CN101117344A - Isolation of rna and DNA from a biological sample - Google Patents

Abstract

The invention relates to methods of isolating nucleic acids from a sample using a filter device comprising a plurality of membranes. The invention also provides for devices comprising a plurality of membranes and kits suitable for isolating nucleic acids from a sample.

Description

The filtration unit that is used for isolating nucleic acid

The application requires the U.S. Provisional Application No.60/817 of submission on June 29th, 2006, the U.S. Provisional Application No.60/881 that on January 18th, 504 and 2007 submitted to, and 058 right of priority is incorporated its full content into the application by reference at this.

Technical field

Generality of the present invention relates to biology field.In some specific embodiment, the invention provides and separate nucleic acid and relevant device, test kit and the method for detection.

Background technology

Isolating nucleic acid usually is first step of most of molecular biology researches, and described research comprises PCR, gene clone, order-checking, Southern trace, Northern trace, RNase protection analysis, RT-PCR, RNA collection of illustrative plates, external translation, in-vitro transcription, comprises and transcribing/amplified reaction and cDNA library construction.Therefore the high-quality complete nucleic acid that acquisition is suitable for analyzing usually be the useful and required starting point of follow-up analysis.(see for example U.S. Patent No. 5,075,430,5,234 though described the various technology that are used for isolating nucleic acid from sample, 809,5,155,018,6,274,308,6,277,648,6,958,392,6,953,686,6,310,199,6,992,182,6,475,388,5,075,430; U.S. Patent application No.20060024701; European patent No.EP0765335; Boom et al.1990, J.Clinical Microbiology 28:495), but provide a kind of fast, the economic method of isolating nucleic acid from sample with high yield remains useful.If method can make to the action required of sample simplify most, allow use mainly be the operation steps of liquid and can utilize single device for example filtration unit implement described method, this method also is useful so.Some embodiment of the present invention described herein provides a kind of like this method.Other embodiment of the present invention described herein provides the device and the test kit that can be used for isolating from sample nucleic acid.Other embodiment of the present invention also provides the nucleic acid in the sample has been detected.

Summary of the invention

In some embodiments, the invention provides a kind of method of from sample, isolating nucleic acid, comprise that the filtration unit that a) will comprise a plurality of porous-films contacts with sample, make sample in turn contact a plurality of porous-films, described contact contacts second porous-film subsequently at least from first porous-film; B) sample on first porous-film of cracking, wherein the demarcation aperture of first porous-film is less than the demarcation aperture of second porous-film; C) apply external force to filtration unit, isolate nucleic acid at least one porous-film in a plurality of porous-films in view of the above.Sample can be cell sample or the viral sample that for example comprises virion.Randomly, can from one of them porous-film, go out isolating nucleic acid by wash-out.

In other embodiments, the invention provides a kind of method of from sample, isolating nucleic acid, comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample, make sample in turn contact a plurality of porous-films, described contact is from comprising first porous-film of polymkeric substance, at least contact second porous-film that comprises silicate subsequently, isolate nucleic acid at least one porous-film in a plurality of porous-films in view of the above.Polymeric film can have the demarcation aperture littler than silicate films.Sample can be cell sample or viral sample, each or two kinds can be therein on film, for example on first porous-film by the original position cracking.Randomly, can go out isolating nucleic acid from wash-out on one of them porous-film.

In other embodiments, the invention provides a kind of method of from sample, isolating nucleic acid, comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample, make sample in turn contact a plurality of porous-films, described contact is from comprising first porous-film of polysaccharide, at least contact second porous-film that comprises silicate subsequently, isolate nucleic acid at least one porous-film in a plurality of porous-films in view of the above.Polysaccharide membrane can have the demarcation aperture littler than silicate films.Sample can be cell sample or viral sample, wherein a kind of or two kinds can be therein on film, for example on first porous-film by the original position cracking.Randomly, can go out isolating nucleic acid from wash-out on one of them porous-film.

Still in other embodiments; the invention provides a kind of method of from sample, isolating nucleic acid; comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample; make sample in turn contact a plurality of porous-films; described contact is from first porous-film of the polymkeric substance that comprises alkylsulfonyl; at least contact second porous-film that comprises silicate subsequently, isolate nucleic acid at least one porous-film in a plurality of porous-films in view of the above.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than silicate films.Sample can be cell sample or viral sample, wherein a kind of or two kinds can be therein on film, for example on first porous-film by the original position cracking.Randomly, can go out isolating nucleic acid from wash-out on one of them porous-film.

Still in other embodiments; the invention provides a kind of method of from sample, isolating nucleic acid; comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample; make sample in turn contact a plurality of porous-films; described contact is from first porous-film of the polymkeric substance that comprises alkylsulfonyl; at least contact second porous-film that comprises polysaccharide subsequently, isolate nucleic acid at least one porous-film in a plurality of porous-films in view of the above.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than polysaccharide membrane.Sample can be cell sample or viral sample, wherein a kind of or two kinds can be therein on film, for example on first porous-film by the original position cracking.Randomly, can go out isolating nucleic acid from wash-out on one of them porous-film.

In some embodiments, the invention provides a kind of method of from sample, isolating RNA, comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample, make sample at first contact the film that comprises mixed cellulose ester, contact subsequently comprises the film of glass fibre, wherein the demarcation aperture of the demarcation aperture ratio glass fibre membrane of mixed cellulose ester membrane is littler, and randomly wash-out goes out RNA from device, isolates RNA in view of the above from sample.Sample can be cell sample or viral sample, wherein a kind of or two kinds can be therein on film, for example on first porous-film by the original position cracking.

In some embodiments; the invention provides a kind of method of from sample, isolating DNA; comprise that the filtration unit that will comprise a plurality of porous-films contacts with sample; make sample at first contact the film of the polymkeric substance that comprises alkylsulfonyl; contact subsequently comprises the film of glass fibre; the demarcation aperture of demarcation aperture ratio glass fibre membrane of polymeric film that wherein comprises alkylsulfonyl is littler, and wash-out goes out DNA from device, isolates DNA in view of the above from sample.In some embodiments, be separated at least some DNA on the polymeric film of alkylsulfonyl comprising.In other embodiments, on glass fibre membrane, be separated at least some DNA.Sample can be cell sample or viral sample, each or two kinds can be therein on film, for example on first porous-film by the original position cracking.Randomly, can from one of them porous-film, go out institute's separated DNA by wash-out.

Still in other embodiments, the invention provides a kind of method of from cell sample, isolating RNA, comprise a) cell sample is contacted with first film that comprises polymkeric substance; B) apply external force for first film, make cell sample be stranded on the surface of first film; C) the lip-deep cell sample that will remain in first film contacts with lysis buffer, makes lysis in the sample; Contact with RNA capture buffer liquid, make from first film wash-out go out the RNA in the sample, and contact with second film that comprises silicate; D) apply external force for first and second film, make lysis buffer and RNA capture buffer liquid flow through c) first and second film; E) randomly with d) first and/or second film contact with one or more lavation buffer solutions; F) randomly give e) first and/or second film apply external force, make lavation buffer solution flow through first and/or second film; G) add no RNase water, make that wash-out goes out at least some RNA from silicate films, from sample, isolate RNA in view of the above.In some embodiments, lysis buffer can be and RNA capture buffer liquid phase damping fluid together that the cell that makes sample comprise is cleaved.

Still in other embodiments, the invention provides a kind of method of from sample, isolating DNA, comprise a) cell sample is contacted with a plurality of films, wherein first film comprises polymkeric substance, contact subsequently with first film at sample, contact with sample with at least one additional film, wherein said at least one additional film comprises silicate; B) apply external force to polymeric film, make sample be retained on the surface of polymeric film; C) sample that will remain on the polymer film surface contacts with lysis buffer, the feasible sample dissociation that contains DNA; D) apply external force in first and second film at least one, make lysis buffer flow through c at least) first and second film; E) randomly with d) first and/or second film contact with one or more lavation buffer solutions; O randomly gives e) at least the second film apply external force, make lavation buffer solution flow through second film at least; G) water of adding nuclease free in a plurality of films makes that wash-out goes out at least some DNA from least one film, isolates DNA in view of the above from sample.

At some in other the embodiment, the invention provides the filtration unit that is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact with first porous-film, at least contact second porous-film subsequently, wherein the demarcation aperture of first porous-film is less than the demarcation aperture of second porous-film.

In other embodiment, the invention provides the filtration unit that is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film that comprises polymkeric substance.Polymeric film can have the demarcation aperture littler than silicate films.

Still in other embodiment; the invention provides the filtration unit that is suitable for from sample, isolating nucleic acid; it comprises a plurality of porous-films that set gradually; make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film of the polymkeric substance that comprises alkylsulfonyl.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than silicate films.

In other embodiment, the invention provides the filtration unit that is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film that comprises polysaccharide.The polysaccharide material film can have the demarcation aperture littler than silicate films.

In other embodiment; the invention provides the filtration unit that is suitable for from sample, isolating nucleic acid; it comprises a plurality of porous-films that set gradually; make the sample that puts on filtration unit contact, contact second porous-film that comprises polysaccharide subsequently at least with first porous-film of the polymkeric substance that comprises alkylsulfonyl.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than polysaccharide membrane.

In other embodiment, the invention provides the filtration unit that is suitable for from sample, isolating RNA, it comprises a plurality of porous-films that set gradually, make the sample put on filtration unit with comprise first porous-film that mixes rhodia and contact, at least contact second porous-film that comprises glass fibre subsequently, wherein the demarcation aperture of first porous-film can be less than the demarcation aperture of second porous-film.

In other embodiment; the invention provides the filtration unit that is suitable for from sample, isolating DNA; it comprises a plurality of porous-films that set gradually; make the sample that puts on filtration unit contact with first porous-film of the polymkeric substance that comprises alkylsulfonyl; at least contact second porous-film that comprises glass fibre subsequently, wherein the demarcation aperture of first porous-film can be less than the demarcation aperture of second porous-film.

