be reflected in the temperature automatically controlled PCR instrument and carry out: 94 ℃ 4 minutes, 55 ℃ 2 minutes, 72 ℃ 3 minutes.5 cycles like this.Product is identified (Fig. 2) with 0.7% sepharose.Proof has obtained the 184bp segment of expection.

Yeast is worn sour plasmid pPIC9K available from American I nvitrogen, and Kanamyin resistant gene, cyanomycin resistant gene and Histidine sign are arranged among Fig. 4.Therefore, no matter in bacterium or yeast during transformant, all can be selected and in the histidine defect type, select to provide the individuality of high resistance.Expression cassette among the pPIC9K, promotor and the end of promptly containing 5 '-AOX1 ahead contain the part that 3 '-AOX1 stops (TT), also include the replication site that instructs gene expression product excretory homing sequence (" S ") and protein restriction endonuclease Kex2 site and the E.coli by plasmid PBR322.

The above-mentioned B-C ' of glue purification-A segment and plasmid pPIC9K cut with restriction endonuclease SnaBI and NotI enzyme, are connected to each other then.It connects product and transforms (E.coli) cell of TOP10F '.Transformant is cut and should be demonstrate,proved by enzyme.

Transformant is further determined by the sequential analysis of TakaRa Biotechology (Dalion) company.Its result following (SEQ ID NO:5):

5’- GCATTACGTATTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGACT GGTATTGTTGAACAATGTTGTACTTCTATTTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAA GCGGCCGCATAT-3’

Wherein, 5 '-and 3 '-two ends be SnaBI and NotI, indicate with single horizontal line down, C '-peptide then indicates with two horizontal lines down.Homology is by the DNAMAN software analysis, and is in full accord with PCR B-C '-A sequence.Fig. 5 shown pPIC9K (B-C '-A) with pPIC9K (+B+A) between the two comparing result.The above work, below second to the 5th the step in more detailed explanation is arranged.

＜the second step: intermediate pPIC9K (+B) structure 〉

Below two oligonucleotides are TaKaRa Biotechnology company synthetic, with them as primer, with pPIC9K (B-C '-A) make template,

5 '-primer (36nt) (SEQ ID NO:6):

5’-ATCT CTCGAGAAAAGATTCGTTAACCAAC ACTTGTG-3’

3 '-primer (36Nt) (SEQ ID NO:7):

5’-ATCT GAATTCATCTTAAGTCTTTGGAGTGTAGAAGA-3’

Their 5 ' end has the XhoI recognition site, and 3 ' end has the EcoRI recognition site, and horizontal line is indicated to place an order.

Synthesize the DNA chain (as follows) of the 122bp length of B chain through 30 circulations by above-mentioned PCR condition, its two ends are contained XhoI and EcoRI restriction enzyme site respectively, and horizontal line marks to place an order.

5’-ATCT CTCGAGAAAAGATTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGACTTAAGAT GAATTCAGAT-3’

The PCR product digests and purifying with XhoI and EcoRI.Insert also with the plasmid pPIC9K of XhoI and EcoRI digestion, form together then another as shown in Figure 6 intermediary carrier pPIC9K (+B).Select and identify positive recombinant chou by the Restriction Enzyme analysis.

＜the three step: intermediate plasmid pPIC9K (+A) structure 〉

Following oligonucleotide is synthetic by TakaRa Biotechnology company, with pPIC9K (B-C '-A) as template:

5 '-primer (36nt) (SEQ ID NO:9):

5’-ATCT CTCGAGAAAAGAGGTATTGTTGAACAATGTTG-3’

3 '-primer (36Nt) (SEQ ID NO:10):

5’-ATCT GAATTCATCTAGTTACAGTTAGTTTTCCAATT-3’

XhoI and EcoRI point of contact indicate with the horizontal line that places an order.

By aforementioned PCR condition, after 30 circulations, the segment that synthesizes 95bp is as follows: its 5 '-and 3 '-end respectively contain XhoI and EcoRI restriction enzyme site, show it by single line down:

5’-ATCT CTCGAGAAAAGAGGTATTGTTGAACAATGTTGTACTTCTATTTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAGAT GAATTCAGAT-3’

Above-mentioned PCR product is with Xhol and EcoR1 double digestion, be connected with pPIC9K after also cutting with above-mentioned two enzyme enzymes another intermediate plasmid, promptly pPIC9K (+A).As Fig. 7, its positive recon is cut conclusive evidence with enzyme.

