CN101093221A

CN101093221A - Application of GADD45 - beta protein and relevant cell factor in treating rheumatoid arthritis

Info

Publication number: CN101093221A
Application number: CN 200710004549
Authority: CN
Inventors: 李宁丽; 张冬青; 王利; 何东仪; 沈佰华
Original assignee: Shanghai Jiaotong University School of Medicine
Current assignee: Shanghai Jiaotong University School of Medicine
Priority date: 2006-03-13
Filing date: 2007-01-08
Publication date: 2007-12-26

Abstract

A GADD 45 beta protein and its relevant cell factor can be used to prepare reagent and the prepared reagent can be used to carry out biological detection and diagnosis on disease of rheumatoid arthritis.

Description

The application in rheumatoid arthritis of GADD45 β albumen and relevant cell factor thereof

Technical field

The present invention relates to the application in rheumatoid arthritis of GADD45 β albumen and relevant cell factor thereof, especially relate to GADD45 β albumen and relevant cell factor thereof purposes at biological detection and diagnostic method, specifically, the present invention relates to a kind of albumen that in the pathogenic process of rheumatoid arthritis, plays an important role-GADD45 β albumen and relevant cell factor thereof, the kinases and the purposes of inhibitor on diagnosis or treatment rheumatoid arthritis in downstream.The present invention also provides corresponding diagnostic kit.

Background technology

Though rheumatoid arthritis (Rheumatoid arthritis, RA) cause of disease and pathogenesis are still indeterminate, as: II Collagen Type VI and heat shock protein are the autoantigens of quasi-wind gateway morbidity, though the effect of these autoantigens in the disease pathologic process is not fully aware of.But it is very important to have generally acknowledged that the cell-mediated inflammation of T has play a part in quasi-wind gateway The lesions of synovium contributed process, particularly the inflammatory cytokine of Th1 cell and inflammation-related and the chemokine mediated damage of RA tissue.It is effective with its acceptor treatment RA to have reported the TNF-alpha-2 antagonists.But the startup of quasi-wind gateway synovial membrane inflammation T cell and the molecular mechanism that continues to exist it be unclear that.

GADD45 β belongs to GADD45 (growth arrest and DNA damage-inducible growth blocking-up and inducing DNA damage factor) family, three member GADD45 α, GADD45 β and GADD45 γ are arranged, very conservative on evolving, product is also quite similar, but function has nothing in common with each other in vivo.GADD45 albumen is regulated at transcriptional level, plays a role in some important physical processes, comprises that G2/M cell cycle phase checkpoint and DNA repair.The present GADD45 family protein that studies show that has antiproliferative activity, energy direct and cyclin such as PCNA, and cdc2, cyclinB and p21 interact cell death inducing.Although process and GADD45 α are similar, GADD45 β has shown different physiologically actives.And GADD45 β regulates the function of T cell activation and differentiation in addition.There is report to show that GADD45 β is by MAPK family (mitogen-activated proteinkinases, MAPKs) differentiation of mediation Th1 cell.MAPKs is transmitted to endonuclear important albumen with extracellular signal: the various stressed conditions in extracellular, can both regulate cell function by this approach, induce biological effects such as differentiation and apoptosis as hyperosmosis, heat shock, ultraviolet ray and cell factor, pathogenic microorganism composition-lipopolysaccharides (LPS) etc., be the important mechanisms that cell is carried out function.

Known GADD45 β albumen starts agent as the earlier T lymphocyte, and relevant with a series of proinflammatory production of cytokines relevant with inflammatory process.GADD45 β albumen is a kind of intracellular protein with multiple function.GADD45 β albumen belongs to the protein of regulating the growth of T cell, activation and differentiation, because GADD45 β albumen has the effect that promotes Th1 emiocytosis IFN-γ.GADD45 β albumen can be by activating the function that many important kinases come mediated cell in the born of the same parents, the wherein topmost ERK that comprises the MAPK approach, and P-38.GADD45 β albumen can and cause the latter that phosphorylation takes place with these kinase interactions, and promotes the T cell to the Th1 type differentiation justacrine various kinds of cell factor, as its effects of performance such as IFN-γ.

Simultaneously, GADD45 β albumen still is the main molecules of anti-apoptotic.The up-regulated of GADD45 β albumen can suppress the apoptosis of cell by the activation that suppresses JNK, and this point is confirmed in the research of some tumours generations and progress.

The activation of GADD45 β albumen and T cell has just begun to launch to the differentiation of Th1 direction and the research of bringing into play aspects such as its function.So far express as yet about the relation of GADD45 β albumen and quasi-wind gateway and not appear in the newspapers.Especially, before the present invention, GADD45 β albumen is crossed to express with its functional relationship in quasi-wind gateway and is not illustrated as yet in quasi-wind gateway synovial membrane infiltrating T cell and the peripheral blood T cells.

Because the molecular mechanism that the startup of the pathogenic CD4+T cell of pathogenesis, especially quasi-wind gateway of rheumatoid arthritis and continuation exist it be unclear that, the diagnosis and the treatment of rheumatoid arthritis have therefore greatly been hindered.Therefore, this area is urgent always for a long time wishes to find the material relevant with the morbidity of RA, so that develop potent agent box or the detection means with auxiliary diagnosis rheumatoid arthritis and other autoimmune disease such as lupus erythematosus, multiple sclerosis etc.

Summary of the invention

Purpose of the present invention just provides a kind of GADD45 β albumen and the application of relevant cell factor in rheumatoid arthritis thereof.

The object of the invention provides the method and the kit of a kind of effective auxiliary detection or auxiliary detection rheumatoid arthritis.

The invention provides a kind of GADD45 β albumen and relevant cell factor thereof and apoptotic purposes, be used to prepare the reagent of detection or auxiliary detection rheumatoid arthritis, wherein, described reagent comprises a kind of or its combination in GADD45 β protein nucleic acid and cell factor, the GADD45 β albumen downstream kinases, described relevant cell factor comprises IFNr, TNFa, IL-12,18.

The invention provides a kind of kit of detection type rheumathritis, it contains container and is positioned at the detection GADD45 β nucleic acid of container or the reagent of protein content.Preferably, the reagent of described detection GADD45 β nucleic acid and protein content is the Oligonucleolide primers of specific amplification GADD45 β albumen or the antibody of the anti-GADD45 β of specificity albumen, described primer is seen sequence table, be SEQ ID NO.1, SEQID NO.2, SEQ ID NO.3, SEQ ID NO.4, wherein, SEQID NO.1, SEQID NO.2 are respectively the upstream and downstream primer of GAPDH; SEQ ID NO.3, SEQ ID NO.4 are the upstream and downstream primer of GADD45 β, and the GADD45 beta gene sequence is used to increase.

In a preference, described kit also contains the reagent that detects downstream kinases state, and wherein said kinases is selected from ERK, P-38 and the JNK that kinases comprises MAPKs.And the reagent of described detection downstream kinases state is the antibody of the anti-phosphorylating kinase of specificity.

