CN101113169A - Use of sorting protein SNX10 for suppressing growth of tumour cell - Google Patents
Use of sorting protein SNX10 for suppressing growth of tumour cell Download PDFInfo
- Publication number
- CN101113169A CN101113169A CNA2006100366920A CN200610036692A CN101113169A CN 101113169 A CN101113169 A CN 101113169A CN A2006100366920 A CNA2006100366920 A CN A2006100366920A CN 200610036692 A CN200610036692 A CN 200610036692A CN 101113169 A CN101113169 A CN 101113169A
- Authority
- CN
- China
- Prior art keywords
- snx10
- cell
- gene
- growth
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of gene engineering, in particular to sorted human protein gene, recombinant carrier with the gene, hosts transferred from the carrier, and the expression products of the gene generated from transferring bodies, and the applications thereof. The theory of inhibiting the growth of tumor cell is searched through the direct observation on the impact of SNX10 to the growth of tumor cell and combined with the regulation mechanism of the SNX10 to the endosomes, and SNX10 is finally used as a target to establish a basis for the design and development of anti-tumor drug. The invention proves the inhibition function to the growth of tumor cell as well as the statement in theory of the regulation mechanism to the endosomes of the sorted protein SNX10, and supplies a new means or a new drug application manner of tumor therapy for the sorted protein SNX10 gene.
Description
[technical field]
The present invention relates to gene engineering technology field, relate in particular to people's sorting protein gene, contain the recombinant vectors of this gene, with this carrier host transformed, and this expression of gene product and application thereof of utilizing transformant to produce.
[background technology]
Sorting protein (SNX) is a class and membrane receptor transhipment and the relevant albumen of intracellular protein sorting, mainly is responsible for the transhipment and the sorting of intracellular protein, participates in significant process such as epicyte protein endocytosis and albumen transportation.Studies show that, SNXs can and multiple important cell-membrane receptor and enzyme interacting, thereby influence the normal function of cell.The SNXs family protein structurally all contains a conservative PX structural domain, comprises 100-130 amino acid, can combine with phosphatidylinositol phosphate, phosphatidylinositols-3-phosphoric acid, makes SNX albumen be positioned on the film of cell endocytic approach.The gene of SNX family is present in yeast and the multiple mammalian cell, has wherein found out to have more than 30 different SNXs in people and mouse.There are some researches show, the SNXs family protein can participate in EGF-R ELISA (EGFR), platelet derived growth factor, Regular Insulin and leptin receptor proteic endocytosis, transport processes such as (Leptin Receptor), therefore estimates to influence generation, development and the treatment of cancer, disease in the blood system, obesity (iatrogenic or heredity).At present, most of SNXs protein function is not clear, and major part is the gene of unknown function, and the research of these proteic structures and physiological function awaits further to carry out.The applicant is to SNX10 systematic research (sequential structure is seen sequence table) having carried out aspect the 26S Proteasome Structure and Function comprehensively.Find: the expression of SNX10 mainly concentrates on expression amount higher (Fig. 1) in blood system (whole blood), neural system (comprising: brain, spinal cord, neurone etc.), immunocyte (B cell, lymphocyte, mononuclear macrophage, medullary cell etc.), pancreas islet and the rectal adenocarcinoma; Simultaneously, SNX10 is playing an important role aspect the running balance of adjusting cellular inclusion.By to the end of the year 2005, the bibliographical information relevant with the SNXs family protein has only 23 pieces, do not see SNXs correlative study report and patent application in China, and the SNXs family protein also is blank suppressing being reported in aspect the tumor growth in the world.Therefore the research to the SNXs family protein is a brand-new research field, has the novelty of science.
[summary of the invention]
The present invention passes through the influence of direct viewing SNX10 to growth of tumour cell, and in conjunction with the regulation mechanism of SNX10 to endosome, explores the mechanism that it suppresses growth of tumour cell, and finally is for target spot designs, developing anti-tumor medicaments lays the foundation with SNX10.
Technical scheme of the present invention comprises: people SNX10 gene clone, vector construction; The preparation of slow virus; Slow virus infection tumour cell and evaluation thereof; Set up the tumor cell line of stably express SNX10; The cell growth experiment; Experimentation on animals; Cell is engulfed experiment etc. to neutral red.
