CN101091798A - Application of meaning inversed miRNA-210 - Google Patents
Application of meaning inversed miRNA-210 Download PDFInfo
- Publication number
- CN101091798A CN101091798A CN 200710039543 CN200710039543A CN101091798A CN 101091798 A CN101091798 A CN 101091798A CN 200710039543 CN200710039543 CN 200710039543 CN 200710039543 A CN200710039543 A CN 200710039543A CN 101091798 A CN101091798 A CN 101091798A
- Authority
- CN
- China
- Prior art keywords
- mirna
- cell
- chip
- gene
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to an application of RNA small molecule, specially, it relates to an application of antisense miRNA-210, belonging to the field of biomedical material technology. Said invention adopts miRNA chip to research expression condition of three cerebroglioma miRNAs, and utilizes the methods of Northern and q-PCR to make verification of chip results of 9 cerebroglioma samples and 4 cerebroglioma cell strains. The results show that the antisense miRNA-210 can obviously reduce invasiveness of human cerebroglioma cell strain.
Description
Technical field
The present invention relates to the micromolecular purposes of a kind of RNA, especially relate to the application of antisense miRNA-210, belong to technical field of biomedical materials.
Background technology
In recent years, to people's cell, extensively there is a kind of noncoding single stranded RNA micromolecule (microRNA from plant, nematicide, miRNA), they can interact with 3 ' untranslated end specific region of incomplete complementary mode and its said target mrna, Profilin matter synthetic.The classical cloning process of employing such as Lee had been cloned the lin-4 gene first in nematicide in 1993, confirmed the existence of microRNA by the method for point mutation.Reinhart in 2000 etc. have found the existence of let-7 gene in people and fruit bat, may be that class evolution is upward conservative so infer this micromolecular, the adjusting molecule that plays an important role in life process.People have found more than 1,000 miRNA gene in plant, nematicide, fruit bat and mammal subsequently.It is that important vital functions action message is being contained in the nonhistones coding region of genome that the research of little RNA brings important inspiration to us.The growth promoter of existing some key activitiess that studies show that life such as larva, the generation of cell and differentiation, neural differentiation etc. are all by the regulation and control of the little RNA of some non-encoding histones; And the little RNA except that miRNA, siRNA we know little about it especially.For a long time, the research emphasis of related gene is all on protein coding gene, and the discovery of little RNA and research is to disclosing the expression of gene regulatory mechanism, and the secret of the understanding life that let us is more deep has great scientific value undoubtedly.
According to statistics, miRNA accounts for 1% quantity in human genome, has significant difference at different space-time stage of development expressions.(Ambros V, Bartel B, Bartel DP such as Bartel, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, Matzke M, Ruvkun G, Tuschl T.) propose, because miRNA is different with the complementary degree of said target mrna, plays cutting or faint inhibitory action.Because the number of its action target spot, miRNA expression are also different, by biochip technology, can detect the situation of all miRNA spatial and temporal expressions simultaneously.On this basis, seek the miRNA target gene, disclosing its mechanism of action is the emphasis of studying at present, also is one of problem that need solve the genome times afterwards comprehensively.All the announcement of miRNA gene functions may bring a deepgoing revolution to the understanding of biosis to people.
Effect research in body growth growth and tumor development process had accumulated a large amount of data about miRNA in recent years.Studies show that miRNA dies in cell growth and accent, the hemocyte differentiation, neuronic polarity, insulin secretion, the brain form forms, and heart takes place, and brings into play significant role in the processes such as late embryogenesis growth.And miRNA sudden change or ectopic expression are relevant with multiple human cancer, have the effect of tumor suppressor gene or oncogene.A miRNA expression decline or a disappearance that plays the tumor suppressor gene effect can cause tumor to form.Ripe miRNA level descend the expression that causes unsuitable target protein may cause cell hyperproliferation, intrusion, decrease of apoptotic cells, can not normal differentiation or dedifferente, cause the formation of tumor.Crossing of miRNA with oncogene function expressed the formation that also will cause tumor, in glioblastoma multiforme, express the increase expression doubly as miRNA-21 than the high 5-100 of normal structure, miRNA-155 precursor, miRNA-15, miRNA-16 also unconventionality expression in malignant lymphoma.
