CN101100666A - Human TCRVbeta7.1_H3F7 gene and its screening method and application - Google Patents
Human TCRVbeta7.1_H3F7 gene and its screening method and application Download PDFInfo
- Publication number
- CN101100666A CN101100666A CNA2007100287425A CN200710028742A CN101100666A CN 101100666 A CN101100666 A CN 101100666A CN A2007100287425 A CNA2007100287425 A CN A2007100287425A CN 200710028742 A CN200710028742 A CN 200710028742A CN 101100666 A CN101100666 A CN 101100666A
- Authority
- CN
- China
- Prior art keywords
- gene
- tcr
- cell
- primer
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A human TCRV beta 7.1-H3F7 gene, its gene sequence table, gene screening cloning method and use are disclosed. It can be used to prepare anti-cancer and anti-tumor vaccine and make research of other medicines.
Description
Technical field
The present invention relates to gene order, be specifically related to sequence and the screening method and the application of human T lymphocyte antigen's acceptor TCRV β 7.1_H3F7 gene.
Background technology
Since the seriousness that radiation and chemotherapy causes body injury and effect not as people's will, biotherapy more and more becomes the major objective of oncotherapy research, wherein immunotherapy is a chief component of tumor biotherapy.The anti-tumor immune response that body immune system produces mainly comprises cellular immunization and humoral immunization two big classes, and wherein the cell-mediated cellullar immunologic response of T is the important component part of antitumor cell immunity.The T lymphocyte is the main cell colony that antigen recognition is carried out in the cells in vivo immunity, specific antigen can only be discerned by the T cell antigen receptor TCR that the specific amino acids sequence is formed, and body is discerned and killing tumor cell tumor cell specific by specific TCR.
TCR is the characteristic marker molecule of T cell surface, is that the T cell carries out antigen recognition, the basis of performance cellular immunization critical function.TCR combines with the peculiar CD3 molecule of T cell with the non covalent bond form, forms the TCR-CD3 complex body with the membrane structure of striding.The TCR identification activation signals that antigen produced is transduceed to the T cell by the CD3 molecule.Generally the TCR molecule can not Direct Recognition proteantigen epi-position, antigen peptide-MHC molecular complex that can only identification specificity, so its recognition process has the dual specific at antigen peptide epi-position and self MHC molecule polymorphism position.The MHC molecule is considered to TCR and carries out indispensable accessory molecule in the epitope recognition process, its major function has provides TCR the essential site of identification, increase T cell and associated molecule bonded susceptibility and stability in the recognition process, subsidiary signal of T cell activation or the like is provided.The restrictive TCR of MHC to the identification classical mode of antigen peptide is, CD8+TCR α β+T cell recognition MHC I quasi-molecule bonded antigen peptide, and this type of antigen peptide length is generally 8～10 amino acid.Another kind of recognition mode is CD4+TCR α β+T cell recognition MHC II quasi-molecule bonded antigen peptide, different with the groove closed at both ends of MHCI quasi-molecule, because the groove both ends open of II quasi-molecule, the antigen peptide length variations that can hold is bigger, be 13-17 amino-acid residue even more, because structural difference, the structure of common motif that makes the antigen peptide that the II quasi-molecule held is more than I quasi-molecule complexity.
The TCR molecule is made of two different peptide chains, and the two all is transmembrane proteins, and is connected to form the heterodimer structure by a disulfide linkage, the peptide chain of TCR has four types of α, β, γ, δ, according to the combination of TCR peptide chain, the T cell in the human peripheral can be divided into two classes, i.e. TCR α β
+T cell and TCR γ δ
+T cell, wherein TCR α β
+The quantity of T cell accounts for the overwhelming majority, is bringing into play important effect in antigen peptide identification performance specific cellular immunity process.TCR α gene TCRA is positioned at chromosomal 14q11-12 position, TCR β gene TCRB is positioned chromosomal 7q32-35 position, TCRA comprises V, J and three gene fragments of C, and TCRB is made up of V, D, four gene fragments of J, C, the connect together V district, variable region of coding TCR molecule peptide chain of V, D, J gene fragment, the encode constant region C district of TCR molecule peptide chain of C gene fragment.