＜the four step: the structure that contains the expression cassette of coding insulin human A sequence 〉

Following two oligonucleotide are synthetic by Takaka Biochnology company, with pPIC9K (+A) be template.

5 '-primer (30Nt) (SEQ ID NO:12)

5’-ATCT GACGTCAGATCTAACATCCAAAGACC-3’

3 '-primer (30Nt) (SEQ ID NO:13):

5’-ATCT GACGTCAAGCTTGCACAAACGAACTT-3’

Its 5 '-end and 3 '-end contains the AatII restriction enzyme site respectively, and following horizontal line shows it.

Adopt above-mentioned PCR condition, 30 synthesis cycles, its PCR product electrophoresis on sepharose is confirmed.The glue absorption method obtains long 1697bp segment, and its structure is represented with following formula:

AatII-5 ' AOX1 promotor-S-insertion sequence A-3 ' AOX1 (TT)-AatII

＜the five step expression plasmid pPIC9K (+B+A) structure 〉

Segment and the pPIC9K (B) of the above-mentioned 1697bp5 of containing '-AOX1 promotor-S-insertion sequence A-3 '-AOX1 (TT) all cut through the AatII enzyme, connect, and transform, select, its final expression plasmid pPIC9K (+B+A), obtain (see figure 8) through enzyme spectrum analysis.

2. the cultivation of host cell transforms the characterized with recon

The cultivation of host cell, the evaluations of conversion and transformant etc. are all by (Pichia Protocols such as David R.Higgins, edited by D.Higgins and J.Cregg, Humana Press (1998)) method of Tui Jianing is carried out, roughly process comprises the cultivation of GS115, transform, the selection of recon, phenotype (his+ glucose 1-his and+methyl alcohol) is determined.The selection of high expression level strain in bottle or the fermentor tank etc. is shaken in phenotypic selection of Mut and expression test.

Transform and select the program of resistive recon as follows: the preparation of GS115 competent cell; PPIC9K (+B+A) DNA adds cell after with enzyme SalI linearizing, be added to behind the mixing in 0.2 conversion tube; Its electric shock condition is: 1.5KV, 2.5 μ F, 200ohm, electric shock back T1 and T2 between 4-5 for well; Sorbyl alcohol with 1.0ml 1.0M washes out; Coat on the MD/-HIS flat board, check the yeast spot after 24 hours for 30 ℃; Choose single bacterium colony separate application and select culture dish (MD) or methyl alcohol to select on the culture dish (MM) in glucose, growth is Mut+ rapidly on the MM flat board, other be Muts (methyl alcohol slowly utilizes type); Renewed vaccination is to the flat board that contains the G418 different concns, and the bacterium colony of screening resistance maximum (it is the highest promptly to insert number of copies) is preserved standby.

Be expression vector pPIC9K (+B+A) the bacterial strain GSGT1 registration that transforms of success and be stored in Chinese Wuhan, Wuhan University China typical culture protection center.

3. insulin human's expression

Put high copy transformant in the MGY of 25ml substratum 30 ℃ earlier, 300rpm overnight incubation (about OD600=4), change that 30 ℃ of 300rpm are cultured to growth logarithmic phase (about OD600=4.0) in 1 liter the MGY substratum over to, under the 2500xg room temperature centrifugal 5 minutes, throw out is suspended in (OD600=1.0) in the BMMY substratum again, 30 ℃, 300rpm continues to cultivate, add 100% methyl alcohol every day to nutrient solution, contain 0.5% methyl alcohol to induce the expression of insulin B and .A chain, per 4 hours with vapor-phase chromatography monitoring methanol content.So cultivated about 90 hours.Under the 2500xg room temperature centrifugal 5 minutes, supernatant liquor was preserved standby down in-80 ℃, and host cell can add fresh culture to be continued to cultivate separation of human Regular Insulin from above-mentioned centrifuged supernatant.

