CN101091794A - Composition in use for preventing and treating metastatic tumor - Google Patents

Composition in use for preventing and treating metastatic tumor Download PDF

Info

Publication number
CN101091794A
CN101091794A CN 200610086817 CN200610086817A CN101091794A CN 101091794 A CN101091794 A CN 101091794A CN 200610086817 CN200610086817 CN 200610086817 CN 200610086817 A CN200610086817 A CN 200610086817A CN 101091794 A CN101091794 A CN 101091794A
Authority
CN
China
Prior art keywords
tumor
light
cell
nucleic acid
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200610086817
Other languages
Chinese (zh)
Inventor
傅阳心
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biochain Beijing Science and Technology Inc
Original Assignee
Biochain Beijing Science and Technology Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biochain Beijing Science and Technology Inc filed Critical Biochain Beijing Science and Technology Inc
Priority to CN 200610086817 priority Critical patent/CN101091794A/en
Publication of CN101091794A publication Critical patent/CN101091794A/en
Pending legal-status Critical Current

Links

Images

Abstract

The present invention discloses a method for immunologically preventing and curing metastatic tumor and its medicine composite, in particular, it relates to a method for raising immunity of liver tissue and/or preventing or curing liver elementary body infection and its medicine composite. Said medicine composite contains immunocytoactivator, optimally, the described immunocytoactivator is LIGHT polypeptide or its variant or their coded nucleic acid.