Cerebral glioma is derived from neuroepithelium, also claims glioma, accounts for the 40-50% of intracranial tumour, is modal intracranial malignant tumor.The topmost biological characteristics of glioma is the final position propagation of cerebral tissue and constantly breeds, and can be divided into astrocytoma, medulloblastoma, multiform glue blastoma, ependymoma, few branch glue blastoma etc. again according to pathology.At present, the epidemiology and the etiology of the cerebral tumor still imperfectly understand, but formation that evidence suggests glioma may be relevant with certain interior environment change and genovariation, is the collaborative cumulative process that multifactor, a multiple oncogene that multistep is rapid and/or antioncogene participate in.The male is more than the women in morbidity, mostly in 20-50 year morbidity, 30-40 year to see that left and right sides child was another high-incidence season in 10 years old more.The growth characteristic of glioma is infiltrative growth, there is not obvious boundary with normal cerebral tissue, majority is not limited to a cerebral lobe, is finger-like and deeply destroys cerebral tissue outside cerebral tissue, optimum partially person's poor growth, the course of disease is longer, from symptom occurring to consultation time average 2 years, pernicious person's tumor bulk-growth is fast, and the course of disease is short, majority is within 3 months when occurring symptom to prescription on individual diagnosis, and 70-80% is many within half a year.(Chan JA, Krichevsky AM and Kosik KS.MicroRNA-21 Is anAntiapoptotic Factor in Human Glioblastoma Cells.Cancer Res 2005 such as Chan; Studies show that 65:6029-6033), glioblastoma multiforme strong expression miRNA-21.Compare with the non-tumor cell of non-tumor embryo, adult brain tissue and cultivation, miRNA-21 significantly raises in the expression of human glioblast tumor tissue and six glioma cell lines (A172, U87, U373, LN229, LN428 and LN308).Studies show that miRNA-2 1 expresses the activation that has caused caspases at the inhibition of the glioblastoma cell line of cultivating, and then apoptotic cell death increases.These results show, by suppressing the crucial gene expression relevant with apoptosis, the miRNA-21 of unconventionality expression may with cause the malignant tumor phenotype relevant.Ciafre (Ciafre SA, Galardi etal, Extensive modulation of a set of microRNAs in primary glioblastoma, BBRC, 2005,1351-1358) etc. employing miRNA chip (containing 245 people and Mus miRNA probe) the analysis showed that to 9 routine glioblastoma multiformes and 10 kinds of colloid blastoma cell strains miRNA-221 significantly raises in glioblastoma multiforme, and rich miRNAs in one group of brain, as miRNA-128, miRNA-181a, miRNA-181b, miRNA-181c then in glioblastoma multiforme expression significantly reduce.
Because the miRNA sequence has certain conservative in different biologies, the function that generally believes miRNA at present is some basic processes that participate in life, as the cell proliferation in the growth course, cell death, stress and lipid metabolism etc.Tumor is that a kind of hereditary material changes the malignant disease that causes, and it seriously threatens human beings'health.In order to study the miRNA molecule that participates in tumor, will determine that at first miRNA expresses and expression actually in those tumor cells or tissue.Further disclose the biological function that the miRNA of unconventionality expression is risen on this basis in tumor cell.But up to the present also there is not reported in literature about the purposes of antisense miRNA-210 as the medicine of preparation treatment human glioma cell line invasion and attack.
Summary of the invention
The objective of the invention is to provide the new purposes of antisense miRNA-210 by the miRNA chip technology.
The invention provides the purposes of antisense miRNA-210 as the medicine of preparation treatment human glioma cell line invasion and attack.
