CN101082047B - Beta-glucosidase gene promoter and uses thereof - Google Patents

Abstract

The present invention discloses one kind of beta-glucosaccharase gene promoter and its application. The promoter has the nucleotide sequence as shown in SEQ ID No. 1 of the sequence list, or the nucleotide sequence capable of hybridizing with the DNA sequence defined by SEQ ID No. 1 of the sequence list under high strict condition. The beta-glucosaccharase gene promoter of the present invention can initiate reporter gene gusA for expressing in plant seedling root system specifically and effectively, with the expression level being higher than CaMV35S promoter commonly used in dicotyledon geneengineering. The beta-glucosaccharase gene promoter may be applied in plant gene engineering, especially for expressing specific target gene in plant seedling root system.

Description

A kind of beta-glucosidase gene promoter and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of corn beta-glucosidase gene promoter and application thereof.

Background technology

Plant diseases is produced to bring to farm crop and is seriously influenced, and the struggle of the mankind and Plant diseases is through the whole story of agriculture production.Rise in classical genetics early in the twentieth century and make people successfully cultivate the disease-resistant crop varieties that makes new advances, improve grain yield significantly by cross-breeding.In recent years, the continuous development of molecular biology theory and technology, the continuous innovation of plant genetic analysis and gene engineering, make people not only can from molecular level, further study the interaction mechanism of plant and pathogenic bacteria, but also can cultivate new disease-resistant crop varieties directly, fast and efficiently by this modern biotechnology of genetically engineered.Genetic engineering of plant for disease resistance refers to the resistance against diseases that improves plant with the means of genetically engineered (genetic transformation), and obtains the method for transgenic plant.Be cloned into first disease-resistant gene (Hm1) (JOHALGS since 1992, BRIGGS SP.Reductase activity encoded by the HM1 diseaseresistance gene in maize.Science, 1992,258:985-987), people have cloned and have obtained up to a hundred disease-resistant related genes, these disease-resistant gene great majority drive constitutive expression in plant by allos constitutive promoter (as CaMV 35S), and such expression can reach disease-resistant effect.But owing to mass expressing external albumen in some inessential tissues, the intravital energy of unnecessary consumption plant not only, increase the plant-growth burden, influence the good character of plant itself, and the too much resistance protein (most of resistance proteins are toxic proteins) that accumulates in crop edible tissue increased the genetically modified organism security risk, causes bigger genetically modified organism safety arguement.Therefore, genetic engineering of plant for disease resistance presses for suitable promotor now, and plant disease resistance genes can be expressed at plant specific etap and position.Promotor commonly used in the plant genetic engineering can be divided three classes by its mode of action and function: constitutive promoter, organizing specific type promotor and inducible promoter.Tissue-specific promoter can make expression of gene only limit to some specific organ or tissue position, and reduces the negative impact to plant.Sometimes, if drive disease-resistant gene in specific or local specific expression with tissue specificity or inducible promoter, not only disease-resistant purpose can be reached, impact and reduction transgenosis safe risk can also be reduced the good character of plant own.

In recent years, corn seedling diseases is more and more serious, and the less important disease by the past rises to main disease.General time average attack rate is about 10%, grave illness field piece often is short of seedling 30%～50%, form to downgrade sterile strain in addition ruin kind and the underproduction (Shanxi volleys, a pair of horses going side by side jumps refined, Song Shuyun, Li Hong, the sand flood woods, open big. the technical study of corn seedling diseases diagnosis and treatment. Jilin Agriculture University's journal, 2004,26 (4): 355～359).Corn seedling diseases can tentatively be divided into infectivity and noninfectious disease.Noninfectious disease mainly comprises the disease that factors such as nutritional deficiency disease, environment-stress and poisoning cause.Use improved seeds, agrotechnical measures such as enhancement of field management promptly can be controlled noninfectious disease.Infectious disease mainly is to be subjected to pathogenic bacteria (pathomycete; bacterium; virus) intrusion causes; The main pathogenic fungi has Fusarium graminearum (Fusarium graminearum); Fusarium moniliforme (Fusarium moniliforme); corn circle spot is from the spore bacterium (Helminthosporiumcarbo2num) that wriggles; dry thread Pyrenomycetes (Rhizoctonia solani); Fusarium moniliforme glue spore mutation (Flmoniliforme varl subglutinans); silk axle group's loose smut (Sporisoriumreilianum) and the false pseudomonas bacillus of corn (Pseudomonas zeae Hsia et Fang) etc. for infectious disease; general traditionally employing kind of a clothing agent is handled and is prevented and treated; to consume lot of manpower and material resources like this. the mankind that appear as of transgenic technology provide an inexpensive method. and the infectious disease in corn seedling stage is to invade from root mostly. exist a large amount of pathogenic bacterias the soil; also there is pathogenic bacteria in the fertilizer; sometimes seed self also has pathogenic bacteria; these pathogenic bacterias are invaded plant by root system behind seed germination; as pythium spp; fusarium moniliforme and rhizoctonia etc. some insect pest in seedling stage also is the root system insect pest in addition, as cutworm. so using gene engineering technique improve corn disease resistance in seedling stage focus on protecting root system.

So far the plant tissue specificity promoter that separates and studied reaches hundreds of, all successively be separated to the promotor that can tissue specificity drives reporter gene expression as root, leaf, pollen, vascular bundle and seed etc. in many tissues of plant, but special seedling stage strong expression, particularly the promotor of strong expression yet there are no report in root.