Description

Be used to prevent and treat the compositions of metastatic tumo(u)r
With application number be 200510055009.3 hereby, the applying date is on March 14th, 2005, the application people is incorporated herein for the full content of the Chinese invention patent application original application file of " by suction effect T cell and consume regulatory T cells treatment cancer " for Fu Yangxin, denomination of invention.
Technical field
The application relates generally to cancer prevention and treatment field, relates more specifically to be used for the method and composition of cancer (particularly metastatic tumo(u)r) immunoprophylaxis and treatment.
Background technology
The radiotherapy of tumor and chemotherapy can not be removed tumor cell fully, have also damaged immune system simultaneously.Remaining tumor cell (comprising metastatic tumour) has often finally been captured patient's life.Immunization therapy provides the optimal method of removing remaining tumor fully, but tumor is often activated the not enough immune attack of escaping because of immune system by tumor antigen.The not enough reason of immune activation is that immunocyte immerses the tumor cell deficiency, or lacks enough strong to soaking the activation signals of Run tumor lymphatic cell.Increase T lymphocyte usually brings good prognosis to the infiltration of tumor.The immunity that how to increase tumor becomes the removing tumor and don't damages immune key.
Metastatic disease is the main cause of cancer pathogenicity rate and mortality rate, although and the great efforts of paying aspect improving at therapeutic outcome through many decades, its malignant tumor remains main medical challenge.The potential scheme that becomes the metastatic tumo(u)r of elimination distribution likely of immunization therapy, especially in early days.Yet the standard strategy of carrying out chemotherapy or radiotherapy at present after ocal resection may hinder the potential benefit of immunization therapy unintentionally.Although excision can suitably be removed the impregnable tumor mass of having set up, yet follow this, the main source of tumor antigen will disappear, thereby may reduce the probability and the effectiveness of immunne response, because very few metastatic tumo(u)r may not make CTL sensitization.Chemotherapy/the radiotherapy that reduces tumor load may destroy the tumour-specific CTL of previous generation unintentionally and suppress new and produce antineoplastic CTL, and inducing tolerance possibly.How to reach suitable balance between present therapeutic scheme and related immune treatment, be the main challenge of eradicating the metastatic tumo(u)r of scattering always.
Active immunity strategy that the tumour-specific T cell of present use amplification in vitro carries out and adoptive transfer treatment depend on the understanding to given tumor antigen largely.These treatments can be used the cancer patient who has the characteristic tumor antigen of limited quantity, but but invalid often when occurring that antigen is lost variant (this usually can observe) on experiencing the tumor of immunological pressure.
LIGHT be a kind of identify recently enter the part of medium (HVEM) at the LT β R on the stromal cell and the herpesvirus on the T cell.The Notes of Key Data that we are previous, LIGHT Mediated Signal Transduction can strengthen the generation with activatory lymphoid tissue chemotactic factor of raising that is used for juvenile cell in the tumor.But, do not know whether LIGHT can be used for the control of metastatic tumo(u)r.In this application, we focus on that adenovirus with high expressed sudden change LIGHT carries out in the tumor injection and eradicates metastatic tumo(u)r to produce competent CTL.
Therefore, need to provide improved metastatic tumo(u)r prevention and Therapeutic Method in the art.The present invention has satisfied these needs and other needs.
Summary of the invention
The present inventor has checked whether the immunne response that directly produces in the excision pre-neoplastic microenvironment will allow more specific for tumour antigen T cell to walk out the metastatic cancer cell of tumor locus with inspection and elimination periphery.In this research, we confirm, the adenovirus direct inoculation of expressing LIGHT is gone in the high aggressiveness 4T1 breast carcinoma of spontaneous transfer, and this primary tumor of exenterate can be eradicated the metastatic cancer cell of distribution afterwards.And we can confirm clearly that topical therapeutic can be induced the proinflammatory cytokine environment at tumor locus, and produce competent tumour-specific CTL to leave primary tumor and to eradicate metastatic tumo(u)r.
Our research prompting, operation front target may be one to primary tumor and produce CTL to eradicate the available strategy of periphery and metastatic tumo(u)r at a distance.Therefore, our research opened up one by skill utilize the new route of immunization therapy as the means treatment cancer of eradicating metastatic disease.
Generally speaking, the present invention relates to prevent and/or treat the method for tumor, this method comprises activator from immunocyte (NK, T, and DC cell) to the patient that use.In particularly preferred embodiments, prevent and/or treat metastatic tumor by the operation front target to primary tumor.
The immunocyte activator can be the activator of CD8+T cell.The example of described activator is an antibody, monoclonal antibody especially, humanized antibody etc.In one embodiment, described activator is the nucleic acid that coding activates the polypeptide of CD8+T cell.
In one embodiment, described immunocyte activator be the polypeptide of coding immune cell activated or coding immune cell activated polypeptide nucleic acid or comprise its Pharmaceutical composition.Especially, described activator is the nucleic acid of LIGHT polypeptide or coding LIGHT.
In another embodiment, described immunocyte activator is recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT or the Pharmaceutical composition that comprises this recombinant vector.
In another embodiment, described immunocyte activator is to comprise and express the tumor cell of nucleic acid of coding LIGHT or tumor (preferably, this tumor cell or tumor also comprise and expressing tumor antigen) or comprise Pharmaceutical composition, particularly therapeutic vaccine or the preventative vaccine of tumor cell or tumor.
In the present invention, except as otherwise noted, when mentioning LIGHT, LIGHT can be wild type, also can suddenly change, LIGHT especially suddenlys change.Preferably, described sudden change LIGHT comprises and stops the sudden change of protease to its degraded, for example, described sudden change LIGHT is the LIGHT that does not contain protease cracking site, particularly, for people LIGHT albumen, do not contain the sudden change LIGHT of the proteolysis site EQLI of people LIGHT albumen 81-84 position.But, the invention is not restricted to the digestion or the degraded that suddenly change and reduce protease by this.Perhaps, described sudden change LIGHT preferably has extracellular domain amino acid sequence and sequence label (for example being convenient to the label of purification), as has the aminoacid sequence and the flag sequence of LIGHT 85-239 position.LIGHT can be from mammal, preferably from the people, but also can be from other animal.
The patient can be a mammal, including, but not limited to the people.
Described tumor can be any type of tumor.Can be primary tumor, but be more preferably metastatic tumo(u)r.For example, in some cases, tumor is the entity cancer, such as, but be not limited to breast carcinoma, ovarian cancer, pulmonary carcinoma, head and neck cancer, carcinoma of prostate, thyroid carcinoma, bladder cancer, gastric cancer, the brain cancer, melanoma, nasopharyngeal carcinoma, skin carcinoma or renal carcinoma.Cancer can be the cancer that shifts, for example breast carcinoma of Zhuan Yiing.Cancer can be hemapoietic cancer, for example lymphoma or leukemia.Certainly, those of skill in the art will appreciate that the lesion/cancer disease that can treat any number according to the present invention.
In the present invention, except as otherwise noted, " primary tumor " is a notion relative with " metastatic tumo(u)r ", therefore, also can regard " primary tumor " as in the metastatic tumo(u)r that primary tumor excision back takes place.
In a preferred embodiment, described tumor is a liver neoplasm.
An especially preferred embodiment, the present invention relates to prevent and/or treat the method for metastatic tumo(u)r, this method comprises to the patient uses the immunocyte activator.This immunocyte activator can be any immunocyte activator mentioned in this article, particularly the nucleic acid of LIGHT polypeptide or coding LIGHT, comprise and express the nucleic acid of coding LIGHT recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus), comprise and express the LIGHT that encodes nucleic acid tumor cell or tumor or comprise in them one or more pharmaceutical composition.
The inventive method can adopt administered in any suitable way, systemic administration for example, administration in preferably for example subcutaneous, the tumor.
Preferably, targeting primary tumor before the primary tumor excision.In the case, can administration in tumor.For the tumor in the liver, the adenovirus of expressing LIGHT or other immunologic stimulant also can carry out sending systemicly.
The invention still further relates to the immunocyte activator and be used for preventing or treating the purposes of the medicine of tumor in preparation.
The invention still further relates to the tumor cell or the tumor that comprise the immunocyte activator.
The invention still further relates to the pharmaceutical composition that comprises the immunocyte activator, is used to prevent or treat tumor, particularly therapeutic vaccine or preventative vaccine.
On the other hand, the present invention relates to prevent and/or treat the method for hepatopathy pathogen infection, this method comprises to the patient uses the immunocyte activator.If suitably, this immunocyte activator can be any immunocyte activator mentioned in this article, particularly the nucleic acid of LIGHT polypeptide or coding LIGHT, comprise and express the recombinant vector (recombinant virus for example, preferably recombinant adenovirus or fowlpox virus) of the nucleic acid of coding LIGHT or comprise in them one or more pharmaceutical composition.The tissue specificity targeting may be the more effective Therapeutic Method of local disease.Adenovirus can be used as the liver specificity targeting agent of the hepatitis and the hepatocarcinoma (comprising constitutional and secondary liver cancer) of pathogen-inducible.Adenovirus-LIGHT is the desirable reagent of targeting hepatic disease (pathogen and cancer).
This method of the present invention can adopt administered in any suitable way, the optimum decision system administration.
The invention still further relates to the immunocyte activator and be used for preventing or treating the purposes of the medicine of hepatopathy pathogen infection in preparation.
The invention still further relates to the pharmaceutical composition that comprises the immunocyte activator, is used to strengthen the interior immunity of liver organization and/or prevention or treatment hepatopathy pathogen infection.
In preferred embodiments, the hepatopathy pathogen infection is viral infection (particularly HBV and HCV infect).
Aspect more specifically, the present invention relates to eliminate the method for primary tumor, this method comprises to the patient (for example to be used, in tumor, import) comprise and express the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) of the nucleic acid of coding LIGHT or comprise the Pharmaceutical composition of this recombinant vector.The nucleic acid of described coding LIGHT can encoding mutant or the LIGHT of sudden change not, and/or can codon optimization or not codon optimization.The nucleic acid coding sudden change as herein described LIGHT of preferred described coding LIGHT, and codon optimization.
The invention still further relates to the method for prevention metastatic tumo(u)r, this method comprises to the patient (for example to be used, in primary tumor, import) comprise and express the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) of the nucleic acid of coding LIGHT or comprise the Pharmaceutical composition of this recombinant vector.
The invention still further relates to the method for the existing metastatic tumo(u)r of treatment, this method comprises to the patient (for example to be used, in primary tumor, import) comprise and express the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) of the nucleic acid of coding LIGHT or comprise the Pharmaceutical composition of this recombinant vector.
The invention still further relates to the method for prevention or treatment hepatopathy pathogen infection, this method comprises to the patient uses recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT or the Pharmaceutical composition that comprises this recombinant vector.
The invention still further relates to the Pharmaceutical composition that is used to eliminate primary tumor, prevention metastatic tumo(u)r and/or the existing metastatic tumo(u)r of treatment, it contains the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT.
The invention still further relates to the Pharmaceutical composition that is used to prevent or treat the hepatopathy pathogen infection, it contains the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT.The nucleic acid of described coding LIGHT can encoding mutant or the LIGHT of sudden change not, and/or can codon optimization or not codon optimization.The nucleic acid coding sudden change as herein described LIGHT of preferred described coding LIGHT, and codon optimization.
Correspondingly, the present invention relates to comprise and express the recombinant vector (recombinant virus for example of the nucleic acid of coding LIGHT, preferred recombinant adenovirus or fowlpox virus) purposes in the preparation medicine, described medicine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.For example, this medicine can come administration by described recombinant virus is imported in the primary tumor.
The invention still further relates to the purposes of recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) in the preparation medicine that comprises and express the nucleic acid of coding LIGHT, described medicine is used for prevention or treatment hepatopathy pathogen infection.
Another concrete aspect, the present invention relates to comprise and express the tumor cell or the tumor of the nucleic acid of coding LIGHT.Preferably, this tumor cell or tumor also comprise and expressing tumor antigen.
In a specific embodiments, the present invention relates to tumor cell or tumor, the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that it has been transduceed and has comprised and express the nucleic acid of coding LIGHT.
Preferably, this tumor cell or tumor are also by radiation treatment.
The invention still further relates to the Pharmaceutical composition that comprises tumor cell of the present invention or tumor, particularly therapeutic vaccine or preventative vaccine.
In one embodiment, the present invention relates to be used to eliminate the therapeutic and/or the preventative tumor vaccine of primary tumor, prevention metastatic tumo(u)r and/or the existing metastatic tumo(u)r of treatment, this tumor vaccine comprises the tumor cell or the tumor of the invention described above.Preferably, this tumor vaccine also can comprise pharmaceutically suitable carrier.
Correspondingly, the invention still further relates to the recombinant vector (recombinant virus for example that comprises and express the nucleic acid of coding LIGHT, preferred recombinant adenovirus or fowlpox virus) purposes in preparation example such as therapeutic and/or preventative tumor vaccine, described tumor vaccine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
The present invention also relates to the tumor cell or the purposes of tumor in preparation therapeutic and/or preventative tumor vaccine of the invention described above, described tumor vaccine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
The invention still further relates to the purposes of the above-mentioned tumor vaccine of the present invention in the preparation medicine, described medicine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
Relatively, the present invention relates to eliminate the method for primary tumor, this method comprises to the patient uses tumor vaccine of the present invention.
The invention still further relates to the method for prevention metastatic tumo(u)r, this method comprises to the patient uses tumor vaccine of the present invention.
The invention still further relates to the method for the existing metastatic tumo(u)r of treatment, this method comprises to the patient uses tumor vaccine of the present invention.