Though the existing report of the expression study of miRNA in glioblastoma multiforme, miRNA chip of the present invention have been integrated the miRNA probe of 476 people and Mus, 254 miRNA number of chips that adopt more than Ciafre in 2005 etc. are many.The present invention adopts to use the same method a large amount of Rhesus Macacus cerebral tissue and human nerve stem cell is carried out comparative study, help to seek characteristics and the rule of age correlated expression miRNA gene in cerebral tumor generation evolution, for protein science research provides more profound research data.The present invention has adopted the miRNA chip research three routine cerebral glioma miRNA expressions, and with methods such as Northern and q-PCR chip results is verified 9 routine cerebral glioma samples and four strain brain glioblastoma cells.The present invention also buys from Ambion company has the normal cerebral RNA of people (the total RNA biased sample of Adult Human Brain) in contrast.Result of study of the present invention shows that miRNA-210 is high expressed in cerebral glioma not only, also high expressed in human nerve stem cell.For the proofing chip testing result, the present invention adopts Northern and q-PCR method that The above results is verified.The present invention adopts the q-PCR method further to prove conclusively miRNA-210 and be high expressed in the human glioma histiocyte on the basis that Northern analyzes.Next has inquired into whether miRNA-210 has the human glioma cell of promotion effect of apoptosis as miRNA-21, and regrettably the research result shows that antisense miRNA-210 effect in this respect is not remarkable.Once more, the present invention adopts Invasion Assay kit (cell invasion detection kit) that U251 and two kinds of cell lines of TJ905 are tested, and found that antisense miRNA-210 can significantly reduce the invasive ability of human glioma cell line.Respectively organize the miRNA quantitative PCR and the Northern checking of cell after the transfection.On this basis, the present invention adopts traditional wound assay, has verified that further antisense miRNA-210 has the effect of remarkable reduction human glioma cell invasion and attack.
Description of drawings
Fig. 1 .miRNA chip hybridization figure
Fig. 2 .miRNA chip analysis cluster result.A shows miRNA cluster general status.B is presented at the miRNA of remarkable high expressed in the cerebral glioma.C is presented at the miRNA that significantly reduces in the cerebral glioma.
Fig. 3. adopt Northern and miRNA quantifying PCR method to detect the expression of miR-210 in cerebral glioma.Quantitative PCR finds that the normal matched group (NHB1-3) of copy number (glioma sample 1-3) in cerebral glioma of miR-210 significantly increases (A).Compare with the meansigma methods of cancer beside organism, the copy number of miR-210 in cerebral glioma increases 2.00 ± 0.10 times, expresses and significantly raises (B).More glioma sample and cancer beside organism are carried out the Northern analysis result further confirm the reliability of chip results (C).
Fig. 4. the cell invasion experiment shows that antisense miRNA-210 can significantly reduce the invasive ability of human glioma cell line.Compare with normal control group (U251NC and TJ905NC) and base mispairing sequence set (U251SC and TJ905SC), antisense miRNA-210 can significantly suppress the invasion and attack effect (A) of brain glioblastoma cell.Quantitative PCR and the synthetic miRNA nucleotide of Northern calibrating cell transfecting result.
The specific embodiment
1.RNA extracting: every 100mg tissue adds 1ml Trizol, fully grinds piece of tissue with liquid nitrogen grinding.The chloroform that adds about 1/5 volume turned upside down abundant mixing about 1 minute, left standstill under the room temperature 5 minutes.4 ℃, 12,000rpm carefully shifts supernatant and goes into new 1.5ml centrifuge tube after centrifugal 15 minutes, add isopyknic isopropyl alcohol, puts upside down mixing gently, and room temperature left standstill 10 minutes.4 ℃, 12000rpm removes supernatant after centrifugal 10 minutes, adds 70% ethanol of 2/5 volume in precipitation, and 4 ℃, 12000rpm centrifuge washing precipitation 5 minutes.Remove supernatant, the water that the precipitation room temperature is dried an amount of no RNA enzyme of back adding fully dissolves, and measures OD260 and OD280 value.Adopt the DNA enzyme I of no RNA enzyme to handle, the total RNA of QIAGEN RNeasy test kit purification, detail operations principle and method are seen the test kit description.The total RNA quality of agarose gel electrophoresis evaluation, is taken pictures at observation on the gel imaging instrument, preserves image, it is generally acknowledged 28S: 18S 〉=2 are can the total RNA quality of preliminary judgement better.