ZmGLU1 is a kind of energy specificity hydrolysis phytokinin beta-glucoside complex body and the enzyme that discharges the active cells mitogen.Its specific being distributed in the vigorous tissue of cell fission, particularly very high at the vigorous content in seedling stage of cell fission, therefore, the promotor of this gene may have very high activity seedling stage at corn.

Summary of the invention

(1) technical problem that will solve

The purpose of this invention is to provide a kind of beta-glucosidase gene promoter.

(2) technical scheme

Beta-glucosidase gene promoter provided by the present invention is the promotor of the beta-glucosidase ZmGLU1 gene of activation glucosides phytokinin in the corn cells in vivo mitogen homeostasis process.Has following nucleotide sequence: the nucleotide sequence of the SEQ ID NO:1 or the dna sequence dna hybridization that under the rigorous condition of height, can limit with SEQ ID NO:1 in the sequence table in the sequence table.

The rigorous condition of described height is washed film with the solution that contains 1 * SSC, 0.1%SDS for the hybridization back under 65 ℃.

Promotor called after ZmGLU1P with the nucleotide sequence of SEQ ID NO:1 in the sequence table is by 1907 based compositions.

The present invention also comprises the carrier that contains beta-glucosidase gene promoter, described carrier transformed host cells (comprising animal and plant cells system and host bacterium).

(3) beneficial effect

Beta-glucosidase gene promoter of the present invention can start reporter gene gusA gene and efficiently express in other tissue except mature seed.Particularly activity is the highest in the root of seedling, also stronger than CaMV 35S promoter, illustrate that it can make goal gene particularly efficiently express in the root of seedling in the most tissues of plant, but trace expression in mature seed, both can reach the purpose that transgenosis improves plant resistance to environment stress, can reduce the accumulation of foreign protein in seed again, thereby reduce influence the transgenic plant seed quality.This promotor will play a significant role in plant disease-resistant and transgenic corn seed improvement.

Description of drawings

The segmental electrophoretogram that is used to sieve the storehouse that Fig. 1 obtains for the RT-PCR amplification;

Fig. 2 A is the X-ray sheet scintigram that the hybridization in first round screening corn gene group library is developed;

Fig. 2 B is the X-ray sheet scintigram that second hybridization of taking turns screening corn gene group library is developed;

Fig. 2 C is the X-ray sheet scintigram that the hybridization in third round screening corn gene group library is developed;

The X-ray sheet scintigram that Fig. 2 D develops for the mono-clonal hybridization that the screening of checking third round obtains;

Fig. 3 A is the restriction enzyme digestion and electrophoresis collection of illustrative plates of lambda DNA;

Fig. 3 B is the hybridization collection of illustrative plates after lambda DNA enzyme is cut;

Fig. 4 A be the specific activity of ZmGLU1 promoter-driven GUS enzyme in each tissue of transgene tobacco and with CaMV 35S driven element driven GUS enzymic activity comparison diagram;

Fig. 4 B is the activity change figure of ZmGLU1 promoter-driven GUS enzyme in transgene tobacco fruit maturation and seed germination process.

Embodiment

Following examples further specify content of the present invention, but are not used for limiting invention which is intended to be protected.

What involved numeral-classifier compound * solution was represented among the embodiment is this solution of what times concentration, for example " 20 * SSC " represents the SSC of 20 times of concentration, need in use its dilution, when using be " 2 * SSC " expression be with above-mentioned solution dilution 10 times of uses; The described M of unit represents mol/L.

The preparation of material

1, bacterial strain and plasmid

Intestinal bacteria (E.coli) DH5 α, Agrobacterium LBA4404 all available from the host bacterium LE392 of vast company, lambda particles phage available from Clontech company.

2, toolenzyme and biochemical reagents

Various restriction enzymes and

The support agent box is available from Promega company; General T aq enzyme and Trizol RNA extract test kit in a small amount available from sky root company; The ExTaq enzyme is available from Takara company; The dNTP mixture is given birth to the worker available from Shanghai; The T4DNA ligase enzyme is available from Promega company; Naphthylacetic acid (NAA), penbritin (Amp), kantlex (Kan), Streptomycin sulphate (Sm) and Reflin (Cef) available from glad through company of section; Isotropic substance α- ³²P dCTP is available from the inferior brightness in Beijing biotech firm; Nylon membrane is available from Amersham company; 4-methyl umbellate form ketone (4-MU) and 4-methyl umbellate form keto acyl-beta-glucuronic acid acid anhydride enzyme (4-MUG) are all given birth to the worker available from Shanghai.

3, substratum

LB liquid nutrient medium (1 liter): 10g NaCl, 5g yeast extract, 10g Tryptones, pH7.0

LB solid medium (1 liter): 1 liter of liquid LB substratum adds 15g agar

YEB liquid nutrient medium (1 liter): 1g yeast extract, 10g peptone, 0.5gMgSO ₄7H ₂O, 5g sucrose, pH 7.5

YEB solid medium (1 liter): 1 liter of YEB liquid nutrient medium adds 15g agar

MS minimum medium (1 liter): the MS macroelement, the MS trace element, the MS organism, the basal component of each component is with reference to Murashige, T﹠amp; Skoog, MS medium component (Murashige, T﹠amp that F. delivered in 1962; Skoog, F.A revised medium for rapidgrowth and bioassays with tobacco tissue culture.Physiol.Plant.1962,15:473-497)

MS salts solution: only contain MS macroelement and trace element

MS solid medium: add 30g sucrose in 1 liter of MS minimum medium, 8g agar, pH5.6-5.8

Tobacco differentiation solid medium: add 30g sucrose in 1 liter of MS minimum medium, 8g agar, 3mg 6-BA, 0.2mg NAA, pH 5.6-5.8

Tobacco root induction substratum: 1 liter of MS minimum medium adds 30g sucrose, 8g agar, pH5.6-5.8

4. the required solution in screening-gene group library

1)20×SSC

175.3g NaCl(3.0M)

88.2g trisodium citrate (0.3M)

Transfer pH to 7.0 with NaOH, be settled to 1 liter, room temperature preservation is standby.