After expression product precipitation in the supernatant concentrates, at least through millipore filtration, purifying procedures such as hydrophobic reactant chromatography or ion exchange chromatography.The above-mentioned Regular Insulin of expressing is by the reverse hplc purifying.

4. quality product is identified

Above-mentioned supernatant product concentrates by precipitation, and confirms by immune Blot and Western Blot.Fig. 9 is the diagram of immune Blot experimental result.Carry out in standard immunoassay Blot mode, use be mouse-anti insulin human's antibody.(Code No：2D11-45.Santa CrnzBiotechnology，lnc.，Santa Craz.Colifornia.USA)。Leftmost is the positive control (1N1 to 1N5) that increases insulin human's concentration successively.Other is that different (+single bacterium colony of B+A) transforming is at the difference collected supernatant product of period of growing through recombinant vectors pPIC9K." 9k " is the culture supernatant of collecting at different growing stage through the pPIC9 transformed host cells, with it as blank.As shown in Figure 9, three strain transformant bacterial strain B36, C320 and D138 insulin human's expression amount all increases with increasing of fermentation time.

Figure 10 is Western Blot result's a photo.Western Blot method by standard is carried out, and used is the clonal antibody (Code N0:ID11-H5) of the synalbumin of mouse.Rightmost being marked with " 1N " be the insulin human of standard.Other then for the recombinant plasmid pPIC9K (nutrient solution of+different strains that B+A) transforms.1-4 is respectively 24,48,72 and 96 hours fermented liquid of fermentation.Visible is that the protein band that obtains of fermentation in 72 hours is consistent with the insulin human of standard among Figure 10.Fig. 9 comes B and A chain to obtain respectively expressing in the Pichia Pastoris cell that transforms with Figure 10 illustrated together insulin human and equipment is secreted into the insulin human.

Figure 11 is the elution curve of HPLC detection insulin expression level.Three figure all have a common elution peak, and promptly 24.5 minutes, internal standard Regular Insulin wash-out position showed identical with the Regular Insulin of expressing generation fully.Compare with standard Regular Insulin, the Regular Insulin of expressing in this system is about 400mgle, and elution peak further part SDS-PAGE is analyzed (special train goes out as a result) and Western Blot analysis (see figure 10)

There is the several different methods can be in order to test the biological activity of expressed Regular Insulin.For example, give 40 health respectively, the purified expression product of normal mouse intraperitoneal injection 0.2ml.After 20 minutes, from them, get blood.With them as test group.After 3 hours, when the blood sugar recoveries of these mouse to standard state, give above-mentioned 40 mouse abdominal injection 0.2ml again with the insulin human again, again 20 minutes afterwards, from the mouse of above-mentioned injection, get blood as positive controls, collected sample is under normal circumstances injected as negative control group with expressed products and commercial Regular Insulin in the front, and the glucose level in this group is carried out and biological analysis.If test demonstrates the reduction of glucose level, then proof has biological activity.The i.u of its trial product (international unit activity) can be by relatively calculating with known positive positive group.

Experiment 2

Here introduce another kind of make up recombinant expression vector pPIC9K (+B+A) program, wherein principal character be saved intermediate pPIC9K in the experiment 1 (B-C '-A) structure.Introduce main difference point between the two below, identical then in to omit.

＜the first step: intermediate pPIC9K (+B) structure 〉

Coding good according to Yeast system used among Fig. 1 obtains the dna segment of insulin human B chain as laxative remedy, and two 3 '-end afterbody phase complementary oligonucleotide is:

5’-Oligo(71Nt)(SEQ ID NO：14)：

5’-GCTA

AAAAGATTCGTTAACCAACACTTGTGTGGTTCTCACTTGGT TGAAGCTTTGTACTTGGTTT-3’

3’-Oligo(70Nt)(SEQ ID NO：15)

5’-TAGC

TTAAGTCTTTGGAGTGTAGAAGAAACCTCTTTCACCAC AAACCAAGTACAAAGCTTCA-3’

Above-mentioned two oligomer 3 '-20 Nucleotide SEQ of end ID NOS:14 and 15 complimentary to one another, as the oligonucleotide among Fig. 2, their are complementary and extend (dotted portion) each other as primer in PCR each other.The result has obtained double-stranded B chain.At 5 ' of SEQ ID NO:14-end the Xho1 restriction enzyme site is arranged, indicate with two horizontal lines down.At 5 ' of SEQ ID NO:15-end the Notl restriction enzyme site is arranged then, also following two horizontal lines are indicated.