1, study the regulation mechanism of SNX10 to endosome:
Utilize multiple protein repercussion study means, seek and SNX10 interaction or closely-related key protein, study the adjusting how they participate in regulating endosome, thereby illustrate the mechanism that SNX10 regulates endosome.
2, research SNX10 suppresses the mechanism of growth of tumour cell:
Utilize existing SNX10 stably transfected cell line, further investigate its cell cycle, cell fission, cell migration, the cell attachment characteristic, and the above each side The Characteristic Study of tissue culture cells of utilizing the tumour of taking out from nude mice to carry out soon on one's body, try hard to illustrate SNX10 has suppressed tumour cell in those processes growth.
3, with SNX10 be target spot, the gene therapy and the drug development of exploitation oncotherapy:
The greatest problem that exists in the oncotherapy is a resistance.Studies show that SNX10 albumen has the function that suppresses growth of tumour cell and increase the tumour cell phagocytic activity.SNX10 can be as suppressing growth of tumour cell gene and tumour cell medicine enhanced sensitivity gene.Therefore, will develop gene therapy methods, be used for the treatment of multiple noumenal tumour with SNX10.Employing is gene constructed in adenovirus (Adenovirus) carrier system (comprising AV, AVV etc.) with SNX10.By this carrier system SNX10 is imported in the drug-fast tumor tissues, can improve the chemotherapy effect of this tumor locus.The preparation method of SNX10 gene therapy can be prepared according to the method in genomic medicine field.SNX10 will be by the method administration of direct injection.SNX10 imports target cancer cell by adenovirus carrier and lowers growth of tumor, improves the susceptibility to compound, reaches result of treatment.
The present invention has confirmed that SNX10 suppresses the effect of growth of tumour cell, provides the application mode of this sorting protein SNX 10 gene as oncotherapy new tool or novel drugs illustrating the regulation mechanism of sorting protein SNX 10 to endosome from mechanism when.
[description of drawings]
The express spectra of Fig. 1: SNX10 in human organ.
Fig. 2: the clone that the SNX10 transfection is different, discovery can cause big cavity in tenuigenin.
The bulliform cell device that Fig. 3: SNX10 becomes belongs to endosome class organoid.
Fig. 4:
Fig. 4 A: utilize Western Blot to identify the protein expression of the monoclonal cell of picking.
Fig. 4 B: cell has big balloon-shaped structure.
Fig. 4 C:SNX10 can significantly reduce the growth of MCF7.
Fig. 4 D: tumor growth curve.
Fig. 4 E, Fig. 4 F: to the tumor mass statistics of weighing.
Fig. 5:
Fig. 5 A: the MCF7 cell of stably express SNX10 increases the phagolysis of neutral red.
Fig. 5 B:OD550 experiment detects the toluylene red concentration in the cell pyrolysis liquid.
[embodiment]
One, people SNX10 gene clone, vector construction:
(1) gene clone: according to people SNX10 encoding sequence (NM_013322.2), design primer (upstream primer: ACCatgtttccggaacaacagaaagaggaatttgt, downstream primer: ggattcctgcggagctgtatttactttacat), with human peripheral blood cell cDNA is the PyrobestDAN synthetic enzyme amplification gene of template with TaKaRa, PCR product behind the purifying is connected among the carrier for expression of eukaryon pCR3.1-uni, cut by enzyme, the sequence into people SNX10 is identified in order-checking.
(2) transfection and phenotype: the clone that this gene transfection is different, discovery can cause big cavity structure (Fig. 2) in tenuigenin, further utilize cotransfection, can find that the bulliform cell device that SNX10 becomes belongs to endosome class organoid (Fig. 3), thereby find a gene SNX10 that can cause endosome to increase.