Tcr gene and general gene have very big different, and promptly its mutability that need have height is used to discern the antigen that varies, and this just needs tcr gene to experience this significant process of gene rearrangement in the growth course of germline gene.Germline gene fragment, particularly V and the J of TCR, number has a variety of, and in the sophisticated process of T cell development, different rearrangement and combination take place in these gene fragments, produce enormous amount, the antigenic TCR of identification specificity.TCRA comprises 70-80 V gene fragment, is divided into 41 families, and TCRA comprises 61 J gene fragments, wherein has 50 for the gene of function is arranged, and TCRA also comprises the C gene fragment of a coding TCR α chain constant region.For TCRB, relatively authority's saying is that the TCRV beta gene fragment has 65, wherein 19 is pseudogene pseudogene, the gene fragment that function is arranged is 46, these 46 TCRV beta gene fragments are according to its sequence similarity degree height, sequence identity is lower than 75% gene and is divided into different families, 23 TCRV β gene families have been obtained altogether, and sequence identity is higher than 75% fragment is the subfamily of same family, relevant knowledge is found in Rowen L, Koop BF, Hood L.The complete 685-kilobaseDNA sequence of the human beta T cell receptor locus.Science1996; 272:1755-1762.TCRB also comprises the C gene fragment of 2 D gene fragments, 13 J gene fragments and two coding TCR β chain constant regions.
The rearrangement universal law of tcr gene is that (D) J gene rearrangement at first takes place in immature T cell, V (D) J gene rearrangement then, on gene level, carry out, after TCRV gene rearrangement is finished, on transcriptional level, realize the rearrangement of V (D) J gene and C gene, by the montage mechanism of eukaryotic mrna, obtain the mRNA of the sophisticated V of comprising (D) JC gene fragment at last, become a complete TCR peptide chain through the translation assembling.Because numerous V, (D), J gene fragment only select one to participate in resetting, can produce numerous V district gene fragment combinations, simultaneously the junction after V, (D), J gene fragment are reset can be lost or N-nucleotide inserts and promptly adds several Nucleotide, more than mechanism significantly increased the diversity of TCR.TCR α chain and β chain all need through after the gene rearrangement process, and the two makes up assembling again, can produce more diversity like this.To carry out in the process be to grow with preceding TCR α combination in the rearrangement of general TCR β chain in T cells whose development process, after treating that the rearrangement of TCR β chain gene is finished, just can carry out the gene rearrangement of ripe TCR α chain, the same TCR β chain of so final fully-developed T cell expressing may make up with a plurality of different TCR α chains, and for each TCR α chain, it can only make up with a kind of TCR β chain.Possibility to the multiple connection of different genes fragment is connected the diversity that diversified mechanism has caused identification antigen TCR with several generations.
TCR α chain and β chain all are made up of variable region V district and constant region C district two portions, the V district is the key position of identification antigen peptide/MHC mixture pMHC, three similar hypervariable regions of V plot structure with immunoglobulin (Ig) are respectively contained in the V district of TCR α chain and β chain, also claim complementary determining region CDR, generally represent with CDR1, CDR2 and CDR3, in addition, the TCRV chain also contains the 4th hypervariable region HV4 or CDR4; TCRV α chain is reset the back transcription and translation by TCRA gene V, J fragment and is obtained, TCRV β chain is obtained by V, D, the J fragment coding of TCRB gene, wherein this three part of CDR1, CDR2 and HV4 is obtained by V gene fragment coding, and there be the intensity of variation higher than other three districts in the CDR3 district, it is to be formed by the gene fragment coding after V, (D), the segmental rearrangement connection of J, because several Nucleotide can be inserted or lose in the junction at random, the CDR3 district height change that final translation is obtained, it is almost unlikely therefore will to obtain two the identical CDR3 of aminoacid sequence districts.Existing numerous discovering, CDR1 in the V district of TCR molecule and CDR2 district are closely related with the identification of MHC molecule in the antigen recognition process, and the HV4 district plays a significant role when the combining of superantigen and TCRV β chain, but really play main still CDR3 district to antigen peptide specific recognition reaction, relevant knowledge is found in Garcia K C, Teyton L, Wilson I A.Structural basis of T cellrecognition.Annu Rev Immunol, 1999,17:369～397.
Because the V of TCR α chain and β chain, (D), the insertion at random or the deletion of n-Nucleotide can take place in the J gene fragment when resetting, the possibility that same sequence appears in the CDR3 in the TCRV district of so last generation is extremely low, and each sequence is formed also irregularities and can be sayed, so just can't advise class to the TCR molecule of final generation, so just according to coding CDR1, the TCRV gene fragment in CDR2 and HV4 district is advised class to the TCR molecule, consistence difference according to the V gene fragment order is classified as different families and subfamily, mostly the family rule class of carrying out the V gene of TCR molecule is to be used for to analyze the T cell and the clonal expansion phenomenon that occurs at a certain or a certain class antigen occurred, wherein with to the analysis of V β gene with research more sees.