Carry out 5 circulations, the dna segment of acquisition 121bp length by the program of experiment 1 according to PCR.This segment and be inserted into pPIC9K just set up out intermediate carrier pPIC9K (+B).Its practice is that the B segment of above-mentioned glue purification is cut with enzyme XhoI and Notl enzyme, and plasmid pPIC9K is earlier with the Notl complete degestion, then partially digested with XhoI again, cut the big segment of recovery the mixture glue from enzyme, and be connected with B segment that enzyme was cut, connect product and transform TOP10F ' E.coli cell, and by the (+B) DNA of preparation intermediate plasmid pPIC9K in the transformant.

Select positive recombinant, and identify with restriction enzyme and electrophoretic method.The B segment of inserting is done further sequential analysis, with the known array contrast, confirms as (SEQ ID NO:16):

5’-TTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGACT-3’

＜the second step: intermediate plasmid pPIC9K (+A) structure 〉

Identical with above-mentioned experiment 1, below two oligomer also adopt yeast preference codon among Fig. 1, by synthetic its A segment of human insulin precursor:

5’-Oligo(90Nt)(SEQ ID NO：17)：

5’-GCTA

AAAAGAGGTATTGTTGAACAATGTTGTACTTCTATTTGTTCTTTGTACCAATTGGAAAACTACTGTAAGCGGCCGCGCTA-3’

3’-Oligo(90Nt)(SEQ ID NO：18)：

5’-TAGC

TTACAGTAGTTTTCCAATTGGTACAAAGAACAAATAGAAGTACAACATTGTTCAACAATACCTCTTTTCTCGAGTAGC-3’

For the XhoI recognition site and the following respectively two horizontal lines of SEQ ID NO:18 5 '-end NotI recognition site of SEQ ID NO:175 '-end are indicated.

Carry out the PCR reaction with the method for the experiment the first step, obtain the segment of required 91bp, this segment and pPIC9K cut with XhoI and NotI enzyme equally, connect.After transforming TOP10F ' cell, it inserts segment and identifies with above-mentioned same method.

＜the three step: A chain expression cassette is to test the method preparation in the 4th step in 1.

＜the four step: last expression plasmid pPIC9K (+B+A) undertaken by the 5th step in the experiment 1.

Experiment 3

Method by introducing in the experiment 1 and 2 can be applied to make up two developed by molecule boxes on same expression vector, in the protein molecular of expression in vivo and two heterodimers of equipment.As interleukin 12.One of them is used to express the P35 of interleukin 12, and another then is used to express the encoding sequence of the P40 of interleukin 12.

Identical carrier and host also can be as the productions of interleukin 12.Promptly change the experiment 1 and 2 B chains that are used for expressing human Regular Insulin and can be used for expressing the P35 of interleukin 12, and be used for the P40 chain that expressing human INSULIN A chain expression cassette can be used for expressing interleukin 12.The details of its change is found in the concrete experiment.

Disclosed patent documentation and scientific publication thing are incorporated herein by reference above this paper.

The present invention describes so that its all respects can be understood more fully with certain embodiment, is not for the present invention being limited to these indivedual concrete embodiments.On the contrary, be all may be included in alternative, modification and the Equivalent in the restricted portion in the incidental claim of the present invention in order to cover.

Sequence table

＜110〉Jino medicine company (Genoteins Pharmaceutical Inc.)