(3) structure of recombined lentivirus vector and virus preparation:
In order to study the influence of high expression level SNX10 for cell, can make up recombined lentivirus vector: the lentiviral vectors pLentiLox3.7 that at first will be used for siRNA is transformed into high-expression vector, and (remodeling method is as follows: cut (buying from NEB company) with Not1 and Apa1 enzyme, remove the U6 promotor in the pLentiLox3.7 carrier, and with T4DNA polysaccharase (buying) sticky end is mended from NEB company flat, and with T4DNA ligase enzyme (buying) connection from NEB company.Simultaneously, the DNA small pieces NotI-XhoI of 4 bases of Synthetic 2 (synthetic by Takara company) cuts the back with the EcoR1 enzyme and adds, with this carrier called after pLXN.Simultaneously, the BfrB1 site is singly cut, connect the reading frame of cell screening microbiotic Blasticidin, this reading frame is from one section of the EM-7-Blasticidin-SV40Pa of the pCDNA6T/R of Invitrogen, with this carrier called after pLXNB).Use experience attitude bacterial strain HB101 (buying from Takara) screens the successful clone of reorganization respectively, enlarged culturing, utilize the package carrier pLP1 of alkaline lysis method of extracting virus, pLP2, the plasmid of pLP/VSVG and the lentiviral vectors pLXNB-SNX10 that transforms again, quantitatively.
Two, use the coprecipitation of calcium phosphate method in the 293T cell, to prepare slow virus:
The present invention utilizes the 293T cell as the slow virus packing cell, the 293T cell grows in two anti-(penicillin+Streptomycin sulphates) that contain 10% foetal calf serum (Hyclone), 100mg/L, in high sugared DMEM (Hyclone company) substratum, in every 6cm cell cultures dish, add the substratum of 3.5ml.Inoculate about 1.5 * 10
6Individual cell, 37 ℃, contain 5%CO
2Humidified incubator in cultivate.Second largest, can adopt the coprecipitation of calcium phosphate method transfection of standard to prepare slow virus.In the every 6cm dish, need altogether to add the slow virus packaging plasmid (pLP1, pLP2, pLP/VSVG) and virus particle (pLXNB) be total to 12ug, ratio is 3: 1.5: 1.8: 6.Transfection can be seen the proteic green fluorescence of GFP after 24 hours, can collect slow virus after 36 hours after the transfection.Collect 293T cell conditioned medium liquid, with 2000 rev/mins centrifugal 10 minutes, receive supernatant, discard precipitation.The enrichment of virus and purifying use ultracentrifuge (Beckman Coulter) 130,000G, and centrifugal 1.5 hours, supernatant discarded will precipitate resuspended spending the night with PBS solution.Virus titer uses flow cytometer after detecting and adopting slow virus infection 293T cell or 3T3 cell, detects by the proteic expression of GFP in the cell.The slow virus titre that obtains by this method is about 10
8About.Adopt present method preparation to pack the slow virus that slow virus empty carrier (pLXNB) is arranged and comprise goal gene SNX10.
Three, tumor cell culture, slow virus infection tumour cell and evaluation thereof:
The MCF-7 cell is a breast cancer cell line, and the medium component of employing is: RPMI 1640 substratum (Hyclone) nutrient solution, add 10% foetal calf serum (Hyclone), two anti-(penicillin/streptomycin) of 100ug/ml simultaneously; At 37 ℃, contain 5%CO
2Humidified incubator in cultivate, stand-by.With the slow virus infection MCF7 cell of enrichment and purifying, wherein the density of cell is 20-30%, and using the amount of virus is 10
6/ 24 holes.
Four, set up the tumor cell line of stably express SNX10:
In infection back 36 hours, above cell is inoculated in the 10cm culture plate with 1/100 density, after treating cell attachment, Blasticidin with 10ug/ml dosage screened 10 days, in the cell cultures dish, can find the visible mono-clonal of naked eyes, choose mono-clonal, the branch dish is cultivated, and continues to keep with the Blasticidin of 2ug/ml.Utilize Western Blot to identify the protein expression (Fig. 4 A) of the monoclonal cell of picking; Cell has big balloon-shaped structure (Fig. 4 B), and the clone that expression is positive continues to go down to posterity, and is frozen standby.