2.MicroRNA the preparation of chip: at first obtain the sequence of preparation miRNA probe, comprising 313 people's and the probe sequence of 34 mices miRNA sequence correspondence from miRNA information registration website http://microrna.sanger.ac.uk (2005.09).Simultaneously, we also are published in XIE article (the Xie X on the Nature in 2005, Lu J, Kulbokas EJ, et al.Systematic discovery of regulatory motifs in humanpromoters and 3 UTRs by comparison of several mammals[J] .Nature, 2005,434 (7031): the probe of the miRNA correspondence 338) in mentioned 122 predictions also is incorporated into wherein, has finally concentrated the probe of 469 kinds of different miRNA correspondences on our miRNA chip.In order to realize the quality control to the chip experimentation, the present invention is provided with feminine gender and positive control on chip.We have designed two kinds negative control, and a kind of is blank point sample liquid; Another is exactly the RNA that does not mix the Y2 correspondence, so Y2 is exactly an only negative control.The hybridization signal of negative control expection is very weak, and their signal value is not enough to enter in the middle of the follow-up data analysis.Positive control is divided into three kinds:
(1) immobilization positive control: 5 '-GTCACATGCGATGGATCGAGCTCCTTTATCATC-3 '.When the last detection of chip experiment results of hybridization, this sequence should have stronger fluorescence signal under the excitation wavelength of cy3, and the sweep signal value shows that more than 8000 the nucleic acid on the chip fixedly is no problem.
(2) Za Jiao positive control: we have selected to organize endogenous, RNA base length about 100nt U6 and tRNA as the endogenous positive control of miRNA chip; The probe sequence of U6 correspondence is: 5 '-ATTTGCGTGTCATCCTTGCG-3 '; The probe sequence of tRNA correspondence is 5 '-GGGTTATGGGCCCAGCACGCTTCCGCTGCGCCACTCTGCT-3 '; Their hybridization signal also should generally all surpass 5000 signal values than higher.
(3) positive control of chip system: for fear of the interference that is subjected to testing the RNA sample, on chip, also have and the laboratory sample nucleotide sequence that it doesn't matter, to check the effectiveness of chip system.The present invention calls external standard (exogenous controls) to this contrast.On the miRNA chip, the present invention has designed 8 does not have the oligonucleotide sequence of homology as external standard with all RNA sequence, and name and sequence see the following form.Through blast relatively, these 8 nucleotide sequences and people's full gene sequence does not have homology.The present invention has synthesized the RNA sequence (20-30nt) of the similar miRNA of length of these 8 probe correspondences with the miRNA Probe Construction kit (Cat#.1550) of Ambion company, in reaction, be incorporated in the RNA sample of actual detected then and go, together carry out the chip reaction experiment.According to the difference of mixing the RNA amount, these outer punctuates can present different hybridization signals; Except Y2, general signal value is all more than 5000.The positive control of chip system sees Table 1.
The positive control of table 1. chip system
ID | sequence(5′-3′) |
Zip23 | CAGCATCGGACCGGTAATCGGACC |
Zip5 | GACCACCTTGCGATCGGGTACAGC |
Zip15 | GACCGGTATGCGACCTGGTATGCG |
Zip13 | CAGCGGTAGACCACCTATCGTGCG |
Zip21 | TGCGATCGCAGCGGTAACCTGACC |
Zip25 | GACCATAGTGCGGGTAGGTAGACC |
Y2 | AGGTACGAAACGCTAAGAAT |
Y3 | CATTCCTAAACGGGCTGAT |
3.miRNA chip detection: the RNA sample preparation that is used for the miRNA chip detection uses the Trizol method for extracting to obtain total RNA earlier, mirVana miRNA isolation kit (catalog#1560) test kit that re-uses Ambion company carries out purification to sample, removal accounts for the big fragment of total RNA main component, stays the small fragment part that comprises miRNA.Concrete purification step sees the test kit service manual for details.The miRNA chip detection is carried out according to a conventional method.