＜120〉coexpression of multiplexed protein chain or subunit

<130>P12988MXD

<150>CN 200410061039.0

<151>2004-11-03

<160>18

<170>PatentIn version 3.3

<210>1

<211>261

<212>DNA

<213>Homo sapiens

<400>1

tttgtgaacc aacacctgtg cggctcacac ctggtggaag ctctctacct actgtgcggg 60

gaacgaggct tcttctacac acccaagacc cgccgggagg cagaggacct gcaggtgggg 120

caggtggagc tgggcggggg ccctggtgca ggcagcctgc agcccttggc cctggagggg 180

tccctgcaga agcctggcat tgtggaacaa tgctgtacca gcatctgctc cctctaccag 240

ctggagaact actgcaacta g 261

<210>2

<211>261

<212>DNA

＜213〉yeast

<400>2

ttcgttaacc aacacttgtg tggttctcac ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tccaaagact agaagagaag ctgaagactt gcaagttggt 120

caagttcaat tgggtggtgg tccaggtcct ggttctttgc aaccattggc tttggaaggt 180

tctttggaaa agagaggtat tgttgaacaa tgttgtactt ctatttgttc tttgtaccaa 240

ttggaaaact actgtaacta a 261

<210>3

<211>100

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>3

gcattacgta ttcgttaacc aacacttgtg tggttctcac ttggttgaag ctttgtactt 60

ggtttgtggt gaaagaggtt tcttctacac tccaaagact 100

<210>4

<211>104

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>4

atatgcggcc gcttagttac agtagttttc caattggtac aaagaacaaa tagaagtaca 60

acattgttca acaatacctc ttttagtctt tggagtgtag aaga 104

<210>5

<211>184

<212>DNA

<213>Artificial

<220>

＜223〉PCR product

<400>5

gcattacgta ttcgttaacc aacacttgtg tggttctcac ttggttgaag ctttgtactt 60

ggtttgtggt gaaagaggtt tcttctacac tccaaagact aaaagaggta ttgttgaaca 120

atgttgtact tctatttgtt ctttgtacca attggaaaac tactgtaact aagcggccgc 180

atat 184

<210>6

<211>36

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>6

atctctcgag aaaagattcg ttaaccaaca cttgtg 36

<210>7

<211>36

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>7

atctgaattc atcttaagtc tttggagtgt agaaga 36

<210>8

<211>122

<212>DNA

<213>Artificial

<220>

＜223〉PCR product

<400>8

atctctcgag aaaagattcg ttaaccaaca cttgtgtggt tctcacttgg ttgaagcttt 60

gtacttggtt tgtggtgaaa gaggtttctt ctacactcca aagacttaag atgaattcag 120

at 122

<210>9

<211>36

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>9

atctctcgag aaaagaggta ttgttgaaca atgttg 36

<210>10

<211>36

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>10

atctgaattc atctagttac agttagtttt ccaatt 36

<210>11

<211>94

<212>DNA

<213>Artificial

<220>

＜223〉PCR product

<400>11

atctctcgag aaaagaggta ttgttgaaca atgttgtact tctatttgtt ctttgtacca 60

attggaaaac tactgtaact agatgaattc agat 94

<210>12

<211>30

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>12

atctgacgtc agatctaaca tccaaagacc 30

<210>13

<211>30

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>13

atctgacgtc aagcttgcac aaacgaactt 30

<210>14

<211>71

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>14

gctactcgag aaaagattcg ttaaccaaca cttgtgtggt tctcacttgg ttgaagcttt 60

gtacttggtt t 71

<210>15

<211>70

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>15

tagcgcggcc gcttaagtct ttggagtgta gaagaaacct ctttcaccac aaaccaagta 60

caaagcttca 70

<210>16

<211>90

<212>DNA

<213>Artificial

<220>

＜223〉PCR product

<400>16

ttcgttaacc aacacttgtg tggttctcac ttggttgaag ctttgtactt ggtttgtggt 60

gaaagaggtt tcttctacac tccaaagact 90

<210>17

<211>90

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>17

gctactcgag aaaagaggta ttgttgaaca atgttgtact tctatttgtt ctttgtacca 60

attggaaaac tactgtaagc ggccgcgcta 90

<210>18

<211>90

<212>DNA

<213>Artificial

<220>

＜223〉synthetic oligonucleotide

<400>18

tagcgcggcc gcttacagta gttttccaat tggtacaaag aacaaataga agtacaacat 60

tgttcaacaa tacctctttt ctcgagtagc 90

The PCT/RO/134 table

Applicant or the reel number GNT 002PG of agency

International application no PCT/US2005/036479

The proof that relates to microorganism or the preservation of other biological material