Sophisticated T cell is exported to peripheral blood by thymic tissue, the family of TCRV α beta molecule presents certain rule step by step on these naive T cells, mainly show as V α and each family of V β gene is evenly distributed phenomenon more uniformly, part family is arranged slightly than other family's height, this characteristic reaction the T cell colony characteristic distributions of body immune system when not running into specific antigen.After body runs into the exotic antigen stimulation, the population distribution that same or analogous antigenic determinant can be ordered about the T cell changes, generation is at clone's property amplification phenomenon of the T cell subsets of specific antigen determinant, if be mono-clonal T cell mass at the clonal expansion of same antigenic determinant, these T cells have the identical TCRV α of sequence beta molecule, if not only one of the determinant of specific antigen, then the T cell amplification of Chu Xianing is few clone or polyclone, and the TCRV α beta molecule aminoacid sequence of these T cell expressings is incomplete same.If having known the effect that these abnormal T CRV α beta molecule is brought into play in body's immunity just can be used, if useful function, just can utilize these specific T CRV α β genetic modification to transform the T cell, the effector cell who prepares this TCRV α of great expression beta molecule is used for the treatment of; If this TCRV α beta molecule is deleterious to body, can design gene vaccine at this clone's property T cell, be used to remove these deleterious T cell clones.
The general method of screening tumour-specific TCR is to utilize the monoclonal T lymphocyte of clearer and more definite tumour specific antigen peptide screening, carry out the analysis of tcr gene again, but because the screening of tumour specific antigen is difficult unusually, some tumour specific antigens of finding all separate acquisition mostly from people's malignant melanoma cell at present, the screening of corresponding tcr gene is also all at melanoma cell, people such as MARYBETH S utilize the T cell clone of the melanoma MART-1 antigen peptide screening of the synthetic HLA-A2 molecule tetramer under presenting at MART-1, obtain strain MART-1 reaction-ive T cell clone M1F12, analyzing its tcr gene is TCRV α 35 V β 10.3, utilize people such as similar method Richard A.Morgan to filter out tcr gene TCRV α 19V β 12.3 at melanoma gp100 antigen peptide, further experiment confirms, these tcr genes really can be transformed mature T cells, and the T cell of expressing tumor antigen specific T CR gene all shows stronger anti-tumor activity in cell in vitro and tumor-bearing mice experiment.Tcr gene screening at the liver cancer particular tumor antigens at present yet there are no report.And liver cancer is the disease of serious threat human health, and searching out the tcr gene of suiting the medicine to the illness, to carry out the biological immune therapy be very important and extremely urgent.
Summary of the invention
An object of the present invention is to provide a kind of people TCRV β 7.1_H3F7 gene.
Another object of the present invention provides the screening amplification method of described gene.
A further object of the invention provides the application of described people TCRV β 7.1_H3F7 gene.
Technical scheme of the present invention provides a kind of people TCRV β 7.1_H3F7 gene, and its gene order is by 942 based compositions, and protein sequence is made up of 312 amino acid, and sequence table is as follows:
1 -ATGGGCTGCAGGCTGCTCTGCTGTGCGGTTCTCTGTCTCCTGGGAGCAGTTCCCATAGAC -60
1 -M G C R L L C C A V L C L L G A V P I D -20
61 -ACTGAAGTTACCCAGACACCAAAACACCTGGTCATGGGAATGACAAATAAGAAGTCTTTG -120
21 -T E V T Q T P K H L V M G M T N K K S L -40
121-AAATGTGAACAACATATGGGGCACAGGGCTATGTATTGGTACAAGCAGAAAGCTAAGAAG -180
41 -K C E Q H M G H R A M Y W Y K Q K A K K -60
181-CCACCGGAGCTCATGTTTGTCTACAGCTATGAGAAACTCTCTATAAATGAAAGTGTGCCA -240
61 -P P E L M F V Y S Y E K L S I N E S V P -80
241-AGTCGCTTCTCACCTGAATGCCCCAACAGCTCTCTCTTAAACCTTCACCTACACGCCCTG -300
81 -S R F S P E C P N S S L L N L H L H A L -100
301-CAGCCAGAAGACTCAGCCCTGTATCTCTGCGCCAGCAGCCAAGCCGGGACAGGGAACACC -360
101-Q P E D S A L Y L C A S S Q A G T G N T -120
361-GGGGAGCTGTTTTTTGGAGAAGGCTCTAGGCTGACCGTACTGGAGGACCTGAAAAACGTG -420
121-G E L F F G E G S R L T V L E D L K N V -140
421-TTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAG -480
141-F P P E V A V F E P S E A E I S H T Q K -160
481-GCCACACTGGTGTGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGG -540
161-A T L V C L A T G F Y P D H V E L S W W -180
541-GTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAG -600
181-V N G K E V H S G V S T D P Q P L K E Q -200
601-CCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTC -660
201-P A L N D S R Y C L S S R L R V S A T F -220
661-TGGCAGAAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAAT -720
221-W Q N P R N H F R C Q V Q F Y G L S E N -240
721-GACGAGTGGACCCAGGATAGGGCCAAACCTGTCACCCAGATCGTCAGCGCCGAGGCCTGG -780
241-D E W T Q D R A K P V T Q I V S A E A W -260
781-GGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACC -840
261-G R A D C G F T S E S Y Q Q G V L S A T -280
841-ATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTC -900
281-I L Y E I L L G K A T L Y A V L V S A L -300
901-GTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGCTAG -942
301-V L M A M V K R K D S R G * X -320
The present invention provides the screening amplification method of described gene simultaneously, may further comprise the steps:
(1) extracts cell total rna in the T lymphocyte, be transcribed into cDNA;
(2) the design primer is that template is carried out pcr amplification reaction with cDNA;
(3) the product gene clone of amplification acquisition is gone on the expression vector pcDNA-kan;
(4) with restriction endonuclease EcoRI and HindIII tcr gene and carrier pcDNA-kan are carried out double digestion, connect with the T4 dna ligase again, at last containing the positive colony bacterium that screening on the LB flat board of kantlex contains recombinant plasmid, the recon that screening is obtained checks order.