In other embodiment; the invention provides the filtration unit that is suitable for from sample, isolating DNA; it comprises a plurality of porous-films that set gradually; make the sample that puts on filtration unit contact with first porous-film of the polymkeric substance that comprises alkylsulfonyl; contact subsequently comprises second porous-film of the polymkeric substance of alkylsulfonyl; at least contact the 3rd porous-film that comprises glass fibre subsequently, wherein the demarcation aperture of first porous-film is less than the demarcation aperture of glass fibre membrane.

In other embodiments, the invention provides a kind of test kit that is used for isolating nucleic acid from sample, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact with first porous-film, at least contact second porous-film subsequently, wherein the demarcation aperture of first porous-film can be less than the demarcation aperture of second porous-film; And b) at least one container.

In other embodiments, the invention provides a kind of test kit that is used for isolating nucleic acid from sample, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film that comprises polymkeric substance; And b) at least one container.Polymeric film can have the demarcation aperture littler than silicate films.

In other embodiments, the invention provides a kind of test kit that is used for isolating nucleic acid from sample, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film that comprises polysaccharide; And b) at least one container.Polysaccharide membrane can have the demarcation aperture littler than silicate films.

In other embodiment, the invention provides a kind of test kit that is used for isolating nucleic acid from sample, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises silicate subsequently at least with first porous-film of the polymkeric substance that comprises alkylsulfonyl; And b) at least one container.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than silicate films.

In other embodiment, the invention provides a kind of test kit that is used for isolating nucleic acid from sample, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid, it comprises a plurality of porous-films that set gradually, make the sample that puts on filtration unit contact, contact second porous-film that comprises polysaccharide subsequently at least with first porous-film of the polymkeric substance that comprises alkylsulfonyl; And b) at least one container.The polymeric film that comprises alkylsulfonyl can have the demarcation aperture littler than polysaccharide membrane.

Still in other embodiment, the invention provides a kind of automation system that is used for isolating nucleic acid, comprise the filtration unit that a) is suitable for from sample, isolating nucleic acid from sample; B) pump; C) program logic controller (PLC); D) at least one is suitable for holding the container of sample; E) randomly, one or more containers that are suitable for holding one or more reagent or damping fluid; F) randomly, one or morely be suitable for receiving filtered liquid from filtration unit, from the elutriant of filtration unit and/or from the receptor of the waste liquid of filtration unit; G) a plurality of folders close valve; H) pipeline and i) randomly, will add the syringe cylinder of delivering in the filtration unit from one or more liquid of pipeline.

In other embodiment, the invention provides the oligonucleotide that one or more are suitable for the microorganism in the test sample.Microorganism can comprise mycoplasma, virus or the like.

Still in other embodiment, the invention provides the method for microorganism in a kind of test sample, comprise a) sample is contacted with one or more oligonucleotide that are incorporated into target nucleic acid specifically that described target nucleic acid comprises at least a portion of microbial genome; B) amplifying target nucleic acid, the microorganism in the test sample in view of the above.Randomly, target nucleic acid can contact with the oligonucleotide probe that is incorporated at least a portion target nucleic acid specifically, in view of the above the microorganism in the test sample.

Description of drawings

Fig. 1 a and 1b have shown an example of filtration unit of the present invention, and it is made up of every device (micropartition) differential.

Fig. 2 has shown an example of filtration unit of the present invention.

Fig. 3 a and 3b have shown the example of the filtration unit of the porous form that is suitable for receiving a plurality of samples or bulk sample of the present invention.

Fig. 4 has shown another example of the filtration unit of the porous form that is suitable for receiving a plurality of samples or bulk sample of the present invention.

Fig. 5 has shown the filtration unit of monocyte sample form of the present invention.

Fig. 6 a has shown the filtration unit of closing form of the present invention: have ventage and do not have ventage.

Fig. 6 b has shown the filtration unit that stacks form of the present invention.

Fig. 7 has shown the system controlled, automatization with filtration unit of the present invention sealing, that the ventage form is arranged.

Fig. 8 shows with (rRNA that CA) is separated to compares for Qiagen, Valencia, with the photo of the sepharose of the rRNA that method of the present invention was separated to RNAeasy  post.

Fig. 9 is the figure of demonstration from the relative purity of the RNA of sample.

Embodiment

The method of isolating nucleic acid

In some embodiments, the invention provides the method for isolating target nucleic acid from sample, this is a kind of method of implementing and only need minimum sample preparation number of times fast, easily.Advantage provided by the present invention is to receive rough cell input thing for example protokaryon or eukaryotic cell, and the biomolecules output of output selectivity.The input of rough cell can only be included on one of them film surface in the contained a plurality of films of filtration unit for example original position lysing cell sample.Lysate can be processed,, and the centrifugal clarification lysate needn't be for example passed through so that with method isolating nucleic acid described herein.Therefore lysate can comprise target nucleic acid and cell debris, substratum and culture medium additive.

In concrete embodiment, the invention provides a kind of method of on glass fibre membrane, isolating RNA, wherein glass fibre membrane is a part that comprises the filtration unit of a plurality of films.In other embodiments, the invention provides the method for DNA isolation on a kind of polymeric film that for example comprises alkylsulfonyl at polymeric film, wherein polymeric film is a part that comprises the filtration unit of a plurality of films.

When target nucleic acid is RNA, the invention provides a kind of method of isolation of RNA, described method does not need to use the DNA enzyme, need in other words than previous described method Qiagen post (Qiagen for example, Inc., Valencia, CA) required DNA enzyme DNA enzyme has still less so just been saved time and reagent expense.Usually will be separated to the nucleic acid of denatured state on porous-film, therefore help further processing treatment, for example PCR comprises RT-PCR, transcriptive intermediate amplification (TMA).The separation of target nucleic acid can be used to multiple downstream analysis and use, and comprises for example identifying for example bacterium of interested pathogenic or non-virulent organism.

In specific implementations, the invention provides a kind of from by the method for isolating nucleic acid the whole cell sample that for example protokaryon or eukaryotic cell are formed.Cell can be contacted with first film, lysing cell can be separated to target nucleic acid on second or subsequently film.Perhaps, both can also can on second film, be separated to target nucleic acid at first.Sample can be applied in the filtration unit of being made up of a plurality of films, make sample in turn with a plurality of films in each film all contact.Therefore, sample can contact with first film, contacts second film subsequently at least.In some embodiments, sample can contact with three or more films.

Sample with the device in first film contact after, can apply external force to device, make sample (for example target nucleic acid or the part of target nucleic acid at least) be retained on the surface of first film, but contain the solution of sample or liquid for example substratum can flow through filtration unit.In some embodiments, can provide power by gravity or by the vacuum unit that for example is additional to filtration unit through the ventage of bottom of device.When external force was vacuum, vacuum can provide the pressure difference of 20-800 millibar.In other embodiments, can provide power by malleation, described malleation is applied to the top of filtration unit, and for example when device has cylinder (cylinder), described malleation is to provide by piston or assembly motion, or the external force by syringe.Still in other embodiments, power can be the centrifugal force that is applied in by being positioned over device in the whizzer.The scope that can apply is from 1xg to 15, the centrifugal force of 000xg.Still in other embodiments, can perhaps after allowing the sample sedimentation, can remove solvent by aspirating for example removal solvent above first film by just simply toppling over.

After first film that the present invention can be included in the contained a plurality of porous-films of sample and filtration unit contacts, sample can with different damping fluid contacts.Therefore, at contained first film of sample contact percolation device and after randomly having applied power recited above to filtration unit, sample can contact with first damping fluid.When sample comprised cell and/or virion, first damping fluid can be a lysis buffer.Can use any lysis buffer known in the art.Lysis buffer generally includes for example proteolytic enzyme of buffering salt, stain remover and enzyme.Enzyme for example can be Proteinase K or N,O-Diacetylmuramidase.In one embodiment, lysis buffer can be made of 50mM Tris-HCl (pH8.0), 100mM EDTA, 2%Triton X-100.

After cracking, sample can contact with precipitation agent, makes the contained nucleic acid of at least a portion sample be deposited on the surface of first porous-film.Precipitation agent can comprise for example ethanol of guanidinesalt (for example Guanidinium hydrochloride, guanidine thiocyanate) and alcohol.In some embodiments, precipitation agent comprises the alcohol of final concentration scope from 25% to 50%.Sample can be hatched the sufficiently long time with precipitation agent, makes at least some nucleic acid be deposited on the surface of first film.In some embodiments, the scope of incubation time is from 1 to 10 minute, 1 to 5 minute, 30 seconds to 3 minutes, 30 seconds to 20 minutes, 30 seconds to 1 hour or 1 hour or longer.Utilize and recited abovely be used for for example applying external force and can from sample, remove precipitation agent and lysis buffer from the technology that sample is removed solvent.

When target analyte is RNA, can add RNA capture buffer liquid, this allows target nucleic acid by first film and be adsorbed or be deposited on second film, makes to isolate target nucleic acid from sample.The example of suitable R NA capture buffer liquid comprises 4M Guanidinium hydrochloride, 50mM Tris-HCl (pH 8.0), 100mM EDTA, 2%Triton X-100,50% ethanol.Can be with the surrogate of 1% sodium lauryl sulphate as 2%Triton X-100.Another kind of RNA capture buffer liquid can be made up of 4M Guanidinium hydrochloride, 50mM Tris-HCl (pH 8.0), 100mM EDTA, 5% ethyl acetate and 50% ethanol.

Apply one or more lavation buffer solutions can between any step the sample that is stranded in the device, described step comprises that a) sample contacts with filtration unit; B) precipitation; C) wash-out target molecule.For example after having removed precipitation agent and lysis buffer, sample can contact with lavation buffer solution, so that the unwanted material that removal cracking and enzyme liberating are generated.Can use any lavation buffer solution known in the art for example phosphate-buffered salt (PBS) and at least 50% ethanol, methyl alcohol or Virahol or 10mM Tris-EDTA (pH 8.0) or 4M Guanidinium hydrochloride.Utilize recited above being used for to remove lavation buffer solution from any method of sample removal solvent.