With tumor vaccine treatment of the present invention or prevent disease the time, can come administration by number of ways, preferably by the subcutaneous route administration.Tumor vaccine of the present invention can give after the excision primary tumor.
The invention still further relates to the expression immunostimulant of the immunity that is used to strengthen liver metastasis tumor, primary tumor and/or viral infection (for example HBV and HCV), it contains the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT.
LIGHT can stimulate various immunocytes, T cell, NK cell and DC, thereby can be used as immunostimulant.LIGHT can break the toleration at local tumor position or liver position, owing to the high expressed at these positions LIGHT.Adenovirus can selectively targeted liver, and liver contains than more T cell of other surrounding tissue and NK cell.
The invention still further relates to and contain the recombinant vector that comprises and express the nucleic acid of coding LI GHT (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) be used for preparing the purposes of expressing immunostimulant, described expression immunostimulant is used to strengthen the immunity of liver metastasis tumor, primary tumor and/or viral infection (for example HBV and HCV).
The invention still further relates to the method for the immunity that strengthens liver metastasis tumor, primary tumor and/or viral infection (for example HBV and HCV), this method comprises to the patient uses the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT or the expression immunostimulant of the invention described above.
The present invention yet relates to the method that increases the amount of TNF-α and IFN-γ or CD8+T cell in the liver, this method comprises to the patient uses recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) or the expression immunostimulant of the present invention that comprises and express the nucleic acid of coding LIGHT.
In the present invention, medicine of the present invention and Therapeutic Method can be united use with other medicines and Therapeutic Method, and medicine for example of the present invention and Therapeutic Method can also comprise primary tumor excision and/or chemotherapy and/or radiotherapy.
In a preferred embodiment, before the primary tumor excision, in primary tumor, give immunocyte activator of the present invention.
In one embodiment, medicine of the present invention (pharmaceutical composition) also comprises other active component, and described medicine is formulated into the form that is suitable for immunocyte activator of the present invention and administration simultaneously of described other active component or separate administration.
In certain embodiments, immunocyte activator and other active component are sent simultaneously.In certain embodiments, the immunocyte activator is sent in different with other active component.In one embodiment, described other active component is a chemotherapeutic agent, especially immunocyte is not had substantive toxic chemotherapeutics.In another embodiment, described other active component is the radiotherapy medicine.In one embodiment, described other active component is an anti-cancer vaccine, for example gene vaccine or peptide vaccine.In one embodiment, described other active component is the nucleic acid of therapeutical peptide or coding therapeutical peptide.
The invention still further relates to the recombinant virus that comprises and express the nucleic acid of encoding mutant LIGHT on the other hand, preferably, this recombinant virus is recombinant adenovirus or fowlpox virus.Preferably, described sudden change LIGHT comprises and stops the sudden change of protease to its degraded, for example, described sudden change LIGHT is the LIGHT that does not contain protease cracking site, the mice sudden change LIGHT that does not particularly contain the proteolysis site EKLI of mice LIGHT albumen 79-82 position, the people who does not perhaps contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position LIGHT that suddenlys change.In another embodiment, described sudden change LIGHT has extracellular domain amino acid sequence and sequence label (for example being convenient to the label of purification), as has the aminoacid sequence and the flag sequence of LIGHT 85-239 position.
In order to obtain better to transcribe and translate, can also optimize the codon of LIGHT.Codon is modified the 10-15% that can change gene, to optimize GC content etc.But codon is modified and is not changed amino acid sequence coded.
The inventor has systematically modified the codon of LIGHT, has changed 10% codon.This allows more stably to express high-caliber LIGHT.Preferred example is described among the embodiment hereinafter.
The nucleic acid coding sudden change as herein described LIGHT of preferred described coding LIGHT, and codon optimization.
The invention still further relates to the Pharmaceutical composition that comprises recombinant virus of the present invention, particularly therapeutic vaccine or preventative vaccine on the other hand.
The invention still further relates to virus of the present invention or compositions on the other hand and be used for the treatment of purposes in the medicine of cancer in preparation.
On the other hand, the invention still further relates to the method for treatment cancer or destruction tumor, comprise: comprise and express the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) of the nucleic acid of encoding mutant LIGHT or comprise the Pharmaceutical composition of this recombinant vector to the cancer patient; Perhaps comprise and express the tumor cell of nucleic acid of encoding mutant LIGHT or tumor (preferably to the cancer patient, this tumor cell or tumor also comprise and expressing tumor antigen) or comprise Pharmaceutical composition, particularly therapeutic vaccine or the preventative vaccine of this tumor cell or tumor.In a preferred embodiment, described is to give in tumor.
On the other hand, the invention still further relates to the tumor cell or the tumor that comprise and express the nucleic acid of encoding mutant LIGHT, preferably, this tumor cell or tumor also comprise and expressing tumor antigen; Also relate to the Pharmaceutical composition that comprises tumor cell of the present invention or tumor, particularly therapeutic vaccine or preventative vaccine.
(comprise compositions of the present invention of the present invention aspect all, purposes, tumor cell or tumor, vaccine, perhaps recombinant virus, in the preferred embodiment if applicable), described LIGHT code nucleic acid is to have carried out codon optimized nucleic acid with respect to the host, more preferably carried out codon optimized and the protease cracking site that suddenlyd change to stop the nucleic acid of protease to the LIGHT protein degradation of coding, for example, coding does not contain the mice sudden change LIGHT polypeptide of proteolysis site EKLI of mice LIGHT albumen 79-82 position or the people that do not contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position nucleic acid that LIGHT polypeptide and codon optimize that suddenlys change, the code nucleic acid shown in the preferred SEQ ID NO:2 and 3.
The invention still further relates to codon optimization but do not change the LIGHT code nucleic acid of aminoacid sequence, preferred people LIGHT code nucleic acid.The invention still further relates to codon optimization and the protease cracking site that suddenlyd change to stop the nucleic acid of protease to the LIGHT protein degradation of coding, for example, coding does not contain the mice sudden change LIGHT polypeptide of proteolysis site EKLI of mice LIGHT albumen 79-82 position or the people that do not contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position nucleic acid that LIGHT polypeptide and codon optimize that suddenlys change, the code nucleic acid shown in the preferred SEQ IDNO:2 and 3.The host cell that the invention still further relates to the carrier that comprises above-mentioned nucleic acid and transformed this carrier.
Can consider that if suitably, any embodiment of being discussed can be implemented with regard to any method of the present invention or compositions, vice versa in this description.In addition, compositions of the present invention can be used to obtain method of the present invention.
In whole this application, term " approximately " is used to show that value comprises the equipment that is used to measure this value, the constant error of method changes, and perhaps is included in the variation that exists among the research patient.
When using in this description and claim, speech " contains ", " having ", " comprising " or " comprising " be wide in range or unconfined, and they do not discharge composition or method step other, that do not describe.
Other targets of the present invention, feature and advantage will be well understood to from following detailed description.; pointed out particular embodiment of the present invention though should be appreciated that detailed description and special embodiment, just explanation for example; because from this describes in detail, various variations within the spirit and scope of the present invention and modification all can be conspicuous to those skilled in the art.
Description of drawings
Fig. 1: A. is by eradicating the metastatic tumo(u)r of having set up with Ad-LIGHT at tumor inner therapeutic.The hypodermic 4T1 breast cancer cell of Balb/c mice flank behind tumor inoculation the 14th day and the 17th day with Ad-LIGHT or Ad-control (Ad-contrast) (2 * 10 9PFU) subcutaneous treatment.At the 28th day excision primary tumo(u)r (～150mm 3), put to death mice at the 35th day and be used for lung colony generation test (colonogenic assay).Data represented three experiments.
B. eradicate the neoplasm metastasis of having set up with the inoculation of the autologous tumor cell after the radiation.At the 0th day in Balb/c flank subcutaneous vaccination 6 * 10 4Individual 4T1 tumor cell.Take out primary tumo(u)r operation in the 22nd day, subcutaneous injection contrasts (4 * 10 through Ad-LIGHT or Ad-in mammary fat pad afterwards 9PFU) the 4T1 cell (1 * 10 after infection and the radiation 6Individual cell).The 21st day, the cell of injection inoculation prepared fresh for the second time in the breast pad of mice.Put to death mice on the 45th day behind the tumor inoculation, and analyze by lung colony generation test.Data are the representative of two independent experiments.
#cologenic tumer cells per liver: the colony of each liver generates tumor cell number
Ad-Control: the adenovirus that contains contrast
Ad-LIGHT: the adenovirus that contains LIGHT
Fig. 2. hepatocyte is to the adenovirus infection sensitivity.Give injected in mice 3 * 10 9Pfu.After 48 hours, digestion hepatocyte and results are used for measuring the LIGHT expression analysis that carries out by LTbR-Ig and anti-people-FITC.
Fig. 3 .1 * 10 6Individual tumor cell was laid in the 100mm Tissue Culture Dish 24 hours, used Ad-LIGHT with 4 * 10 then 8Pfu/ml infected 24 hours.Harvesting, and check that by FACS LIGHT expresses: use 0.02mg/mL LT β R-Ig dyeing earlier, use the second step antibody PE anti-human IgG dyeing of link coupled monkey (white) then; Perhaps only use the second step antibody to dye (Lycoperdon polymorphum Vitt) in contrast.
The spontaneous metastatic tumor of Fig. 4 .Ad-LIGHT treatment may command.The local expression of LIGHT can prevent the generation of spontaneous metastatic tumor on the A-B.4T1 tumor cell.The 4T1 breast carcinoma (1 * 10 of In vitro culture 6Individual cell) with Ad-LIGHT or Ad-contrast (4 * 10 8PFU/ml) infected 24 hours, subcutaneous injection 1 * 10 then 5Individual cell is to Balb/c mice flank.Detect tumor growth (A), behind inoculated tumour, put to death mice on the 35th day, carry out the lung colony and generate analysis (B).Data represented two experiments.C. injection Ad-LIGHT can prevent the metastatic tumor diffusion in tumor.Subcutaneous injection 1 * 10 5Individual 4T1 breast cancer cell is to Balb/c mice flank.Behind inoculated tumour the 7th day, injection Ad-LIGHT or Ad-contrast (5 * 10 in tumor 9PFU).At the 18th day excision primary tumor.Behind inoculated tumour, put to death mice on the 35th day, be used for the lung colony and generate test.Data represented two independent experiments.
Fig. 5. the T cells with antigenic specificity that LIGHT stimulates in the tumor can be transferred to distal site.A. express same amount L to the OT-1 mouse hypodermic inoculation dAntigenic 10 6Ag104L dPerhaps Ag104L d-LIGHT cell.After 10-14 days, to these OT-1 mice infusions 3 * 10 6The 2C T cell of CFSE-labelling.In draining lymph node (DLNs), non-DLNs and spleen and tumor itself, estimated the situation of 2C T cellular expression CD44 and secretion of gamma-IFN after the adoptive transfer in 14-20 days.B-C. every OT-1 mice is with two tumor inoculations.Primary tumor is 10 6Ag104L dPerhaps Ag104L d-LIGHT tumor cell, and secondary tumors is 10 5Ag104L dTumor cell.Behind tumor challenge 10-14 days, to mice infusion 3x10 6The 2C T cell of CFSE-labelling.The existence and the CFSE that estimated 2C T cell in primary tumor and secondary tumors after adoptive transfer on the the 3rd, 5 and 10 day dilute (CFSE dilution) (B).Relatively having the Ag104L that expresses LIGHT dPerhaps parent Ag104L dThe host in the percentage ratio (C) of 2C T cell in the secondary tumors.D. after the adoptive transfer, from Ad-LIGHT handle the T of mouse lymph organ cell-mediated to setting up the repulsion of tumor.With 10 5Ag104L dTumor cell inoculation is in the C3B6F1 mice.Behind tumor challenge the 14th day with 5 * 10 10Individual Ad-LIGHT or Ad-control virion are handled mice.After processing the 7th day, we collected spleen and lymph node from handling mice, purification T cell, and with 10 7Individual these T cell adoptive transfers are set up 7 days Ag104L to having dIn the C3B6F1 mice of tumor.Detect growth of tumor in these mices.
Fig. 6. can in secondary tumors, induce intensive anti-tumor immune response to primary tumor with the Ad-LIGHT processing.After primary tumor was attacked 6 days with 10 5Ag104L dWith 10 5Ag104L dEvery C3B6F1 mice of tumor cell inoculation.Secondary tumors inoculation after 5 days on the primary tumor inoculum with 5 * 10 10Adenovirus particles carries out Ad-LIGHT processing in the tumor.Detect the growth (A) of constitutional and secondary tumors.Check CD8 in DLN, spleen, primary tumor and the secondary tumors +The T cell accounts for Ly5.2 +The CD8+T cell of the percent of cell and generation IFN-γ accounts for the percent (B) of CD8+T cell, and carries out statistical analysis (C).Gather in the crops spleen and tumor tissues after 7 days at Ad-LIGHT or Ad-control treatment, grind these tissues, collect supernatant and carry out cytokine assay (D).
Fig. 7 has shown the protease site that suddenlyd change, has optimized the mice LIGHT sequence (SEQ ID NO:3) of codon simultaneously again.
Fig. 8 has shown wild type LIGHT, saltant LIGHT, sudden change and the expression of the LIGHT that modifies through codon.
The specific embodiment
The LIGHT treatment
LIGHT is one and newfoundly acts on immunoregulatory gene.Thereby the sudden change that we carried out and codon are modified and can be improved it at the stability of cell surface expression immune response stimulating better.Four amino acid whose sudden changes to LIGHT have stoped this proteinic degraded.When not suddenling change, in cells transfected system, there is not anti-tumor activity.Codon is modified and is allowed lip-deep LIGHT to increase 4-8 doubly (embodiment sees below).The increase of LIGHT is important for the increase that plays anti-tumor activity.We are converted into thought and new mutant gene that adenoid invention has comprised a new genetic immunization treatment about adopting LIGHT with tumor tissues.
The immunotherapy method that we are newly clear and definite a kind of: make lymphocyte can directly contact and attack tumor cell by in tumor tissues, bringing out lymphoid tissue, thereby induce suitable immunoreation and produce more effector T cell removing metastatic tumor and elimination tumor in inside tumor to tumor.LIGHT is the ligand as the HVEM of the lymph poison receptor of stromal cell expression and T cellular expression.Among LIGHT introducing tumor tissues, will induce high-caliber chemokines and adhesion molecule, and follow the Jin Run of a large amount of not activated T lymphocytes sudden change.The mutant of LIGHT has stoped the degraded of protease to it, makes that LIGH can be in the surface of tumor cells expressed intact.LIGHT will have great help to the selective activation of TS T lymphocyte reaction to immunoreactive synergistic activation activity, remove the existing high progressive primary tumo(u)r and the tumor at other positions of deriving thereby be of value to.The tumor cell of expressing LIGHT can be used as clinical relevant therapeutic vaccine, can be used for eradicating the primary tumo(u)r of having deposited.The tumor cell of expressing LIGHT will attract and activate lymphoblast as clinical relevant therapeutic vaccine in inside tumor, be used to remove tumor thereby produce more antitumor lymphocyte.Our research has proved that tumor necrosis factor superfamily (TNFSF14) and LIGHT can form receptor signal and attract the T cell of tumour-specific at the stromal cell of inside tumor and lymphocytic cell surface.We find that the tumor cell that LIGHT transforms can strengthen by the new effect of collaborative its two receptoroid depositing the immune clearance reaction of primary tumo(u)r.Our data shows that the LIGHT of expression of tumor tissue has the stronger scavenging action that excites former tumor progression, be better than excitation (NatureImmunology, Vol.5, the No.2 of other cytokines and collaborative stimulation molecule, in February, 2004, p.141-149).Up to the present, resemble LIGHT like this, have so dual calling up not see the report that any other is arranged as yet with the molecule of the usefulness of activated T cell.Such characteristic makes us can develop a kind of brand-new immunotherapy method to tumor.