Wherein, the described primer of step (2) is V7CK and C2CK, and its sequence is as follows:
V7CK：ATT GAATTC+GCC+ATGGGCTGCAGGCTGCTCTGC
C2CK：GCC AAGCTT+CTAGCCTCTGGAATCCTTTCT
The primer front end all contains 3 protection base sequences, also contains sequence and the Kozark sequence of restriction enzyme EcoR I in the V7CK primer, contains the sequence of restriction enzyme HindIII in the C2CK primer.
It is that gene inserts the site that the described clone of step (3) selects EcoRI and HindIII site in the pcDNA-kan carrier multiple clone site for use.
The described order-checking of step (4) with T7 universal primer and BGH reverse sequencing primer as sequencing primer.
The invention provides the application of described gene, with described gene transfection T cell, can strengthen its tumour identification and strengthen lethal effect, based on this effect, described gene can be applicable to prepare anti-Hepatoma Vaccine and other medicines.
Utilize RT-PCR in conjunction with the Southern hybridization technique, the applicant finds in detecting T cell TCR β chain V district subfamily expression, with respect to the normal people, the TCRV beta gene expression of liver cancer patient all has weakening in various degree, be one of predominant expression or a few TCRV β subfamily, simultaneously other TCRV β subfamily significantly reduce or lack fully as, the acceptor shift phenomenon is promptly arranged.Therefore cause the T cell to weaken, thereby caused a large amount of increments of tumour cell and caused a series of serious symptoms for the identification and the responsibility of tumour antigen.Therefore with the TCRV β gene of this disappearance, adopt the in-vitro transfection peripheral blood mononuclear cell to strengthen TCR identification antigen presenting cell (antigen present cell, the ability of the tumour antigen of APC) offering, can promote cytotoxic T cell CTL activation, thereby recover identification and killing ability, the final cellular immune function of comprehensively recovering tumour patient to tumour cell.
The invention has the beneficial effects as follows:
(1) provides a kind of brand-new gene order, filled up this area blank;
(2) clone part TCRV β 7.1 genes, and carry out sequencing, help TCR β 7.1 biology of gene are studied;
(3) development for preparation anti-tumor vaccine, medicine provides necessary base and technology to realize means, and the reliable prospect of capturing liver cancer is provided.
Description of drawings
The sequencing result (part) of Fig. 1 T7 primer
Fig. 2 BGH reverse primer sequencing result (part)
Fig. 3 TCRV β 7.1_H3F7 gene order
Fig. 4 TCRV β 7.1_H3F7 gene is without the expression on the transfection T lymphocyte
The expression of Fig. 5 TCRV β 7.1_H3F7 gene on transfection group T lymphocyte
Fig. 6 Laser Scanning Confocal Microscope detects the expression of TCRV β 7.1_H3F7 gene transfection front and back at the T cell surface
The two fluorescent mark laser confocal microscopes of Fig. 7 detect the situation of tumour cell peripheral lymphoid cellular infiltration
Fig. 8 inverted phase contrast microscope is observed the kill and wound situation of TCRV β 7.1_H3F7 gene transfection T cell to tumour cell
Tumour cell DNA Ladder detects figure behind Fig. 9 TCRV β 7.1_H3F7 gene transfection T cytosis tumour cell
Neoplastic cell nuclei becomes figure after Figure 10 electron microscopic observation TCRV β 7.1_H3F7 gene transfection T cytosis
The anticancer design sketch of T cell local injection lotus knurl SCID mouse of Figure 11 TCRV β 7.1_H3F7 genetic modification
The tumor tissues medium size lymphocyte soaks into figure behind Figure 12 TCRV β 7.1_H3F7 gene transfection T lymphocyte effect tumor animal, HE dyeing, wherein the picture left above be 10 *, top right plot and lower-left figure be all 100 *
Figure 13 immunohistochemical methods detects the lymphocytic TCRV β of TCRV β 7.1_H3F7 gene transfection T 7.1_H3F7 expression of gene situation in the tumor tissues, and wherein left figure is 10 *, right figure is 40 *
No lymphocytic infiltration figure in other healthy tissues of Figure 14 tumor animal, HE dyeing wherein left side figure be cerebral tissue 40 *, right side figure be lung tissue 40 *, figure below be nephridial tissue 40 *
Embodiment
Further specify the present invention below in conjunction with the drawings and specific embodiments.