2)20×SSPE

175.3g NaCl(3.0M)

27.6g SODIUM PHOSPHATE, MONOBASIC (0.2M)

40ml 0.5M EDTA (final concentration 0.02M)

Transfer pH to 7.4 with NaOH, be settled to 1 liter, room temperature preservation is standby.

3) 50 * Denhardt liquid

5.0g ficoll (Ficoll)

5.0g polyvinylpyrrolidone (Polyvinylpyrrolidone)

5.0g BSA (component V)

Add water and be settled to 500ml ,-20 ℃ of preservations are standby.

4)20％SDS

5) 10 * lambda dilution buffer liquid

58.3g NaCl(0.1M)

24.65g MgSO ₄·7H ₂O(0.1M)

350ml 1.0M Tris-HCl (pH7.5) (final concentration 0.35M)

Add water and be settled to 1000ml.

5.PCR primer

Probe-F：5′-ACCTAGTAGGACCCAACAATGAGAG-3′

Probe-R：5′-CTCTTATCTAGGAAGCCGCCGTAC-3′

P1735-F：5′-CCGTCTAGAGGTGGAAATATCT?TCTCAAGC-3′

P1735-R：5′-TCCATGGCCCCCCCTTTGCT-3′

GUS-F：5′CAGGAAGTGATGGAGCATCAG?3′

GUS-R：5′TCGTGCACCATCAGCACGTTA?3′

It is synthetic that above primer is given birth to the worker by Shanghai.

The clone of embodiment 1 corn beta-glucosidase gene ZmGLU1 gene 5 ' flanking sequence

One, the preparation of probe

CDNA sequence (Accession No.X74217) according to ZmGLU1 gene among the GenBank designs a pair of primer (Probe-F and Probe-R).Extract test kit with Trizol RNA and extract the total RNA of corn seedling that sprouted 4 days, the method operation that extraction step provides by the test kit specification sheets.The total RNA of corn seedling with extraction is a template, carries out reverse transcription.

Getting 1 μ L Oligo (dT) 18, to be added to 10 μ L concentration be in the total rna solution of 200ng/ μ L, 70 ℃, be placed on cooled on ice 5 minutes in 5 minutes, and add following composition then:

Reagent volume

5 * reverse transcription damping fluid (providing in the test kit), 5 μ L

DNTP mixture (every kind of 10mM) 2.5 μ L

RNasin ribonuclease inhibitor (concentration is 50U/ μ L) 1 μ L

AMV ThermoScript II (30U/ μ L) 3 μ L

The DEPC treating water is settled to 25 μ L

The reaction conditions that is set as follows with reference to Promega company AMV Reverse Transcriptase working instructions: 25 ℃ of 10min, 42 ℃ of 60min, 70 ℃ of 10min, ice bath 2min.Being template with synthetic cDNA first chain then, is that primer carries out pcr amplification with Probe-F and Probe-R.

Reaction system is:

Reagent volume

10 * damping fluid (providing in the test kit), 5 μ L

DNTP mixture (every kind of 10mM) 1 μ L

Primer Probe-F (concentration is 10 μ M) 1 μ L

Primer Probe-R (concentration is 10 μ M) 1 μ L

Ex-Taq (5U/μL) 1μL

Reverse transcription product (concentration is 10ng/ μ L) 5 μ L

Aqua sterilisa is settled to 50 μ L

Reaction conditions:

94℃5min；

94 ℃ of 1min, 53 ℃ of 30s, 72 ℃ of 1min (7 circulations);

94 ℃ of 1min, 59 ℃ of 30s, 72 ℃ of 1min (30 circulations);

72℃7min；

4 ℃ of preservations.

The amplified production that obtains is carried out agarose gel electrophoresis, and the result shows that amplification obtains a fragment about 500bp as shown in Figure 1, with the probe of this fragment as screening corn gene group library.Among Fig. 1, left side swimming lane is 1kb ladder marker; Middle swimming lane is the purpose fragment; The right swimming lane is negative contrast.

Two, screening corn gene group library obtains ZmGLU1 gene 5 ' flanking sequence

1, corn gene group library

Corn gene group library is available from Clontech company, and catalog number (Cat.No.) is FL1032D.

2, the mensuration of library titre

1) single spot of a host bacterium of picking (LE392) (contains 10mM MgSO in 10ml LB liquid nutrient medium ₄, 0.2% maltose) in, shaken overnight under 200rpm, 37 ℃ of conditions makes OD ₆₀₀Reach about 2.0.

2) dilution of library phage

A. from the corn gene group library of buying, get 2 μ L lambda particles phage original seeds and be added to (thinning ratio is 1: 500) in 1ml 1 * lambda dilution buffer liquid.