In another preference, described kit also contains the reagent that detects TNF-α or IFN-γ content.

In another preference, described kit also contains detection IL-12, the reagent of IL-18.

Mechanism of the present invention and research:

Fig. 1: gene U133A gene chip expression spectral in patient RA synovial tissue and the normal person synovial tissue.

The human full genomic gene chip U133A of this research and utilization Afmetrix company has carried out multianalysis to the gene expression profile of quasi-wind gateway tissue, for the tumor susceptibility gene development mechanism of quasi-wind gateway disease in this research provides significant gene profile.Pathology synovial tissue is from replacement knee in arthroplasty.Normal person synovial tissue comes from arthrocsopic surgery.With the aseptic operating table of taking from of synovial tissue, place the serum-free RPMI-1640, deliver to the laboratory as early as possible.Carry out mRNA and reverse transcription after in super-clean bench, being cut into small pieces immediately and be the cDNA row labels of going forward side by side, then with gene chip hybridization.Because in the screening study of genetic chip, hybridization signal machine is as calculated handled, is analyzed, and can obtain gene expression spectrum information in the sample and the gene expression difference between the sample.In view of the above advantage of genetic chip, this technology has caused scholars' extensive concern immediately since setting up, and become technology most popular in the current life science it.

Fig. 1 has shown with transcription group-gene expression-monochromatic biochip technology about 38000 expression of gene spectrum of patient's RA synovial tissue has been detected.And do contrast with normal person homologue gene expression profile.In figure below, a kind of gene of each some representative: red point is represented the gene of both co expression, and the blue dot representative has a kind of gene expression variant, and on behalf of both, yellow dots will all do not have this expression of gene.Results suggest: RA patient compares with the normal person the gene that much there were significant differences expresses, and only is (shown in the Bluepoint in the log2-10 zone of left side ordinate) about 30 but express the gene that increases more than 4 times.

30 genes of finding after analyzing to have an appointment are expressed in RA and are increased more than 4 times, and wherein GADD45 β expresses and obviously increases.

Fig. 2. genetic chip detects the expression of GADD45 β in the RA synovial tissue: the expression of the GADD45 β in the RA patient synovial tissue of being detected in the genetic chip is compared with normal person's synovial tissue, as seen the expression of the GADD45 β of RA increases, and is 9.6 times of normal person.

Fig. 3. the expression of the mononuclearcell GADD45 β of separate sources.From the mononuclearcell extracting RNA in 60 routine RA patient's peripheral bloods, joint fluid and synovial tissue source, quantitative PCR analysis.The contrast mononuclearcell is from 20 healthy volunteers.GADD45 β expression is with the expression standardization of same sample GAPDH.Relative quantity is expressed and is represented with Δ Δ CT.The relative content of GADD45 β gene is with 2 ^{-Δ Δ CT}Calculate.The result shows, and is than normal person height, and in the tissue of RA, the highest with the relative content of the GADD45 β gene of the mononuclearcell in the synovial membrane at the relative content of the GADD45 β gene of RA patient's mononuclearcell.

The relative content of GADD45 β gene is expressed general layout in Fig. 4 .RA patient T cell.Separate the T cell with magnetic bead from the mononuclearcell in 10 routine RA patient's peripheral bloods source, adopt the anti-CD3 monoclonal antibody of specificity mark after, detect institute with flow cytometer and separate the T cell purity above 97%.Extracting RNA, quantitative PCR analysis.Contrast T cell is from 10 healthy volunteers.GADD45 β expression is with the expression standardization of same sample GAPDH.Relative quantity is expressed and is represented with Δ Δ CT.The relative content of GADD45 β gene is with 2 ^{-Δ Δ CT}Calculate.The result shows, at the relative content of the GADD45 β of RA patient's T cell gene than at least 3 times of normal person height.

The relative content of GADD45 β gene is expressed general layout and is isolated CD4+T cell and CD8+T cell with magnetic bead from RA and normal person's peripheral blood in Fig. 5 .RA patient T cell subsets, after adopting anti-CD4 of specificity and CD8 monoclonal antibody mark, surpass 97% with flow cytometer detection institute's separation of C D4+T cell and CD8+T cell purity.With quantitative PCR analysis GADD45 β expressing quantity.A. the result shows, GADD45 β mainly is expressed in the CD4+T cell, and GADD45 β expression is fairly obvious in the RA patient CD4+T cell, and expresses no significant change in the CD8+T cell.In all legends, the asterisk representative relatively has statistical significance (p＜0.05) in different groups.B. at the relative content of the GADD45 β of RA patient's CD4+T cell gene than normal person CD4+T cell height, and in the tissue of RA, the highest with the relative content of the GADD45 β gene of the CD4+T cell in the synovial membrane.

Fig. 6. having shown with RA synovium of joint liquid stimulates the analysis result that GADD45 β protein mRNA is expressed in back mononuclearcell and the CD4+T cell.The synovial membrane liquid of aseptic extraction from RA patient joint, after centrifugal removal fragment of tissue, be added in normal person's PERIPHERAL BLOOD MONONUCLEAR CELL and the CD4+T cell after 3-5 part synovial membrane liquid mixing, detected GADD45 β expression respectively at 2 hours, 4 hours, 6 hours, 8 hours, 16 hours, 24 hours, found that, after synovial membrane liquid was added above-mentioned cell with the dilution of 1: 8 ratio, GADD45 β expressed and increased since 2 hours, peaks in the time of 8 hours.Slowly descend then, in the time of 24 hours, return to initial level substantially.Show that the knuckle synovia of RA has the effect of GADD45 β up-regulated in stimulated healthy mononuclearcell and the CD4+T cell.

A. the dose curve of normal person's PBMC GADD45 β protein expression under the RA-SF of variable concentrations and corresponding serum stimulation.When synovial membrane liquid was diluted as 1: 16, spread effect disappeared substantially.

B. magnetic bead separates peripheral blood CD2+T cell (purity is greater than 97%), and the RA-SF of dilution in 1: 8 is added to respectively among 10 normal persons selecting at random and 10 patients' RA (age, sex corresponding) the PBMC after filtering.Collect cell in the different time and carry out the expression that real-time quantitative PCR detects GADD45 β protein nucleic acid.The result of data represented four independent experiments that carry out with different patients' RA-SF shown in the figure.Experiment with patient RA and normal person's CD4+T cell also obtains identical result.The computing method of GADD45 β protein expression illustrate described with Fig. 1.