Embodiment 1: the method for utilizing the gene advantage to take filters out anti-liver cancer-specific TCR β gene
Collect liver cancer patient and healthy people's peripheral blood lymphocytes, separate the T lymphocyte respectively with after liver cancer cell is cultivated stimulation altogether, with PBS cell is washed twice then, cell total rna is provided by the method that provides according to Invitrogen company test kit carries out, and total RNA that will extract with the reverse transcription test kit synthesizes cDNA.26 family members' of TCR β gene family CDR3 primer is synthesized in design respectively, and the cDNA that becomes with extracted total RNA reverse transcription in above two kinds of cells is that template is carried out pcr amplification reaction.After the product utilization concentration 1.2% agarose gel electrophoresis separation with the amplification acquisition, choosing the probe that conserved sequence designs and synthesizes digoxigenin labeled carries out Southern hybridization and develops to picture, the T lymphocyte of finding healthy people source is after liver cancer cell stimulates, and amplification at random appears in TCR β gene; And the T lymphocyte in liver cancer patient source is after liver cancer cell stimulates, and only TCR β 7.1 subfamilies obviously amplification occurs and express.
Embodiment 2: utilize PCR method to amplify complete TCRV β 7.1 genes
According to the conserved sequence of TCRV β 7.1 subfamilies, the primer of design amplification TCRV β 7.1 gene family encoding sequences:
V7CK：ATT GAATTC+GCC+ATGGGCTGCAGGCTGCTCTGC
C2CK：GCC AAGCTT+CTAGCCTCTGGAATCCTTTCT
The primer front end all contains 3 protection base sequences, contains the sequence of restriction enzyme EcoR I in the V7CK primer, contains the sequence of restriction enzyme HindIII in the C2CK primer, also contains the Kozark sequence in the V7CK primer.
From the normal human blood sample, separate---extraction of lymphocyte RNA---through lymphocyte and extract the reverse transcription-pcr of back RNA this a series of program that increases, at last TCR β 7.1 gene clones are gone on the expression vector pcDNA-kan.
Selecting EcoRI and HindIII site in the pcDNA-kan carrier multiple clone site for use is that gene inserts the site, increase from cDNA with primer V7CK and C2CK earlier and obtain tcr gene, with restriction endonuclease EcoRI and HindIII tcr gene falls respectively and carrier pcDNA-kan carries out double digestion then, connect with the T4 dna ligase again, at last containing the positive colony bacterium that screening on the LB flat board of kantlex contains recombinant plasmid.As sequencing primer, the recon that screening is obtained checks order with T7 universal primer and BGH reverse sequencing primer.After sequence verification, we obtain 20 clones that belong to TCR β 7.1 gene families altogether, and the order-checking partial results is seen Fig. 1 and Fig. 2.We have carried out a series of anticancer experiment in vitro subsequently, the antitumous effect of finding one of them clone is obvious especially, we are TCR β 7.1_H3F7 with this unnamed gene, its complete encoding sequence and aminoacid sequence are seen accompanying drawing 3, its gene order is by 942 based compositions, protein sequence is made up of 312 amino acid, and its gene order table is seen Fig. 3.
The T cells in vitro of embodiment 3:TCRV β 7.1_H3F7 genetic modification is induced the apoptosis of liver cancer cell
Behind the specificity TCR V β 7.1_H3F7 gene transfection T cell of identification liver cancer, flow cytometer and laser co-focusing light microscopic detect, and have confirmed that the expression of TCRV β 7.1_H3F7 molecule is in the ascendance, and see Fig. 4-Fig. 8, left side figure is a control group among Fig. 6, and right figure is a TCRV β 7.1_H3F7 gene transfection group.Left side figure is a laser confocal microscope synoptic diagram after TCRV β 7.1_H3F7 transgenosis T cell and the liver cancer cell effect among Fig. 7; Right figure is the computer software analysis synoptic diagram, and stylolitic part is that the T cell combines with liver cancer cell specificity, and in conjunction with comparatively tight, other is non-special.Left side figure is a untransfected T groups of cells among Fig. 8, and right figure is TCRV β 7.1 gene transfection T groups of cells.Cultivate altogether with liver cancer cell, DNA Ladder detects, and finds the experimental group of transfection TCRV7.1_H3F7 gene, typical apoptosis DNA Ladder appears in liver cancer cell, the Electronic Speculum ultrastructure shows has only the liver cancer cell of TCRV β 7.1_H3F7 gene transfection group apoptotic body to occur, sees Fig. 9-10.Among Fig. 9,1: normal tumour cell; 2: untransfected T cytosis group, 1 * 10
73:TCRV β 7.1_H3F7 gene transfection T cytosis group 1,1 * 10
64:TCRV β 7.1_H3F7 gene transfection T cytosis group 2,1 * 10
75:TCRV β 7.1_H3F7 gene transfection T cytosis group 3,5 * 10
86:TCRV β 7.1_H3F7 gene transfection T cytosis group 4,1 * 10
87:TCRV β 7.1_H3F7 gene transfection T cytosis group 5,1 * 10
98:DNA Marker.The result shows: the T cell of TCRV β 7.1_H3F7 gene transfection can strengthen its tumour identification and strengthen lethal effect.