Preferably, LIGHT is sudden change LIGHT.Particularly preferably be, described sudden change LIGHT comprises and stops the sudden change of protease to its degraded, for example, described sudden change LIGHT is the LIGHT that does not contain protease cracking site, does not particularly conform to the sudden change LIGHT of the proteolysis site EQLI (for people LIGHT) of LIGHT albumen 79-82 position.In another embodiment, described sudden change LIGHT has extracellular domain amino acid sequence and sequence label (for example being convenient to the label of purification), as has the aminoacid sequence and the flag sequence of LIGHT 85-239 position.LIGHT aminoacid sequence and amino acid residue are numbered referring to Nature Immunology, Vol.5, and No.2, in February, 2004, p.141-149.Another important change is that codon is modified, and this allows to express better LIGHT.Before the present invention, nobody carries out codon and modifies and study its expression.Our data show, sudden change and codon are modified the expression that LIGHT significantly is provided.
The administration of LIGHT or mutant LIGHT is preferably by various viral delivery systems or express that the tumor cell of LIGHT carries out.Particularly, comprising: comprise and express the recombinant vector (recombinant virus for example, preferred recombinant adenovirus or fowlpox virus) of the nucleic acid of encoding mutant LIGHT or comprise the Pharmaceutical composition of this recombinant vector to the cancer patient; Perhaps comprise and express the tumor cell of nucleic acid of encoding mutant LIGHT or tumor (preferably to the cancer patient, this tumor cell or tumor also comprise and expressing tumor antigen) or comprise Pharmaceutical composition, particularly therapeutic vaccine or the preventative vaccine of this tumor cell or tumor.In a preferred embodiment, described is to give in tumor.Particularly, above-mentioned recombinant virus or tumor cell injection are arrived former position of tumor
Adenovirus that preferred viral delivery system includes, but not limited to recombinate and fowlpox virus (fowlpox virus) wait other virus.In particularly preferred embodiments, mutant LIGHT comes administration by the adenovirus and the fowlpox virus of reorganization.If the primary tumo(u)r cell fails in the month to be eliminated at 1-2, tumor will be by excision or radiating irradiation.Our previous experiments is found to handle through the treatment of LIGHT, and animal body has been set up intensive tumour immunity memory, can remove the tumor at tip position.
Use the adenovirus and the fowlpox virus of reorganization to come administration to have special advantage, for example, efficient is higher and safer.Owing to be easy to produce and the output height, recombinant adenovirus has been widely used in the humans and animals experiment, but Most patients may have anti-adenovirus antibody, the adenovirus that they may neutralize rapidly and inject.Whether the injection adenovirus can avoid this quick removing in the not clear tumor.Seldom there is the patient that anti-fowlpox virus antibody is arranged in serum.Therefore, this recombinant virus to continue be a potential advantage.Might initially use recombinant adenovirus, treat the patient with fowlpox virus then, to reduce the reaction that the host removes virus.Our PRELIMINARY RESULTS shows, will have 5 * 10 of 50ul of reorganization LIGHT 10Virion is expelled in tumor in the Ag104Ld tumor of having set up; cause local and the repulsion (5/5) of tumor at a distance, obviously protection (being ostracised for 0 in 5 mices) and all mices did not die from tumor in two months and contrast virus (not having LIGHT).Repeated experiments has obtained similar result.(please provide concrete process of the test, more example provides following)
Ad-LIGHT can mediate the repulsion of the spontaneous liver metastatic tumors of having set up (establishedspontaneous liver metastasis).Existing Therapeutic Method can successfully be eradicated the very rare of metastatic tumo(u)r.Whether we have tested at present producing immunne response before the ocal resection in tumor tissues can produce the tumour-specific effector T cell that is enough to eradicate metastasis tumor (distant metastases).The adenovirus of expressing LIGHT is inoculated in the constitutional 4T1 breast carcinoma that is in the stage that transfer has taken place.As the following examples proof, this treatment can be eradicated metastatic tumo(u)r.
Pharmaceutical composition
Pharmaceutical composition of the present invention contains immunocyte activator and pharmaceutically suitable carrier of effective dose.Term " pharmaceutically acceptable " is meant in the time being applied to animal (if suitable, for example be the mankind), does not produce the molecular entity and the compositions of disadvantageous, hypersensitive or other undesired reaction.According to disclosure of the present invention and Remington ' s Pharmaceutical Sciences, 18thEd.Mack Printing Company, the explanation of 1990 (herein quoting as a reference), those of ordinary skills know how to prepare the pharmaceutical composition that contains the immunocyte activator.And, use for animal (for example human), said preparation should be understood and the desired aseptic of administrative authority, pyrogen, overall security and purity rubric should be satisfied.
As used herein, " pharmaceutically useful carrier " is meant any and all solvents known to those of ordinary skills, disperse medium, coating materials, surfactant, antioxidant, antiseptic (antibacterial agent for example, antifungal), isotonic agent, absorption delays reagent, salt, antiseptic, medicine, the medicine stabilizing agent, gel, bonding agent, excipient, disintegrating agent, lubricant, sweeting agent, flavoring agent, dyestuff, similar substance and combination thereof (referring to, Remington ' sPharmaceutical Sciences for example, 18th Ed.Mack Printing Company, 1990, pp.1289-1329 quotes as a reference herein).Unless conventional carriers and active component are incompatible, otherwise they may be used in the described pharmaceutical composition.
Pharmaceutical composition of the present invention can contain dissimilar carriers, and this depends on that it is to use and whether it needs to sterilize to be applicable to the route of administration of injection and so on the form of solid, liquid or aerosol.The present composition can be as known to persons of ordinary skill in the art in intravenous, Intradermal, transdermal, sheath, in the intra-arterial, tumor, intraperitoneal, intranasal, internal rectum, epidermis (topical), intramuscular, subcutaneous, mucosa ground, oral, epidermis ground, partly, the modes such as (for example aerosol suction), injection, infusion, continuous infusion that suck use, or directly, through conduit, through douche and regional perfusion is spread in target cell, or use with cream, fluid composition (for example liposome) or alternate manner or above-mentioned any combination.Referring to, Remington ' s Pharmaceutical Sciences for example, 18th Ed.Mack PrintingCompany, 1990, quote as a reference) herein.
For the metastatic tumo(u)r in HBV, HCV, constitutional liver neoplasm or the liver, the adenovirus of expressing LIGHT or other immunologic stimulant also can carry out sending systemicly.
The adenovirus of systemic administration can preferentially be positioned liver and stimulate the local immunity cell to eradicate tumor in this site.
The combination treatment that is used for cancer/tumor
Usefulness for the enhance immunity cell activator it is desirable to, with these compositionss of the present invention and method and effectively material (for example antitumor and anticancer agent) coupling of treatment hyperplasia disease." anticancer " reagent can produce negatively influencing to the cancer among the experimenter, for example, by kill one or more cancerous cell, in one or more cancerous cell cell death inducing, reduce one or more cancerous cell growth rate, reduce metastasis rate or number, minimizing tumor size, suppress tumor growth, reduce blood supply, improve immunne response, prevent or suppress the development of tumor or increase life-span of cancer patient to one or more cancerous cell or tumor to tumor or one or more cancerous cell.Antitumor and anticancer agent comprises, for example, chemotherapy agents (chemotherapy), radiotherapy reagent (X-ray therapy), operation method (operation), immunization therapy reagent (immunotherapy), genetic therapy reagent (gene therapy), hormonotherapy, other biological reagent (biotherapy) and/or substituting therapy.
A preferred example of " anticancer " reagent is regulatory T cells consume agent.Regulatory T cells consume agent is chemical compound, compositions, mixture or the combination formulations of any or multiple consume regulatory T cells.Regulatory T cells consume agent includes, but not limited to anti-regulatory T cells antibody, as humanized anti-CD 4 antibodies; Perhaps disclosed herein, prior art is known or will found consume regulatory T cells (CD4 particularly +The T cell) any other chemical compound or one or more this combination of compounds.
In these areas, described regulatory T cells CD4 preferably +T cell, particularly CD4 +CD25 +The T cell.Described regulatory T cells can be at the tumor locus place, and/or in tumor, and/or outside tumor.Described consume can be a tumor by local, and/or is general.
In one embodiment, described regulatory T cells consume agent is the antibody of regulatory T cells, particularly anti-CD4 +Antibody is as anti-CD4 +CD25 +Antibody; Perhaps, described regulatory T cells consume agent is the IL2-toxin.The preferably anti-people CD4 of described antibody +Antibody.Described antibody can be monoclonal antibody or polyclonal antibody.Preferably, antibody is humanized antibody.
More generally, such (anticancer) reagent will provide with effective kill cancer cell or the combined amount that suppresses its propagation with the immunocyte activator.Such method can comprise: cell is contacted with the immunocyte activator simultaneously with reagent, and perhaps contact has in a period of time wherein produced required therapeutic effect for cell, tissue or biology immunocyte activator and reagent separate administration.This also can realize by following manner: cell, tissue or biology are contacted with the single compositions or the pharmaceutical preparation that contain immunocyte activator and one or more reagent simultaneously, perhaps that cell is different with two or more compositionss or preparation contact, wherein a kind of compositions comprises the immunocyte activator, and another kind of compositions comprises one or more reagent.
When being used for cell, tissue or biochron, term " contact " and " exposure " are meant a kind of like this process herein, by means of this process, the treatment construction of immunocyte activator and/or other reagent (for example chemotherapy agents or radiotherapy reagent) is sent in target cell, or is directly placed described target cell, tissue or biology side by side.For cell killing or make the cell tranquillization, immunocyte activator and/or additional agents are effectively to kill described cell or to prevent that their splitted combined amount are delivered to one or more cells.
The immunocyte activator can be before other reagent, with its simultaneously and/or after it, use, interval therebetween be several minutes to a few weeks longer.In some embodiments, immunocyte activator and other reagent separate administration are in cell, tissue or biology, and in such embodiments, the interval between should guaranteeing usually at every turn to send should be not oversize, thereby make consume CD4 +The chemical compound of T cell and reagent still can apply favourable combined effect to described cell, tissue or biology.
Embodiment
Embodiment proves the preferred embodiments of the invention below introducing.Persons of ordinary skill in the art will recognize that the fine enforcement technology of the present invention that is used for that on behalf of the inventor, the disclosed technology of following embodiment find, can think that therefore they have constituted enforcement optimal way of the present invention.But after reading the disclosure of invention, those of ordinary skills also it should be understood that and can carry out many changes and still can obtain similar result disclosed specific embodiments, but do not deviate from the spirit and scope of the present invention.
Material and method
Mice and cell line.The female C3HxB6F1 (C3B6F1) of 5-8 week size and C3H mouse are available from the Frederick CancerResearch Facility of US National Cancer Institute, and quilt is raised in the particular device that does not contain pathogen of Chicago University.Regulation according to institute and National Institutes of Health (NIH) is taken care of and is studied animal, and uses the approval of committee through the animal of Chicago University.Expression Mus H-2L has been described d(AG104-L d) Ag104 cell line (Wang, 2001) and Ag104 fibrosarcoma (people such as Wick, 1997).
Histology and immunology.The mankind tumor tissue that is used for histological examination is fixing in 10% buffered neutral formalin, paraffin embedding, and use standard method hematoxylin and eosin (H﹠amp; E) dyeing, or according to the explanation of manufacturer be specific to CD4 (NovocastraLaboratories, UK) and CD8 (DAKO, monoclonal antibody CA) dyes.(Sigma-Aldrich, (Vector, APAAP technology CA) discloses the combination of anti--CD4 or anti--CD8 antibody for peroxide zymotechnic MO) or use Vector Blue by using DAB respectively.For the breast carcinoma sample, 40 a times high of picked at random by the visual field in to CD4 +And CD8 +Cell carries out manual counting.
Measure the cytokine in spleen and the tumor.According to describing people such as (, 2003) Janssen, the inventor has prepared the homogenate of tumor and spleen.In brief, collect a considerable amount of tumors or spleen tissue, weigh, and in containing the PBS of protease inhibitor, carry out homogenate, by centrifugal collection supernatant.According to the explanation of manufacturer, in the FACSCaliber hematimeter of being furnished with cell QuestPro and CBA software (BD Pharmingen), use the cytokine quantity in the next quantitative supernatant of cytometer beads array test kit (CBA).
Flow cytometry.Use Fluorescein isothiocyanate (FITC) is puted together, that phycoerythrin (PE) is puted together, that Cy-chromium is puted together or the biological antibody of puting together at mice CD45RB, CD4, CD8, CD25 and IFN (all from BD Pharmingen) carries out facs analysis.Strepto-affinity element-Cy-chromium conjugate is from BD Pharmingen; At clonotype antibody (1B2) cell dyeing of the biotin-conjugated of 2C TCR according to described carrying out (Sun and Bevan, 2003).Dye for the cell within a cell factor, in the presence of Brefeldin A (Sigma-Aldrich), with PMA (50ng/ml, Sigma-Aldrich) and ionomycin (500ng/ml Sigma-Aldrich) stimulated 4 hours from the T of tumor tissues cell purification again.For the analysis of the 2C T cell of CFSE-labelling, with biotinylated 1B2 antibody isolating tumor or spleen single-cell suspension liquid are dyeed, washing, and with PE link coupled anti--mixture of CD8 and the link coupled strepto-affinity of CyC element dyes.Analyze the FACS data with FlowJo software (BD Pharmingen).
The adaptability of 2C T cell shifts.The inventor at first passes through 10 6MC57-SIY tumor cell subcutaneous vaccination is in B6/Rag-1 -/-2C T cell (Sun and Bevan, 2003) is activated in a plurality of sites of the 2C mice of background (2C mice).The inventor then separates lymph-node cell and splenocyte from the 2C mice that these are attacked, and uses CD8 behind tumor inoculation in 5 days +T cell enrichment test kit (Miltenyi Biotec) is to CD8 +The T cell is born selection.When analyzing, most of 2C cellular expression CD44 HighCD62L LowPhenotype.According to described (Sun and Bevan, 2003), then these 2C T cells are carried out labelling with CFSE.The inventor is with 3 * 10 6The T cell of individual CFSE-labelling (volume 0.2-ml) intravenous injection vascular plexus (retro-orbital plexus) behind the eye socket of the mice that has tumor.Shift back 48 hours isolated cells from spleen and tumor, and carry out facs analysis.