Five, cell growth experiment:
In order to study the influence of SNX10 cell growth, in 2 24 orifice plates, inoculate 2 * 10 respectively
4 Individual cell cultures 7 days, count the cell in 3 holes every day, draws cell growth curve, can find that MCF7-pLXNB compares with the empty carrier cell, and SNX10 can significantly reduce the growth (Fig. 4 C) of MCF7.
Six, experimentation on animals:
Nude mice becomes the knurl experiment: the vegetative period cell preparation of taking the logarithm becomes the female nude mice of cell suspension inoculation, inoculum size 2 * 10
6Individual cell/injection point is observed tumor formation rate, tumour latent period and tumor growth curve (Fig. 4 D).When knurl body diameter reaches 1cm when above, put to death the back of taking a picture, and to the tumor mass statistics (Fig. 4 E, Fig. 4 F) of weighing, takes out tumor mass simultaneously and do the pathology histological examination, the part nude mice carries out pathological examination to the whole body important organ, notes having or not regional nodes and whole body to shift.Found that SNX10 can significantly suppress growth of tumor.
Seven, cell is to the experiment of engulfing of neutral red:
In the proteic MCF7 breast cancer cell of stably express SNX10 culture dish, add the toluylene red dyestuff, find after the co-cultivation that the MCF7-SNX10 cell increases (Fig. 5 A, Fig. 5 B) greatly to the phagolysis of neutral red.This prompting SNX10 albumen can improve the phagocytic activity of tumour cell to antitumor drug, and then can influence the susceptibility of tumour cell for antitumor drug.
The purposes of sorting protein SNX 10 for suppressing growth of tumour cell
＜110〉Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health
＜120〉purposes of sorting protein SNX 10 for suppressing growth of tumour cell
<160>2
<170>PatentIn?Version?2.1
<210>1
<211>609
<212>DNA
＜213〉people (Homo sapiens)
<220>
<221>CDS
<222>(4)…(609)
＜223〉n=a or g or c or t
<220>
<221>prim_bind
<222>(1)…(35)
＜223〉n=a or g or c or t
<220>
<221>prim_bind
<222>(576)…(606)
＜223〉n=a or g or c or t
<400>1
accatgtttc?cggaacaaca?gaaagaggaa?tttgtaagtg?tctgggttcg?agatcctagg?60
attcagaagg?aggacttctg?gcattcttac?attgactatg?agatatgtat?tcatactaat?120
agcatgtgtt?ttacaatgaa?aacatcctgt?gtacgaagaa?gatatagaga?attcgtgtgg?180
ctgaggcaga?gactccaaag?taatgcgttg?ctggtacaac?tgccagaact?tccatctaaa?240
aacctgtttt?tcaacatgaa?caatcgccag?cacgtggatc?agcgtcgcca?gggtctggaa?300
gatttcctca?gaaaagtcct?acagaatgca?cttttgcttt?cagatagcag?ccttcacctc?360