Fig. 7 .GADD45 β protein mRNA is expressed to increase with mononuclearcell and CD4+T cell and is proportionate in the time of external survival.The synovial membrane liquid of aseptic extraction from RA patient joint after centrifugal removal fragment of tissue, is added in normal person's PERIPHERAL BLOOD MONONUCLEAR CELL and the CD4+T cell after 3-5 part synovial membrane liquid mixing, express at following time detecting GADD45 β protein mRNA respectively: 0h, 2h, 4h, 8h, 16h.Detect with Avinnex V and PI staining cell at 24 hours, 48 hours, 72 hours, 96 hours, 120 hours that apoptotic a situation arises, simultaneously in contrast with normal human serum.Found that, be added with cell with the synovial membrane liquid of 1: 8 dilution proportion, no matter be among normal person or patient RA, GADD45 β protein mRNA is expressed in 2h and promptly obviously expresses, but, promptly descend rapidly after GADD45 β protein mRNA in the normal cell is expressed in 2 hours, and GADD45 β protein mRNA expression decline was very slow in patient's RA cell, still kept higher level (figure A) at 16 hours.The ratio that apoptosis appears in cell is starkly lower than cellular control unit.Prompting GADD45 β protein mRNA is expressed to increase with mononuclearcell and CD4+T cell and is proportionate in the time of external survival.And RA patient's joint fluid is expressed and is kept in normal person's peripheral blood mononuclearcell and CD4+T cell in the time of external survival (figure B) by raising GADD45 β protein mRNA, same result of study also be confirmed in patient's RA peripheral blood cells (figure C).

After the PERIPHERAL BLOOD MONONUCLEAR CELL that is separated to density gradient centrifugation, separate peripheral blood CD4+T cell (purity is greater than 97%) with magnetic bead, the RA-SF of dilution in 1: 8 is added to respectively among 6 normal persons selecting at random and 6 patients' RA (age, sex corresponding) the PBMC and CD4+T cell after filtering.Collect cell in the different time and carry out Avinnex V and PI dyeing observation of cell apoptosis situation.The result of data represented three independent experiments that carry out with different patients' RA-SF shown in the figure.

Fig. 8 .RA patient joint fluid has the expression of raising mononuclearcell and CD4+T cell Fas albumen in normal person's peripheral blood, and the expression of FasL is not had obvious influence.The synovial membrane liquid of aseptic extraction from RA patient joint, after centrifugal removal fragment of tissue, be added in normal person's PERIPHERAL BLOOD MONONUCLEAR CELL and the CD4+T cell after 3-5 part synovial membrane liquid mixing, detected Fas and FasL expression at 24 hours, 48 hours with the real-time quantitative PCR method respectively, simultaneously in contrast with normal human serum.Found that, be added with in the cell with the synovial membrane liquid of 1: 8 dilution proportion, intracellular Fas genetic transcription appears at post-stimulatory 4 hours, (figure A) peaked at 48 hours, and FasL does not have significant change in early days, after hatching 48 hours jointly with synovial membrane liquid, FasL expresses and begins to increase (figure B).Specific monoclonal antibody dyeing with Fas and FasL has also confirmed equifinality.

Fig. 9 .GADD45 β protein mRNA express increase with peripheral blood in the expression of mononuclearcell and CD4+T cell synthetic IL-12, IFN-r and IL-10 be proportionate, promptly IL-12, IFN-r in mononuclearcell in the peripheral blood and the CD4+T cell are had the rise effect, but the expression of IL-10 is not obviously acted on.The synovial membrane liquid of aseptic extraction from RA patient joint, after centrifugal removal fragment of tissue, be added in normal person's PERIPHERAL BLOOD MONONUCLEAR CELL and the CD4+T cell after 3-5 part synovial membrane liquid mixing, after the PERIPHERAL BLOOD MONONUCLEAR CELL that is separated to density gradient centrifugation, separate peripheral blood CD4+T cell (purity is greater than 97%) with magnetic bead, the RA-SF of dilution in 1: 8 is added to respectively among 6 normal persons selecting at random and 6 patients' RA (age, sex corresponding) the PBMC and CD4+T cell after filtering.Collect cell respectively at 2 hours, 4 hours, 6 hours, 8 hours, 16 hours, 24 hours, 48 hours and carry out real-time quantitative PCR detection cytokine expression situation.Found that, be added with in the cell with the synovial membrane liquid of 1: 8 dilution proportion, IL-12, TNF-α, the time that the expression of IFN-γ is hatched along with cell and synovial membrane liquid increases and expresses, and peaks in the time of 24 hours.And by contrast, the expression of IL-10 does not have significant change.In the present invention, test findings prompting RA patient joint fluid is expressed by stimulated healthy GADD45 β protein mRNA, mononuclearcell and CD4+T cell synthesize the synthetic of IL-12, IFN-r and IL-10 and express in the promotion peripheral blood, thereby reach the effect of inducing inflammatory reaction.

Figure 10 has shown that with after the GADD45 β specificity SiRNA interference be accompanied by the reduction that GADD45 β expresses, IFN-γ and other inflammatory factor such as TNF-α, IL-12 obviously reduce.(human peripheral blood mononuclear cells PBMC) is resuspended to 2.5 * 10 with people's mononuclearcell of fresh separated ⁷The concentration of ,/ml, the cell suspension (i.e. 1 * 106 cell) of getting 40 μ l is placed in 24 well culture plates, in 37 ℃, cultivates in the 5%co2 incubator.

The transfection of GADD45 β specificity SiRNA: transfection reagent is liposome geneporter and contains antibiotic serum-free composition 1640 solution that rotaring redyeing system (is example with 24 orifice plates) is 250 μ l.

With 1640 (volume ratio is 1: 6, and cumulative volume is 125 μ l) of 12 μ l geneporter and 113 μ l mixing gently, room temperature leaves standstill 3-5min; With 2 μ l siRNA and 123 μ l 1640 mixing gently, (cumulative volume 125 μ l) room temperature leaves standstill 3-5min then; With the mixing gently again of two kinds of liquid behind the mixing, room temperature leaves standstill about 20-25min (being no more than 30min) then.Liquid with mixing is added in the cell suspension again, and fully piping and druming makes RNA-geneporter complex and the abundant mixing of cell.At 37 ℃, 5%CO ₂Cultivate after 5-7 hour in the incubator, add to contain isopyknic 20%FBS and contain antibiotic 1640 nutrient solutions and continue to cultivate, after 24-48 hour, get cultured cells and do real-time quantitative PCR, detect effects of jamming.The result shows, is accompanied by the reduction that GADD45 β expresses, and IFN-γ and other inflammatory factor such as TNF-α, IL-12 obviously reduce.

Figure 10 shows after disturbing with GADD45 β specificity SiRNA, reduces (Figure 10 A), inflammatory factor IL-12 along with GADD45 expresses, TNF-α, IFN-γ expresses and reduces (Figure 10 B), and Lymphocyte Apoptosis obviously increases (Figure 10 C) simultaneously, and Fas/FasL expresses and reduces (Figure 10 D).These tests have confirmed that GADD45 β control synovial membrane soaks into proinflammatory cytokine secretion and produces inflammatory factor, and whether the activation of GADD45 β has very large relation with the local inflammation environment.The continuation of GADD45 β in synovial membrane infiltrating T cell activates and is closely related by the approach inhibition apoptosis of Fas/FasL mediation, differentiation, polarization, inhibition apoptosis and the effect thereof of peripheral blood pathogenic T cell.Can play the effect that suppresses the pathogenic T cell activation by downward modulation GADD45 β.RA patient's synovial membrane liquid and peripheral blood IL-12, IL-18 can stimulate the expression of GADD45 β in the T cell to increase, and then break up, suppress IL-10 secretion and t cell proliferation and stimulate secretion of gamma-IFN and IL-12 to the Th1 type, and reaction causes inflammation.The method of using RNA to disturb can be blocked this process. and this screening for later gene therapy and novel drugs provides solid foundation.