Real-time quantitative RT-PCR detects.According to describing (Shedlock and Shen, 2003), foxp-3 is carried out real-time quantitative sex reversal record PCR (RT-PCR) detect.In brief, separate total RNA from tumor, (Amersham Pharmacia NJ) becomes complementary with the total RNA reverse transcription of 5 μ g to use First Strand cDNA Synthesis Kit.(Cepheid carries out the real-time quantitative pcr analysis on CA) at the real-time thermal cycler of CepheidSmartCycler.According to the explanation of manufacturer (PE Applied Biosystems, MA), with the TaqMan Universal PCR master mixture that contains AmpliTaqGold DNA Polymerase increase foxp-3 and GAPDH in each cDNA sample.The inventor utilizes comparison type CT (the threshold cycle number at the intersection point place of amplification curve and threshold value) method to determine the concentration of target gene, and with numerical value to inner GAPDH contrast carrying out standardization.The primer sequence that is used for foxp-3 is 5 '-CCCAGGAAAGACAGCAACCTT-3 ' (forward primer) and 5 '-TTCTCACAACCAGGCCACTTG-3 ' (reverse primer), the probe that is used for FOXP-3 is 5 '-ATCCTACCCACTGCTGGCAAATGGAGTC-3 '.
The adenovirus of LIGHT is expressed in preparation.Before (22) had prepared sudden change Mus LIGHT (mmLIGHT).In order to make up reorganization mmLIGHT-adenovirus, downcut the BamH1/NotI fragment that contains Mus LIGHT cDNA from pCDN3.1-mmLIGHT, with this fragment cloning first pLEP-ubp of parental plasmid ( The left end plasmid (?), be positioned at human ubiquitin promoter (ubp) in BamH/NotI site Tetr) after.Afterwards, (the right-hand member plasmid Ampr) connects in the Cla I site of unique intron coding for the pLEP-mmLIGHT and the second plasmid pREP.Pack the connection product with the bacteriophage lambda packaging extract.Select pLEP/pREP heterozygosis cosmid by the growth on the Amp/Tet LB agar plate.Utilize Bgl II digestion further to identify the reorganization cosmid of the mmLIGHT that contains insertion.From the reorganization cosmid, discharge the Adv-mmLIGHT dna fragmentation by I-Ceu I digestion, and without being further purified, with the mixture rotaring redyeing 293 cell of I-CeuI digestion with preparation recombinant adenovirus (Adv-mmLIGHT).
Tumor injection, treatment and generate the test evaluation neoplasm metastasis by cluster.For Ag104L dTumor is with the root of the tail portion peripheral region of the dosage subcutaneous vaccination C3B6F1 mice described in result's part.For B16-SIY and MC38 tumor, use 10 respectively 6Or 10 5The root of the tail portion peripheral region of individual tumor cell subcutaneous vaccination B6 mice.For the 4T1 tumor, with 10 5In the root of the tail portion peripheral region or breast fat pad of individual tumor cell subcutaneous vaccination Balb/c mice.In the 50 μ l PBS of virion of measuring shown in containing and pfu, contrast inoculated tumour piece in the viral tumor with Ad-LIGHT or Ad-.For excision constitutional 4T1 tumor, anesthetized mice before operation is used the aseptic apparatus tumor resection.With the metal clip closure of wound.Death during all mices are not all performed the operation.From then on get rid of mice in the experiment at excision position recurrence primary tumor.For the evaluation of neoplasm metastasis, collect also chopping lung, replenishing 5%FCS and containing among the DMEM of 1.5mg/ml 4 Collagen Type VI enzymes (Sigma) in 37 ℃ of vibration incubation periods afterwards with 178rpm speed disassociation 30 minutes.Then, with the different dilution factor inoculation organs in the DMEM that replenishes 10%FCS and 60 μ M 6-thioguanines.Counting is represented each single colony of micrometastasis after 5-10 days.
Infection in Vitro and with the tumor cell immunity inoculation after the radiation.In the 100mm Tissue Culture Dish, inoculate 1 * 10 6Individual cell 24 hours, then with Ad-contrast or Ad-LIGHT with 4 * 10 8Pfu/ml carries out infecting in 24 hours.Harvesting is by (PA) dyeing utilizes FACS to check the expression of LIGHT for Jackson, West grove with the anti-human IgG of the link coupled donkey of PE-afterwards with 0.02mg/mL LT β R-Ig.For immunity inoculation, infect tumor cell that the back gathers in the crops, and shine with 1500rads through confirming expression LIGHT, subcutaneous injection is to the breast fat pad afterwards.All infection are all implemented in approved protect against biological hazards cover.
From the tumor tissues isolated cell.At first give the mice blood-letting to reduce the pollution of blood to tumor tissues.Collect tumor tissues, wash among the PBS, cut into pieces, be suspended in again afterwards among the DMEM that replenishes 5%FCS and 1.5mg/ml collagenase D (collagenase D solution) and in 37 ℃ of vibration couveuses, hatched 40 minutes.Collect single-cell suspension liquid after 40 minutes, peptic cell is rolled into a ball and was all resolved into single-cell suspension liquid up to all tumor tissues in fast 40 minutes again in collagenase D solution.
The statistical analysis of tumor growth difference.Because repeated observation arrives growth of tumor in time in same mouse, so use the random-effect model of length data to analyze this data.For each experiment, suppose that tumor growth depends on treatment and follows linear growth rate in time.This pattern has provided the intercept of linear growth and the estimation substantially of slope at every group.Intercept and slope all are allowed to change with mice is individual.Our interest mainly is the comparison slope, i.e. whether growth rate is different in different treatment groups.Because the actual growth of tumor can not be followed linear growth trend during whole follow-up study.In some experiments, tumor growth increases slowly in early days the time, accelerates in the later stage.We also by add the quadratic term of tracking time in above-mentioned random-effect model, study this.
Embodiment 1: give ad-LIGHT before the ocal resection in tumor and can eradicate the metastatic tumo(u)r that has existed in advance
Because subcutaneous injection 10 5The 4T1 tumor cell is always in 11 days detectable metastatic tumo(u)rs of generation in lung behind the tumor inoculation, so will show the effectiveness of this treatment to (seeded) metastatic cancer cell of inoculation with Ad-LIGHT (can express the recombinant adenovirus of LIGHT) treatment after the 11st day time point.We have given WT Balb/c mouse hypodermic inoculation 10 5The 4T1 tumor cell.Behind tumor challenge the 14th day, tumor was created as significant solid block, and begin 2 * 10 this moment 9The treatment of pfu Ad-LIGHT or Ad-contrast.This treatment gives (the 14th day and the 17th day) twice.Then, the last time after the treatment, from taking out primary tumor with the mice underwent operative of Ad-LIGHT or Ad-contrast treatment.
Behind the inoculation primary tumor, put to death mice on the 35th day, analyze the metastatic tumo(u)r in the lung.In the mice of Ad-contrast treatment, observe a large amount of transitivity colonies, and the quantity of detected metastatic cancer cell significantly reduces (seeing Figure 1A) in the mice of Ad-LIGHT treatment.This results suggest gives ad-LIGHT effectively enhance immunity in the tumor, eradicate the metastatic tumo(u)r that has existed in advance, particularly in liver.
Embodiment 2: the tumor cell that inoculation Ad-LIGHT infects can be treated metastatic tumo(u)r
Present embodiment determines whether carry out immunity inoculation through radiating autologous tumor cell can eradicate the metastatic tumo(u)r of having set up.At the 0th day in Balb/c mice flank subcutaneous vaccination 6 * 10 4The 4T1 tumor cell.Take out primary tumor operation in the 22nd day, subcutaneous injection Ad-LIGHT or Ad-contrast (4 * 10 in mammary fat pad afterwards 9PFU) infect, through radiating 4T1 cell (1 * 10 6Cell).At the 21st day, the cell of immunity inoculation (injection) prepared fresh for the second time in the mice mammary fat pad.Behind tumor inoculation, put to death mice on the 45th day, generate experiment by the lung colony and analyze.The results are shown in Figure 1B, show with the inoculation of the autologous tumor cell after the radiation and eradicated the neoplasm metastasis of having set up.
Importantly, the tumor cell that infects for this class tumor patient ad-LIGHT that suffers from liver metastatic tumors can be very effective vaccine.Advantageously, after primary tumor is removed in operation with this vaccine therapy patient.
Embodiment 3: can treat hepatopathy pathogen infection and tumor with Ad-LIGHT
For whether hepatocyte after checking injection ad-LIGHT expresses LIGHT, with 5 * 10 10Ad-LIGHT injects mice.After 24 hours, isolating hepatocytes is also used solubility LTbR (receptor of LIGHT) dyeing.(see figure 2) clearly illustrates as a result, and a part of hepatocyte (4.5%) is the LIGHT positive.This data acknowledgement hepatocyte is to the adenovirus sensitivity.
As depicted in figs. 1 and 2, the immunostimulating adenovirus of the expression of sending can be accumulated in liver, and strengthens local immunity power.We propose also the method to be used for the treatment of pathogen and preinvasive cancer in the liver, for example, and HBV, HCV and hepatocarcinoma (HCC).
The neoplasm metastasis that embodiment 4:Ad-LIGHT control is spontaneous
It is that the cancer patient falls ill and main causes of death that known cancer shifts, and determines that therefore the metastatic tumor whether Ad-LIGHT can induce enough immunne response to scatter with control to the treatment of primary tumor is very significant.4T1 breast carcinoma shifts the very similar human breast cancer of character (23-25) with regard to its anatomical location, immunogenicity, growth characteristics, and prior.Because can not give the defense reaction of attacking once more after the 4T1 tumor in the exenterate growth, this tumor has poor immunogenicity (10) (data not shown).When our breast fat pad or root of the tail portion peripheral region subcutaneous injection 10 to wild type (WT) Balb/c mice 5During individual 4T1 tumor cell, in various organs and draining lymph node (LN), as one man detecting neoplasm metastasis in 11 days behind the tumor inoculation.
In order to determine to reply the tumor cell that whether may be enough to remove or control little distribution at the primary tumor position by the antitumor of Ad-LIGHT generation, we are at first with Ad-LIGHT or Ad-contrast Infection in Vitro 4T1 tumor cell.Infected back 24 hours, and, but and contrasted the LIGHT (Fig. 3) that the cell that infects is not expressed detection level with Ad-with the high-caliber LIGHT of 4T1 tumor cells expression of Ad-LIGHT infection.Then, infect back 24 hours culture results tumor cell from Ad-LIGHT, and with 10 5Individual express LIGHT's or the 4T1 tumor cell subcutaneous vaccination infected of Ad-contrast to Balb/c mice body.Monitor the primary tumor 35 days of subcutaneous growth, put to death mice afterwards, use colony test to estimate transfer in the lung.We find that the growth of primary tumor is subjected to hindering still still continuation development and is not subjected to repelling (Fig. 4 A) fully.Yet,, in the lung of the mice that inoculates the 4T1 tumor cell of expressing LIGHT, do not detect the colony of transitional cell, and in the lung of the mice of carrying control tumor, detect a large amount of transfer (Fig. 4 B) although fail to repel primary tumor.CD8 +The exhaustion of T cell has been abolished this effect (data not shown).Control to neoplasm metastasis can be expressed LIGHT owing to the LIGHT of local expression in primary tumor because tumor cell in this model at a distance is impossible infected.These presentation of results, 4T1 tumor are expressed to be not enough to induce at the LIGHT at tumor growth initial stage primary tumor are produced repulsion, but are enough to the transfer of control tumor under the situation that has the growing tumors cell.
We then are intended to test the therapeutic effect of Ad-LIGHT.Whether we have studied the Ad-LIGHT that directly is delivered in the tumor of having set up can control cancerometastasis.Set up 10 in that the Balb/c mice is subcutaneous in 7 days 5The growth of individual 4T1 tumor cell injects 5 * 10 afterwards in tumor 9PfuAd-LIGHT or Ad-contrast.We observe, primary tumor be grown in the inhibition that is subjected to after the Ad-LIGHT treatment to a certain degree, but still continued growth (data not shown).In order to simulate the clinical treatment situation, operation in 18 days removes primary tumor behind tumor inoculation.35 days execution mices behind the injection primary tumor are used the neoplasm metastasis in the colony generation test evaluation lung then.Meaningfully, we do not detect transfer in the lung of the mice that obtains the Ad-LIGHT treatment, and have found a large amount of metastasis cancer cell (Fig. 4 C) in the lung of control mice.These presentation of results shift the generation that the LIGHT that is delivered in the primary tumor of having set up can induce significant tumour-specific CTL to shift with the control spontaneous tumor by adenoviral gene.
Embodiment 5: activated specific for tumour antigen T cell leaves the tumor environment of LIGHT mediation and appears in the lymphoid tissue subsequently
We observe to have induced intensive antineoplastic immune and spontaneity shifted to the LIGHT of intra-tumor delivery by adenovirus and cause repulsion.We guess that Ad-LIGHT can be from tumor internal stimulus tumour-specific CD8 +The T cell also produces effect/memory T cell, and these effect/memory T cells are systemic circulation and the tumor cell generation repulsive interaction to scattering subsequently.Yet checking detected activated tumour-specific T cell in drain LN is from tumor or what produce in drain LN is difficult, presents because the intersection of tumor antigen may take place in two compartments.In order clearly to distinguish this tumour-specific T cell is to be activated in tumor or in lymphoid tissue at first, and we have used following system, and reaction-ive T cell is only by directly presenting identification antigen on the tumor cell in this system.We before reported, at B6/OT-1/Rag-1 -/-Host (H-2 b) in (OT-1 mice), identification Ag104L dTumor is (through transfection expression H-2L dFibrosarcoma) the 2C TCR transgenic T cell of adoptive transfer can not be activated by presenting indirectly, but only can be by directly the presenting of unusual MHC I type molecule be activated (22,26).These host mouse lack and Ag104L dThe endogenous T cell of tumor response, and 2C T cell is unique T cell that this antitumor of mediation is replied.In addition, 2C T cell can not be at CD8 +Back experience stable state amplification (Brown, the manuscript of submission) in being transferred to these mices when OT-1 T cell exists.Therefore, in this model, by Ag104L dThe sensitization that tumor causes only depends on directly presenting to 2C T cell in the tumor.In addition, for the local effect of concentrating research LIGHT and avoid arriving the probability of systematicness diffusion of the Ad-LIGHT of lymphatic organ, we have used Ag104L dOr the Ag104L of expression LIGHT dTumor system.
Subcutaneous vaccination 10 in the OT-1 mice 6Ag104L dOr Ag104L d-LIGHT cell, infusion 3 * 10 after 10-14 days 6The 2C T cell of individual CFSE-labelling.The existence of the 14-20 days activated 2C T cells of evaluation in draining lymph node (DLN), non-DLN and spleen and in tumor self after the adoptive transfer.We at first observe, at the Ag104L that expresses LIGHT dHave a large amount of activated 2C T cells in the tumor, these cell displays go out the high surface expression of CD44 and produce IFN-γ (Fig. 5 A).On the contrary, at parent Ag104L dAlmost check in the tumor less than activated 2CT cell (data not shown).Importantly, at this moment, we find the much higher activated 2C T cell (Fig. 5 A) of percentage ratio in lymphoid tissue (comprising DLN, non-DLN and spleen).These activated 2C T cells are all expressed high-caliber CD44 and IFN-γ (Fig. 5 A).This result of experiment is pointed out consumingly, and behind the inside tumor local expression, some activated T cells with antigenic specificity can move out of tumor and enter in the systemic circulation at LIGHT.
Embodiment 6: from activated specific for tumour antigen T cell the moving to the far-end tumor of primary tumor generation