ttcttacaga?gccatctgaa?ttcagaagac?attgaggcgt?gtgtttctgg?gcagactaag?420
tactctgtgg?aagaagcaat?tcacaagttt?gccttaatga?atagacgttt?ccctgaagaa?480
gatgaagaag?gaaaaaaaga?aaatgatata?gattatgatt?cagaaagttc?atcctctggg?540
cttggacaca?gtagtgatga?cagcagttca?catggatgta?aagtaaatac?agctccgcag?600
gaatcctga?609
<210>2
<211>201
<212>PRT
＜213〉people (Homo sapiens)
<400>2
Met?Phe?Pro?Glu?Gln?Gln?Lys?Glu?Glu?Phe?Val?Ser?Val?Trp?Val
1 5 10 15
Arg?Asp?Pro?Arg?Ile?Gln?Lys?Glu?Asp?Phe?Trp?His?Ser?Tyr?Ile
20 25 30
Asp?Tyr?Glu?Ile?Cys?Ile?His?Thr?Asn?Ser?Met?Cys?Phe?Thr?Met
35 40 45
Lys?Thr?Ser?Cys?Val?Arg?Arg?Arg?Tyr?Arg?Glu?Phe?Val?Trp?Leu
50 55 60
Arg?Gln?Arg?Leu?Gln?Ser?Asn?Ala?Leu?Leu?Val?Gln?Leu?Pro?Glu
65 70 75
Leu?Pro?Ser?Lys?Asn?Leu?Phe?Phe?Asn?Met?Asn?Asn?Arg?Gln?His
80 85 90
Val?Asp?Gln?Arg?Arg?Gln?Gly?Leu?Glu?Asp?Phe?Leu?Arg?Lys?Val
95 100 105
Leu?Gln?Asn?Ala?Leu?Leu?Leu?Ser?Asp?Ser?Ser?Leu?His?Leu?Phe
110 115 120
Leu?Gln?Ser?His?Leu?Asn?Ser?Glu?Asp?Ile?Glu?Ala?Cys?Val?Ser
125 130 135
Gly?Gln?Thr?Lys?Tyr?Ser?Val?Glu?Glu?Ala?Ile?His?Lys?Phe?Ala
140 145 150
Leu?Met?Asn?Arg?Arg?Phe?Pro?Glu?Glu?Asp?Glu?Glu?Gly?Lys?Lys
155 160 165
Glu?Asn?Asp?Ile?Asp?Tyr?Asp?Ser?Glu?Ser?Ser?Ser?Ser?Gly?Leu
170 175 180
Gly?His?Ser?Ser?Asp?Asp?Ser?Ser?Ser?His?Gly?Cys?Lys?Val?Asn
185 190 195
Thr?Ala?Pro?Gln?Glu?Ser
200
Claims (7)
1. sorting protein SNX 10, it has following nucleotide sequence:
accatgtttc?cggaacaaca?gaaagaggaa?tttgtaagtg?tctgggttcg?agatcctagg?60
attcagaagg?aggacttctg?gcattcttac?attgactatg?agatatgtat?tcatactaat?120
agcatgtgtt?ttacaatgaa?aacatcctgt?gtacgaagaa?gatatagaga?attcgtgtgg?180
ctgaggcaga?gactccaaag?taatgcgttg?ctggtacaac?tgccagaact?tccatctaaa?240
aacctgtttt?tcaacatgaa?caatcgccag?cacgtggatc?agcgtcgcca?gggtctggaa?300
gatttcctca?gaaaagtcct?acagaatgca?cttttgcttt?cagatagcag?ccttcacctc?360
ttcttacaga?gccatctgaa?ttcagaagac?attgaggcgt?gtgtttctgg?gcagactaag?420
tactctgtgg?aagaagcaat?tcacaagttt?gccttaatga?atagacgttt?ccctgaagaa?480
gatgaagaag?gaaaaaaaga?aaatgatata?gattatgatt?cagaaagttc?atcctctggg?540
cttggacaca?gtagtgatga?cagcagttca?catggatgta?aagtaaatac?agctccgcag?600
gaatcctga?609。
2. the expression vector that contains the open reading frame of nucleotide sequence in the claim 1.
3. the expression vector that contains the open reading frame of nucleotide sequence in the claim 1 is lentiviral vectors pLXNB-SNX10.
4. host cell with the vector gene through engineering approaches of claim 2.
5. host cell with the vector gene through engineering approaches of claim 3.
6. the application of sorting protein SNX 10 in the medicine of preparation inhibition growth of tumour cell.