Isolating target nucleic acid under can wash-out on the film or the isolating target nucleic acid that is stranded on the film are further analyzed.When needs wash-out target nucleic acid, can collect target nucleic acid from first film or second film with elution buffer.Perhaps, elution buffer can make to stay target nucleic acid on first film or second film from for example unwanted nucleic acid of material under the wash-out on first film or second film.Can select elution buffer according to the isolating nucleic acid type of institute.For example, when nucleic acid was RNA, elution buffer can be the water of no RNA enzyme, and it can be used to go out target RNA from second film or when first film contacts each other or stacks with second film from first and second membrane elution.Other suitable elution buffer can comprise tris-ethylenediamine tetraacetic acid (EDTA) (tris-ethylenediaminetetraacetic acid, TE) damping fluid and 10mM Tris-HCl (pH8.0).

In specific implementations, when filtration unit comprises two above films, can be from target nucleic acid under the wash-out on first or second film or first and second film on the 3rd film.The 3rd film can comprise for example specificity binding partners of target nucleic acid of capture probe, because the special chemical interaction between target nucleic acid and the target probe can be so that target nucleic acid be preferentially remained on the 3rd film.Capture probe can covalently or non-covalently interact with target nucleic acid.Interaction can comprise electric charge-coulombic interaction, hydrogen bond, hydrophobic interaction, Van der Waals force and dipole-dipole-dipole interaction.The example of capture probe comprises and the oligonucleotide of relevant concrete nucleic acid array complementation and the small molecules of peptide, albumen and bind nucleic acid.For example, can be specifically in conjunction with the microbiotic of 16s RNA for example edeine can combine with film.Another example of capture probe can comprise and is suitable for catching for example few dT probe of mRNA of polyA RNA.For example avidin or streptavidin or neutravidin (neutravidin) can be carried out derivatize to film with known part.Can add biotinylated capture probe to film, so that give specificity to target nucleic acid sequence.

In concrete embodiment, the invention provides a kind of method (for example total cell RNA comprises 23s and 16s rRNA, cell DNA, mycoplasma DNA or RNA, viral DNA or RNA) of from cell sample, isolating nucleic acid, comprise that the one or more holes with porous plate contact with sample, wherein one or more holes of porous plate are made up of a plurality of films, and described film is polymeric film for example glass fibre filter or a glass fibre membrane of cellulose mixture film, silicate films or filter for example for example.Sample can at first contact with polymeric film, contacts with silicate films subsequently.First film that sample contacted can have for example littler demarcation aperture, demarcation aperture of second film of the film subsequently that contacts than sample.Can be by stacking the configuration alignment films.Can apply the filtered liquid of vacuum and discarded sample to porous plate, make cell sample be located away from first film.Cell sample can with lysis buffer for example comprise one or more lyase for example the damping fluid of N,O-Diacetylmuramidase contact.Sample can with one or more precipitation agents for example guanidinesalt contact with ethanol.Can allow that sample hatches the time of suitable length.Can apply vacuum to porous plate, can discard filtered liquid.Can apply for example PBS and 50% or the ethanol of greater concn of one or more washing solns to porous plate, so that wash away any reagent or non-target material.Can apply vacuum and discarded filtered liquid.It is collecting board that second porous plate can be provided, and is used for receiving target nucleic acid.Second porous plate can be by forming with the hole of the porous plate similar number that receives sample, its size is designed to tight connecting each other, for example by the interlocking under the porous plate or by junction that is buckled together or edge, make each hole of porous plate all aim at and corresponding to each hole of second porous plate.

Sample can contact with water, the TE damping fluid that elution buffer does not for example have a RNA enzyme, so that target nucleic acid is eluted in the collecting board from porous plate.Perhaps, any LISS (0-50mM) (pH 6.0-8.0) all be appropriate to from the device wash-out go out for example RNA of target nucleic acid.

Automation system

In specific implementations, the invention provides the automation system that is used for isolating nucleic acid from sample.Therefore, arbitrary step or institute in steps can be by automatizations, comprise to filtration unit application of sample, lysate sample, washing sample, elution samples, automation system can comprising the program of being designed with the computer of each step of implementing said method Personal Computer for example.The present invention also comprises with a plurality of samples of multi-joint (multiplex) mode treatment.

Fig. 7 has shown an example of automated installation.In other embodiment, the invention provides the automation system that is used for isolating nucleic acid from sample, comprise the filtration unit (74) that a) is suitable for from sample, isolating nucleic acid; B) pump (75); C) program logic controller (PLC) (76); D) at least one is suitable for holding the container (71) of sample; E) randomly, one or more containers (71) that are suitable for holding one or more reagent or damping fluid; F) randomly, one or morely be suitable for receiving filtered liquid from filtration unit, from the elutriant of filtration unit and/or from the receptor (77) of the waste liquid of filtration unit; G) a plurality of folders close valve (72); H) pipeline (73) and i) randomly is arranged in the syringe cylinder of syringe barrel (79), and it is used to add one or more liquid for by the road filtration unit (74).Vacuum breaker (78) is provided, adds and/or removal liquid so that allow to filtration unit.

Therefore, automation system of the present invention can be set, make comprise reagent damping fluid, sample etc. liquid never with any moving part for example the moving part of pump contact.Can realize this point by using folder to close valve, it does not need to contact with the liquid of the system of flowing through.Pipeline that native system is used and filtration unit can be suitable for single to be used, and can be disposable therefore.The combination that disposable pipeline and folder close valve provides the system that for example only needs seldom to safeguard in that run duration cleans.In addition, because pipeline and filtration unit are only used once, therefore eliminated or minimized the danger of sample contamination.When sample comprises nucleic acid and the detected downstream of nucleic acid is depended on the amplification scheme for example when PCR or TMA, this is useful especially.Though the amplification scheme provides outstanding susceptibility, this has also increased the amplification contaminated nucleic acid and the danger of non-target nucleic acid significantly.Automation system described herein minimizes or has eliminated this danger, and when when comparing, providing the low cost system that is used to carry out separate nucleic acid with more traditional chromatographic system of forming by reusable (normally metal) part (liquid of the system that wherein flows through contacts with the moving part of pump).

The filtration unit that is applicable to automation system can be the filtration unit in arbitrary embodiment of the present invention described herein.System can be set, make 1) pipeline provides the fluid connection between sample and the filtration unit; 2) pipeline provides the connection between each container in filtration unit and the one or more optional container; 3) pump can provide and a) can drive sample or damping fluid or reagent and be filter device and/or flow through the external force and/or the b of filtration unit from container) can for example comprise any liquid of first surface removal external force of reagent, damping fluid, sample for example of the film of filtration unit from the film surface.First surface can be the surface of contact liq at first, the topsheet surface in a plurality of films that for example set gradually.

In some embodiments, the order and the time of can the Controlling System performed step of PLC.Therefore, PLC can control one or more folders and closes valve and when open and/or close.Equally, PLC can control and apply time length and opportunity to one or more containers and/or filtration unit institute externally applied forces.System also can comprise pump and for example can extract the liquid of given volume out from one or more containers and make the syringe pump that filtration unit contacts with liquid.Pump also can be by sequencing, makes the volume that can determine and control liquid that obtain and/or that contact with filtration unit from a container, can determine and control the speed of liquid that extract out and/or that apply from container and/or filtration unit.In another embodiment, the volume of the opportunity of can the Controlling System performed step of PLC and time length and the liquid that obtains from container or film surface, liquid flow are through the flow velocity of system and/or extract and/or apply the speed of liquid out from container and/or filtration unit.

When installing, can carry out following step by automatization.In initial setting, all required solution of can in solution container, packing into.Can close valve control container by folder, container is communicated with the two-way valve that links to each other with syringe.Can control the suction and the release of syringe with syringe pump.Can be through double filter (dual filter) injected sample.Filtrate flows to waste liquid pool, and resistates can be by dry air on the film.Can inject lysate through double filter.Filtrate flows to waste liquid pool.Resistates can be by dry air on the film.Can inject elutriant through double filter.Filtrate flows to the collection receptor.Resistates can be by dry air on the film.Can detect the nucleic acid in the filtrate with gel, PCR or TMA.

Filtration unit

The present invention can use various filtration unit forms.Filter can be that single hand gear or it can be the parts of automation system.Character per sample and target analyte can determine the size and the number of filter.In some embodiments, filtration unit can by isolated unit for example filter cylinder form.Filter cylinder can comprise the filter cylinder shell, for example contains ducted body and one or more inlet and one or more outlet of a plurality of films.The size of entrance and exit can be designed to and the standard syringe fit, perhaps can be designed to be adapted to vacuum source or positive pressure source.Filter cylinder can also comprise the filtrate cup that is used to collect effluent.The filter cylinder size can be designed to be suitable for whizzer.

Filtration unit can be made up of post, and it comprises a plurality of filters that set gradually within it, makes the sample put on the column top to contact with a plurality of porous-films in the post by specific order.For example, the film of first contact can have the littler demarcation aperture of film that contacts than subsequently.Another example is, filtration unit can comprise one or more syringe cylinders that set gradually, and it is used to exert pressure or vacuum to device.

Filtration unit can be multi-joint, for example be made up of porous plate, wherein at least one hole is made up of filtration unit, and described filtration unit comprises a plurality of films that set gradually, make the sample that puts on filter can contact first film earlier, contact one or more films subsequently subsequently again.Can use arbitrary filtration unit described herein that at least one hole in the multi-joint device is set, wherein first film has the littler demarcation aperture of film than subsequently.Filtration unit can be multi-joint, for example is made up of porous plate, and wherein at least one hole is made up of filtration unit, and described filtration unit comprises as at a plurality of films described in these different embodiments.Therefore, at least one hole in the porous plate is made up of a plurality of films that set gradually, and makes the sample that puts on filter can contact first film earlier, contacts one or more films subsequently subsequently again, for example first film comprises polymkeric substance, and second film comprises silicate.