4. bioinformatic analysis: because microRNA studies by the means of gene chip, so both are illustrated side by side.At first, the chip that adopts is Affymetrix U133 Plus 2.0array, this chip is maximum a kind of of covering gene number in the present like product: on a chip, covered 47,000 transcripts, represent 38,500 distinct human genes are from following public database GenBank, dbEST, the gene of and RefSeq. 6,500 renewals wherein is from up-to-date data base: Build 159 of the UniGene database (on January 25th, 2003).U133 mainly is applicable to research expression of gene situation and understands the network of gene performance function.Comprise 1) tissue specificity and the cell-specific of gene expression; 2) inducible gene expression spectrum research; 3) gene expression differentiation and 4) tumor express spectra research.In the result of gene chip, adopt the method for T-Test to come significant difference between testing data in the hope of its credibility, whether have the age specificity and try to achieve some protein expression, use the cluster3.0 program to carry out cluster analysis with the method that the data in all ages and classes stage are compared in twos.
5.Northern blotting analyzes: use total RNA of Trizol extracting cultured cell or tissue, quantitatively also quality inspection.Get the total RNA of 30-50ug and carry out denaturing polyacrylamide gel electrophoresis, gel strength is 15%.Carry out electricity after electrophoresis finishes and change film, sample is gone on the positively charged nylon membrane.The probe of the miRNA correspondence that will detect is carried out end labelling with isotope, and hybridize with film under optimum conditions.After finishing, hybridization carries out tabletting scanning.Hybridize with the probe and the film of U6 gene again, obtain the hybridization signal of U6, and with this criterion as applied sample amount.Use imaging system to read intensity of hybridization signal at last, respectively organize the difference of different sample rooms.
6.qPCR the qPCR of detection method: miRNA detects the Trizol extracted total RNA of using invitrogen, quantitatively also quality inspection.Getting the total RNA of 50-100ng is template, uses at the reverse transcriptase primer of specific miRNA and the synthetic cDNA of SuperScript III First-Strand Synthesis System test kit of invitrogen.With cDNA is template, uses SYBR (R) the Premix Ex TaqTM quantitative fluorescent PCR system at PCR primer and the Takara of target miRNA, increases on stratagen MX3000P quantitative PCR instrument, and records the Ct value of sample.With the formula that gained Ct value draws by substitution bioassay standard curve, the computational methods of employing absolute quantitation draw the content of the target miRNA in the sample.The U6 gene carries out standardization as interior photograph to miRNA qPCR testing result and proofreaies and correct.QPCR for the target gene in the prediction detects the Trizol extracted total RNA of using invitrogen, quantitatively also quality inspection.Getting the total RNA of 3ug is template, is primer with the random oligonucleotide, uses the synthetic cDNA of SuperScript III First-Strand Synthesis System test kit of invitrogen.With cDNA is template, uses at the special primer of target gene and the SYBR of Takara (R) Premix Ex TaqTM quantitative fluorescent PCR system, increases on stratagen MX3000P quantitative PCR instrument, and records the Ct value of sample.Measure the Ct value of the house-keeping gene (as: B-actin, GAPDH) in the testing sample simultaneously, proofread and correct with this and respectively organize applied sample amount difference between the sample, will compare the variation (being the relative quantification method) of genes of interest between each group behind the gained data normalization.
7. cell culture: glioblastoma cell TJ905 (by General Hospital of Tianjin Medical Univ.'s neurosurgery present) cultivates in the high sugared DMEM culture medium that contains 10%FBS (Lanzhou Min Hai), people's glioblastoma multiforme U251MG (available from Shanghai Chinese Academy of Sciences cell bank) cultivates in the RPMI1640 culture medium that contains 10%FBS (Lanzhou Min Hai), put 37 ℃ of incubators, 5%CO2, went down to posterity once in 2 days.People's glioblastoma multiforme SHG-44 (available from Shanghai Chinese Academy of Sciences cell bank) cultivates in the RPMI1640 culture medium that contains 10%FBS (Lanzhou Min Hai), puts 37 ℃ of incubators, 5%CO2, goes down to posterity once in 2 days.Human neuroblastoma SH-SY5Y (ATCC number: available from Shanghai Chinese Academy of Sciences cell bank) cultivates in the MEM-F12 culture medium that contains 15%FBS (Lanzhou Min Hai), puts 37 ℃ of incubators, 5%CO2, goes down to posterity once in 3-4 days.