B. taking out 20 μ L from above-mentioned dilution buffer liquid is added in 980 μ L, 1 * lambda dilution buffer liquid (thinning ratio is 1: 50).

C. add 100 μ L, 1 * lambda dilution buffer liquid at six test tubes, 200 μ L host bacterium add dilution phage damping fluid (step b gained) respectively: 0 μ L, 5 μ L, 10 μ L, 50 μ L, 100 μ L and 250 μ L then.

3), with above-mentioned six pipes 37 ℃ of water-baths about 20 minutes.

4) add 4ml dissolved 0.7%LB top layer substratum (about 50 ℃), then, fully be taped against on the 15%LB solid plate behind the mixing, the fast rotational culture dish makes the top layer substratum be uniformly distributed in whole flat board.

5), room temperature left standstill 10 minutes, treat the top layer culture medium solidifying after, be inverted at 37 ℃ and cultivate 6-7hr..

6), add up the plaque number that grows on each flat board, calculate the titre (pfu/ml) in library according to following formula:

The titre that six flat boards are recorded average into: 8.22 * 10 ⁸Pfu/ml.The titre in library is greater than 10 ⁸Pfu/ml is so this library can be used for screening.

3, screen the library with dna probe

1) preparation of bed board host bacterium;

The single bacterium colony of the host bacterium LE392 of inoculation lambda particles phage is in LB liquid nutrient medium (MgSO ₄10mM, maltose 0.2%), 37 ℃, 200rpm, shaking culture is to OD ₆₀₀Be 2.0, take out standby.

2) lambda particles phage infects host bacterium and bed board

Get in the mixture that top layer substratum that 15ml dissolves is added to phage after infecting and host bacterium, fully mixing is layered on rapidly on the preprepared 1.5%LB solid plate equably.Room temperature left standstill 10 minutes, treat the top layer culture medium solidifying after, be inverted to cultivate 5-8hr. at 37 ℃.When phage is long when the edge has just contacted with each other between different plaques, take out flat board and be put in 4 ℃, prepare against the commentaries on classics film of back.

3) absorption of plaque original position is fixed to nylon membrane

A. the suitable nylon membrane of size (more smaller) of clip than culture dish.On every film, cut three asymmetric breach, and with pencil label on film.

B. will number identical film with flat board and be put into gently on the plate culture medium, not produce bubble as far as possible.

C. be inserted in three asymmetric indentation, there that on film, shear in advance with the sterilization toothpick, as film return mark.Uncover nylon membrane carefully with aseptic nipper after 2 minutes, be adsorbed with one of phage and face up, be put on the clean filter paper, room temperature is dried.

D. the air dried film is put 5min respectively respectively in sex change liquid (1.5M NaCl, 0.5M NaOH) and neutralizer (1.5M NaCl, 0.5M Tris-HCl pH8.0).Forward the middle rinsing of 2 * SSC (0.3M NaCl, 0.03M trisodium citrate) then to once, film is put on the clean filter paper, room temperature is dried.

E.80 ℃, baking film 2hr., be put in after wrapping with preservative film 4 ℃ standby.

4) prehybridization

Press following one-tenth assignment system prehybridization solution:

After prehybridization solution prepares, prehybridization solution is put in the film taking-up that is stored in 4 ℃, 42 ℃, 40rpm is more than the prehybridization 4hr..

5) label probe

The dna probe of getting 4 μ L concentration and be 20ng/ μ L adds in the 26 μ L water, sex change 5min in boiling water, and then ice bath 5min adds following composition then successively:

5 * mark damping fluid (providing in the test kit), 10 μ L

DATP, dGTP, dTTP (every kind of 1.5mM) 2 μ L

BSA(10mg/ml) 2μL

Klenow fragment (5U/ μ L) 1 μ L

α- ³²P-dCTP(10μCi/μL) 5μL

After adding mentioned component, about 37 ℃ of mark 4hr..Wherein, the composition of 5 * mark damping fluid is as follows:

250mM Tris-HCL (pH8.0), 25mM MgCl ₂, 10mM DTT, 1M HEPES (pH6.6) and 6 bases deoxynucleotide primer at random.

6) hybridization

The probe that mark is good sex change 10min in boiling water is adding in the prehybridization solution after the cooling rapidly on ice.At 42 ℃, hybridization is 16-20 hour under the 40rpm condition.

7) wash selecting of film and pressure X-ray sheet and positive colony

After hybridization finished, film damping fluid 1 is washed in adding, and (2 * SSC, 0.5%SDS), 42 ℃, 40rpm washed 1hr..And then (1 * SSC, 0.1%SDS) (0.2 * SSC), 65 ℃, 40rpm respectively washes 1hr. with damping fluid 3 to use damping fluid 2 respectively.After washing the film end,, be pressed under the X-ray sheet after with preservative film film being wrapped up then with the most of liquid on the clean filter paper suction striping.On film, mark the position of positive spot according to image on the X-ray sheet.And then film is put on the culture plate of reference numeral the toothpick alignment on breach and the flat board.Choose the substratum that contains positive spot according to the label on the film and put into the 1.5ml centrifuge tube, add 1ml sterilization 1 * lambda diluent, room temperature is placed 1-2hr., phage is diffused out from substratum, 12000rpm is centrifugal 10 minutes then, collects supernatant liquor, is used for the next round screening.Through 3 take turns the screening and the checking, obtain 7 positive monoclonals (Fig. 2 A-Fig. 2 D) altogether.