The present invention expects that also the institute that uses filtration unit described herein to be provided with in the porous plate is porose.Suitable porous plate comprises the plate of being made up of a plurality of holes, for example 6 holes, 12 holes, 48 holes, 96 holes, 384 holes or more porous.Porous plate can self stack.Perhaps, the filtration unit of being made up of single orifice plate of the present invention also is fine.In some embodiments, can be provided for receiving the plate of effluent and refuse, for example drainage plate.Whether drainage plate can be made up of single hole or a plurality of hole, depend on concrete analyte and sample source and need effluent is carried out subsequent analysis.One of them plate can comprise one or more inlets that are suitable for sending sample or damping fluid in filtration unit.One of them plate can comprise outlet, promotes to discharge effluent and refuse thus.The outlet size can be designed to be suitable for being connected with vacuum source.The size of porous plate can be designed to be suitable for whizzer, so that can promote the sample processing treatment after sample is added on filtration unit.

In a concrete embodiment, filtration unit can comprise mixed cellulose ester membrane, and for example its demarcation aperture is 0.45 micron, described film be covered in the APFF glass fibre membrane (MilliporeCorp, Billerica, MA) on.When if filtration unit is configured to filter cylinder, film can have the diameter of 13mm so.Perhaps, if filtration unit is configured to porous plate, the size of film can be designed to be suitable for commercial obtainable porous plate.In another concrete embodiment, filtration unit can comprise the polymeric film of alkylsulfonyl, and its demarcation aperture is 28 nanometers, is covered in to have that to demarcate the aperture be on 0.7 micron the glass fibre membrane.

Fig. 1 has shown the example of the reusable filtration unit of being made up of components of the present invention of single step.Take out sample pool lid (1), to sample pool (2) in, add sample,, and make sample contact with first porous-film of a plurality of porous-films (4) owing to gravity or some external force of putting on device cause sample flow.A plurality of porous-films can be positioned on the film upholder (5), between described film upholder and the filtrate cup fluid connection are arranged, described filtrate cup also can be used as target under the wash-out receptor.Filtrate lid (6) also is provided.Because device can be disassembled and a plurality of porous-film can be replaced, so it is suitable for reusing.

Fig. 2 has shown the example of the not re-usable filtration unit of the present invention of single step.

Fig. 3 a has shown the example of porous filter of the present invention.Each hole all comprises at least two films that self stack (30,31).Fig. 3 b has shown another example of the equipment that comprises porous filter of the present invention.Equipment can comprise detachable overcoat (32), and it comprises the overcoat bed course (33) that is positioned at overcoat.Overcoat (32) connects screen plate (34), and it comprises a plurality of holes, and wherein one of them hole is made up of two or more porous-films, and wherein first porous-film has than second demarcation aperture that porous-film is littler.Can self stack porous-film.Screen plate (34) can be positioned on the collecting board (35), and described collecting board is made up of a plurality of holes.The hole of collecting board can be man-to-man each other corresponding with the hole of screen plate.Collecting board can be positioned on the pedestal (36) that comprises multi-joint vacuum manifold.

Fig. 4 has shown another example of porous filter of the present invention.Device can comprise the funnel (41) that is used to receive sample, its with by a plurality of be used to receive sample for example the detachable screen plate formed of the hole of bulk sample contact, wherein at least one hole is made up of one or more porous-films (42).Screen plate can be positioned at porous plate for example Ziptip  (Millipore Corp., Billerica is MA) on (43).The hole of Ziptip  plate can be man-to-man mutual corresponding with the hole of screen plate.Ziptip  can comprise resin or other are suitable for for example solid support of RNA of stranded nucleic acid.In concrete embodiment, resin can comprise poly-A, poly-U or poly-T agarose.Ziptip  plate can be positioned on the collecting board of being made up of a plurality of holes (44).The hole can be corresponding one by one with the hole of Ziptip  plate, and can contain TMA reagent for example the reagent for amplification of reconstruct comprise the enzyme of amplification with oligomer and reconstruct.Collecting board can be positioned on the pedestal (45) that comprises a plurality of vacuum manifolds.

Fig. 5 has shown another example of single sample filtration unit of the present invention.Device comprise receptor (51) for example Microfil  or Milliflex  (MA), it contains one or more porous-films that are suitable for keeping cell for Millipore Corporation, Billerica.Receptor can be positioned on the microtrabeculae that the trapping nucleic acids resin that is suitable for being detained target nucleic acid analyte (53) is housed.Microtrabeculae can be used for the lysate suction syringe (53) by post with fluid connection.

Fig. 6 a has shown the example of the closed overhead guard filtration unit (closed dome filtrationdevice) of sealing.Closed overhead guard device can be used for processing treatment sample under aseptic condition.Overhead guard can be used as the shell of one or more porous-films, can also comprise one or more not as the ventage of sample or reagent inlet.Ventage can be to be made of any suitable material, and it allows that air and other gases pass through, but do not allow particular matter for example microorganism pass through.In one embodiment, ventage is to be made of the breathable hydrophobic barrier.The wetting ability barrier also is fine.In some embodiments, ventage can be positioned on the surface of the containment structure of being with overhead guard.In another embodiment, ventage can be set up as side arm, extend in the part of the shell of being with overhead guard, for example the inlet that is connected with the band overhead guard shell that contains one or more porous-films.When sample flow is crossed filtration unit, can use the plug closes ventage of Luer fore shaft.Stopper can be made of solid material, perhaps itself can be ventage, therefore can by envelope barrier for example hydrophobic film constitute.The application of ventage provides the means of relief pressure, and has therefore avoided the infringement to filter.

Fig. 6 b has shown that single uses the example of film device of the present invention, and wherein device comprises a plurality of film filter cylinders that stack.Each filter cylinder in the device all with the contiguous filter cylinder of the next one with fluid connection.Filter cylinder can comprise one or more porous-films.If filter cylinder comprises a plurality of porous-films, film can be identical or different with contained other porous-films of filter cylinder.In some embodiments, the polypropylene with heating can merge the interior a plurality of films of filter cylinder.For example, first filter cylinder can comprise mixed cellulose ester (MCE) film, and second filter cylinder that overlays under first filter cylinder can comprise glass fibre membrane.MCE can have the demarcation aperture littler than glass fibre membrane.

Fig. 7 has shown the example of the device of a plurality of film ventages of having of an embodiment of the invention.Device can be connected through bidirectional vacuum valve (control valve assembly) with syringe.Bidirectional vacuum valve can be communicated with the solution manifold.Send a plurality of pipelines that link to each other with air vent with solution container (for example sample, lysate, washings, elutriant/damping fluid) from the solution manifold.Each solution pipeline all is subjected to automatically controlled folder to close valve to control.Can in turn introduce sample, follow, follow by washings, follow by elution buffer by lysis buffer so that on first porous film surface of device, catch and lysing cell, then from device stack film catch, wash and wash-out under nucleic acid.First porous-film of device can comprise polymkeric substance for example MCE, PES.Second film can comprise for example glass fibre of silicate.The demarcation aperture of polymeric film is less than the demarcation aperture of silicate films.System shown in Figure 7 is a example how to realize automatization.

Film

Using film and not using the remarkable advantage that is used for analyte absorption or chromatographic porous bead is the difference of two kinds of liquid flowing modes between the form.When for example using porous bead in packed bed, the analyte in the migration stream that is applied permeates into film surface, then also slowly disperse in the hole of bead.When using film, the analyte in added migration stream moves through film apace, only need permeate into film surface.Utilize film can realize saturated combination quickly than pearl to analyte.Because film is a kind of side direction much larger than structure longitudinally, therefore substance transfer can appear through film under various motivating forces.

Except great majority migration wherein all with the proper flow device of film Surface Vertical, also the radial flow device can be used for analyte absorption and stratographic analysis.In the radial flow device, liquid stream is flowed through and is wound in perforated cylinder shape frit film on every side.Liquid stream can be from inside to outside or from outside to inside.

The used film of the present invention can comprise any porous material known in the art.Suitable porous material example includes but not limited to polyethersulfone, polymeric amide is agarose for example, Mierocrystalline cellulose, polysaccharide, tetrafluoroethylene, polysulfones, polyester, fluorinated ethylene propylene, polypropylene, fluorocarbon for example poly-(tetrafluoroethylene-be total to-perfluor (alkyl vinyl ether)) (poly (tetrafluoroethylene-co-perfluoro (alkyl vinylether))), polycarbonate, polyethylene, glass, polycarbonate, pottery, nylon, metal and carbon-based material be graphite fibre and carbon nanotube for example.

In concrete embodiment, first film can comprise cellulose mixture, for example mixed cellulose ester membrane (MCE) or the polymkeric substance that comprises alkylsulfonyl polyethersulfone (PES) for example.Second film can comprise glass or glass fibre.In some embodiments, can be with being suitable for for example second film of resin replacement of RNA of stranded nucleic acid.Comprise the 3rd the optional film of capture probe if desired, the 3rd film can comprise nylon.

Those skilled in the art will understand, can select by other films that are applicable to that material of the present invention is formed according to the zeta-potential (zeta-potential) of hydrophobicity and film.The material particulate that all contact with liquid or macroscopic all requires its surface to have electric charge.Zeta-potential is the index of this electric charge, can be used to predict and control the stability of soliquid or milk sap.Streaming potential/streaming current method can be used to determine membrane zeta-potential (see for example Lu et a1., 2006, J.Colloid.Interface Sci.299 (2) 972; Haggard et al., 2005, Langmuir 21 (16): 7433; Werner et al.1998, J.Colloid Interface Sci.208 (1): 239).Zeta-potential is the measured value of the surface electrostatic state of material.If the interaction between nucleic acid and the material is mainly by electrostatic interaction decision, so under identical imposing a condition, in all pH scopes, have two kinds of materials that similar zeta-potential composes should be similarly corresponding to the ability of itself and nucleic acid interaction.Estimate to relate to be transformed into the nucleic acid purification scheme of less salt state from high salt state will be to the zeta-potential sensitivity of the material that is used for capture nucleic acid.