The present invention has illustrated the mechanism of action of GADD45 β albumen in RA inflammatory process and other autoimmunity condition.Studies show that the GADD45 β protein expression of quasi-wind gateway PERIPHERAL BLOOD MONONUCLEAR CELL and CD4+T cell obviously increases, and the GADD45 β protein expression of normal person's PERIPHERAL BLOOD MONONUCLEAR CELL and CD4+T cell can be induced by inflammation synovium of joint liquid.GADD45 β protein expression increases provides a kind of in quasi-wind gateway patient body in the pathogenic T cell continuous activation process, works the functional mechanism that amplifies inflammation.Finished the present invention on this basis.

In the present invention, find that first GADD45 β albumen is at the synovial tissue of pathology and the high expressed in the cell, and showing that with the method that external pathology synovial membrane liquid stimulates crossing on the periphery blood T cell express with the local inflammation environment very large relation is arranged, GADD45 β albumen has played important effect as a kind of important medium in the rheumatoid arthritis patients course of disease.Studies show that GADD45 β protein mRNA is high expressed on RA patient's synovium of joint liquid CD4+T cell, is associated with patient's the degree of being in a bad way.The continuation high expressed of GADD45 β albumen on the CD4+T cell is relevant with the high-caliber inflammatory factor (IL-12,18) in the local joint synovial membrane liquid.RA patient's SF and IL-12 all can stimulate the T cell that GADD45 β protein expression is increased.GADD45 β albumen can raise the mode of IFN-γ, IL-12 and inhibition IL-10 secretion by activation, induces Th1 cell differentiation justacrine IFN-γ to mediate the function of pathogenic T cell.

Major advantage of the present invention is:

(a) diagnosis or the auxiliary diagnosis for rheumatoid arthritis provides detection method accurately and efficiently.

(b) provide the new method of effective screening treating rheumatoid arthritis medicine.

Description of drawings

Gene U133A gene chip expression spectral in Fig. 1 patient .RA synovial tissue and the normal person synovial tissue.

Fig. 2. genetic chip detects the expression of GADD45 β in the RA synovial tissue.

Fig. 3. the expression of the mononuclearcell GADD45 β of separate sources

The relative content of GADD45 β gene is expressed general layout in Fig. 4 .RA patient T cell.

The relative content of GADD45 β gene is expressed general layout in Fig. 5 .RA patient T cell subsets

Fig. 6. having shown with RA synovium of joint liquid stimulates the analysis result that GADD45 β protein mRNA is expressed in back mononuclearcell and the CD4+T cell.

Fig. 7 .GADD45 β protein mRNA is expressed to increase with mononuclearcell and CD4+T cell and is proportionate in the time of external survival.

Fig. 8 .RA patient joint fluid has the expression of raising mononuclearcell and CD4+T cell Fas albumen in normal person's peripheral blood, and the expression of FasL is not had obvious influence.

Fig. 9 .GADD45 β protein mRNA express increase with peripheral blood in the expression of mononuclearcell and CD4+T cell synthetic IL-12, IFN-r and IL-10 be proportionate, promptly IL-12, IFN-γ in mononuclearcell in the peripheral blood and the CD4+T cell are had the rise effect, but the expression of IL-10 is not obviously acted on.

Figure 10 has shown that with after the GADD45 β specificity SiRNA interference be accompanied by the reduction that GADD45 β expresses, IFN-γ and other inflammatory factor such as TNF-α, IL-12 obviously reduce, and Lymphocyte Apoptosis obviously increases, and Fas/FasL expresses reduction.

Embodiment

Based on above-mentioned research, the invention provides a kind of purposes of the GADD45 of detection β protein expression state, described GADD45 β protein expression is used to prepare the reagent of detection or auxiliary detection rheumatoid arthritis.

The present invention also provides a kind of kit of detection type rheumathritis, it contains container and is positioned at the reagent of the detection GADD45 β protein content of container, as the Oligonucleolide primers of specific amplification GADD45 β albumen or the antibody of the anti-GADD45 β of specificity albumen.

In addition, described detection kit also contains and detects IL-12, and 18, the reagent of TNF-α or IFN-γ content.

In kit of the present invention, also can contain corresponding specific probe and/or PCR damping fluid etc.

On the other hand, the invention still further relates to GADD45 β albumen and relevant inflammatory cytokine thereof, i.e. IL-12,18, TNF-α or IFN-γ, or the antibody that detects of IL-12/18 and specific antibody thereof, especially monoclonal.The present invention not only comprises complete monoclonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.

With GADD45 β albumen is example, and " specificity " is meant that antibody capable is incorporated into GADD45 β albumen or fragment.Preferably, refer to that those can combine with GADD45 β albumen or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.

With GADD45 β albumen is example, and " specificity " nucleic acid or probe are meant the fragment that can combine with the complementation of GADD45 β protein mRNA specificity.Preferably, refer to that those can only combine with GADD45 β protein mRNA nucleic acid or fragment but nonrecognition and be incorporated into the nucleic acid or the probe of other irrelevant protein nucleic acid and mRNA molecule.Nucleic acid of the present invention or probe can be prepared by the known various technology of those skilled in that art.

The method that whether has GADD45 β albumen in a kind of test sample is to utilize the specific antibody of GADD45 β albumen to detect, and it comprises: sample is contacted with GADD45 β protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample GADD45 β albumen.According to the quantity of antibody complex, can quantitatively determine the quantity of GADD45 β albumen.

The method that whether has GADD45 β protein nucleic acid mRNA in a kind of test sample is to utilize the specific probe or the primer of GADD45 β protein nucleic acid to detect, and it comprises: sample is contacted with GADD45 β protein-specific probe; Observe whether form compound, formed compound and just represented to exist in the sample GADD45 β protein-specific nucleic acid.According to the content of nucleic acid complexes, can quantitatively determine the expression quantity of GADD45 β protein nucleic acid.

For IL-12,18, the antibody of TNF-α or IFN-γ, also all be as known in the art, available conventional method preparation also can be from buying in market.

In the present invention, can also be by conventional nucleic acid quantification detection technique, as the fluorescent real time PCR technology, come GADD45 β albumen and related inflammatory factor IL-12 thereof in the test sample, 18, the level of TNF-α or IFN-γ.

With GADD45 β albumen is example, and the polynucleotide of GADD45 β albumen also can be used for the early stage auxiliary diagnosis and the treatment of rheumatoid arthritis.Part or all of polynucleotide of the present invention can be used as probe stationary on little array (microarray) or DNA chip (being called " genetic chip " again) or polyphenyl alkene plate, is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect GADD45 β albumen with the special primer of GADD45 β albumen.