4, lambda bacteriophage dna extracts

1) with 7 positive monoclonals difference bed boards, each two 200mm flat board in positive colony shop.When the surface of each flat board is almost completely covered by plaque, take out lambda dilution buffer liquid (20mM Tris-HCl pH7.4,100mM NaCl, 10mM MgSO dull and stereotyped and directly adding 15ml ₄), room temperature is placed 1-2hr., and phage is diffused out from the substratum of upper strata.

2) lambda dilution buffer liquid is moved into from culture dish in the 50ml centrifuge tube, 4 ℃, the centrifugal 20min of 8000rpm removes bacterial debris.

3) supernatant is moved in the new centrifuge tube, add RNaseA (final concentration is 2 μ g/ml), DNase (final concentration is 1 μ g/ml), 37 ℃ of digestion 30min.

4) add PEG8000 (final concentration is 10%), NaCl (final concentration is 1M) is in lambda dilution buffer liquid, and abundant mixing is more than the ice bath 1hr..

5) 4 ℃, 11000rpm, centrifugal 10min.Abandon supernatant, collect phage particle on the tube wall.

6) add the resuspended phage of 1ml 1 * lambda dilution buffer liquid, and resuspended back phage branch is installed to (500 μ L/ pipe) in the 1.5ml centrifuge tube.Add RNaseA to final concentration 1 μ g/ml in every pipe, DNaseI is to final concentration 5 μ g/ml, and 37 ℃ digest 20min.

7) add EDTA to final concentration 20mM, stop enzyme reaction; Adding Proteinase K to final concentration then is 100 μ g/ml, destroys bacteriophage coat protein, simultaneously RNase A and DNase is digested, and adds SDS to 0.5%, 65 ℃ of water-bath of final concentration 1 hour.

8) equal-volume phenol, chloroform extracting twice, the chloroform extracting once.

9) supernatant adds isopyknic Virahol, precipitation lambda DNA.

10) 70% washing with alcohol precipitation is dissolved in an amount of TE damping fluid after draining, the electrophoresis detection that takes a morsel, and all the other-20 ℃ of preservations are standby.

5, Lambda phage DNA restriction analysis and subclone sequencing fragment

1 lambda bacteriophage dna getting in 7 positive colonies carries out single endonuclease digestion and double digestion analysis with plurality of enzymes, their combination is as follows: 1.Sal I/Xba I, 2.Sal I/Kpn I, 3.Sal I/HindIII, 4.Sal I/BamH I, 5.Sal I/EcoRV, 6.EcoR I, 7.BamH I, 8.Sal I, 9.HindIII, 10.Sal I/Sma I.

The single endonuclease digestion system:

10 * damping fluid (providing in the test kit), 5 μ L

Lambda?DNA 30μL

Restriction enzyme 6 μ L

Aqua sterilisa is settled to 50 μ L.

The double digestion system:

10 * damping fluid (providing in the test kit), 5 μ L

Lambda?DNA 30μL

Restriction enzyme I 5 μ L

Restriction enzyme II 5 μ L

Aqua sterilisa is settled to 50 μ L.

Enzyme is cut the product electrophoresis, hybridized with the probe that screens the library after changeing film, and concrete steps are as follows:

1, electrophoresis and commentaries on classics film

1) with enzymolysis completely the every pipe of DNA add 5 μ l, 10 * loading buffer (70% glycerine, 0.5 * TBE, 0.2%SDS, 20mM EDTA, 0.2% tetrabromophenol sulfonphthalein), mixing.Sample is in 1 * TAE (40mM Tris-acetate, 1mM EDTA) electrophoretic buffer, and 0.8% sepharose makes under the 100v voltage that in the 40cm electrophoresis chamber all samples enters gel from the point sample hole, then under the 30v constant voltage, and electrophoresis 16hr..

2) gel behind the electrophoresis is cut unnecessary glue limit, and cut a little angle, place 0.25M HCl jog 15min to show direction.

3) disk is added 0.4M NaOH solution, frame lastblock sheet glass, on put 4 layers of thieving paper of being wider than gel, two is dipped in the liquid, between filter paper bubble can not be arranged.

4) glue with distilled water flushing after, the point sample hole places downwards on the filter paper, drains bubble therebetween, puts the water proof bar around the blob of viscose well.

5) (Hybond-N+ Amersham), is laid on the glue after placing 0.4M NaOH evenly to soak into, and repaves four filter paper with the identical size of film, all bubble can not be arranged therebetween to cut the nylon membrane of the big 1mm of long-width ratio blob of viscose.

6) addend layer paper handkerchief pressed a sheet glass and 750g weight on it, inhaled seal 20～24 hours.

7) after the suction seal finishes, mark in pencil, (0.3M NaCl, 0.03M citric acid pH7.0) soaked 10 minutes 2 * SSC.

8) film is moved on the filter paper, super clean bench dries up.

9) film is sandwiched between filter paper and the two blocks of glass, dried by the fire 1～2 hour in 80 ℃ of baking ovens, with the preservative film parcel, 4 ℃ of preservations are standby.