Because the LIGHT that has illustrated in the tumor expresses system's recirculation that can cause the activated T cell, we be intended to study these existing specific for tumour antigen T cells then whether can tour of inspection perienchyma to soak into the far-end secondary tumors piece of not expressing LIGHT.For fear of the probability of the system of the Ad-LIGHT that can arrive far-end tumor diffusion, we continue to use Ag104L dOr the Ag104L of expression LIGHT dThere is the problem that whether can cause antineoplastic immune on the far-end tumor in tumor system to solve the part of LIGHT in primary tumor.We use model system same as described above, wherein with the adoptive transfer of 2C T cell to carrying Ag104L dThe OT-1 mice of tumor, but these two tumors of every OT-1 mouse inoculation.Primary tumor is 10 6Ag104L dOr Ag104L d-LIGHT, and secondary tumors is 10 5Ag104L dBehind the tumor challenge 10-14 days, shift the 2C T cell of CFSE labelling.Estimated the propagation of 2C T in the 3rd, 5 and 10 day in adoptive transfer back to the tumor.Shifted back 3 days, at the Ag104L that expresses LIGHT dThere is CFSE in the primary tumor HiZeng Zhi 2C cell not.By the original position dilution of CFSE, observed the propagation subsequently of these 2C T cells in back 5 days in transfer.By the 10th day, at Ag104L dFind the 2C T cell (Fig. 5 B) of a large amount of propagation in the-LIGHT tumor.At Secondary cases Ag104L dIn the tumor, carrying Ag104L dIn the mice of-LIGHT tumor than carrying Ag104L dMice in the existing of 2C T cell (Fig. 5 B and C) of higher frequency detecting to the CFSE labelling of dilution.Carrying two Ag104L dAll only detect the 2C T cell (Fig. 5 C) of a small set of infiltration tumor in constitutional of the mice of tumor and the secondary tumors.These data have supported some activated T cells with antigenic specificity of following viewpoint: LIGHT treatment back can move out of primary tumor and go to secondary tumors.
Embodiment 7: Ad-LIGHT produces more CTL at the primary tumor position
Up to the present our experimental result illustrates that activated T cells with antigenic specificity can not expressed the tumor migration of LIGHT to the distant place in the environment of LIGHT mediation.In order to check Ad-LIGHT whether can produce more antitumor CTL from primary tumor, these CTL systemic circulation are to repel the far-end tumor then, we have carried out the adoptive transfer experiment, produce repulsive interaction with the research tumor whether the T cell of lymphatic organ of mice of treatment can mediate having set up of hanging oneself.Because usually being transferred property 4T1 tumor cell pollution of 2 all secondary lymphoid tissues behind the tumor challenge is so these experiments can not be used the 4T1 model.We have given the C3B6F1 mouse inoculation 10 5Individual Ag104L dTumor cell, then behind tumor inoculation 14 days with 5 * 10 9PfuAd-LIGHT or Ad-control treatment.At the 21st day, collect spleen and lymph node and purification T cell from the mice of handling, with 10 7The adoptive transfer of individual T cell is to through setting up Ag104L in 7 days dIn the C3B6F1 mice body of tumor.We find, the mice of accepting the T cell of the mice of handling from Ad-LIGHT all repels its tumor, and accept to die from tumor load (Fig. 5 D) from those mices of the T cell of the mice of Ad-control treatment.This presentation of results, Ad-LIGHT are handled but not the activatory T cells with antigenic specificity that exists in the circulation after the contrast virus treated is enough to repel the far-end tumor of having set up.These results also illustrate, can produce more CTL with Ad-LIGHT topical therapeutic tumor and enter drain LN, and these CTL can attack the far-end tumor of having set up afterwards.
The topical therapeutic of embodiment 8:Ad-LIGHT strengthens in cell-mediated the replying of the T of this local location and remote location
Estimate the tumor environment whether the Ad-LIGHT treatment directly changes primary tumor position and remote location, be separated by 6 days to twice subcutaneous vaccination Ag104L of C3B6F1 mice dTumor is to simulate the formation of new subcutaneous metastatic tumor.Secondary tumors is inoculated back 5 days, Ad-LIGHT treatment in primary tumor imposes tumor.We find that constitutional and secondary tumors are all repelled in the mice of handling with Ad-LIGHT, and the development (Fig. 6 A) of tumor occurs with the mice of Ad-control treatment.Because the effect of Ad-LIGHT is the CD8 mediation, still checked CD8 in DLN, spleen, constitutional and the secondary tumors +The T cell accounts for Ly5.2 +The effector lymphocyte of leukocytic percent and generation IFN-γ is at these all CD8 +Shared percent in the T cell.Ad-LIGHT handles CD8 in back primary tumor and the secondary tumors +The effect CD8 of T cell and generation IFN-γ +The quantity of T cell all increases (Fig. 6 B and C) sharp.Cause the generation of the antineoplastic immune of tumour regression may relevant with the change of cytokine environment (27).In order to check the cytokine environment in these lymphatic organs and in the tumor self, after Ad-LIGHT or Ad-control treatment, gathered in the crops spleen and tumor tissues in 7 days, grind these tissues and collect supernatant and be used for cytokine assay.We find, with respect to spleen with the mice of Ad-control treatment, and the cytokine of being tested, TNF-α, IFN-γ, IL-2, IL-4, IL-5, IL-6, none exists significantly and changes in the spleen of the mice that Ad-LIGHT handles.Yet TNF-α and IFN-y all have sizable increase (Fig. 6 D) in constitutional and secondary tumors under Ad-LIGHT handles.Therefore, tumor rejection is accompanied by CD8 +The increase of T cell, by effect CD8 +The output of the IFN-γ that the T cell produces increases and inflammatory cytokine TNF-α and the increase of IFN-γ in constitutional and secondary tumors.The treatment on primary tumor of these presentation of results, Ad-LIGHT can produce a large amount of effector lymphocytes from this tumor, and these cells can be reconnoitred surrounding tissue effectively and reply the far-end tumor, thereby causes the decline of secondary tumors load.
The codon of embodiment 9:LIGHT is modified
In order to obtain better to transcribe and translate, the inventor has optimized the codon of LIGHT.Codon is modified the 10-15% that has changed gene, to optimize GC content etc., does not still change amino acid sequence coded.
Fig. 7 has shown the protease site that suddenlyd change, has optimized the mice LIGHT sequence (SEQ ID NO:3) of codon simultaneously again.Synthetic gene sequence, and with synthetic gene clone in plasmid.LIGHT (saltant LIGHT) with the wild type LIGHT and the protease site that suddenlyd change is contrast.The mice LIGHT nucleic acid of protease site of having suddenlyd change is seen NatureImmunology, Vol.5, and No.2, in February, 2004, p.141-149.
Test the 2ug plasmid DNA transfection in 293 cell lines by standard lipofetant.Two days later, measure the expression of LIGHT with mice LTbR-Ig.Measure by FACS and immunofluorescence dyeing.The result shows that sudden change is also expressed best through the LIGHT that codon is modified.The expression of saltant LIGHT also is better than wild type LIGHT.The results are shown in Figure 8.
On the whole, after modifying, protein expression has increased by 10 times.
This shows, the sudden change of protease site and codon are modified combined, is the method that a kind of new effective increase LIGHT expresses.
After the same method, the inventor has also optimized people's LIGHT.The sequence following (SEQ ID NO:2) of the LIGHT of wild type and codon modification and protease site sudden change.Confirm that by above identical experimental technique the people LIGHT that codon is modified has effectively increased the expression (result does not show) of LIGHT.
Normal person LIGHT (SEQ ID NO:1)
AGCCCAGGAGTGTTGAGCAATTTCGGTTTCCTCTGAGGTTGAAGGACCCAGGCGTGTCAG
Start codon＞
CCCTGCTCCAGACACCTTGGGC ATGGAGGAGAGTGTCGTACGGCCCTCAGTGTTTGTGGT
GGATGGACAGACCGACATCCCATTCACGAGGCTGGGACGAAGCCACCGGAGACAGTCGTG
CAGTGTGGCCCGGGTGGGTCTGGGTCTCTTGCTGTTGCTGATGGGGGCCGGGCTGGCCGT
CCAAGGCTGGTTCCTCCTGCAGCTGCACTGGCGTCTAGGAGAGATGGTCACCCGCCTGCC
TGACGGACCTGCAGGCTCCTGGGAGCAGCTGATACAAGAGCGAAGGTCTCACGAGGTCAA
CCCAGCAGCGCATCTCACAGGGGCCAACTCCAGCTTGACCGGCAGCGGGGGGCCGCTGTT
ATGGGAGACTCAGCTGGGCCTGGCCTTCCTGAGGGGCCTCAGCTACCACGATGGGGCCCT
TGTGGTCACCAAAGCTGGCTACTACTACATCTACTCCAAGGTGCAGCTGGGCGGTGTGGG
CTGCCCGCTGGGCCTGGCCAGCACCATCACCCACGGCCTCTACAAGCGCACACCCCGCTA
CCCCGAGGAGCTGGAGCTGTTGGTCAGCCAGCAGTCACCCTGCGGACGGGCCACCAGCAG
CTCCCGGGTCTGGTGGGACAGCAGCTTCCTGGGTGGTGTGGTACACCTGGAGGCTGGGGA
GAAGGTGGTCGTCCGTGTGCTGGATGAACGCCTGGTTCGACTGCGTGATGGTACCCGGTC
TTACTTCGGGGCTTTCATGGTGTGA
The codon of people LIHGT is modified (sudden change of codon modification and protease site) (SEQID NO:2)
Start codon＞
GAATTCGAGCTCGGTACCCGACACGGTACCGGATCCGCCACC ATGGAGGAGAGCGTTGTG
AGGCCCAGCGTGTTCGTGGTGGACGGCCAGACCGACATCCCCTTCACCCGGCTGGGCCGG
AGCCACCGGAGGCAGAGCTGCTCCGTGGCCAGAGTGGGGCTGGGCCTGCTGCTCCTGCTG
ATGGGAGCCGGCCTGGCCGTGCAGGGCTGGTTCCTGCTGCAGCTGCACTGGCGGCTGGGC
GAGATGGTGACCCGGCTGCCCGATGGCCCTGCCGGCAGCTGGCAGGAGCGGCGGAGCCAC
GAGGTGAACCCTGCCGCCCACCTGACCGGCGCCAACAGCAGCCTGACCGGCAGCGGCGGA
CCCCTGCTGTGGGAGACCCAGCTGGGCCTGGCCTTCCTGAGGGGCCTGAGCTACCACGAC
GGCGCCCTGGTGGTGACCAAGGCCGGCTACTACTACATCTACAGCAAGGTGCAGCTGGGC
GGAGTGGGCTGCCCTCTGGGGCTGGCCAGCACCATCACCCACGGCCTGTACAAGCGGACC
CCCAGATACCCCGAGGAGCTGGAGCTGCTGGTGTCCCAGCAGAGCCCCTGTGGCAGGGCC
ACCTCCAGCAGCCGGGTGTGGTGGGACAGCAGCTTCCTGGGCGGCGTGGTGCACCTGGAG
GCCGGCGAGAAAGTGGTTGTGAGGGTGCTGGACGAGCGGCTTGTGAGGCTGAGGGACGGC
ACCCGGAGCTACTTCGGCGCCTTCATGGTGTGATGAGCGGCCGCGAGCTCGTCTCGGGGA
TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTG
List of references
Incorporate this paper into as a reference below with reference to document, they replenish, explain or instructed method used herein, technology and/or compositions, perhaps provide to these methods, technology and/or compositions background is provided.
1.Fidler，I.J.2003.The?pathogenesis?of?cancer?metastasis：the′seed?andsoil′hypothesis?revisited.Nat?Rev?Cancer?3：453-458.
2.Koscielny，S.，M.Tubiana，M.G.?Le，A.J.Valleron，H.Mouriesse，G.Contesso，and?D.Sarrazin.1984.Breast?cancer：relationship?betweenthe?size?of?the?primary?tumour?and?the?probability?of?metastaticdissemination.Br?J?Cancer?49：709-715.
3.Koscielny，S.，M.Tubiana，and?A.J.Valleron.1985.A?simulationmodel?of?the?natural?history?of?human?breast?cancer.Br?J?Cancer52：515-524.
4.Boon，T.，and?P.van?der?Bruggen.1996.Human?tumor?antigensrecognized?by?T?lymphocytes.J?Exp?Med?183：725-729.
5.Rosenberg，S.A.1999.A?new?era?for?cancer?immunotherapy?based?onthe?genes?that?encodon?cancer?antigens.Immunity?10：281-287.
6.Schreiber，H.?2003.Tumor?Immunology.In?FundamentalImmunology.W.E.Paul，editor.Lippincott?Raven?Press，New?York.1557-1592.
7.Willimsky，G.，and?T.Blankenstein.2005.Sporadic?immunogenictumours?avoid?destruction?by?inducing?T-cell?tolerance.?Nature437：141-146.
8.Rosenberg，S.A.?2005.?The?emergence?of?modern?cancerimmunotherapy.Ann?Surg?Oncol?12：344-346.
9.Rosenberg，S.A.，J.C.?Yang，and?N.P.?Restifo.?2004.Cancerimmunotherapy：moving?beyond?current?vaccines.Nat?Med10：909-915.
10.Danna，E.A.，P.?Sinha，M.Gilbert，V.K.Clements，B.A.Pulaski，andS.Ostrand-Rosenberg.2004.Surgical?removal?of?primary?tumorreverses?tumor-induced?immunosuppression?despite?the?presence?ofmetastatic?disease.Cancer?Res?64：2205-2211.
11.Mullen，C.A.，D.A.?Rowley，and?H.?Schreiber.?1989.?Highlyimmunogenic?regressor?tumor?cells?can?prevent?development?ofpostsurgical?tumor?immunity.Cell?Immunol?119：101-113.
12.Nguyen，L.T.，A.R.?Elford，K.?Murakami，K.M.?Garza，S.P.Schoenberger，B.Odermatt，D.E.Speiser，and?P.S.Ohashi.2002.Tumor?growth?enhances?cross-presentation?leading?to?limited?T?cellactivation?without?tolerance.J?Exp?Med?195：423-435.
13.Debes，G.F.，C.N.Arnold，A.J.Young，S.Krautwald，M.Lipp，J.B.Hay，and?E.C.Butcher.?2005.Chemokine?receptor?CCR7?requiredfor?T?lymphocyte?exit?from?peripheral?tissues.Nat?Immunol6：889-894.
14.Bromley，S.K.，S.Y.Thomas，and?A.D.Luster.2005.Chemokinereceptor?CCR7?guides?T?cell?exit?from?peripheral?tissues?and?entryinto?afferent?lymphatics.Nat?Immunol?6：895-901.
15.Mauri，D.N.，R.Ebner，R.I.Montgomery，K.D.Kochel，T.C.Cheung，G.L.Yu，S.Ruben，M.Murphy，R.J.Eisenberg，G.H.Cohen，P.G.Spear，and?C.F.?Ware.1998.LIGHT，a?new?member?of?the?TNFsuperfamily，and?lymphotoxin?alpha?are?ligands?for?herpesvirusentry?mediator.Immunity?8：21-30.
16.Ngo，V.N.，H.Korner，M.D.Gunn，K.N.Schmidt，D.S.Riminton，M.D.Cooper，J.L.Browning，J.D.Sedgwick，and?J.G.?Cyster.?1999.Lymphotoxin?alpha/beta?and?tumor?necrosis?factor?are?required?forstromal?cell?expression?of?homing?chemokines?in?B?and?T?cell?areas?ofthe?spleen.J?Exp?Med?189：403-412.
17.Wu，Q.，Y.?Wang，J.Wang，E.O.Hedgeman，J.L.Browning，and?Y.X.Fu.?1999.?The?requirement?of?membrane?lymphotoxin?for?thepresence?of?dendritic?cells?in?lymphoid?tissues.?J?Exp?Med190：629-638.
18.Wang，J.，A.Foster，R.Chin，P.?Yu，Y.?Sun，Y.?Wang，K.Pfeffer，andY.X.Fu.2002.The?complementation?of?lymphotoxin?deficiency?withLIGHT，a?newly?discovered?TNF?family?member，for?the?restorationof?secondary?lymphoid?structure?and?function.Eur?J?Immunol32：1969-1979.
19.Tamada，K.，K.Shimozali，A.I.Chapoval，G.?Zhu，G.?Sica，D.Flies，T.Boone，H.Hsu，Y.X.Fu，S.Nagata，J.Ni，and?L.Chen.2000.Modulation?of?T-cell-mediated immunity?in?tumor?andgraft-versus-host?disease?models?through?the?LIGHT?co-stimulatorypathway.Nat?Med?6：283-289.
20.Ware，C.F.?2005.Network?communications：lymphotoxins，LIGHT，and?TNF.?Annu?Rev?Immunol?23：787-819.
21.Wang，J.，R.A.Anders，Y.?Wang，J.R.Turner，C.Abraham，K.Pfeffer，and?Y.X.Fu.2005.The?critical?role?of?LIGHT?in?promoting?intestinalinflammation?and?Crohn′s?disease.J?Immunol?174：8173-8182.
22.Yu，P.，Y.?Lee，W.?Liu，R.K.Chin，J.Wang，Y.?Wang，A.Schietinger，M.Philip，H.Schreiber，and?Y.X.Fu.2004.Priming?of?naive?T?cellsinside?tumors?leads?to?eradication?of?established?tumors.?NatImmunol?5：141-149.
23.Miller，F.R.，B.E.Miller，and?G.H.Heppner.1983.Characterization?ofmetastatic?heterogeneity?among?subpopulations?of?a?single?mousemammary?tumor：heterogeneityin?phenotypic?stability.InvasionMetastasis?3：22-31.
24.Parviz，M.，C.S.Chin，L.J.Graham，C.Miller,?C.Lee，K.George，and?H.D.Bear.2003.Successful?adoptive?immunotherapy?withvaccine-sensitized?T?cells，despite?no?effect?with?vaccination?alone?ina?weakly?immunogenic?tumor?model.Cancer?Immunol?Immunother52：739-750.
25.Pulaski，B.A.，and?S.Ostrand-Rosenberg.1998.Reduction?ofestablished?spontaneous?mammary?carcinoma?metastases?followingimmunotherapy?with?major?histocompatibility?complex?class?II?andB7.1?cell-based?tumor?vaccines.Cancer?Res?58：1486-1493.
26.Yu，P.，M.T.Spiotto，Y.Lee，H.Schreiber，and?Y.X.Fu.2003.Complementary?role?of?CD4+T?cells?and?secondary?lymphoid?tissuesfor?cross-presentation?of?tumor?antigen?to?CD8+T?cells.J?Exp?Med197：985-995.
27.Yu，P.，Y.?Lee，W.Liu，T.Krausz，A.Chong，H.Schreiber，and?Y.X.Fu.?2005.?Intratumor?depletion?of?CD4+?cells?unmasks?tumorimmunogenicity?leading?to?the?rejection?of?late-stage?tumors.J?ExpMed?201：779-791.
28.Bessis，N.，F.J.GarciaCozar，and?M.C.Boissier.?2004.Immuneresponses?to?gene?therapy?vectors：influence?on?vector?function?andeffector?mechanisms.Gene?Ther?11?Suppl?1：S10-17.
29.Wick，M.，P.?Dubey，H.Koeppen，C.T.Siegel，P.E.Fields，L.Chen，J.A.Bluestone，and?H.Schreiber.1997.Antigenic?cancer?cells?growprogressively?in?immune?hosts?without?evidence?for?T?cell?exhaustionor?systemic?anergy.J?Exp?Med?186：229-238.
30.Blank，C.，I.Brown，A.C.Peterson，M.Spiotto，Y.?Iwai，T.Honjo，andT.F.?Gajewski.2004.PD-L1/B7H-1?inhibits?the?effector?phase?oftumor?rejection?by?T?cell?receptor(TCR)?transgenic?CD8+T?cells.Cancer?Res?64：1140-1145.
Sequence table
＜110〉Fu Yangxin
＜120〉be used to prevent and treat the compositions of metastatic tumo(u)r
<130>IDC050145
<160>2
<170>PatentIn?version?3.2
<210>1
<211>805
<212>DNA
＜213〉people
<400>1
agcccaggag?tgttgagcaa?tttcggtttc?ctctgaggtt?gaaggaccca?ggcgtgtcag 60
ccctgctcca?gacaccttgg?gcatggagga?gagtgtcgta?cggccctcag?tgtttgtggt 120
ggatggacag?accgacatcc?cattcacgag?gctgggacga?agccaccgga?gacagtcgtg 180
cagtgtggcc?cgggtgggtc?tgggtctctt?gctgttgctg?atgggggccg?ggctggccgt 240
ccaaggctgg?ttcctcctgc?agctgcactg?gcgtctagga?gagatggtca?cccgcctgcc 300
tgacggacct?gcaggctcct?gggagcagct?gatacaagag?cgaaggtctc?acgaggtcaa 360
cccagcagcg?catctcacag?gggccaactc?cagcttgacc?ggcagcgggg?ggccgctgtt 420
atgggagact?cagctgggcc?tggccttcct?gaggggcctc?agctaccacg?atggggccct 480
tgtggtcacc?aaagctggct?actactacat?ctactccaag?gtgcagctgg?gcggtgtggg 540
ctgcccgctg?ggcctggcca?gcaccatcac?ccacggcctc?tacaagcgca?caccccgcta 600
ccccgaggag?ctggagctgt?tggtcagcca?gcagtcaccc?tgcggacggg?ccaccagcag 660
ctcccgggtc?tggtgggaca?gcagcttcct?gggtggtgtg?gtacacctgg?aggctgggga 720
gaaggtggtc?gtccgtgtgc?tggatgaacg?cctggttcga?ctgcgtgatg?gtacccggtc 780
ttacttcggg?gctttcatgg?tgtga 805
<210>2
<211>814
<212>DNA
＜213〉synthetic
<400>2
gaattcgagc?tcggtacccg?acacggtacc?ggatccgcca?ccatggagga?gagcgttgtg 60
aggcccagcg?tgttcgtggt?ggacggccag?accgacatcc?ccttcacccg?gctgggccgg 120
agccaccgga?ggcagagctg?ctccgtggcc?agagtggggc?tgggcctgct?gctcctgctg 180
atgggagccg?gcctggccgt?gcagggctgg?ttcctgctgc?agctgcactg?gcggctgggc 240
gagatggtga?cccggctgcc?cgatggccct?gccggcagct?ggcaggagcg?gcggagccac 300
gaggtgaacc?ctgccgccca?cctgaccggc?gccaacagca?gcctgaccgg?cagcggcgga 360
cccctgctgt?gggagaccca?gctgggcctg?gccttcctga?ggggcctgag?ctaccacgac 420
ggcgccctgg?tggtgaccaa?ggccggctac?tactacatct?acagcaaggt?gcagctgggc 480
ggagtgggct?gccctctggg?gctggccagc?accatcaccc?acggcctgta?caagcggacc 540
cccagatacc?ccgaggagct?ggagctgctg?gtgtcccagc?agagcccctg?tggcagggcc 600
acctccagca?gccgggtgtg?gtgggacagc?agcttcctgg?gcggcgtggt?gcacctggag 660
gccggcgaga?aagtggttgt?gagggtgctg?gacgagcggc?ttgtgaggct?gagggacggc 720
acccggagct?acttcggcgc?cttcatggtg?tgatgagcgg?ccgcgagctc?gtctcgggga 780
tcctctagag?tcgacctgca?ggcatgcaag?cttg 814