Film of the present invention can have scope from 0.01 μ m to 300 μ m, 0.1 μ m to 100 μ m, 0.1 μ m to 50 μ m, 0.1 μ m is to the aperture of 20 μ m.In specific implementations, wherein at least one film has the aperture of 0.45 μ m.In concrete embodiment, one of them film has the demarcation aperture of 0.2 μ m.Film of the present invention can have the thickness of scope from 0.1mm to 10mm.Thickness is represented the distance from an outside surface to another outside surface, and it is corresponding to when the power that applies to film for example when gravity, vacuum unit, the distance that will pass through during the sample transmembrane.Film can be symmetric or asymmetric.Film itself can be made up of one or more layers film.

Nucleic acid samples

Sample comprises the material of the nucleic acid that is derived from any biological origin in this expression.Biological origin can be for example plant, animal, a virion of any live body things.Biological origin comprises whole organism or is derived from the organ or tissue of organism.Biological origin can be single celled for example bacterium, mycoplasma, or cellulous for example animal or plant, or acellular for example virus.The cell source can comprise eukaryotic cell, prokaryotic cell prokaryocyte.Eukaryotic example can comprise and is derived from any mammiferous cell, for example people, non-human primates, horse, goat, sheep, mouse, rabbit, mouse, cavy.The example of prokaryotic cell prokaryocyte comprises gram negative bacterium and gram positive bacterium for example intestinal bacteria, Pseudomonas aeruginosa, streptococcus aureus.Sample can comprise whole cell or its lysate.Sample can comprise naturally occurring sample or those partly or entirely artificial generate or finished samples.

The isolating target nucleic acid that is used in the said method comprises any nucleic acid that sample is found, comprises the hybrid of DNA, RNA, PNA, LNA and more than one nucleic acid types.Nucleic acid can be double-stranded, strand or multichain.When target was DNA, DNA can be the fragment that plasmid DNA, carrier DNA, genomic dna comprise Mitochondrial DNA or above-mentioned any DNA.When target comprises RNA, RNA can be mRNA, tRNA or for example 16sRNA, 23s RNA or its any combination of rRNA.Nucleic acid can comprise for example chain terminator of nucleotide analog.The magnitude range of target nucleic acid can from 2 to 30 Nucleotide or can is kilobase or bigger scope.

Test kit

The present invention also provides the test kit that can be used for isolating from sample nucleic acid.Test kit can comprise one or more filtration unit of the present invention and one or more container.Test kit can comprise one or more contrasts or sample target nucleic acid or sample, can randomly comprise the various damping fluids that the inventive method is used.For example, test kit can comprise the lysis buffer that is suitable for lytic virus particle or cell.Test kit can randomly comprise and be used to eliminate lavation buffer solution reagent or non-special delay or the bonded material.Other optional test kit reagent comprise the elution buffer that is used for going out from the film wash-out bonded target nucleic acid.Can in different containers, the form with solution provide every kind of damping fluid.Perhaps, can provide damping fluid, can it be prepared into solution according to the required purposes of user with dried forms or powder type.In this case, can provide damping fluid by bag.For device be automatization and for example situation of vacuum pump mode of external force is provided, test kit can provide propulsion source.Test kit also can comprise and be used for the specification sheets that using appts and/or preparation are applicable to the reagent of apparatus and method of the present invention.When implementing method of the present invention or when using device of the present invention, also can comprising the optional record and the software of the data that analysis obtained.

Be used to detect method of microorganism and oligonucleotide

In specific implementations, the invention provides the oligonucleotide that is suitable for the microorganism in the test sample.Oligonucleotide can comprise DNA or RNA, can be incorporated into the part of microbial genome at least specifically.Microorganism can the time virus for example microvirus comprise minute parvovirus of mice (MVM) or mycoplasma.

Specificity is combined in this expression nitrogenous base pairing, and the Nucleotide that for example comprises guanine will combine with the Nucleotide specificity that its complement promptly comprises cytosine(Cyt).Similarly, the Nucleotide that comprises VITAMIN B4 will combine with the Nucleotide specificity that its complement promptly comprises thymus pyrimidine.Under medium stringent condition, sequence can combine with its complement specificity usually.

One or more oligonucleotide can comprise short nucleotide sequence for example dna sequence dna or RNA sequence, and described sequence can combine with at least a portion specificity in the genome of one or more mycoplasmas or MVM.The length range of oligonucleotide is normally from 10 Nucleotide to 40 Nucleotide, from 15 Nucleotide to 35 Nucleotide, from 20 Nucleotide to 30 Nucleotide.

Therefore the present invention provides the separated DNA sequence, and it is selected from: (a) comprise nucleotide sequence SEQ ID NO:4,5,6,7,8,9,10,11 and/or 12 DNA; (b) DNA that can under medium stringent condition, hybridize with the DNA of arbitrary sequence encoding among the SEQ ID NO:4,5,6,7,8,9,10,11 and/or 12; (c) DNA that can under high stringent condition, hybridize with the DNA of (a).

In another embodiment, nucleic acid molecule of the present invention also comprises and SEQ ID NO:4,5,6,7,8,9,10,11 and/or 12 80% identical nucleotide sequences at least.Wherein to comprise with SEQ ID NO:4,5,6,7,8,9,10,11 and/or 12 at least 90% identical, at least 95% identical, at least 98% identical, at least 99% embodiment identical or at least 99.9% identical sequence also be that the present invention is desired to nucleic acid molecule.Homogeny per-cent can comprise the homogeny on the whole sequence length, for example can replace one or more Nucleotide with one or more different Nucleotide, and perhaps it can comprise the brachymemma of a part of sequence, or both combinations.Can determine homogeny per-cent by observation and mathematical computations.Perhaps, utilize Devereux et al.1984, Nucl.Acids Res.12:387 GAP computer program described and that obtain from University of Wisconsin's genetics computer set (UWGCG) can be determined the homogeny per-cent of two kinds of nucleotide sequences by comparative sequences information.The preferred default parameter of GAP program comprises: the monobasic comparator matrix of (1) Nucleotide (value that comprises for identical be 1, for non-identical be 0), with Gribskov and Burgess 1986, the weighting comparator matrix of Nucl.Acids Res.14:6745, as Schwartz and Dayhoff, eds.1979, Atlas of Protein Sequence andStructure, National Biomedical Research Foundation, pp.353-358 is described like that; (2) offset of each breach is 3.0, each the mark ancillary relief 0.10 in each breach; (3) not compensation of terminal breach.Also can use relatively other used programs of those skilled in the art of sequence.

Medium stringent condition comprises the condition that the general personnel in this area can determine easily according to for example DNA length at this.Sambrook et al.1989, Molecular Cloning:A LaboratoryManual, 2d ed., 1:1.101-104, Cold Spring Harbor Laboratory Press has set primary condition, comprises that pre-wash solution (comprises 50% methane amide, 6X SSC, 42 ℃; Or other similar hybridization solutions for example Stark solution, 50% methane amide, 42 ℃), and wash conditions is 60 ℃, 0.5X SSC, 0.1%SDS.

High stringent condition comprises the condition that general personnel determine easily according to for example DNA length at this.These conditions are generally defined as aforesaid hybridization conditions, and with nearly 68 ℃, 0.2XSSC, 0.1%SDS the washing.The technician will recognize, according to factor for example oligonucleotide length can adjust temperature and washing soln salt concn as required.

Two kinds of oligonucleotide can be used as the primer in the polyreaction, and for example PCR comprises RT-PCR, PCR in real time.In PCR, use two kinds of primers, itself and specific DNA sequence are hybridized, and it is synthetic to promote that therefore polysaccharase starts DNA.Primer is incorporated in opposite direction startup DNA with complementary DNA link and synthesizes.The 3rd oligonucleotide can be used as the probe that is used to detect the pcr amplification sequence, by combining with at least a portion in the contained nucleotide sequence in the extension increasing sequence.Wherein at least one oligonucleotide can the time peptide nucleic acid(PNA) (PNA).Peptide nucleic acid(PNA) is a nucleic acid molecule, has wherein replaced ribodesose or the ribose skeleton that is present in usually in DNA and the RNA with peptide backbone.The method for preparing PNA is known (see for example Nielson, 2001, CurrentOpinion in Biotechnology 12:16) in this area.

In specific implementations, detecting the contained target nucleic acid sequence of microorganism may need.Therefore, can modify one of them oligonucleotide with detecting thing.Suitable detected thing comprises dyestuff, and for example fluorescence dye, radio-labeling be for example ³²P and molecule by being detected in conjunction with one or more additional molecules.For example, can modified oligonucleotide by adding digoxigenin, by detecting this oligonucleotide in conjunction with one or more antibody.Antibody also can be modified to and comprise one or more things that detect.Can detect thing and can be placed on the oligonucleotide probe, perhaps similarly can detect thing and can be placed on one or more oligonucleotide, described oligonucleotide in amplified reaction as primer.

If can detect thing is the used fluorescence dye of PCR in real time, also can use the quencher labeled oligonucleotide.Usually implement PCR in real time with the quencher that has the probe of fluorescence report and be positioned on the close position.The close proximity of report and quencher is avoided its emitting fluorescence, only just can see fluorescence subsequently in the probe degraded.This process depends on 5 ' to 3 ' exonuclease of related polysaccharase.Separate in the chain process at DNA, probe can combine (primer also is like this) with the complementary sequence in the relevant range of template DNA.When heating PCR activated polysaccharase, polysaccharase began to produce complementary strand on the single stranded DNA in conjunction with primer.When polymerization continued, it arrived and its complementary sequence bonded probe place.Polysaccharase chemical ground " covering " probe is broken into isolating Nucleotide with it, and therefore separates fluorescence report and quencher.This has just caused the increase of fluorescence.When PCR carries out more and more fluorescence report with its quencher disengaging, caused the significant geometry of fluorescence to increase.This just allows and determines amount final and initial DNA exactly.