Below in conjunction with specific embodiment, further set forth the present invention, should be understood that these embodiment only are used to the present invention is described and are not used in to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The RA detection method:

Patient and experiment material

60 routine RA patients are collected in this research altogether.All patients all meet the diagnostic criteria of Americanism diseases caused by dampness association.RA patient's sex ratio is: women 42 people, male 18 people; Disease year is limited to 15 ± 12 years.Patient age is 54 ± 19 years old.Complete paired sample has 25 examples, and every patient has peripheral blood, joint fluid and synovial tissue of joint.Other one group of 20 routine paired sample has joint fluid and serum (not containing cell).Contrast PERIPHERAL BLOOD MONONUCLEAR CELL and serum are from 20 healthy volunteers, and sex is similar to the RA group with the age.In sample collection preceding 1 month, not used immunodepressant of patient and immunomodulator.The patient all signs Informed Consent Form before sample collection.The research flow process meets the research pact.

Synovial tissue is from villusectomy or arthrocsopic surgery.Joint fluid 3000rpm collected supernatant ℃ preservation at once-80 in centrifugal 3 minutes.Ficoll separates RA patient's joint fluid and peripheral blood gets mononuclearcell, carries out cellular incubation immediately.Tissue is cut into small pieces, homogenate extracting RNA immediately.

RNA extracting and quantitative PCR:

With the Rneasy Mini of Qiagen company kit extracted total RNA.In the purifying RNA process, use the dnase digestion genomic DNA.RNA-80 ℃ of preservation.With the Sensiscript RT of Qiagen company kit reverse transcription RNA sample.In cDNA is synthetic, use random primer.

The mRNA that detects GADD45 β albumen with quantitative PCR SYBR method expresses, and its specific primer sequence sees Table 1.

Table 1. is used for the Auele Specific Primer that PCR in real time is analyzed

Title	Primer	Sequence (5 ' → 3 ')	?SEQ?ID?NO：	Product length
Title	Primer	Sequence (5 ' → 3 ')	?SEQ?ID?NO：	Product length	GAPDH	FW RV	GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC	?1 ?2	187
GADD45β	FW RV	GGGAAGGTTTTGGGCTCTCT TCCAGCGTCATGTTGCAATT	?3 ?4	100	GAPDH	FW RV	GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC	?1 ?2	187

Thermal cycle conditions comprise initial 50 ℃ 2 minutes, subsequently 95 ℃ 10 minutes, 2 step PCR circulations comprise 95 ℃ 15 seconds, 60 ℃ 60 seconds, 40 circulations.Data aggregation, 7900 pairs of data of ABI are done quantitative test.The GAPDH gene makes the total RNA amount of different specimens be able to standardization as confidential reference items.Sample is quantitatively expressed multiple with GAPDH and is represented.The multiple hole of each sample mean value is with threshold calculations and expression (CT, each PCR reaction reaches the period of predetermined fluorescence threshold).Gene expression amount is represented with the difference of sample CT value and confidential reference items GAPDHCT value.Relative quantity is expressed and is calculated with Δ Δ CT.The gene relative expression quantity is 2 ^{-Δ Δ CT}Synovial tissue's single cell suspension preparation:

The synovial tissue that operation is taken off puts into the complete RPMI medium that contains 10% hyclone and 1% mycillin immediately, is cut into small pieces.Drive mill away with Teflon Resin rod, wash repeatedly, obtain single cell suspension with 70 μ m nylon net filters with the complete RPMI medium that contains 10% hyclone and 1% mycillin.

Separating and purifying of CD4+ and CD8+T cell:

The cell of collecting is washed once with the PBS that contains 2%FCS (hyclone), and by 1 * 10 ⁷The concentration of cell/ml is resuspended among the PBS that contains 2%FCS.Select CD2+ with Dynal beads sun then, CD4+ and CD8+T cell.After the separation, use the flow cytometer showed negative cells, detect in these cells and contain CD2+, the ratio of CD4+ and CD8+T cell.The cell part that sun is selected is used for purity analysis, and remaining is used for extracting RNA and do PCR in real time and detect.In all experiments, sun selects efficient all more than 97%.CD2+, the purity of CD4+ and CD8+T cell is also more than 97%.

The T cytositimulation:

RA and normal person's PBMC, magnetic bead press every hole 1 * 10 after separating T cell and CD4+T cell ⁶Individual quantity is placed on 24 orifice plates and cultivates, and cultivates with containing 10% the FBS and the RPMI 1640 of 100U/ml penicillin and streptomysin.With in the stimulation test of RA-SF, in nutrient solution, add RA-SF (dilution in 1: 8).During use, all RA-SF will use Millex filtrator (Millipore company) degerming.Cell is at 37 ℃, 5%CO ₂Incubator in cultivate after 2,4,8,16,24 hours and to collect.Do the PCR in real time analysis behind the cell harvesting.In blocking experiment, the monoclonal antibody of anti-people IL-12 and homotype control antibodies are added in the nutrient solution of the PBMC that stimulates with SF with the concentration of 10 μ g/ml.Handle according to process recited above then.When research specific nucleic acid and antibody blocking, also adopt the identical operations flow process.

Specificity SiRNA interference test:

For detecting inhibition and corresponding inflammatory factor and the pair cell effect of apoptosis that GADD45 β protein-specific SiRNA expresses GADD45 β protein nucleic acid, disturb with GADD45 β specificity SiRNA pair cell.With people's mononuclearcell of fresh separated (human peripheral bloodmononuclear cells, PBMC) after the transfection with GADD45 β specificity SiRNA, at 37 ℃, 5%CO ₂Cultivated 5-7 hour in the incubator, add then to contain isopyknic 20%FBS and contain antibiotic 1640 nutrient solutions and continue to cultivate 24-48 hour.Get cultured cells and do real-time quantitative PCR, detect effects of jamming.

Statistical study:

The difference condition of gene expression adopts Mann Whitney U test (TheMann-Whitney U Test) analysis between each group.The P value has significant difference less than 0.05 expression.

The result:

The result is shown in Fig. 1-9 and table 1.

(a) expression status of GADD45 β protein mRNA and protein level in the quasi-wind gateway synovial membrane:

With transcription group-gene expression-monochromatic biochip technology about 38000 expression of gene spectrum of patient's RA synovial tissue is detected.And do contrast with normal person homologue gene expression profile.30 genes of finding after analyzing to have an appointment are expressed in RA and are increased more than 4 times, and wherein GADD45 β expresses and obviously increases (Fig. 1).The expression of GADD45 β in the RA patient synovial tissue of being detected in the genetic chip is compared with normal person's synovial tissue, and the expression of the GADD45 β of visible RA increases, and is 9.6 times (Fig. 2) of normal person.PERIPHERAL BLOOD MONONUCLEAR CELL (PBMC), synovial membrane liquid mononuclearcell (SFMC) and synovial tissue are contrast with healthy human PBMC from clinical RA patient simultaneously.The expression of mononuclearcell and the same RA patient mononuclearcell GADD45 β of synovial tissue albumen and himself PBMC and normal healthy controls PBMC go up the expression of GADD45 β albumen among the quantitative PCR detection SFMC, as shown in Figure 3 at the relative content of the GADD45 β gene of RA patient's mononuclearcell than normal person height, and in the tissue of RA, with the relative content the highest (p＜0.01) of the GADD45 β gene of the mononuclearcell in the synovial membrane.