7. the application of sorting protein SNX 10 in the medicine of preparation inhibition breast cancer cell growth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100366920A CN101113169B (en) | 2006-07-28 | 2006-07-28 | Use of sorting protein SNX10 for suppressing growth of tumour cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100366920A CN101113169B (en) | 2006-07-28 | 2006-07-28 | Use of sorting protein SNX10 for suppressing growth of tumour cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101113169A true CN101113169A (en) | 2008-01-30 |
| CN101113169B CN101113169B (en) | 2011-07-13 |
Family
ID=39021718
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100366920A Expired - Fee Related CN101113169B (en) | 2006-07-28 | 2006-07-28 | Use of sorting protein SNX10 for suppressing growth of tumour cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101113169B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684478B (en) * | 2009-06-26 | 2012-02-29 | 武汉大学 | Method for constructing tandem expression small interfering RNA recombinant lentiviral vector |
| CN110604818A (en) * | 2018-06-14 | 2019-12-24 | 复旦大学 | Application of SNX10 in preparation of drug targets for preventing and/or treating cardiovascular diseases |
| CN114752596A (en) * | 2022-04-02 | 2022-07-15 | 南华大学附属第一医院 | shRNA for knocking down SNX10 gene, lentiviral vector, breast cancer cell and application |
-
2006
- 2006-07-28 CN CN2006100366920A patent/CN101113169B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684478B (en) * | 2009-06-26 | 2012-02-29 | 武汉大学 | Method for constructing tandem expression small interfering RNA recombinant lentiviral vector |
| CN110604818A (en) * | 2018-06-14 | 2019-12-24 | 复旦大学 | Application of SNX10 in preparation of drug targets for preventing and/or treating cardiovascular diseases |
| CN114752596A (en) * | 2022-04-02 | 2022-07-15 | 南华大学附属第一医院 | shRNA for knocking down SNX10 gene, lentiviral vector, breast cancer cell and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101113169B (en) | 2011-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7479082B2 (en) | Method for producing immunocompetent cells expressing nucleic acid encoding immune function regulator, cell surface molecule specifically recognizing cancer antigen, IL-7 and CCL19 | |
| CN101400785B (en) | Method for production of t cell population | |
| US11331345B2 (en) | PD-1 CAR NK-92 cell and preparation method and use thereof | |
| CN108778314A (en) | To the inhibition of the SH2 albumen of cytokine induction in NK cells | |
| CN107188969A (en) | Anti-epidermal growth factor receptor variant III Chimeric antigen receptors and its purposes for treating cancer | |
| CN107709359A (en) | The conditioning agent that ROR1 ROR2 are combined | |
| CN110536693A (en) | PD1-41BBL fusion protein and the method for using it | |
| CN103570818B (en) | Tumor antigenic polypeptide and the purposes as tumor vaccine thereof | |
| US20230287116A1 (en) | Chimeric antigen receptor cells targeting robo1, preparation method and use thereof | |
| US20150337310A1 (en) | Splice modulating oligonucleotides that inhibit cancer | |
| Pastan et al. | Molecular manipulations of the multidrug transporter: a new role for transgenic mice 1 | |
| CN108884440A (en) | For enhancing the mescenchymal stem cell of the anti-tumor activity of immunotherapy | |
| CN110520156A (en) | For the immunoregulation method of exogenous antigen and/or autoantigen | |
| KR20220100912A (en) | Treatment for hematopoietic cell malignancies using genetically engineered T cells targeting CD70 | |
| CN110305906A (en) | A kind of slow virus carrier and PDL1-CAR-T cell of the CAR Chimerical receptor targeting PDL1 | |
| CN106102753A (en) | The method that treatment vegetation is formed | |
| CN101113169B (en) | Use of sorting protein SNX10 for suppressing growth of tumour cell | |
| Gao et al. | Surface-engineered chlorella alleviated hypoxic tumor microenvironment for enhanced chemotherapy and immunotherapy of first-line drugs | |
| CN108129560B (en) | Mutant melittin MEL-pep and application thereof | |
| CN109715191A (en) | Pharmaceutical associations for the conversion of neoplastic cells into non-neoplastic cells and uses thereof | |
| CN111205361B (en) | Interleukin 21 protein (IL21) mutant and application thereof | |
| CN102899325B (en) | Small interfering RNA for TRAPPC4 gene target point, and uses thereof | |
| CN107438605A (en) | Growth hormone receptor blocking agent in prevention from suffering from the diseases and treatment | |
| CN101712960A (en) | Mac-2BP tumor antigen gene, protein, antibody and application thereof | |
| US20230248824A1 (en) | Immune cells with increased glycolytic flux |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20080606 Address after: A District of Guangzhou Science City International Business Incubator, Guangzhou, Guangdong Applicant after: Guangzhou Biomedicine and Health Inst., Chinese Academy of Sciences Address before: No. 100 martyrs Middle Road, Guangdong, Guangzhou Applicant before: Guangzhou Branch, Chinese Academy of Sciences |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110713 Termination date: 20150728 |
|
| EXPY | Termination of patent right or utility model |