Claims (39)

1. comprise the immunocyte activator, be used for the prevention or the treatment tumor (particularly metastatic tumo(u)r) pharmaceutical composition, particularly therapeutic vaccine or preventative vaccine.
2. the pharmaceutical composition of claim 1, wherein said immunocyte activator be the polypeptide of coding immune cell activated or coding immune cell activated polypeptide nucleic acid or comprise its Pharmaceutical composition; Especially, described activator is the nucleic acid of LIGHT polypeptide or coding LIGHT.
3. each pharmaceutical composition of claim 1-2, wherein said immunocyte activator are the recombinant vector that comprises and express the nucleic acid of coding LIGHT (for example recombinant virus, preferred recombinant adenovirus or fowlpox virus).
4. each pharmaceutical composition of claim 1-3, wherein said immunocyte activator is tumor cell or the tumor (preferably, this tumor cell or tumor also comprise and expressing tumor antigen) that comprises and express the nucleic acid of coding LIGHT; Particularly described pharmaceutical composition is as therapeutic vaccine or preventative vaccine.
5. each pharmaceutical composition of claim 1-4, wherein said medicine adopts administration in systematicness or the tumor.
6. the immunocyte activator is used for the purposes of the medicine of prevention or treatment tumor (particularly metastatic tumo(u)r) in preparation.
7. the purposes of claim 6, wherein the immunocyte activator is each described immunocyte activator of claim 2-4.
8. be used to eliminate the Pharmaceutical composition of primary tumor, prevention metastatic tumo(u)r and/or the existing metastatic tumo(u)r of treatment, it contains the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT.
9. comprise and express the recombinant vector (recombinant virus for example of the nucleic acid of coding LIGHT, preferred recombinant adenovirus or fowlpox virus) purposes in the preparation medicine, described medicine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment; For example, this medicine can come administration by described recombinant virus being imported in the primary tumor or through systemic approach.
10. the tumor cell or the tumor that comprise the immunocyte activator; Preferably, this tumor cell or tumor are also by radiation treatment.
11. the tumor cell of claim 10 or tumor, it is tumor cell or the tumor that comprises and express the nucleic acid of coding LIGHT; Preferably, this tumor cell or tumor also comprise and expressing tumor antigen.
12. the tumor cell of claim 10 or tumor, the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that it has been transduceed and has comprised and express the nucleic acid of coding LIGHT.
13. comprise each tumor cell or the Pharmaceutical composition of tumor, particularly therapeutic vaccine or preventative vaccine of claim 10-12.
14. be used to eliminate the therapeutic and/or the preventative tumor vaccine of primary tumor, prevention metastatic tumo(u)r and/or the existing metastatic tumo(u)r of treatment, this tumor vaccine comprises each tumor cell or tumor of claim 10-12; Preferably, this tumor vaccine also can comprise pharmaceutically suitable carrier.
15. comprise and express the recombinant vector (recombinant virus for example of the nucleic acid of coding LIGHT, preferred recombinant adenovirus or fowlpox virus) purposes in preparation therapeutic and/or preventative tumor vaccine, described tumor vaccine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
16. each tumor cell or the purposes of tumor in preparation therapeutic and/or preventative tumor vaccine of claim 10-12, described tumor vaccine is used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
17. the purposes of the tumor vaccine of claim 14 in the preparation medicine, described medicine are used to eliminate the existing metastatic tumo(u)r of primary tumor, prevention metastatic tumo(u)r and/or treatment.
18. be used to strengthen the expression immunostimulant of the immunity of liver metastasis tumor, primary tumor and/or viral infection (for example HBV and HCV), it contains the recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) that comprises and express the nucleic acid of coding LIGHT.
19. contain the recombinant vector (recombinant virus for example that comprises and express the nucleic acid of coding LIGHT, preferred recombinant adenovirus or fowlpox virus) be used for preparing the purposes of expressing immunostimulant, described expression immunostimulant is used to strengthen the immunity of liver metastasis tumor, primary tumor and/or viral infection (for example HBV and HCV).
20. comprise and express the purposes of recombinant vector (for example recombinant virus, preferably recombinant adenovirus or fowlpox virus) in the preparation medicine of the nucleic acid of coding LIGHT, described medicine is used for increasing liver TNF-α and IFN-γ or CD8+T cell.
21. each pharmaceutical composition or purposes or vaccine of claim 1-9,13-20, wherein said medicine or pharmaceutical composition and other medicines or Therapeutic Method are united use, for example with primary tumor excision and/or chemotherapy and/or radiotherapy.
22. the pharmaceutical composition of claim 21 or purposes or vaccine are giving the immunocyte activator or giving tumor vaccine after the primary tumor excisions in primary tumor before the primary tumor excision.
23. comprise and express the recombinant virus of the nucleic acid of encoding mutant LIGHT, preferably, this recombinant virus is recombinant adenovirus or fowlpox virus; Preferably, described sudden change LIGHT comprises and stops the sudden change of protease to its degraded, and for example, described sudden change LIGHT is the LIGHT that does not contain protease cracking site, does not particularly contain the sudden change LIGHT of the proteolysis site EQLI of people LIGHT albumen 81-84 position; In another embodiment, described sudden change LIGHT has extracellular domain amino acid sequence and sequence label (for example being convenient to the label of purification), as has the aminoacid sequence and the flag sequence of LIGHT 85-239 position.
24. comprise the Pharmaceutical composition of the recombinant virus of claim 23, particularly therapeutic vaccine or preventative vaccine.
25. the recombinant virus of claim 23 or the compositions of claim 24 are used for the treatment of purposes in the medicine of cancer in preparation.
26. comprise and express the tumor cell or the tumor of the nucleic acid of encoding mutant LIGHT, preferably, this tumor cell or tumor also comprise and expressing tumor antigen.
27. comprise the tumor cell of claim 26 or the Pharmaceutical composition of tumor, particularly therapeutic vaccine or preventative vaccine.
28. the pharmaceutical composition that comprises the immunocyte activator, is used to strengthen interior immunity of liver organization and/or prevention or treats the hepatopathy pathogen infection.
29. the pharmaceutical composition of claim 28, wherein said immunocyte activator be the polypeptide of coding immune cell activated or coding immune cell activated polypeptide nucleic acid or comprise its Pharmaceutical composition; Especially, described activator is the nucleic acid of LIGHT polypeptide or coding LIGHT.
30. each pharmaceutical composition of claim 28-29, wherein said immunocyte activator are the recombinant vector that comprises and express the nucleic acid of coding LIGHT (for example recombinant virus, preferred recombinant adenovirus or fowlpox virus).
31. the immunocyte activator is used for preventing or treating the purposes of the medicine of hepatopathy pathogen infection in preparation.
32. the purposes of claim 31, wherein the immunocyte activator is each described immunocyte activator of claim 29-30.
33. claim 28-29 each pharmaceutical composition or the purposes of claim 31-32, wherein the hepatopathy pathogen infection is viral infection (for example HBV and HCV).
34. each compositions, purposes, tumor cell or tumor or vaccine of claim 1-22 and 28-33, the LIGHT polypeptide of wherein said LIGHT polypeptide or described nucleic acid coding is wild type people LIGHT.
35. each compositions, purposes, tumor cell or tumor or vaccine of claim 1-22 and 28-33, the LIGHT polypeptide of wherein said LIGHT polypeptide or described nucleic acid coding is the LIGHT of sudden change for wild type people LIGHT; Preferably, described sudden change LIGHT comprises and stops the sudden change of protease to its degraded, for example, described sudden change LIGHT is the LIGHT that does not contain protease cracking site, the mice sudden change LIGHT that does not particularly contain the proteolysis site EKLI of mice LIGHT albumen 79-82 position, the people who does not perhaps contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position LIGHT that suddenlys change; In another embodiment, described sudden change LIGHT has extracellular domain amino acid sequence and sequence label (for example being convenient to the label of purification), as has the aminoacid sequence and the flag sequence of LIGHT 85-239 position.
36. each compositions of claim 1-35, purposes, tumor cell or tumor, vaccine, perhaps recombinant virus, wherein said LIGHT code nucleic acid is to have carried out codon optimized nucleic acid with respect to the host, more preferably carried out codon optimized and the protease cracking site that suddenlyd change to stop the nucleic acid of protease to the LIGHT protein degradation of coding, for example, coding does not contain the mice sudden change LIGHT polypeptide of proteolysis site EKLI of mice LIGHT albumen 79-82 position or the people that do not contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position nucleic acid that LIGHT polypeptide and codon optimize that suddenlys change, the code nucleic acid shown in the preferred SEQ ID NO:2 and 3.
37. codon optimization but do not change the LIGHT code nucleic acid of aminoacid sequence, preferred people LIGHT code nucleic acid.
38. the codon optimization and the protease cracking site that suddenlyd change are to stop the nucleic acid of protease to the LIGHT protein degradation of coding, for example, coding does not contain the mice sudden change LIGHT polypeptide of proteolysis site EKLI of mice LI GHT albumen 79-82 position or the people that do not contain the proteolysis site EQLI of the people LIGHT albumen 81-84 position nucleic acid that LIGHT polypeptide and codon optimize that suddenlys change, the code nucleic acid shown in the preferred SEQ ID NO:2 and 3.
39. comprise the carrier of nucleic acid of claim 37 and 38 and the host cell that has transformed this carrier.
CN 200610086817 2006-06-19 2006-06-19 Composition in use for preventing and treating metastatic tumor Pending CN101091794A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 200610086817 CN101091794A (en) 2006-06-19 2006-06-19 Composition in use for preventing and treating metastatic tumor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 200610086817 CN101091794A (en) 2006-06-19 2006-06-19 Composition in use for preventing and treating metastatic tumor