As shown in Figure 4, with the mononuclearcell separation T cell of magnetic bead from 10 routine RA patient's peripheral blood sources, extracting RNA, quantitative PCR analysis.Contrast T cell is from 10 healthy volunteers.The result shows, at the relative content of the GADD45 β of RA patient's T cell gene than at least 3 times of normal person height.Further from RA and normal person's peripheral blood, isolate CD4+T cell and cd8 t cell with magnetic bead, analyze the relative content of GADD45 β gene in the RA patient T cell subsets and express general layout, the result shows, GADD45 β mainly is expressed in the CD4+T cell, GADD45 β expression fairly obvious (p＜0.05) in the RA patient CD4+T cell, and express no significant change in the CD8+T cell.And at the relative content of the GADD45 β of RA patient's CD4+T cell gene than normal person CD4+T cell height, and in the tissue of RA, with the relative content the highest (Fig. 5) of the GADD45 β gene of the CD4+T cell in the synovial membrane.

(b) knuckle synovia and cell factor can be induced GADD45 β protein expression:

Can the joint fluid that be contained different cytokines for the expression of setting forth GADD45 β albumen on the T cell induce, and randomly draws RA patient and separate PBMC with healthy volunteer's peripheral blood and be used for functional experiment.In-vitro separation PBMC at first adds the joint fluid of different extension rates then, and separation of C D4+T cell is analyzed the expression of GADD45 β protein mRNA with quantifying PCR method subsequently.With after the stimulation of RA synovium of joint liquid, analyze GADD45 β protein mRNA expression in mononuclearcell and the CD4+T cell in the research.Found that after synovial membrane liquid was added above-mentioned cell with the dilution of 1: 8 ratio, GADD45 β expressed and increased since 2 hours, peaks in the time of 8 hours.Slowly descend then, in the time of 24 hours, return to initial level substantially.Show that the knuckle synovia of RA has the effect (Fig. 6) of GADD45 β up-regulated in stimulated healthy mononuclearcell and the CD4+T cell.Owing to contain abundant IL-12 and IL-18 in the knuckle synovia, and IL-12 and IL-18 are effective derivants that GADD45 β expresses.In addition, also contain TNF-α in the knuckle synovia, IFN-γ, these cell factors all have the effect that GADD45 β expresses of raising.Therefore, the knuckle synovia of pathology is induced the expression of GADD45 β by the cell factor of multiple mixing.

In the test, in order to illustrate whether cross expressing and the inflammation environment of quasi-wind gateway synovial tissue and peripheral blood and the relation of cell factor of GADD45 β albumen, at first, in RA patient's joint fluid and self paired sera and normal control serum, detect IL-18, IL-10, IL-12, TNF-α and IFN-γ with detecting 5 kinds of cytokine concentration with the ELISA method.IL-18 and IL-12 concentration ratio normal control serum obviously increase (p＜0.01) in RA joint fluid and the serum, and TNFa in the knuckle synovia and IFNr be than RA patients serum height, and promptly normal human serum wants high.This result at first points out in RA patient's joint fluid 2 kinds of cytokine expression relevant with the expression of T cell GADD45 β albumen, promptly; IL-12/18 can stimulate the expression of GADD45 β albumen.IL-12/18 stimulates the expression of GADD45 β albumen also mainly at CD4+T cell rather than CD8+T cell.IL-12/18 stimulates the CD4+T cell, and IFN-γ concentration significantly increases in the ELISA detection culture supernatant, and is relevant with the expression of GADD45 β albumen.IL-12/18 stimulates being dose-dependent mode and part being blocked by anti-IL-12/18 antibody of GADD45 β protein expression, illustrate in the joint fluid IL-12/18 really or can induce the expression of GADD45 β albumen to small part.

Because the level of IL-12/18 also increases than the normal person is remarkable in the quasi-wind gateway patient peripheral blood, it is similar that test findings and synovial membrane liquid stimulate. this explanation in, in end-stage patients' body, increasing of the inflammatory factor of general, for the T cell, especially the performance of the activation of CD4+T cell and effect is essential.GADD45 β albumen plays and is connected and amplification, also is one of mechanism of quasi-wind gateway constitutional symptom generation.

(c) induce GADD45 β protein expression can prolong the time of T cell in external survival:

In above-mentioned test, except of the effect of analysis of joint synovia, also analyzed the accordingly result with the effect of GADD45 β up-regulated to GADD45 β up-regulated, promptly cell is in the time and the correlative protein expression of external survival.

The RA-SF of dilution in 1: 8 is added to respectively at random among 6 normal persons selecting and 6 patients' RA (age, sex corresponding) the PBMC and CD4+T cell.Collect cell in the different time and carry out Avinnex V and PI dyeing observation of cell apoptosis situation, simultaneously in contrast with normal human serum.Found that be added with in the cell with the synovial membrane liquid of 1: 8 dilution proportion, the ratio that apoptosis appears in cell is starkly lower than cellular control unit.Prompting RA patient joint fluid has keeps in normal person's peripheral blood mononuclearcell and CD4+T cell in the effect of external time-to-live.And analyze for the expression conditions with apoptosis-related of generally acknowledging at present, find to add RA patient's joint fluid and have the expression of raising mononuclearcell and CD4+T cell Fas albumen in normal person's peripheral blood, and the expression of FasL is not had obvious influence.Specific monoclonal antibody dyeing with Fas and FasL has also confirmed equifinality.This result has been obtained checking by the result after disturbing with GADD45 β SiRNA specificity.Figure 10 shows that Fas expresses also and almost disappears after disturbing with GADD45 β specificity SiRNA, but FasL expresses no significant change.Show that synovium of joint liquid may express by raising cell Fas, activation inflammatory cell, and do not promote its FasL expression of results makes it keep active state and continues survival in the part, causes local inflammation and tissue damage.