In concrete embodiment, the invention provides the oligonucleotide that one or more are applicable to the mycoplasma in the test sample.Surprising, the present inventor has been found that at least a portion bonded oligonucleotide specifically in the genome of a plurality of and a plurality of mycoplasma species.Therefore, in specific implementations, oligonucleotide combines specifically with at least 12 mycoplasma species.Utilization can comprise Mycoplasma orale (M.orale) by detected mycoplasma species according to one or more oligonucleotide of the present invention, mycoplasma hyorhinis (M.hyorhinis), Mycoplasma gallisepticum (M.gallisepticum), mycoplasma pneumoniae (M.pneumoniae), synovia mycoplasma (M.synoviae), mycoplasma fermentans (M.fermentans), Lai Tewa mycoplasma (M.laidlwaii), mycoplasma arginini (M.arginini), mycoplasma hominis (M.hominis), M.pirum, mycoplasma salivarium (M.salivarium), mycoplasma arthritidis (M.arthritidis).

The present invention also provides the method for microorganism in a kind of test sample, comprises a) isolating nucleic acid from sample; B) isolating nucleic acid contacts with a plurality of oligonucleotide of the present invention; C) amplify from least a portion in the isolating nucleic acid of sample, detect the microorganism in the sample in view of the above.Method can also comprise optional step, and the nucleic acid that is about to be increased contacts with the oligonucleotide that warp can detect substance markers.Perhaps, in some embodiments, if for example use PCR in real time, step b) can comprise isolating nucleic acid with comprise can detect thing at least a oligonucleotide for example probe contact.

Embodiment

Embodiment 1: isolate rRNA from Pseudomonas aeruginosa

Will be in 4ml trypticase soya broth (TSB) the Pseudomonas aeruginosa culture of grow overnight transfer among the 20ml TSB and reach the logarithmic phase growth at 35 ℃.The optical density(OD) that is measured in the 600nm place is 0.888, and it is 4.1E08 colony-forming unit/milliliter (cfu/ml) that count plate obtains bacterium colony density.Culture is diluted 100 times (4.1E06cfu/ml) in TSB.

Give the Millipore differential every device (Fig. 1) (Millipore Corporation, Billerica, MA) 13mm 0.7 micron glass fibre of APFF (underlying membrane) and 13mm mixed cellulose ester (MCE) 0.45 micron membranes (top layer film) are installed, so that the former YMT film that provides to be provided.Only replace the former YMT film that provides and second Millipore differential is installed every device with 13mm MCE 0.45 micron membranes.

The positive control that will comprise the 4.1E06cfu Pseudomonas aeruginosa among the 1ml TSB is 10, and 000rpm, 4 ℃ centrifugal 10 minutes down obtain throw out.

In device, add 1ml Pseudomonas aeruginosa (4.1E08 cfu or 4.1E06 cfu) to differential.With the device after filling 4000rpm, 4 ℃ centrifugal 5 minutes down.Discarded filtered liquid.To differential in device, add hen egg-white lysozyme TE solution (100 microlitres, 0.4mg/ml).After top layer film at room temperature contacts 10 minutes, adding 600 microlitres comprises 350 μ l and contains 25-50% guanidine thiocyanate (Qiagen RNAeasy Minikit  (Qiagen, Inc., Valencia, CA)) RLT damping fluid and 250 microlitre alcoholic acid solution, and allow that it stopped 5 minutes on top layer film.To install 4000rpm, 4 ℃ centrifugal 5 minutes down.Discarded from the filtered liquid of the differential with two films in device.(Valencia is in the mini post of Qiagen CA) for Qiagen, Inc. will to join QiagenRNAeasy Minikit  from the filtered liquid of the differential with suitable top layer film in device.The cell precipitation of positive control in vitro carries out cracking by similar mode little, also be added into then Qiagen RNAeasy Minikit  post (Qiagen, Inc., Valencia, CA) in.Comprise 2.5-10% guanidine thiocyanate and 2.5-10% alcoholic acid RW1 damping fluid (Qiagen RNAeasyMinikit ) (Qiagen with 700 microlitres, Inc., Valencia, CA) the washing differential is every device and Qiagen post, 4000rpm, 4 ℃ centrifugal 5 minutes down, use (Qiagen, Inc. then from Qiagen RNAeasy Minikit , Valencia, 500 microlitre RPE damping fluid washed twice CA).Discarded all filtered liquids.Adding 100 microlitres by twice order does not have RNA enzyme water and carries out wash-out.

(Invitrogen Corporation, Carlsbad CA), will be added to the PowerBase through Sybersafe E-gel from the elution samples in two film devices, the monofilm device that links to each other with the Qiagen post or the independent Qiagen post according to manufacturer's specification sheets ^TMIn the hole of prestained 1.2% agarose.Allow and ran glue 15 minutes.(Fujifilm Global, Japan) UV on excites and blue emission can be seen nucleic acid belt with LAS-3000.The result confirms that the rRNA that is separated to has generated 16s and 23sRNA from of the present invention pair of membrane filter appts, without any significantly genomic dna pollution.On the contrary, flowing through that the sample of Qiagen post has significantly can detected genomic dna band (Fig. 8).The sample of the cracking and the Qiagen post of flowing through does not subsequently have tangible genomic dna to pollute (data do not show) on the MCE filter membrane.

Embodiment 2: quantitative isolating RNA

Quantitatively go out warp such as embodiment 1 MCE film recited above and glassy membrane subsequently and MCE film and Qiagen post subsequently (Qiagen, Inc., Valencia, the RNA that CA) handled that from sample, is separated to RT-PCR.Bacterial cell precipitation (also recited above as embodiment 1) in contrast.

Buy the special primer of following 23S Pseudomonas aeruginosa:

PAF1-23S (TAM), forward primer CACACGGCGGGTGCTAAC (Sigma-Aldrich, St Louis, MO) (SEQ ID NO:1)

PAR1-23S (TAM), reverse primer CCACAACTTTGGGACCTTAGCT (Sigma-Aldrich, StLouis, MO) (SEQ ID NO:2)

PAP1-23S (TAM), the probe CCGTCGTGAAAAGGGAAACAACCCA of FAM mark (Applied Biosystems, Inc., Foster City, CA) (SEQ ID NO:3).

Utilization is carried out PCR in real time through the probe of top fluorescence labels and quencher mark.The generation of PCR product has caused dissociating of label on the probe and quencher, has therefore generated fluorescent signal, and the combined standard curve can quantitatively go out the PCR product with described fluorescent signal.Produced time of occurrence (emergence time) (CT) and the standard value of nucleic acid molecule with the Pseudomonas aeruginosa rRNA transcription of concentration known.Threshold period (CT) represents that the fluorescent signal of wherein RT-PCR reaction surpasses the branch number of cycles of predetermined fluorescence threshold.In order to get in touch rRNA copy number and CT value, at first set up the linear relationship between known number purpose Pseudomonas aeruginosa rRNA and the CT value.Determine the copy number of the Pseudomonas aeruginosa rRNA that from handled sample, is purified into then with this typical curve.

Use an one step RT-PCR standard mix reagent box (ABI).Mix the eluted rna of forward primer (300nM) and reverse primer (10nM), probe (50nM), 2X RT-PCR mixture, reversed transcriptive enzyme and 10 microlitre samples, make that final volume is 15 microlitres.ABI 7000 cycle instrument (Applied Biosystems, Inc., Foster City, carry out following cycling program in CA):

1.50 ℃, 30:00 minute

2.95 ℃, 10:00 minute

3.95 ℃, 0:15 minute, 40 cycles

4.62 ℃, 1:00 minute

Quantitative (being with or without reversed transcriptive enzyme) to the RNA in the sample and positive and negative control (no template) all repeats 3 times.

Utilize quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) (PCR in real time) to confirm by before catching, using the degree of the selectivity RNA purifying that the MCE film obtained, as Fig. 9 and table 1 with glass fibre.Set up DNA in each sample to the relative quantity of RNA by each sample is all carried out PCR when existing or not having reversed transcriptive enzyme.When not having reversed transcriptive enzyme, an amplifying genom DNA.When having reversed transcriptive enzyme, carrying out PCR subsequently can DNA amplification and RNA, but the initial copy number of the RNA of concrete target sequence is obviously excessive (〉=1000 times) with respect to the initial copy that is derived from genomic dna.Therefore, when reversed transcriptive enzyme was used to the PCR of ribosome-RNA(rRNA), viewed amplified signal all was the signal of RNA basically.Exist or the ratio of target gene copy number (being derived from the typical curve of known original nucleic acid concentration) when not having reversed transcriptive enzyme by determining, catch the remarkable reduction that cell has been realized the genome contaminating dna on the cracking MCE film.Determine the copy number of the nucleic acid signal that is increased by association test CT value and the corresponding copy number value on the typical curve of the Pseudomonas aeruginosa rRNA of known quantity definition.The DNA copy that exists in noRT (no reversed transcriptive enzyme) the copy number representative sample (perhaps if desired be RNA, be exactly the level of DNA pollutent) number.If the contrast throw out is set to standard substance, determine degree (table 1) so easily by the RNA purifying that uses the realization of MCE film or two membrane method.The copy number of the noRT reaction of three samples has following numerical value: positive control (6.63E+07 copy), MCE film be Qiagen post (1.42E+06 copy), MCR/APFF film (3.05E+05 copy) then.The sample of handling by the MCE film shows significantly less callable DNA, and therefore purer RNA sample is provided.Therefore, make relative purifying approach 2 orders of magnitude (Fig. 9) with the MCE film.