The T cell local injection lotus knurl SCID mouse of embodiment 4:TCRV β 7.1_H3F7 genetic modification shows tangible anticancer effect
Through long-term deep research, the applicant has finished the foundation of 150 SCID mouse lotus knurl models, preliminary observation the anti-liver cancer efficacy behind the specificity TCR gene transfection T cell.Experimental group is compared with control group, the knurl piece of control group mice continues to increase, and experimental group knurl piece reduces gradually, and liver cancer cell growth obviously suppresses or disappears, a large amount of lymphocytic infiltrations are arranged and surround cancer nests with around the tumour and liver portal area in the cancer nests, and its hetero-organization does not have lymphocytic infiltration.See Figure 11-14.Among Figure 11, A control group, the simple PBMC group of B, C TCR7.1 gene transgenic group.Simultaneously, survival time and administration maximum tolerated dose of each group lotus knurl SCID mouse are studied, found out experiment condition preferably, see Table 1, table 2.
Animals survived is counted cell concn 10 after table 1. liposome/TCRV β 7.1_H3F7 recombinant plasmid transfection PBMC mouse iv administration
8/ ml
| Dosage (ul/ only) | Beginning number of animals (only) | Death toll (only) |
| 400 200 100 50 25 | 2 2 2 2 2 | 2 0 0 0 0 |
The death time distributes after table 2. liposome/TCRV β 7.1_H3F7 recombinant plasmid transfection PBMC mouse iv administration
| Dosage (ul/ only) | 30 min | 1 h | 2 h | 3 h | 4 h | 1 d | 2 d | 3 d | 4 d | 5 d | 6 d | 7 d | 8 d | 9 |
1 0 |
1 1 |
1 2 |
1 3 |
1 4 d |
| 400 200 100 50 25 | 2 0 0 0 0 |
Untitled.ST25.txt
SEQUENCE LISTING
＜110〉Guangdong Pharmaceutical University
＜120〉people TCRV β 7.1_H3F7 gene and screening method and application
<130>
<160>2
<170>PatentIn version 3.2
<210>1
<211>942
<212>DNA
＜213〉artificial sequence
<220>
<221> CDS
<222>(1)..(942)
<400> 1
atg ggc tgc agg ctg ctc tgc tgt gcg gtt ctc tgt ctc ctg gga gca 48
Met Gly Cys Arg Leu Leu Cys Cys Ala Val Leu Cys Leu Leu Gly Ala
1 5 10 15
gtt ccc ata gac act gaa gtt acc cag aca cca aaa cac ctg gtc atg 96
Val Pro Ile Asp Thr Glu Val Thr Gln Thr Pro Lys His Leu Val Met
20 25 30
gga atg aca aat aag aag tct ttg aaa tgt gaa caa cat atg ggg cac 144
Gly Met Thr Asn Lys Lys Ser Leu Lys Cys Glu Gln His Met Gly His
35 40 45
agg gct atg tat tgg tac aag cag aaa gct aag aag cca ccg gag ctc 192
Arg Ala Met Tyr Trp Tyr Lys Gln Lys Ala Lys Lys Pro Pro Glu Leu
50 55 60
atg ttt gtc tac agc tat gag aaa ctc tct ata aat gaa agt gtg cca 240
Met Phe Val Tyr Ser Tyr Glu Lys Leu Ser Ile Asn Glu Ser Val Pro
65 70 75 80
agt cgc ttc tca cct gaa tgc ccc aac agc tct ctc tta aac ctt cac 288
Ser Arg Phe Ser Pro Glu Cys Pro Asn Ser Ser Leu Leu Asn Leu His
85 90 95
cta cac gcc ctg cag cca gaa gac tca gcc ctg tat ctc tgc gcc agc 336
Leu His Ala Leu Gln Pro Glu Asp Ser Ala Leu Tyr Leu Cys Ala Ser
100 105 110
agc caa gcc ggg aca ggg aac acc ggg gag ctg ttt ttt gga gaa ggc 384
Ser Gln Ala Gly Thr Gly Asn Thr Gly Glu Leu Phe Phe Gly Glu Gly
115 120 125
tct agg ctg acc gta ctg gag gac ctg aaa aac gtg ttc cca ccc gag 432
Ser Arg Leu Thr Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu
130 135 140
gtc gct gtg ttt gag cca tca gaa gca gag atc tcc cac acc caa aag 480
Val Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys
145 150 155 160
gcc aca ctg gtg tgc ctg gcc aca ggc ttc tac ccc gac cac gtg gag 528
Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu
165 170 175
ctg agc tgg tgg gtg aat ggg aag gag gtg cac agt ggg gtc agc aca 576
Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr
180 185 190
gac ccg cag ccc ctc aag gag cag ccc gcc ctc aat gac tcc aga tac 624
Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr
195 200 205
tgc ctg agc agc cgc ctg agg gtc tcg gcc acc ttc tgg cag aac ccc 672
Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro
210 215 220
cgc aac cac ttc cgc tgt caa gtc cag ttc tac ggg ctc tcg gag aat 720
Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn
225 230 235 240
gac gag tgg acc cag gat agg gcc aaa cct gtc acc cag atc gtc agc 768
Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro ValThr Gln Ile Val Ser
245 250 255
gcc gag gcc tgg ggt aga gca gac tgt ggc ttc acc tcc gag tct tac 816
Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr
260 265 270
cag caa ggg gtc ctg tct gcc acc atc ctc tat gag atc ttg cta ggg 864
Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly
275 280 285
aag gcc acc ttg tat gcc gtg ctg gtc agt gcc ctc gtg ctg atg gcc 912
Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala
290 295 300
atg gtc aag aga aag gat tcc aga ggc tag 942
Met Val Lys Arg Lys Asp Ser Arg Gly
305 310
<210>2
<211>313
<212>PRT
＜213〉artificial sequence
<400>2
Met Gly Cys Arg Leu Leu Cys Cys Ala Val Leu Cys Leu Leu Gly Ala
1 5 10 15
Val Pro Ile Asp Thr Glu Val Thr Gln Thr Pro Lys His Leu Val Met
20 25 30
Gly Met Thr Asn Lys Lys Ser Leu Lys Cys Glu Gln His Met Gly His
35 40 45
Arg Ala Met Tyr Trp Tyr Lys Gln Lys Ala Lys Lys Pro Pro Glu Leu
50 55 60
Met Phe Val Tyr Ser Tyr Glu Lys Leu Ser Ile Asn Glu Ser Val Pro
65 70 75 80
Ser Arg Phe Ser Pro Glu Cys Pro Asn Ser Ser Leu Leu Asn Leu His
85 90 95
Leu His Ala Leu Gln Pro Glu Asp Ser Ala Leu Tyr Leu Cys Ala Ser
100 105 110
Ser Gln Ala Gly Thr Gly Asn Thr Gly Glu Leu Phe Phe Gly Glu Gly
115 120 125
Ser Arg Leu Thr Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu
130 135 140
Val Ala Val Phe Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys
145 150 155 160
Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu
165 170 175
Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr
180 185 190
Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr
195 200 205
Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro
210 215 220
Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn
225 230 235 240
Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser
245 250 255
Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr
260 265 270
Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly
275 280 285
Lys Ala Thr Leu Tyr Ala Val Leu ValSer Ala Leu Val Leu Met Ala
290 295 300
Met Val Lys Arg Lys Asp Ser Arg Gly
305 310
Claims (7)
1, a kind of people TCR β 7.1_H3F7 gene is characterized in that gene order by 942 based compositions, and protein sequence is made up of 312 amino acid, sequence table such as SEQ ID NO:1.
2, the screening amplification method of the described gene of a kind of claim 1 is characterized in that may further comprise the steps:
(1) extracts cell total rna in the T lymphocyte, be transcribed into cDNA;
(2) the design primer is that template is carried out pcr amplification reaction with cDNA;
(3) the product gene clone of amplification acquisition is gone on the expression vector pcDNA-kan;
(4) with restriction endonuclease EcoRI and HindIII tcr gene and carrier pcDNA-kan are carried out double digestion, connect with the T4 dna ligase again, at last containing the positive colony bacterium that screening on the LB flat board of kantlex contains recombinant plasmid, the recon that screening is obtained checks order.