(d) induce GADD45 β protein expression to have and raise the effect that patient's RA inflammatory factor is expressed:

In above-mentioned test, being accompanied by joint fluid stimulates mononuclearcell and CD4+T cell induction GADD45 β protein expression in RA patient's peripheral blood, the IL-12 in these cells, the up-regulated of IFN-r, and the expression of IL-10 does not have significant change.As shown in Figure 9, be added with in the cell with the synovial membrane liquid of 1: 8 dilution proportion, IL-12, TNF-α, the time that the expression of IFN-r is hatched along with cell and synovial membrane liquid increases and expresses, and peaks in the time of 24 hours.And by contrast, the expression of IL-10 does not have significant change.But, in joint fluid stimulated healthy peripheral blood when mononuclearcell and CD4+T cell induction GADD45 β protein expression, the IL-10 up-regulated in these cells, and the expression of IL-12, IFN-r does not have significant change.Prompting, normal person's mononuclearcell or CD4+T cell can be resisted role of cytokines by the synthetic IL-10 that discharges when being subjected to the stimulation of focus synovial membrane liquid, play the effect that the protection body is not subjected to the activation of synovial membrane liquid.And patient's RA mononuclearcell or CD4+T cell are very responsive to the spread effect of synovial membrane liquid, show as the synthetic rapidly inflammatory factor that discharges, the inflammatory effect of aggravation focus.This different reaction general layout, prompting patient's RA regulation and control get muddled.And the synthetic increase of inflammatory factor expression direct and GADD45 β is proportionate, and this point is confirmed in the test of GADD45 β SiRNA specificity.Figure 10 shows after disturbing with GADD45 β specificity SiRNA, inflammatory factor IL-12, and TNF-α, IFN-γ expresses reduction, and Lymphocyte Apoptosis increases.

GADD45 β albumen is and cells survival, differentiation and dead closely-related protein. especially under stress situation, many kinases in can activating cell, the ERK that comprises the MAPKs approach, P38, and JNK, regulate the retarded growth of cell, repair the damage back. and also be simultaneously the main molecules of mediation TGF-β function.Function in different cells is also inequality.In the T cell, be that mediation T cell breaks up the key molecule of secretion of gamma-IFN to Th1.Result of the present invention has confirmed this point.

Discuss: up to the present, cause of disease and the pathogenesis of RA still imperfectly understand.Except the participation of factors such as T cell, B cell and complement, in RA synovium of joint liquid, also there are many short inflammatory factors and Apoptosis inhibiting factor.They interact and form the regulated and control network of a complexity, play an important role in the formation and development of RA.Fully confirmed the importance of inflammatory factor in clinical obtained curative effect at the treatment of TNF-α.Finding out a critical inflammatory factor of keeping this regulated and control network in RA synovium of joint liquid is significant for the pathogenic process of being familiar with RA and the new treatment means of exploitation.This research has been done systematic study to GADD45 β at patient's RA expression first, and further investigation has been done in the effect between GADD45 β and other cell factor and the apoptosis of inflammatory cell.These discoveries had both helped to be familiar with the effect of GADD45 β in RA, also helped to be familiar with its effect in other inflammatory reaction.

So far because less to the research of the early activation of autoreactivity Th1 cell, people know roughly that just the T cell is activated by autoantigen and finally causes autoimmunity disease, still studies carefully its regulation mechanism and knows little about it.Controlling the autoreactive T cell activation as which albumen or controlling gene? what has caused autoreactive T cell to cause the Th1/Th2 dysequilibrium to the Th1 direction polarization? regulate what is the Th1 cell early activation factor? how are these activated T cells kept in vivo? we can not answer these problems so far.And research is answered these problems for not only the pathogenesis of illustrating RA and even autoimmunity disease being had important significance for theories, and all has important in theory meaning and using value for the target spot of seeking the RA biological therapy, the research and development of newtype drug.

Among the present invention, at first contrived experiment is estimated CD4+T cell activation in GADD45 β abnormal exprssion and RA patient's synovial membrane and the peripheral blood, the relation between differentiation and effect, and and the relation of cell factor.Be illustrated in then and induce GADD45 β albumen to cross the effect in mediation T emiocytosis IFN-γ etc. of the cell factor of expression and GADD45 β albumen in the quasi-wind gateway synovial membrane.

Result of study shows that the expression of GADD45 β albumen in patient's RA synovial membrane and periphery blood T cell significantly raises, and is relevant with the course of disease, and the expression of CD4+T cell can be used as the foundation of state of an illness judgement and prognostic evaluation than CD8+T cell height.Detecting GADD45 β expression in RA patient's peripheral blood and synovial membrane liquid in the mononuclearcell exceeds more than 8 times than the GADD45 β expression in the normal person peripheral blood.More meaningfully, because the obtaining and check more actually of peripheral blood, this monitoring for quasi-wind gateway provides may.The inflammatory factor relevant with quasi-wind gateway: IL-18 and IL-12 all increase at synovial membrane and expression of serum, and relevant with the increase level of GADD45 β albumen.More block the generation of inflammatory factor of the expression of GADD45 β albumen and its mediation and other numerous functions, providing may.

Sequence table

＜110〉Medical College, Shanghai Communication Univ.

＜120〉GADD45 β albumen and relevant cell factor thereof the application in rheumatoid arthritis

<130>demo

<160>4

<170>PatentIn?version?3.3

<210>1

<211>19

<212>RNA

＜213〉synthesize

<220>

<223>primer

<400>1

gaaggtgaag?gtcggagtc 19

<210>2

<211>20

<212>RNA

＜213〉synthesize

<220>

<223>primer

<400>2

gaagatggtg?atgggatttc 20

<210>3

<211>20

<212>RNA

＜213〉synthesize

<220>

<223>primer

<400>3

gggaaggttt?tgggctctct 20

<210>4

<211>20

<212>RNA

＜213〉synthesize

<220>

<223>primer

<400>4

tccagcgtca?tgttgcaatt 20

Claims

1. GADD45 β albumen and the purposes of relevant cell factor in rheumatoid arthritis thereof, be used to prepare the reagent of detection or auxiliary detection rheumatoid arthritis, wherein, described reagent comprises a kind of or its combination in GADD45 β albumen and cell factor, the GADD45 β albumen downstream kinases, described relevant cell factor comprises: raise effect IFN γ, the TNF α of GADD45 β expression and effective derivant IL-12 that GADD45 β expresses, IL-18.

2. utilize a kind of kit of the described purposes preparation of claim 1, it contains container and is positioned at the detection GADD45 β nucleic acid of container or the reagent of protein content, the reagent of described detection GADD45 β nucleic acid and protein content is the Oligonucleolide primers of specific amplification GADD45 β albumen or the antibody of the anti-GADD45 β of specificity albumen, described primer SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEO ID NO.4, wherein, SEQ ID NO.1, SEQ ID NO.2 are respectively the upstream and downstream primer of GAPDH; SEQID NO.3, SEQ ID NO.4 are the upstream and downstream primer of GADD45 β.

3. kit according to claim 2, it is characterized in that, contain the reagent that detects downstream kinases state, wherein said kinases is selected from ERK, P-38 and the JNK that kinases comprises MAPKs, and the reagent of described detection downstream kinases state is the antibody of the anti-phosphorylating kinase of specificity.

4. kit according to claim 2 is characterized in that, described kit also contains and detects IL-12/18, a kind of reagent of or its combined content among TNF-α or the IFN-γ.