2, hybridization

Hybridizing method used when hybridizing method after the commentaries on classics film finishes and screening corn gene group library is identical, and hybridizing used probe also is probe used when screening the library.Enzyme is cut the result as shown in Figure 3A, and enzyme is cut the result and shown that used several restriction enzymes are cut the enzyme of lambda bacteriophage dna and all compare fully that the bands of different sizes all separate substantially.The results of hybridization of endonuclease bamhi is shown in Fig. 3 B, at distance initiator codon 2.1kb place one SalI point of contact is arranged as can be known according to known ZmGLU1 gene cDNA sequence, obtain 5 ' flanking sequence at least greater than 2kb, and it is long as far as possible, but oversize and do not allow the subclone that is easy to do, the positive band of about 4kb (shown in the arrow) of 1.Sal I/Xba I double digestion reclaims and subclone arrives so choose

Among the SalI of-3Zf (-) and the XbaI enzyme cutting site, finish the order-checking of about 2kb of the end of 5 ' in this 4kb sequence by associating genome company, sequencing result shows that this 2kb fragment total length is 1907bp, it is 5 ' flanking sequence of ZmGLU1 gene codon ATG upstream that 1735bp is wherein arranged, and other 172bp sequence is the ZmGLU1 gene order.Compare among the sequence submission GenBank with 1907bp, wherein 3 ' end 172bp sequence and ZmGLU1cDNA sequence homology are that 100%, 5 ' terminal sequence is not found any homologous sequence.Illustrate that resulting 1735bp sequence really is 5 ' flanking sequence of ZmGLU1 gene, and be newfound sequence.

The clone of embodiment 2, ZmGLU1 promotor and Construction of eukaryotic thereof and transformation of tobacco

One, the clone of ZmGLU1 promotor and Construction of eukaryotic thereof

1, amplification ZmGLU1 promotor from ZmGLU1 gene 5 ' flanking sequence

5 ' flanking sequence of the ZmGLU1 gene that obtains according to order-checking has designed 2 primer P1735-F and P1735-R.With the 4kb sequence that is connected on the sequencing vector is template, amplifies a fragment about 1735bp by the pcr amplification method from ZmGLU1 gene 5 ' flanking sequence.

Amplification system:

10 * damping fluid (providing in the test kit), 5 μ L

DNTP mixture (every kind of 10mM) 1 μ L

P1735-F(10μM) 1μL

P1735-R(10μM) 1μL

Taq enzyme (5U/ μ L) 0.5 μ L

Template (concentration is 10ng/ μ L) 0.5 μ L

Aqua sterilisa is settled to 50 μ L

Amplification condition is:

94℃5min

94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 2min (30 circulations)

72℃10min

4 ℃ of preservations.

The fragment called after ZmGLU1P that will obtain with primer P1735-F and P1735-R amplification (sequence 1,1735bp).

The ZmGLU1P fragment that amplifies is connected to

On the sequencing vector.5 ' flanking sequence of the 1907bpZmGLU1 gene of sequencing result and gained compares, and consistence is 100%, shows that mispairing does not appear in amplification.

2, Construction of eukaryotic

According to the restriction enzyme site of primer P1735-F and P1735-R two ends design, with XbaI and NcoI with the ZmGLU1P fragment from

Carrier downcuts, and enzyme is cut the back ZmGLU1P fragment that reclaims and linked to each other with the pCAMBIA3301 carrier segments that the NcoI enzyme is cut through XbaI.To connect product and transform in the DH5a bacterial strain, extract plasmid DNA, cut evaluation with XbaI and NcoI enzyme.With the carrier called after that builds: p3301-ZmGLU1P.

Two, transformation of tobacco

A large amount of plasmid DNA of extracting the expression vector (p3301-ZmGLU1P) that makes up, get 20 μ L (about 1 μ g) and transform Agrobacterium LBA4404 competent cell, go up at 28 ℃, YEB substratum (containing kantlex Kan 100 μ g/ml, Streptomycin sulphate Sm 125 μ g/ml) and to cultivate two days.Respectively select two clones and do bacterium liquid PCR evaluation, all amplify target stripe.

The Agrobacterium that will contain expression vector is inoculated in YEB substratum (containing kantlex 100 μ g/ml, Streptomycin sulphate 125 μ g/ml), and 28 ℃ of shaking culture are to OD ₆₀₀Be 0.6-0.8, centrifugal 10 minutes of room temperature (4000rpm).Precipitation uses MS salts solution (pH 7.0) to suspend, and is diluted to 30 times of original volume.Get tobacco aseptic seedling blade, cut blade edge and master pulse, blade is cut into about 0.4 * 0.6cm ²About size, put into the bacterium liquid for preparing and soak 5-10min, blot surperficial bacterium liquid with aseptic filter paper, change in the MS solid medium that the surface is covered with one deck filter paper (contain 3mg/L 6-BA, 0.2mg/L NAA, pH 5.8) 28 ℃ of dark cultivations over to.After three days, change in the MS screening culture medium (contain 3mg/L6-BA, 0.2mg/L NAA contains kantlex 100 μ g/ml, Reflin 250 μ g/ml, pH 5.8) 28 ℃ of illumination cultivation, illumination every day 12-16 hour over to.Per 2 all subcultures are once lost the blade or the callus of flavescence at every turn, and big callus cuts into fritter, and behind 2-3 subculture, the callus of cultivation differentiates seedling successively.Seedling is transferred in the bottled MS solid medium of can (contain kantlex 100 μ g/ml, Streptomycin sulphate 125 μ g/ml, pH 5.8), 28 ℃ of illumination cultivation, treat that its root system development fully after, be transplanted in the greenhouse.