8. cell transfecting: the methoxyl group oligonucleotide is by the chemosynthesis of Shanghai Ji Ma company, and the microRNA precursor is available from (the Ambion Pre-mir of U.S. Ambion company
TMMiRNA precursor CaU No.17100), the normal control group is established in transfection altogether, miRNA precursor group, miRNA antisense strand group (anti sense), miRNA base mispairing sequence set (scramble) and the general negative control group of miRNA (EGFP).To 70%-80% fusion beginning transfection, agents useful for same is Lipofectamine 2000 (Invitrogen) to cell behind bed board 18-24h.Transfection is carried out by this chamber conventional method and with reference to description.The working concentration of oligonucleotide is 50nmol/L.DDR1 siRNA group and the general negative control group of siRNA (Negative).To 70%-80% fusion beginning transfection, agents useful for same is Lipofectamine 2000 (Invitrogen) to cell behind bed board 18-24h. concrete transfection method carries out with reference to description, and the working concentration of oligonucleotide and siRNA is 50nmol/L.The used nucleotide sequence of cell transfecting sees Table 2.
The used nucleotides sequence tabulation of table 2. cell transfecting
miRNA | Sequence 5’-3’ |
antisense hsa-mir210 | UCAGCCGCUGUCACACGCACAG |
scrambled hsa-mir210 | AGAACGCGCUAUCUCGCACGCC |
EGFP antisense | ACGGCAAGCUGACCCUGAAGU |
9. cell migration experiment: get aseptic 12 orifice plates, glioblastoma cell TJ905 cultivates in containing the high sugared DMEM culture medium of 10%FBS, people's glioblastoma multiforme U251MG cultivates in containing the RPMI1640 culture medium of 10%FBS, puts 37 ℃ of incubators, 5%CO2, goes down to posterity once in 2 days.Behind the transfection miRNA 24h, mark two decussation cells with the 200ul suction nozzle and strike off band.Beginning observed and recorded experimental result behind the transfection miRNA 48h.
10. cell invasion experiment: the experiment used kit is QCM
TMCollagen Cell Invasion Assay kit (Chemicon Cat.#ECM551).Transfection inoculating cell the previous day is cultured to 80% in 6 orifice plates and converges, after the transfection with cell in serum-free medium hungry 18-24 hour.Also use the DMEM cessation reaction that contains 5%BSA with 0.25% trypsin digestion cell.Be resuspended in behind the cell centrifugation (0.5 * 106 cells/mL) among the DMEM that contains 5%BSA.250ul cell suspension is added in the last chamber of Boyden cell, following chamber adds the DMEM that 500ul contains 10%FBS, and 37C incubator 5%CO2 cultivates.Behind the 48h cell is immersed dyeing 20min and rinsing in the 400ul cell dye liquor, wipe the cell on microporous membrane upper strata, afterwards film is cut imaging under 200 power microscopes with cotton swab.To react 10min in the Merlon microporous filter membrane immersion dyestuff extracting solution, 100ul cell dye liquor changes ELISA Plate over to and reads light absorption value at the 560nm place.