(PCT treaty 13bis)

A.. following proof relates to specification sheets the 23Page or leaf, the 4The microorganism that row is mentioned or the preservation of other biological material
		B. attached sheet is seen in the more preservations of preservation proof
Depositary institution title China typical culture center (CCTCC)
		Wuhan, Wuhan University Hubei, Chinese typical culture center, depositary institution address (comprising postcode and country) 430072 China
Preservation date on September 17th, 2004	Deposit number M204071
		C. this information attachment page or leaf of other content (if not then keep blank)
		D. designated country is this appointment country witness (if this proof is not suitable for all designated country)
		E. the proof of submitting to respectively (if not then keep blank)
Following proof will be submitted to international office (describing the general content of this proof in detail, for example deposit number) subsequently

It is special-purpose to accept office	The international office special use
		This page or leaf of is received simultaneously with international application	This page or leaf of is received in the following time by international office:
The handler	The handler

PCT/RO/134 shows (in July, 1998; Again print in January, 2004)

Claims (40)

1. reorganization of genetic structure, be used for expressing and have at the target protein of natural production by at least two chains of translation back formation, described reorganization of genetic structure comprises at least two expression cassettes, each expression cassette comprises the sequence corresponding to a chain of described target protein, wherein, target protein as described in the translation of described reorganization of genetic structure is expressed under the situation that enzyme after the translation that does not need as natural production is cut.

2. reorganization of genetic structure according to claim 1, wherein said target protein are mammalian proteins matter.

3. reorganization of genetic structure according to claim 1, wherein said target protein comprises insulin molecule.

4. reorganization of genetic structure according to claim 1, wherein said at least two expression cassettes are closely adjacent.

5. reorganization of genetic structure according to claim 1, wherein said at least two expression cassettes all comprise 5 ' identical end control region.

6. reorganization of genetic structure according to claim 1, wherein said at least two expression cassettes all comprise 5 ' mutually the same end control region, and the dna sequence dna of target protein subunit differing from each other.

7. reorganization of genetic structure according to claim 1, wherein said at least two expression cassettes all have identical homing sequence.

8. reorganization of genetic structure according to claim 1, wherein first expression cassette comprises the sequence of article one chain of the coding target protein that is operably connected to first homing sequence, second expression cassette comprises the sequence of the second chain of the coding target protein that is operably connected to second homing sequence, and these two homing sequences then can induce separately the expressed product of expression cassette to enter the Secretory Pathway of nature.

9. reorganization of genetic structure according to claim 8, wherein said article one chain is different with described second chain.

10. reorganization of genetic structure according to claim 1 comprises following sequence:

Pm ₁-Ld ₁-Pt ₁-Y ₁-Tm ₁-Pm ₂-Ld ₂-Pt ₂-Y ₂-Tm ₂

Wherein each is listed element and is operably connected to adjacent element, and Pm represents promoter sequence; Ld represents homing sequence; Pt represents protease recognition sequence; Y ₁And Y ₂Then represent the different chains sequence separately of target protein respectively; Tm then represents terminator sequence.

11. reorganization of genetic structure according to claim 10, wherein Pm ₁And Pm ₂Basically be identical, Ld ₁And Ld ₂Basically be identical, Pt ₁And Pt ₂Basically be identical, Pt ₁And Pt ₂Basically be identical, Tm ₁And Tm ₂Basically be identical.

12. reorganization of genetic structure according to claim 1 comprises DNA.

13. reorganization of genetic structure according to claim 1 comprises RNA.

14. by the described reorganization of genetic structure expression of claim 1 is protein.

15. comprising, a cell is used for being expressed in the target protein that natural production has at least two chains that form by post-translational cleavage, a kind of reorganization of genetic structure comprises at least two expression cassettes, wherein each expression cassette is corresponding with a peptide chain of described target protein basically, and can express the target protein of biologically active under the situation of described cell by described reorganization of genetic structure required post-translational cleavage in not having the natural production process of described target protein.

16. cell according to claim 15, wherein said cell are a kind of eukaryotic cells.

17. cell according to claim 15, wherein said cell are a kind of yeast cell.

18. cell according to claim 15 is to be selected from pichia, yeast strains such as Hansenula, Candida and Toralopsis.