Table 1

Sample	Condition	Q1	Q2	Q3	Mean value	Stdav	Copy	Copy	Copy	Mean value	Compare the relative mark of genomic dna with the Qiagen test kit with precipitation	With respect to contrast precipitation, the percentage ratio that genomic dna reduces
													41EO6 precipitation, Qiagen test kit (positive control) then	RT	12.15	12.16	12.11	12.14	0.03	1.78E+10	1.77E+10	1.83E+10	1.79E+10
	NoRT	19.25	19.33	19.28	19.29	0.04	6.81E+07	6.40E+07	6.68E+07	6.63E+07	1.00E+00	0.0
4.1EO6 the MCE film, Qiagen leans on then	RT	12.18	12.25	12.08	12.17	0.08	1.74E+10	1.64E+10	1.87E+10	1.75E+10
														NoRT	24.29	24.1	24.18	24.19	0.10	1.31E+06	1.52E+06	1.43E+06	1.42E+06	2.14E-02	97.9
													41EO6 MCE/APFF film	RT	13.74	13.61	13.45	13.60	0.15	5.09E+09	5.64E+09	6.42E+06	5.72E+09
	NoRT	26.22	26.22	26.02	26.15	0.12	2.88E+05	2.88E+05	3.39E+05	3.05E+05	4.60E-03	99.5
NTC (no template contrast)	RT	N/A	29.76	N/A	29.76	N/A	ND	1.80E+04	ND	1.80E+04	2.72E-04	100.0

Embodiment 3: the multi-joint analysis of isolation of RNA (Multiscreen Analysis)

Pseudomonas aeruginosa cell (1.83E06cfu) is trapped in and is inserted in the multi-joint manifold of Millipore (Millipore Corporation, Billerica MA) on 0.45 micron MCE 96 orifice plate (Millipore Corporation, Billerica MA) that 0.01% peptone is prewetted.Then with 300 μ l0.01% peptones washing captured cell.To the MCE plate (Millipore Corporation, stack below BillericaMA) 1.0 microns Type B glass mats (Millipore Corporation, BillericaMA).Adding contains 100 μ l, and (200 μ l solution of RLT damping fluid CA) and 1000 microlitre ethanol allow that it stopped 5 minutes in the hole of top plate for Qiagen Inc., Valencia from Qiagen RNAeasy Minikit .Filtering cracked solution subsequently, taking out and discarded top layer screen plate.With 200 microlitre RW1 damping fluids (Qiagen, Inc.Valencia, CA) and 200 microlitre RPE damping fluids (Qiagen, Inc., Valencia, CA) the cleaning glass fiberboard is 1 time.Use 300 microlitre washing with alcohol screen plates twice then, so that dry hole.Adding recovery collecting board below glass mat (Millipore Corporation, Billerica, MA).The wash-out from glass mat of wash-out successively that does not have RNA enzyme water by each 100 microlitres goes out nucleic acid.

In order to determine the relative purity of bacterial ribosome RNA, at first use Syber Gold dyestuff (the Invitrogen Corporation of 5 microlitres dilution in 1: 1000, Carlsbad, CA) and 15 microlitre sample eluates or 60ng 0.5-10Kb rna ladder (Invitrogen Corporation, Carlsbad, CA) filling 48 holes 2% clarification agarose E glue (Invitrogen Corporation, Carsbad, CA).Ran glue 30 minutes.(Fujifilm Global, Japan) UV on excites with blue emission and demonstrates the nucleic acid band with LAS-3000.

(MA) a plurality of screen plate types on are carried out the isolating whole process of cell capture, cracking and selective nucleic acid for Millipore Corporation, Billerica to utilize the multi-joint manifold of Millipore.At first catch cell by the vacuum filtration on the MCE screen plate.Then glass mat is positioned over the below of MCE screen plate.(Qiagen, Inc.Valencia CA) carry out lysis with ethanol with the 50% RLT damping fluid based on the Qiagen guanidine.Filtration through two plates has caused the RNA on the glass mat to be detained.Behind discarded top layer MCE plate, with Qiagen RW1 and RPE damping fluid (Qiagen, Inc.Valencia, CA) cleaning glass fiberboard.Use ethanol filtered liquid drying plate then.Carry out wash-out successively twice of each 100 microliters of water.

Result's confirmation has obtained not have the ribosome-RNA(rRNA) (16S, 23S) of obvious genomic dna pollution with multi-joint form.

Embodiment 4: separate from cell culture supernatant and the detection viral DNA

From the indicating clone people NB-324K that has infected minute virus of mice, collect supernatant liquor.At 8log10 TCID ₅₀/ ml calculates the virus titer of supernatant liquor.

With two-layer ultrafiltration poly (ether sulfone) film (demarcate aperture be 28 nanometers) be inserted into sealing have a ventage have that (Fig. 6 a) in the overhead guard Millipore device.The overhead guard Millipore device that has that has ventage of second sealing contains Millipore APFF glass fibre membrane (0.7 micron).Outlet by luer sliding latch mode (luer slip to luer lock) connects to install to inlet and self stacks.

In first film device, add the cell culture supernatant that 0.5ml contains virus.Second device polyphone ground is positioned over after first installs.Add 1ml with syringe and comprise 500 μ l from Qiagen RNeasy Minikit  (Qiagen, Inc., Valencia, the solution of the RLT damping fluid that comprises 25-50% guanidine thiocyanate CA), and allow that it stopped 10 minutes on top layer film.Can remove excessive liquid by utilizing syringe with the air scour device.Comprise 2.5-10% guanidine thiocyanate and 2.5-10% alcoholic acid RW1 damping fluid (Qiagen RNeasy Minikit ) (Qiagen with being added with 1ml, Inc., Valencia, the device that overhead guard is arranged that has ventage of the sealing of syringe washing polyphone CA), then with having 1ml Qiagen RNeasy Minikit  (Qiagen, Inc., Valencia, the syringe washing device of RPE damping fluid CA) 2 times.Discarded all filtered liquids.With the dry differential of the syringe that is added with air every device.Tripping device, and by add 500 microlitre nuclease free water carry out each the device on wash-out.

With PCR in real time quantitatively through differential every device and the DNA that is separated to of Qiagen damping fluid.With the viral nucleic acid of previous quantitative mistake in contrast.Add forward and reverse primer, the probe that has fluorescence labels and quencher, water, template and ABI 2X Universal TaqMan PCR MasterMix, make that final volume is 20 μ l.Probe that is specific to MVM and primer below using:

Forward primer (MVMJ02275f1): GCAAACAGCATGGTGAAAATTG (SEQ ID NO:4)

Reverse primer (MVMJ02275r): CCTGAACCAAAGCTTGTTTCATC (SEQ ID NO:5)

Probe (MVMJ02275 probe 1): TGGACCAGCACCAGAGCGCTACAC (SEQ ID NO:6)

On BioRad Chromo4 instrument, circulate: 1) 50 ℃, 2:00 minute; 2) 95 ℃, 10:00 minute; 3) 95 ℃, 0:15 minute; 4) 60 ℃, 1:00 minute; 5) return step 3 totally 39 times.

Table 2

Sample	Ct1	Ct2	Ct3	Mean value	Standard deviation	cv
							8log 10TCID 50/ml VR	28.84	28.88		28.86	0.03	0.001
8log 10TCID 50/ml APFF	17.54	17.57		17.56	0.02	0.001
							8log 10TCID 50/ml VR	30.24	30.37		30.31	0.09	0.003
8log 10TCID 50/ml APFF	18.57	20.00		19.29	1.01	0.052
							No template contrast	ND	ND	ND	ND
10^6copies/ul (PCR internal reference)	19.65	19.97		19.81	0.23	0.011

Amplification reference standard nucleic acid as expection.From APFF and ultrafiltration polyethersulfone (UF PES) film, successfully reclaim and detect viral DNA (represented) as the VR in the table 2.The APFF film has been detained more nucleic acid than UF PES film.

Embodiment 5: separate from mycoplasma hyorhinis and quantitative rRNA.

Culture on the 1st of mycoplasma hyorhinis is grown in 50ml contain (37 ℃ and 7%CO in the serum of mycoplasma broth culture ₂).The colony concentration of this culture is 2.4 * 10 ⁸Cfu/ml.Culture is diluted 1000 times in 0.1% peptone.Counting Chinese hamster ovary (CHO) cell culture finds that its concentration is 1.1 * 10 ⁷Cell/ml.

Preparation contains 25mm Millipore polypropylene prefilter (the Millipore Corporation with 10 microns demarcation apertures, Billerica, MA) and the sealing of 0.5 micron/0.1 micron poly (ether sulfone) film (PP10-HVEP) have a ventage overhead guard Millipore device arranged.Also prepare second device that contains 25mm APFF glass fibre.

Positive control is to contain being used to of recommending the scheme of solution example of bacterium through Qiagen RNAeasy test kit (Qiagen, Valencia, 2.4 * 10 in 1ml 0.1% peptone of CA) handling according to the manufacturer ⁵Mycoplasma hyorhinis.

Before sample introduction, in each device, push 3ml 0.1% peptone with the 10ml syringe.In two PP10-HVEP devices, add 3ml 0.1% peptone; In two PP10-HVEP devices, add 3ml and wherein contain 0.1% peptone of 100 μ l through the mycoplasma hyorhinis of 100 times of dilutions; In two additional PP10-HVEP devices, add 3ml and wherein contain the Chinese hamster ovary celI supernatant liquor of 100 μ l through the mycoplasma hyorhinis of 100 times of dilutions.Add and push sample through device with the 10ml syringe.1ml Qiagen damping fluid RLT+ ethanol (1: 1) solution is pumped in the 10ml syringe (each device), and joins in the device, begin to occur 1 or 2 drop of liquid up to bottom at device.In each PP10-HVEP device, add the APFF device safely.Allow that the RLT-ethanolic soln stopped 5 minutes under the room temperature, disposed solution subsequently from device on filtering.Tripping device, and further handle the device that has the APFF filter.Push 1ml Qiagen damping fluid RW1 with the 10ml syringe through the APFF filtration unit.Push 1ml Qiagen damping fluid RPE with the 10ml syringe through the APFF filter, repeat then 1 time.In the APFF filtration unit, add 500 microlitre nuclease free water then, pressurization by and be collected in vitro.