11.Caspase-3/7 enzymatic activity detects: cell inoculation in 96 orifice plates, is cultivated, carried out transfection experiment, cultivated 48 hours.Adopt Apo-ONE
TMHomogeneous Caspase-3/7kit (Promega Cat No.G7790) test kit, the by specification operation.With caspase substrate and Apo-ONE
TMCaspase3/7 buffer mixes, and is made into Apo-ONE
TMReagent.Press Apo-ONE
TMReagent and culture volume ratio are that 1: 1 ratio adds Apo-ONE
TMReagent, 300rpm-500rpm shook 30 seconds at least, made Apo-ONE
TMThe abundant mixing of reagent and culture medium.Use spectrofluorophotometer under excitation wavelength 485 ± 20nm and emission wavelength 530 ± 25nm condition, to read the OD value.The Caspase3 enzymatic activity detects the activity that also can utilize chemoluminescence method (Calbiochem, Cat No.235400).Cell counting is collected cultured cell, and PBS washes twice.Add an amount of lysis buffer, liquid nitrogen/37 ℃ multigelation three times, each 5 minutes.10,000xg, 4 ℃ are centrifugal 10 minutes.The absorption supernatant is standby.Prepare caspase3 substrate solution (2mM, Calbiochem, Cat No.235400)), caspase3 inhibitor solution (500nM) adds sample, the by specification operation according to the amount of following form in 96 orifice plates., 37 ℃ of preheating ELISA Plate, add cell pyrolysis liquid and caspase3 inhibitor, place 37 ℃ to hatch 10 minutes.Add 10ul caspase3 substrate and begin reaction, under 405nm, survey the OD value after 0.5-2 hour.
12. western blot analysis: in sample, add lysate, place the liquid nitrogen multigelation for several times after, ultrasonic more thorough broken sample, centrifugalize goes out protein, and the protein sample of obtaining is carried out quantitatively.In protein sample, add sample-loading buffer, boil 3-5 minute after, carry out sds polyacrylamide gel electrophoresis, constant current 20mA.After treating that the forward position indicator is run out of gel just, stop electrophoresis, change film.After going to sample on the film, hatch jointly with the proteic monoclonal antibody that will study again, finally develop the color, obtain the trace signal.Be reference with beta-actin simultaneously, signal carried out standardization proofread and correct that read output signal density in imaging system is further analyzed afterwards.
The present invention finds that the overexpression of miRNA-210 is remarkable.On the basis of chip analysis, adopt Northern, the q-PCR method is further proved conclusively miRNA-210 and be high expressed in the human glioma histiocyte.The present invention adopts Invasion Assay kit (cell invasion detection kit) that U251 and two kinds of cell lines of TJ905 are tested, and found that antisense miRNA-210 can significantly reduce the invasive ability of human glioma cell line.Adopt woundassay, verified that further antisense miRNA-210 has the effect of remarkable reduction human glioma cell invasion and attack.Aggressive and transitivity are the topmost biological characteristicses of cancerous cell, also are the important symbols of malignant tumor.Above-mentioned experimental result proof miRNA-210 can be used as the invasion and attack effect that a kind of oncogene promotes human glioma cell.
Claims (1)
1. antisense miRNA-210 is as the purposes of the medicine of preparation treatment human glioma cell line invasion and attack.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200710039543 CN101091798A (en) | 2007-04-17 | 2007-04-17 | Application of meaning inversed miRNA-210 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200710039543 CN101091798A (en) | 2007-04-17 | 2007-04-17 | Application of meaning inversed miRNA-210 |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101091798A true CN101091798A (en) | 2007-12-26 |
Family
ID=38990354
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200710039543 Pending CN101091798A (en) | 2007-04-17 | 2007-04-17 | Application of meaning inversed miRNA-210 |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101091798A (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102140466A (en) * | 2010-12-30 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR-1825 antisense nucleic acid and application thereof |
CN102140463A (en) * | 2010-04-29 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR (microRNA)-1296 antisensenucleic acid and application thereof |
CN102140469A (en) * | 2010-12-30 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR (microRNA)-1233 antisensenucleic acid and application thereof |