3, method according to claim 2 is characterized in that the described primer of step (2) is V7CK and C2CK, and its sequence is as follows:
V7CK：ATT GAATTC+GCC+ATGGGCTGCAGGCTGCTCTGC
C2CK：GCC AAGCTT+CTAGCCTCTGGAATCCTTTCT
The primer front end all contains 3 protection base sequences, also contains sequence and the Kozark sequence of restriction enzyme EcoRI in the V7CK primer, contains the sequence of restriction enzyme HindIII in the C2CK primer.
4, method according to claim 2 is characterized in that it is that gene inserts the site that the described clone of step (3) selects EcoRI and HindIII site in the pcDNA-kan carrier multiple clone site for use.
5, method according to claim 2, it is characterized in that the described order-checking of step (4) with T7 universal primer and BGH reverse sequencing primer as sequencing primer.
6, the application of the described gene of a kind of claim 1 is characterized in that discerning application aspect tumour and the killing tumor cells medicine in preparation.
7,, it is characterized in that being applied to prepare the application of medicines resistant to liver cancer or vaccine aspect according to the application of the described gene of claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100287425A CN101100666B (en) | 2007-06-22 | 2007-06-22 | Human TCRVbeta7.1_H3F7 gene and its screening method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100287425A CN101100666B (en) | 2007-06-22 | 2007-06-22 | Human TCRVbeta7.1_H3F7 gene and its screening method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101100666A true CN101100666A (en) | 2008-01-09 |
| CN101100666B CN101100666B (en) | 2011-05-25 |
Family
ID=39035114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100287425A Expired - Fee Related CN101100666B (en) | 2007-06-22 | 2007-06-22 | Human TCRVbeta7.1_H3F7 gene and its screening method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101100666B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023064899A1 (en) * | 2021-10-14 | 2023-04-20 | Health Research, Inc. | Compositions and methods for use of recombinant t cell receptors against claudin 6 |
-
2007
- 2007-06-22 CN CN2007100287425A patent/CN101100666B/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023064899A1 (en) * | 2021-10-14 | 2023-04-20 | Health Research, Inc. | Compositions and methods for use of recombinant t cell receptors against claudin 6 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101100666B (en) | 2011-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | Induction of tumor immunity following allogeneic stem cell transplantation | |
| EP1249490B1 (en) | In vitro activation of cytotoxic T cells | |
| EP3692057B1 (en) | Modified epidermal growth factor receptor peptides for use in genetically-modified cells | |
| CN107072184A (en) | Chimeric antigen receptor | |
| KR102617818B1 (en) | Optimized engineered nuclease with specificity for human T cell receptor alpha constant region gene | |
| KR20170074245A (en) | Altering gene expression in modified t cells and uses thereof | |
| Matsuura et al. | NKT cells in the rat: organ-specific distribution of NK T cells expressing distinct Vα14 chains | |
| EP2670848B1 (en) | Affinity maturated t cell receptors and use thereof | |
| DE60127715T2 (en) | POLYPEPTIDES FOR INDUCING AN IMMUNE REACTION AGAINST CANCER | |
| US6096314A (en) | Peptides and pharmaceutical compositions comprising them | |
| DE69534024T2 (en) | PEPTIDES AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM | |
| CN101100666B (en) | Human TCRVbeta7.1_H3F7 gene and its screening method and application | |
| AU690234B2 (en) | Peptides and methods against diabetes | |
| CA2325666A1 (en) | Immunogenic mutated peptides derived from r9m, polynucleotides, coding polynucleotides and their therapeutic uses | |
| CA2109481A1 (en) | Anti-metastatic vaccine | |
| Tjoa et al. | Diversity of T cell receptor-alpha chain transcripts from hyperimmune alloreactive T cells. | |
| Mosley et al. | Phenotype and TCR-γδ variable gene repertoire of intestinal intraepithelial lymphocytes in wild mice (Mus musculus domesticus): abundance of Vγ1 transcripts and extensive δ gene diversity | |
| Von Bonin et al. | Analysis of major histocompatibility complex class I‐restricted hapten recognition by mutation of the V‐J joining of T cell receptor α chains | |
| Ikeda et al. | Clonal dominance of human autologous cytotoxic T lymphocytes against gastric carcinoma: molecular stability of the CDR3 structure of the TCRαβ gene | |
| Inozume et al. | Dendritic cells transduced with autoantigen FCRLA induce cytotoxic lymphocytes and vaccinate against murine B-cell lymphoma | |
| CN112930394B (en) | Cancer cell vaccines expressing class II major histocompatibility complex and methods of use for generating integrated immune responses | |
| CN101374857A (en) | Novel T-helper antigenic determinant (THD) peptides | |
| Cantagrel et al. | T cell receptor gene in synovial tissues of rheumatoid arthritis | |
| KR20190084316A (en) | Mating Improved T Cell Receptor | |
| CA2144044A1 (en) | Reagents and methods for treating rheumatoid arthritis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110525 Termination date: 20130622 |