Will be through the sample handled of device in Ultralow Temperature Freezer freezing 30 minutes, be placed into then Savant DNA 120 SpeedVac (system on Medium, Manual Setting) (ThermoElectron Corp., Waltham, MA) in.Sample is not heated between diakinesis at SpeedVac.Drying material is resuspended in the 50 μ l nuclease free water.

Carry out PCR in real time.Generate the standard value of time of occurrence (CT) and nucleic acid molecule with the rna transcription thing of concentration known.Threshold period (CT) represents that the fluorescent signal of wherein RT-PCR reaction surpasses the branch number of cycles of predetermined fluorescence threshold.In order to set up the dependency of RNA copy number and CT numerical value, the mycoplasma hyorhinis rRNA of dose known amounts and the linear dependence between the CT value have at first been set up.Determine the copy number of the mycoplasma hyorhinis rRNA that from handle sample, is purified into then with this typical curve.

Use an one step RT-PCR standard mixture test kit (Applied Biosystems, Foster City, CA).Mix the eluted rna of forward primer (400nM) and reverse primer (400nM), probe (300nM) (through fluorescence labels and quencher mark), 2X RT-PCR mixture, reversed transcriptive enzyme and 5 microlitre samples, make that final volume is 25 microlitres.Detect following primer and the probe of use eventually at this:

Sequence set 1:

Forward primer: AAATGATCCGCCTGAGTAGTATGC (SEQ ID NO:7)

Reverse primer CATGCTCCACCGCTTGTGC (SEQ ID NO:8)

Probe: CGCAAGAGTGAAACTTAAAGGAATTGACGG (SEQ ID NO:9)

Sequence set 2:

Forward primer: AAACATCCCGCCTGGGTAGTACAT (SEQ ID NO:10)

Reverse primer: CAACATGCTCCACCACTTGTG (SEQ ID NO:11)

Probe: CGCAAGAATGAAACTTAAACGGAATTGACG (SEQ ID NO:12)

In ABI 7000 circulation instrument, the cycling program below carrying out:

1.50 ℃, 30:00 minute

2.95 ℃, 10:00 minute

3.95 ℃, 0:15 minute, 40 circulations

4.55 ℃, 1:00 minute

Quantitative (being with or without reversed transcriptive enzyme) to the RNA in the sample and positive and negative control (no template) all repeats 3 times.Table 3 has shown the result.

Table 3

The sample name	CT	Std.Dev.CT	Quantity	Average quantity	Std.Dev.Quantity
						Neg#1
Neg#2
		Myco#3	26.27			0.278		6.95E+06		7.25E+06	1.41E+06
26.48	6.02E+06
			25.93	8.78E+06
Myco#4	26.33				1.016		6.69E+06	1.25E+07	9.46E+06
		24.51	2.34E+07
	26.2			7.31E+06
		CHO+Myco#5	24.6			0.233	2.19E+07			2.01E+07	3.06E+06
25.01	1.65E+07
			24.61	2.17E+07
CHO+Myco#6	24.62				0.346		2.16E+07	2.70E+07	6.63E+06
		24.41	2.49E+07
	23.94			3.44E+07
		MycoTube#1	24.48			0.287	2.38E+07			1.92E+07	3.99E+06
24.97	1.70E+07
			24.98	1.69E+07
MycoTube#2	25.72				0.547		1.01E+07	1.37E+07	5.52E+06
		24.73	2.00E+07
	25.63			1.08E+07
		Cracking filtered liquid #1
Cracking filtered liquid #2
		Cracking filtered liquid #3	37.79			-1	2547.83
Cracking filtered liquid #4	39.2				1.376		963.6	2937.72	2783.902
		38.35	1727.67
	36.51			6121.88
		Cracking filtered liquid #5	31.13			0.253	246485.42			223580.92	36721.332
31.58	181225.69
			31.15	243031.64
Cracking filtered liquid #6	30.51				0.547		377207.84	558744.03	214071.602
		29.43	794805.31
	30.09			504218.94
		No RT	35.6			3.695	11470.41			626558.41	546658.382
29.01	1.06E+06
			29.4	811279.56

Sample Neg#1 and Neg#2 are negative controls, do not have mycoplasma.Sample Myco#3 and Myco#4 are mycoplasmas, but do not have Chinese hamster ovary celI, and through the film processing treatment.Sample CHO+Myco#5 and CHO+Myco#6 have mycoplasma and Chinese hamster ovary celI, and through the film processing treatment.The mycoplasma that sample Myco Tube#1 and Myco Tube#2 have precipitation and in vitro handled.

Sample dissociation filtered liquid #1, cracking filtered liquid #2, cracking filtered liquid #3, cracking filtered liquid #4, cracking filtered liquid #5 and cracking filtered liquid #6 represent the filtered liquid behind the adding lysate in sample Neg#1, Neg#2, Myco#3, Myco#4, CHO+Myco#5 and CHO+Myco#6 respectively respectively.According to manufacturer's specification sheets, with Qiagen RNAeasy  MinikitColumn (Qiagen, Valencia, CA) processing treatment filtered liquid.Sample NoRT is illustrated in when not having reversed transcriptive enzyme the amplified reaction that sample Myco#3 and Myco#4 are carried out, and the indicator that pollutes as the DNA in the sample.

All numbers of used expression integer amount, reaction conditions etc. all should be understood to all be modified by term " approximately " in all situations in specification sheets and claims.Therefore, unless opposite explanation is arranged, the parameter that sets in this specification sheets and the appending claims all is proximate, and the required performance that may will reach according to the present invention and changing.Minimally and have no intention to limit and will be equal to the scope that clause is applicable to claims, each numerical parameter all should be understood according to the amount of significant figure and general rounding method.

Under the condition that does not break away from the spirit and scope of the present invention, can carry out multiple modification and change to the present invention, this is conspicuous for those skilled in the art.Only the mode with embodiment provides concrete embodiment described herein, and it is not as any restriction.This specification sheets and embodiment should only be considered to illustrational, and following claims have shown true scope of the present invention and spirit.

Sequence table

＜110〉Millipore Corp

＜120〉be used for the filtration unit of isolating nucleic acid

<130>MCA-762 US

<160>12

<170>PatentIn version 3.4

<210>1

<211>18

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>1

cacacggcgg gtgctaac 18

<210>2

<211>22

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>2

ccacaacttt gggaccttag ct 22

<210>3

<211>25

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>3

ccgtcgtgaa aagggaaaca accca 25

<210>4

<211>22

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>4

gcaaacagca tggtgaaaat tg 22

<210>5

<211>23

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>5

cctgaaccaa agcttgtttc atc 23

<210>6

<211>24

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PROBE

<400>6

tggaccagca ccagagcgct acac 24

<210>7

<211>24

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>7

aaatgatccg cctgagtagt atgc 24

<210>8

<211>19

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>8

catgctccac cgcttgtgc 19

<210>9

<211>30

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PROBE

<400>9

cgcaagagtg aaacttaaag gaattgacgg 30

<210>10

<211>24

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>10

aaacatcccg cctgggtagt acat 24

<210>11

<211>21

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PRIMER

<400>11

caacatgctc caccacttgt g 21

<210>12

<211>30

<212>DNA

<213>ARTIFICIAL

<220>

<223>ARTIFICIAL PROBE

<400>12

cgcaagaatg aaacttaaac ggaattgacg 30

Claims (25)

1. the method for an isolating nucleic acid from sample, comprise that the filtration unit that a) will comprise a plurality of porous-films contacts with sample, make sample in turn contact described a plurality of porous-film, described contact starts from first porous-film, contact at least the second porous-film subsequently, b) sample on first porous-film of cracking, wherein the demarcation aperture of first porous-film is less than the demarcation aperture of second porous-film, c) apply external force to filtration unit, isolate nucleic acid at least one film in described a plurality of porous-films in view of the above.

2. the method for claim 1 also comprises filtration unit is contacted with one or more damping fluids or washing reagent.

3. the method for claim 1 also comprises filtration unit is contacted with elution buffer.

4. the method for claim 1 also comprises sample is contacted with the 3rd porous-film.

5. the method for claim 4, wherein a plurality of porous-films comprise capture probe.

6. the process of claim 1 wherein that first porous-film comprises polymkeric substance.

7. the method for claim 6, wherein polymkeric substance is selected from polysaccharide and polyethersulfone.

8. the process of claim 1 wherein that second film comprises silicate.

9. the method for claim 8, wherein silicate is glass fibre.

10. the process of claim 1 wherein that sample comprises cell.

11. the process of claim 1 wherein that sample comprises virion.

12. the process of claim 1 wherein that sample comprises mycoplasma.

13. be used for from the filtration unit of sample isolating nucleic acid, it comprises a plurality of porous-films that set gradually, and makes the sample that puts on filtration unit contact with first porous-film that comprises polysaccharide earlier, contacts with second porous-film that comprises silicate at least subsequently.

14. the filtration unit of claim 13, wherein polysaccharide is a Mierocrystalline cellulose.

15. the filtration unit of claim 14, wherein Mierocrystalline cellulose is a mixed cellulose ester.

16. the filtration unit of claim 13, wherein silicate is glass fibre.

17. the filtration unit of claim 13 also comprises the 3rd porous-film that comprises capture probe.

18. the filtration unit of claim 13, wherein the demarcation aperture of first film is less than the demarcation aperture of second film.

19. be used for from the filtration unit of sample isolating nucleic acid; it comprises a plurality of porous-films that set gradually; make the sample that puts on filtration unit contact with first porous-film of the polymkeric substance that comprises alkylsulfonyl earlier, contact with second porous-film that comprises silicate at least subsequently.

20. the filtration unit of claim 19, wherein polymkeric substance is a polyethersulfone.

21. the filtration unit of claim 19, wherein silicate is glass fibre.

22. the filtration unit of claim 19 also comprises the 3rd porous-film that comprises capture probe.

23. the filtration unit of claim 19, wherein the demarcation aperture of first film is less than the demarcation aperture of second film.

24. the process of claim 1 wherein that nucleic acid is DNA.

25. the process of claim 1 wherein that nucleic acid is RNA.

Images