5. utilize the method for the described purposes detection type of claim 1 rheumathritis:

The first, patient and experiment material are prepared: collect RA patient, all patients all meet the diagnostic criteria of Americanism diseases caused by dampness association; In the complete paired sample, every patient has peripheral blood, joint fluid and synovial tissue of joint, and other one group of example paired sample has joint fluid and serum, but does not contain cell; Contrast T cell and serum are from the healthy volunteer, and sex is similar to the RA group with the age; Synovial tissue is from villusectomy or arthrocsopic surgery, and tissue is cut into small pieces, and separates mononuclearcell or homogenate extracting RNA immediately; Joint fluid 3000rpm collected supernatant ℃ preservation at once-80 in centrifugal 3 minutes; Ficoll separates RA patient's joint fluid and peripheral blood gets mononuclearcell, carries out cellular incubation immediately, or is directly used in the RNA extracting;

The second, RNA extracting and quantitative PCR: with the Qiagen Rneasy Mini of company kit extracted total RNA, use the dnase digestion genomic DNA in the purifying RNA process, RNA-80 ℃ of preservation with RT kit reverse transcription RNA sample, used random primer in cDNA is synthetic; The mRNA that detects GADD45 β albumen with quantitative PCR SYBR method expresses its specific primer sequence SEQ ID NO.1, SEQ ID NO.2, SEQID NO.3, SEQ ID NO.4; Thermal cycle conditions comprise initial 50 ℃ 2 minutes, subsequently 95 ℃ 10 minutes, 2 step PCR circulations comprise 95 ℃ 15 seconds, 60 ℃ 60 seconds, 40 circulations; Data aggregation, ABI7900 does quantitative test to data; As confidential reference items, sample is quantitatively expressed multiple with GAPDH and is represented with the GAPDH gene; The multiple hole of each sample mean value is with threshold calculations and expression; Gene expression amount represents with the difference of sample CT value and confidential reference items GAPDH CT value, relative quantity express with _{The Δ Δ}CT calculates, and the gene relative expression quantity is 2 ^{-Δ Δ CT}

The 3rd, ELISA detects peripheral blood and joint fluid cell factor protein content: with the cytokine concentration in ELISA Kit detection by quantitative serum and the joint fluid; At first use the antibacterial agent mouse antibodies wrapper sheet of purifying, nonspecific binding site was sealed 1 hour with the PBS that contains 10% hyclone in the washing back, subsequently washing; Joint fluid or serum and standard items one are reinstated PBS dilution back and are added, and every part of sample is all done two multiple holes; Plate was hatched 2 hours, washed with PBS-T subsequently; The detection antibody incubation of adding biotin combination 2 hours; After the washing, add the horseradish peroxidase and 3 of Avidin combination, 3 ', 5, (3,3 ', 5,5 '-tetramethylbenzidine) colour developing detects with suitable wavelength 5 '-tetramethyl benzidine, with computer software quantitative test cytokine concentration;

The 4th, synovial tissue's single cell suspension preparation: the synovial tissue that operation is taken off puts into the complete RPMI medium that contains 10% hyclone and 1% mycillin immediately, drive mill after being cut into small pieces away, wash repeatedly with the complete RPMI medium that contains 10% hyclone and 1% mycillin, obtain single cell suspension with 70 μ m nylon net filters;

The 5th, the separating and purifying of CD4+ and CD8+T cell: with the cell collected once with the PBS washing that contains 2% hyclone (FCS), and by 1 * 10 ⁷The concentration of cell/ml is resuspended among the PBS that contains 2%FCS; Select CD2+ with Dynal beads sun then, CD4+ and CD8+T cell; After the separation, use flow cytometer, detect in these cells and contain CD2+, the ratio of CD4+ and CD8+T cell; The cell part that sun is selected is used for purity analysis, and remaining is used for extracting RNA and do PCR in real time and detect;

The 6th, T cytositimulation: RA and normal person's PBMC, magnetic bead press every hole 1 * 10 after separating T cell and CD4+T cell ⁶Individual quantity is placed on 24 orifice plates and cultivates, and cultivates with containing 10% the FBS and the RPMI 1640 of 100U/ml penicillin and streptomysin; Use again in the stimulation test of RA-SF, in nutrient solution, add RA-SF, with dilution in 1: 8; During use, all RA-SF will use the filtrator degerming; Cell is at 37 ℃, 5%CO ₂Incubator in cultivate after 2,4,8,16,24 hours and to collect; Do the real-time quantitative PCR analysis behind the cell harvesting; In blocking experiment, the monoclonal antibody of anti-people IL-12 and homotype control antibodies are added in the nutrient solution of the PBMC that stimulates with SF with the concentration of 10 μ g/ml; Handle according to process recited above then;

The 7th, specificity SiRNA interference test, disturb with GADD45 β specificity SiRNA pair cell: (human peripheral blood mononuclearcells is PBMC) with after the GADD45 β specificity SiRNA transfection with people's mononuclearcell of fresh separated, at 37 ℃, 5%CO ₂Cultivated 5-7 hour in the incubator, add then to contain isopyknic 20%FBS and contain antibiotic 1640 nutrient solutions and continue to cultivate 24-48 hour.Get cultured cells and do real-time quantitative PCR, detect effects of jamming;

At last, the difference condition of gene expression adopts the Mann Whitney U test analysis between each group, and the P value has significant difference less than 0.05 expression.

6. a kind of method of screening treatment rheumatoid arthritis and anti-tumor drug of utilizing claim 1 to set up is characterized in that, comprises step:

(a) set up experimental group and control group, described experimental group is made of 2-50 non-human mammal rheumatoid arthritis model, and control group is made of 1-50 non-human mammal rheumatoid arthritis and model, and does not use candidate substances for control group;

(b) candidate substances is applied to experimental group, and the level of GADD45 β nucleic acid and albumen in the observation experiment treated animal, and compare with GADD45 β nucleic acid and albumen in the animals of control group, wherein compare in the experimental group animal GADD45 β nucleic acid and protein level and descend and be not less than 30%, just represent that this candidate substances is the medicine of potential treatment rheumatoid arthritis with control group.

7. method according to claim 6 is characterized in that wherein comparing with control group in the experimental group animal GADD45 β nucleic acid and protein level and descends and be not less than 50%, just represents that this candidate substances is the medicine of preferable treatment rheumatoid arthritis.

8. method according to claim 6 is characterized in that wherein comparing with control group in the experimental group animal GADD45 β nucleic acid and protein level and descends and be not less than 60%, just represents that this candidate substances is the medicine of better treatment rheumatoid arthritis.

9. method according to claim 6 is characterized in that wherein comparing with control group in the experimental group animal GADD45 β nucleic acid and protein level and descends and be not less than 70%, just represents that this candidate substances is the medicine of best treatment rheumatoid arthritis.

10. method according to claim 6, it is characterized in that, the expression that in step (b), also comprises GADD45 β albumen in further comparative experiments treated animal and the control group albumen or IL-12, described GADD45 β albumen downstream kinases is selected from ERK, P-38 and the JNK of MAPKs approach, wherein compare kinase activation level or IFN-γ in the experimental group animal with control group, or the IL-12 level descends and to be not less than 30%, just represents that this candidate substances is the medicine of potential treatment rheumatoid arthritis.