CN102080086B (en) * | 2009-12-01 | 2012-12-26 | 中国科学院上海药物研究所 | Human miR-133a antisense nucleic acid and application thereof |
CN102080083B (en) * | 2009-12-01 | 2013-02-27 | 中国科学院上海药物研究所 | Human miR-149 antisense nucleotide and application thereof |
CN103740809A (en) * | 2013-11-14 | 2014-04-23 | 上海交通大学 | miR-218 mimetic and application thereof, and method for screening drugs capable of inhibiting glioma cell migration and invasion |
CN113795580A (en) * | 2019-01-18 | 2021-12-14 | 旗舰创业股份有限公司 | TREM compositions and uses thereof |
-
2007
- 2007-04-17 CN CN 200710039543 patent/CN101091798A/en active Pending
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102080086B (en) * | 2009-12-01 | 2012-12-26 | 中国科学院上海药物研究所 | Human miR-133a antisense nucleic acid and application thereof |
CN102080083B (en) * | 2009-12-01 | 2013-02-27 | 中国科学院上海药物研究所 | Human miR-149 antisense nucleotide and application thereof |
CN102140463A (en) * | 2010-04-29 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR (microRNA)-1296 antisensenucleic acid and application thereof |
CN102140466A (en) * | 2010-12-30 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR-1825 antisense nucleic acid and application thereof |
CN102140469A (en) * | 2010-12-30 | 2011-08-03 | 苏州吉玛基因股份有限公司 | Human miR (microRNA)-1233 antisensenucleic acid and application thereof |
CN102140466B (en) * | 2010-12-30 | 2013-03-27 | 苏州吉玛基因股份有限公司 | Human miR-1825 antisense nucleic acid and application thereof |
CN102140469B (en) * | 2010-12-30 | 2013-04-10 | 苏州吉玛基因股份有限公司 | Human miR (microRNA)-1233 antisensenucleic acid and application thereof |
CN103740809A (en) * | 2013-11-14 | 2014-04-23 | 上海交通大学 | miR-218 mimetic and application thereof, and method for screening drugs capable of inhibiting glioma cell migration and invasion |
CN113795580A (en) * | 2019-01-18 | 2021-12-14 | 旗舰创业股份有限公司 | TREM compositions and uses thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Li et al. | microRNA expression profiling of nasopharyngeal carcinoma | |
CN102439169B (en) | Compositions and methods for micro-rna expession profiling of colorectal cancer | |
Boštjančič et al. | MicroRNA microarray expression profiling in human myocardial infarction | |
CN101091798A (en) | Application of meaning inversed miRNA-210 | |
Meng et al. | Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines | |
Li et al. | Identification of new aberrantly expressed miRNAs in intestinal-type gastric cancer and its clinical significance | |
Zhang et al. | Global changes of mRNA expression reveals an increased activity of the interferon-induced signal transducer and activator of transcription (STAT) pathway by repression of miR-221/222 in glioblastoma U251 cells | |
EP2391738B1 (en) | Methods of detecting sepsis | |
CN101316935B (en) | Chip for esophagus cancer diagnosis | |
Guo et al. | Identification of miRNAs that are associated with tumor metastasis in neuroblastoma | |
Wang et al. | Focus on RNA isolation: obtaining RNA for microRNA (miRNA) expression profiling analyses of neural tissue | |
Steudemann et al. | Detection and comparison of microRNA expression in the serum of Doberman Pinschers with dilated cardiomyopathy and healthy controls | |
KR20120041168A (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
Tian et al. | Simultaneously sensitive detection of multiple miRNAs based on a strand displacement amplification | |
CN102475892A (en) | Application of anti-sense miRNA (Ribonucleic Acid)-210 to preparation of anti-cancer drug | |
CN105018603A (en) | Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection | |
Yu et al. | Functional significance and therapeutic potential of miRNA-20b-5p in esophageal squamous cell carcinoma | |
Kiani et al. | MicroRNA expression in infertile men: its alterations and effects | |
CN108699603A (en) | Composition and method for diagnosing and treating fracture and osteopathy | |
CN103343167B (en) | Screening and identifying method of SCA3/MJD molecular marker miRNAs capable of regulating and controlling ATXN3 gene expression | |
CN101088565A (en) | Use of miRNA-34a | |
CN104975019B (en) | Application of the finger-print of tiny RNA composition in human ovarian cancer diagnosing and treating | |
US8895525B2 (en) | Preventing hyaluronan-mediated tumorigenetic mechanisms using intronic RNAs | |
Weng et al. | Angiogenin promotes angiogenesis via the endonucleolytic decay of miR-141 in colorectal cancer | |
CA2725477A1 (en) | Methods for assessing colorectal cancer and compositions for use therein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20071226 |