19. cell according to claim 15, wherein said reorganization of genetic structure comprises following sequence:

Pm ₁-Ld ₁-Pt ₁-Y ₁-Tm ₁-Pm ₂-Ld ₂-Pt ₂-Y ₂-Tm ₂

Wherein each listed element is operably connected to adjacent element, and on behalf of promoter sequence, Ld, Pm represent homing sequence, Pt to represent a kind of protease recognition sequence, Y ₁And Y ₂Represent the sequence of the different chain of target protein respectively, Tm represents terminator sequence.

20. cell according to claim 19, wherein Pm ₁And Pm ₂Be identical, Ld ₁And Ld ₂Be identical, Pt ₁And Pt ₂Be identical, Tm ₁And Tm ₂Be identical.

21. cell according to claim 19, wherein said protease recognition sequence encoded K ex2 action site.

A kind of signal peptide 22. cell according to claim 19, wherein said homing sequence are encoded, this signal peptide guiding is by the Secretory Pathway of described reorganization of genetic structure polypeptide expressed by described cell.

23. cell according to claim 22, wherein said target protein is secreted with its natural folded conformation.

24. cell according to claim 22 wherein forms at least one disulfide bond, the target protein when secreting to form between at least two different chains.

25. according to the described cell of claim 22, wherein said target protein in secretion process by glycosylation.

26. cell according to claim 15, wherein said target protein comprises Regular Insulin.

27. cell according to claim 15, wherein said reorganization of genetic structure comprises DNA.

28. target protein is by the described cell expressing of claim 15.

29. a method that is used for production biological activity target protein, described target protein have at least two chains that form by post-translational cleavage under the natural production situation, said method comprising the steps of:

(a) provide a kind of cell of tool reorganization of genetic structure, wherein said reorganization of genetic structure comprises at least two expression cassettes, and each expression cassette comprises basically the sequence corresponding to a chain of target protein; And

(b) under the situation of the post-translational cleavage that need not to require under the nature situation, pass through the described bioactive target protein of described cell expressing.

30. method according to claim 29, wherein said target protein comprises the Regular Insulin with two chains, and described reorganization of genetic structure comprises two expression cassettes.

31. method according to claim 29, wherein said cell is a yeast cell.

32. recombinant DNA is made up of following sequence:

Pm ₁-Ld ₁-Pt ₁-Y ₁-Tm ₁-Pm ₂-Ld ₂-Pt ₂-Y ₂-Tm ₂

Wherein each listed element is operationally connection adjacent one another are, and Pm represents the Yeast promoter sequence, and Ld represents the yeast homing sequence, and Pt represents protease recognition sequence, and Tm represents the yeast terminator sequence.

33. recombinant DNA according to claim 32, wherein, described yeast is PichiaPastoris.

34. recombinant DNA according to claim 32, Pt ₁And Pt ₂In at least one comprise the Methionin codon, and arginine codon of heel.

35. recombinant DNA according to claim 32, wherein Y ₁And Y ₂The B chain of difference representative Regular Insulin and the dna sequence dna of A chain.

36. recombinant DNA according to claim 32, wherein Y ₁And Y ₂Represent a kind of two subunits of cytokine respectively.

37. recombinant DNA according to claim 36, wherein said cytokine is an interleukin 12.

38. recombinant human insulin's molecule is produced as follows:

(a) provide a kind of eukaryotic cell, it comprises by first expression cassette and second reorganization of genetic structure that expression cassette is formed, wherein said first expression cassette comprises the sequence corresponding to human insulin molecule A chain, and described second expression cassette comprises the sequence corresponding to human insulin molecule B chain;

(b) induce described cell expressing described recombinant human insulin's molecule, and recombinant human insulin's molecule of described expression is secreted on every side in the substratum by described intracellular reorganization of genetic structure; With

(c) from described substratum on every side, collect described excretory human insulin molecule.

39. according to the described recombinant human insulin's molecule of claim 38, wherein in step (b) the described recombinant human insulin's molecule of excretory be have bioactive.

40. according to the described recombinant human insulin's molecule of claim 38, wherein said eukaryotic cell is a yeast cell.

Images