The detection of the Molecular Detection of embodiment 3, tobacco transgenic progeny and ZmGLU1P promoter activity

One, the Molecular Detection of tobacco transgenic progeny

1, the total DNA of tobacco extracts in a small amount

Get about tobacco young leaflet tablet 150mg in the 1.5ml centrifuge tube grinding powder.Add 65 ℃ of preheatings of 800 μ L the SDS lysis buffer (0.1M Tris-HCl, 0.05M EDTA, 0.5M NaCl, 1%SDS), the vibration mixing.65 ℃ of water-baths 20 minutes add 250 μ L 5MKAc, ice bath 5 minutes, centrifugal 10 minutes of 4 ℃, 12000rpm.Get supernatant in another 1.5ml centrifuge tube, centrifugal again 5 minutes of 4 ℃, 12000rpm.Change supernatant over to another clean centrifuge tube, add 600 μ L Virahols, abundant mixing, centrifugal 15 minutes of 4 ℃ of 12000rpm.Use 70% ethanol washing and precipitating 2 times at last, after the vacuum-drying, add 80 μ L sterilization redistilled water dissolving DNA.

2, PCR detects

According to a pair of primer GUS-F of the sequences Design of gusA gene and GUS-R, primer is detected the transgene tobacco DNA that extracts with the SDS method with this.Wherein, the PCR reaction system is composed as follows:

10 * damping fluid, 2.5 μ L

DNTP mixture (every kind of 10mM) 0.5 μ L

P45F (concentration is 10 μ M) 0.5 μ L

P46R (concentration is 10 μ M) 0.5 μ L

Taq enzyme (concentration is 5U/ μ L) 0.5 μ L

The total DNA of transgene tobacco (concentration is 20ng/ μ L) 1 μ L

Aqua sterilisa is settled to 25 μ L.

The PCR detected result shows that it is 74% that ratio is counted in the positive tobacco plant and the strain of tobacco plant to be detected.

Two, the active detection of beta-glucosidase gene promoter

The tobacco plant that the PCR detected result is positive, extract root, stem, stem foot and the leaf of its 6-8 sheet leaf seedling, sepal, petal, anthocaulus, gynoecium and the stamen of flower, the mature leaf that stretches fully, the bloom back 20 days immature seed and the total protein of mature seed, (activity of β-Glucuronidase), the tissue specificity of analyzing ZmGLU1P drives active detection by quantitative gusA gene coded protein β-Pu Taotanggansuanmei.Take away and spend back 0,5,10,15,20,25,30,35,40,45,50 days fruit and sprouting back 0,1,2,3,4,5,6,7,9,11, the total protein of 13,15 days seed (seedling), (activity of β-Glucuronidase) is analyzed the driving activity change of ZmGLU1P in fruit development and seed germination process to detection by quantitative gusA gene coded protein β-Pu Taotanggansuanmei.Concrete steps are as follows:

1, the making of typical curve

With reaction terminating liquid (0.2mol/LNa ₂CO ₃) with 4-MU (4-methyl umbelliferone) be mixed with 0.00,6.25,12.50,50.00,100.00,250.00,500.00, the series standard concentration of 1000.00pmol, by measuring their fluorescence intensity, make a typical curve.

2, the mensuration of total protein extraction and protein concentration

1) gets the 0.1g material in the 1.5ml centrifuge tube, add liquid nitrogen, grinding powder.

2) add 600 μ L zyme extract (0.05M pH7.0 phosphoric acid buffer, 0.1%SDS, 0.01MpH8.0EDTA, 20% methyl alcohol, 0.1%Triton X-100,0.1% mercaptoethanol), at 4 ℃ of centrifugal 10min of 13000rpm, get supernatant in a new centrifuge tube ,-20 ℃ of preservations are standby.

3) get supernatant, measure proteic content with the Coomassie brilliant blue G250 method.

3, the enzymatic reaction of β-Pu Taotanggansuanmei and fluorescent quantitation thereof

1) gets the supernatant that 50 μ L contain GUS, join in the detection liquid (2mmol/L 4-MUG solution) of 37 ℃ of preheatings of 450 μ L, rapidly abundant mixing.

2) take out 50 μ L at once and join 950 μ L reaction terminating liquid (0.2mol/L Na ₂CO ₃), with 0 point of this pipe as enzymatic reaction.

3) from reaction solution, take out 50 μ L at 10min, 20min, 30min, 45min and 60min respectively, change in the reaction terminating liquid of 950 μ L.

4) after enzymatic reaction finishes, under excitation wavelength 365nm, emission wavelength 455nm, measure the fluorescent value of different time points with spectrophotofluorometer.

5) according to the total protein of fluorescent value of measuring and participation reaction, obtain the GUS activity, the MU/ protein content (unit: nmol4-MU.min that the GUS activity=the unit time internal reaction generates ^-1.mg ^-1Albumen).