Publications (1)

Publication Number Publication Date
CN101091794A true CN101091794A (en) 2007-12-26

Family

ID=38990351

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200610086817 Pending CN101091794A (en) 2006-06-19 2006-06-19 Composition in use for preventing and treating metastatic tumor

Country Status (1)

Country Link
CN (1) CN101091794A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102787119A (en) * 2011-05-17 2012-11-21 傅阳心 Products and methods for treatment and/or prevention of virus infections
CN104721816A (en) * 2015-03-30 2015-06-24 河北科技大学 Preparation method and application of liver cancer immunogen Z1
CN104740621A (en) * 2015-03-25 2015-07-01 黑龙江八一农垦大学 Preparation method and application of antitumor immunogen Z5
CN105876780A (en) * 2008-09-19 2016-08-24 雀巢产品技术援助有限公司 Nutritional support of the immune system during anti-cancer treatment

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105876780A (en) * 2008-09-19 2016-08-24 雀巢产品技术援助有限公司 Nutritional support of the immune system during anti-cancer treatment
CN102787119A (en) * 2011-05-17 2012-11-21 傅阳心 Products and methods for treatment and/or prevention of virus infections
CN104740621A (en) * 2015-03-25 2015-07-01 黑龙江八一农垦大学 Preparation method and application of antitumor immunogen Z5
CN104740621B (en) * 2015-03-25 2017-12-05 黑龙江八一农垦大学 A kind of antineoplastic immune original Z5 preparation method and application
CN104721816A (en) * 2015-03-30 2015-06-24 河北科技大学 Preparation method and application of liver cancer immunogen Z1

Similar Documents

Publication Publication Date Title
Narvaiza et al. Intratumoral coinjection of two adenoviruses, one encoding the chemokine IFN-γ-inducible protein-10 and another encoding IL-12, results in marked antitumoral synergy
Belardelli et al. Interferon-alpha in tumor immunity and immunotherapy
Pien et al. A unique mechanism for innate cytokine promotion of T cell responses to viral infections
Casares et al. CD4+/CD25+ regulatory cells inhibit activation of tumor-primed CD4+ T cells with IFN-γ-dependent antiangiogenic activity, as well as long-lasting tumor immunity elicited by peptide vaccination
Zitvogel et al. Interleukin‐12 and B7. 1 co‐stimulation cooperate in the induction of effective antitumor immunity and therapy of established tumors
Todryk et al. CD40 ligation for immunotherapy of solid tumours
Yu et al. Targeting the primary tumor to generate CTL for the effective eradication of spontaneous metastases
Schmitz et al. Adenovirus-mediated CD40 ligand gene therapy in a rat model of orthotopic hepatocellular carcinoma
CA2293805C (en) Use of mhc class ii ligands as adjuvant for vaccination and of lag-3 in cancer treatment
WO2018097540A9 (en) Serum-free immune cell-culturing medium-added kit, method for culturing immune cells by using same kit, serum-free immune cell culture obtained by same kit or culturing method, and cosmetic composition comprising same culture
Bridle et al. Privileged antigen presentation in splenic B cell follicles maximizes T cell responses in prime-boost vaccination
KR20190033066A (en) Adoptive cell delivery and tumor decay virus combination therapy
WO2017023138A1 (en) Chimeric antigen receptor, and t cells in which chimeric antigen receptor is expressed
US10953045B2 (en) Agents and compositions for eliciting an immune response
Zhang et al. Tumour necrosis factor‐α (TNF‐α) transgene‐expressing dendritic cells (DCs) undergo augmented cellular maturation and induce more robust T‐cell activation and anti‐tumour immunity than DCs generated in recombinant TNF‐α
Ju et al. Immunity to melanoma mediated by 4‐1BB is associated with enhanced activity of tumour‐infiltrating lymphocytes
CN101091794A (en) Composition in use for preventing and treating metastatic tumor
Miller et al. Optimization of dendritic cell maturation and gene transfer by recombinant adenovirus
KR101723786B1 (en) Composition for preventing or treating B-cell lymphoma comprising IL-21 expressing mesenchymal stem cells
Bubenı́k et al. Interleukin-2 and dendritic cells as adjuvants for surgical therapy of tumours associated with human papillomavirus type 16
WO2021040064A1 (en) Pharmaceutical composition comprising vaccinia virus and hydroxyurea as active ingredient for treatment of cancer
WO2022045827A1 (en) Novel coronavirus recombinant spike protein, polynucleotide encoding same, vector comprising polynucleotide, and vaccine for preventing or treating coronavirus infection, comprising vector
Li et al. Protective immunity induced by B7/CD28-costimulated gamma delta T cells to the EL-4 lymphoma in allogenic athymic mice.
US20040043040A1 (en) SDF-1 beta tumor vaccines and uses therefor
Fuzzati-Armentero et al. hu-PBL-SCID mice: an in vivo model of Epstein-Barr virus-dependent lymphoproliferative disease

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20071226