(β-Glucuronidase) determination of activity reaches the active comparative result of the β-Pu Taotanggansuanmei that drives with the CaMV 35S promoter as shown in Figure 4 to the β-Pu Taotanggansuanmei that beta-glucosidase gene promoter drives, show: the sequence (ZmGLU1P) of (1) ZmGLU1 gene start codon ATG upstream 1907bp is enough to start reporter gene gusA and expresses. and gusA gene expression activity in the root of seedling that (2) ZmGLU1P drives is the strongest, than active powerful about 3 times of the driving of 35S promoter in homologue, at leaf, petiole, stem, stamen, anthocaulus, specific activity 35S in the sepal is low slightly, but the expression amount in mature seed have only 35S promoter in mature seed 1/30, be itself in immature seed 1/50,1/300 (Fig. 4 A) of the seedling that sprouts. (3) the promotor activity change in fruit of blooming in back 10 days is not obvious, subsequently along with the growth of fruit, promoter activity sharply descends, time 35 days, drop to low-down level, / 50th, in the chances are flowering period and along with the sprouting of seed, the very fast again rising of promoter activity, sprout that activity reaches the highest in the seedling after 11 days, be 300 times (Fig. 4 B) of mature seed. above result proves absolutely that the ZmGLU1P promotor is that an expression activity in the seedling root and in the seedling is very strong, but in the promotor of mature seed specificity trace expression.

Sequence table

＜110〉China Agricultural University

＜120〉a kind of beta-glucosidase gene promoter and application thereof

<130>

<160>1

<170>Patent?In?version?3.3

<210>1

<211>1907

<212>DNA

＜213〉Zea corn (Zea mays L.)

<400>1

atgtatgcct?ctgcaatgga?agcctcaatt?ttgcatttat?ttctacattt?ctttcgaata 60

gtatttagac?atctctcgat?tggatagcac?caacgtccct?gcactggccc?cccattcgtg 120

cctcataggg?gagatgaaga?atcaaatgct?gcattggatt?gaagaagcca?ggtggaaata 180

tcttctcaag?ctcacggcca?tgtttagtga?tcattttcaa?atttcgagta?catatgatat 240

catgacatgt?ggataagtgg?acaagtttca?tgattttcaa?attttatcac?agctttctcg 300

aaacattttc?aaaattttta?ttacagcctg?tacatatgat?atcatgacac?gtggacaagt 360

ttcatgattt?tctgactttg?tttgtatttt?atataatttt?taaacatgta?gatggcaagt 420

tcacggccat?gtttagtgag?catgttgctc?gaagtttctg?gtccgctcct?gaaatcggtc 480

gtaacttatg?ctaagtaaca?tgaatatcat?ttttgcatga?acggtttttc?aagtttcgag 540

tgacctgcag?ttcaaatctg?gattttccgg?agaaattcaa?ataaacgaat?taaatctact 600

aacgattgaa?aactctgtta?taattgtcca?caaatgatac?atgtaggttt?acatagtgca 660

ggaatatacc?acaaaaagtt?tgggagacaa?aatctaaaaa?ataaaaatat?gctttgccga 720

gtgtccaagg?aagacactcg?gcaaagagtt?ctttgccgag?tgccaaccat?cggccctcgg 780

caaaggctga?cgaccgttag?ctttaggacg?gccgctgacg?atcctttgtc?gagcgccacc 840

gttgtcgagt?gtttgacact?cggcaaagag?atctttgccg?agagttctcc?tgtgccgagt 900

gtcctgcact?cggtaaacca?gctcgttacc?gagagcagga?gtttaccgag?tggctctcgg 960

caaagtcgcc?tttgccgagt?gcccgacaaa?aggcactcgg?caaagctgcc?gcattcggca 1020

aagcctgcaa?ttccggtagt?gttttaccac?gttgacaaaa?aaaatgaaga?aatccgatat 1080

tttagtcatt?atggatatgg?cgcggtgtca?aatcggtata?gtcataatcc?tttccatagg 1140

attgtcccat?gctcgacaca?ttaacactaa?gtttatccct?gaataacacg?gctacctcca 1200

tcctaatctt?ttctattgat?caattgccta?tttttaaggc?gcagttgttc?ttggccgtat 1260

ctgtggagat?gattttttta?aagacgtcca?actctagcta?gctagtccgt?gtatgtgaac 1320

ggtgttaggt?agtcattgga?tccgttgact?atatttgtaa?aggtggtagc?cgttcttttt 1380

aattttaacg?ccgctgggaa?gaaattaaac?gtggtacatc?tatgtatcgt?tttcttaaca 1440

gtgatataat?aatatactat?cattgcatgc?gtccgcaatt?gctctctcgc?ggctcgttct 1500

accgtgggaa?gaagagctga?cccgtcgccg?ccccacatgc?atacgatgcg?tccttatctg 1560

tcgcggctcg?tgcaaacgcg?gggcgggctg?agcgccccag?cccaccactt?gcaccacttg 1620

catttactta?attagttcat?aacacatcac?atctgtatct?tacattatct?ttaaaaaaat 1680

gattcacaca?ttatttatat?atgagatata?ataagtttcc?aggaagcatc?tttggcgact 1740

tacgtacgtg?tatcagagac?atggagtgat?aaactattgg?gcaaccattt?agcaatccta 1800

gctagccagc?tcgtctataa?atagatgcat?cagctccact?tggtctacac?acttcacaag 1860

cagctcaaag?ctctagttct?agctagctag?caaagggggg?gaaaatg 1907

Claims (5)

1. corn beta-glucosidase gene promoter, its nucleotide sequence is shown in SEQ IDNO:1.

2. the carrier that contains the described beta-glucosidase gene promoter of claim 1.

3. by the described carrier transformed host cells of claim 2.

4. the application of the described beta-glucosidase gene promoter of claim 1 in plant genetic engineering.

5. the described beta-glucosidase gene promoter of claim 1 is in the corn gene application in engineering.

Images