CN101068926B - Multiple promoter expression cassettes for simultaneous delivery of RNAi agents - Google Patents

Abstract

The present invention provides multiple-promoter expression cassettes for simultaneous delivery of RNAi, preferably to mammalian cells in vivo.

Description

Be used for multiple promoter expression cassettes and purposes that RNAi reagent is sent simultaneously

The mutual reference of related application

It is 60/553,920 that the application has benefited from series number, and submitting day to is the U.S. Provisional Patent Application on March 17th, 2004, and series number is 60/550,504, submitting day to is the U.S. Provisional Patent Application on March 5th, 2004, and these two pieces of documents are incorporated herein by reference.

Background of invention

Come inhibition of gene expression to find that to medicine industry has brought change with double-stranded RNA by sequence-specific mode.In Mammals, RNA disturbs, perhaps RNAi, be by 19 to 29 Nucleotide long, the double stranded rna molecule regulation and control, this double stranded rna molecule refers to the siRNA that the long dsrna molecule in the cells in vivo derives through enzymatic lysis.RNAi reagent can be in extracellular chemistry or zymetology synthetic and and then be delivered in the cell (referring to, Fire for example, etc., Nature, 391:806-11 (1998); Tuschl, etc., Genes and Dev., 13:3191-97 (1999); And Elbashir, etc., Nature, 411:494-498 (2001)); Perhaps can express in vivo by carrier suitable in the cell (referring to, McCaffrey for example, etc. Nature Biotech.21 (6): 639-644 (2003)).

Yet the RNAi that sends unmodified in human body is to be faced with many technology barriers as therepic use effectively.At first because the nuclease in cell and the serum, the half life of the RNA that is injected in vivo only have about 70 seconds (referring to for example, Kurreck, Eur.J.Bioch.270:1628-44 (2003)).Taked to make great efforts to increase the stability of injecting RNA by chemically modified; Yet, some have appearred because chemically changed causes the increase example of toxic effect.In a concrete example, cell can't tolerate the RNAi that per two phosphoric acid in the two strands are replaced by thiophosphatephosphorothioate dosage (Harborth, etc., Antisense Nucleic Acid DrugRev.13 (2): 83-105 (2003)).Other obstacle comprises provides tissue specificity to send, and can send enough initiation therapeutic responses but do not have virose RNAi reagent dosage.

For sending of RNAi had been found that many selections, comprise that use can infect target cell, and send in position the carrier system based on virus with expressed rna i molecule.Usually, the little RNA of about 70 Nucleotide is transcribed into bob folder precursor (shRNA) from the virus vector skeleton.In case transcribed, shRNA is processed into suitable viable rna i kind by the enzyme of dicing (Dicer).Attempt to develop viral target attribute to produce tissue specificity based on the route of delivery of virus, in case correctly target is located, just depend on the endogenous cell machine to produce enough RNAi kind levels and then to obtain the effective dosage for the treatment of.

Now, the virus for sending target sequence of the most generally using is that those develop and next systems based on retrovirus, hsv (HSV) or adenovirus (Ad).All these carriers can hold sizable insertion and can be with the relevant titre production of therapeutic.Yet, all systems, have the worry relevant with the development of cancer (Cavazzana-Calvo, etc., Science, 288:669-72 (2000)), and be attended by undesirable host immune response and in the patient, cause toxicity.Another virus that can be used for sending RNAi is adeno associated virus (AVV).

An effective application of RNAi treatment is as Anti-virus agent.Generally speaking, RNA viruses depends on the RNA polymerase that RNA/DNA relies on and copies.Such RNA/DNA polysaccharase is with lower rigor replication-competent virus genome, and its functional consequence is to have produced the genome with unusual most sudden changes.Consequently had the ability of rapid evolution progeny virus particle to escape general immunity and chemical Anti-virus agent.Therefore, similar with the effect of the small molecules treatment of having observed, the relative potential of RNAi treatment and effectiveness may reduce owing to the virus in long therapeutic procedure develops.In an example research, with the shRNA that expresses send occurred after 35 days in the body including HIV that single Nucleotide changes escape mutant (Boden, etc., J.Virol.77 (21): 11531-11535 (2003)).In another example research, after the transit cell that uses pre-synthesis RNAi transfection dyes, only just can detect poliovirus in 54 hours and escape mutant.Yet, send simultaneously two kinds for the RNAi of multiple target sequence in the virus can postpone significantly to escape mutant appearance (see Gitlin, etc., Nature.418:430-434 (2002)).

Therefore, the art needs development stability, effectively RNAi treatment.The present invention has satisfied these needs of the art.

Summary of the invention

The present invention relates to composition from reagent to target cell and method for the innovation of sending RNAi kind or.The RNAi kind is the part of the multiple promoter expression construct preferably sent by viral delivery systems.Because three kinds or more RNAi reagent are used on each construct, the present invention can be especially effectively be used for using the target gene location organism with sequence difference between variant (SNPs), wherein the RNAi reagent of each importing can target one or more variant hypotype.Similarly, the compositions and methods of the invention also can be used for the treatment of the disease that the cause of disease by rapid sudden change causes, the disease that is for example caused by the viral reagent based on RNA effectively; In other words, virus is escaped mutant and is unlikely avoided three kinds or the more effect of different RNA i sequence.

Therefore, embodiment of the present invention provide a kind of multiple promoter expression cassettes to comprise: at least three kinds of promotor/RNAi/ terminator components, wherein every kind of promotor/RNAi/ terminator component comprises promoter element, terminator element and the RNAi kind of be operably connected promoter element and terminator element, and wherein the sequence of each RNAi kind is differing from each other.Another of this embodiment preferred aspect, the sequence of each promoter element is differing from each other in multiple promoter expression cassettes.In this embodiment on the other hand, in multiple promoter expression cassettes differing from each other and/or each the terminator element of the sequence of each terminator element come from identical gene with corresponding promoter element and mutually natural in pairs.In addition, in the one side of this embodiment, the invention provides one and include the multiple promoter expression construct that the treatment carrier package is entered the essential element of infectious viral particle.

In another embodiment of the invention, the method of a processing at one or more target set nucleic acid of a cells is provided, comprised: expressed multiple promoter RNAi expression cassette that three or more RNAi reagent suppresses one or more target set nucleic acid with one and mix virus vector and send construct in order to make the RNAi of virus; Packaging virus RNAi sends construct and enters virion; Send this virion to cell; And express from three or more RNAi reagent in this multiple promoter expression cassettes.In this embodiment of the present invention on the other hand, expressed one or more target set nucleic acid is initiation or keeps the necessary gene of morbid state, for example cancerous state in cell.In the other side of this embodiment of the present invention, expressed one or more target set nucleic acid is that pathogenic agent infects cell or keeps the necessary gene of infection.Perhaps, multiple promoter RNAi expression cassette can provide by non-virus carrier, and is delivered to cell by non-viral method known in the art.

The accompanying drawing summary

For the ease of at length understanding above-described feature of the present invention, advantage and purpose, more detailed description book of the present invention, top short summary can be cited in the embodiment of accompanying drawing illustrated.Yet, should be noted that those description of drawings only are used for conclusive evidence embodiment of the present invention and therefore can not be considered to limit scope of the present invention, because the present invention can comprise other same effectively embodiments.

Fig. 1 is the simplified block diagram be used to an embodiment of the method for sending RNAi kind of the present invention.

Fig. 2 A and 2B are the synoptic diagram that represents the embodiment of multiple promoter RNAi expression cassette of the present invention.

Fig. 3 A and 3B have shown that the multilist with shRNA precursor delivery RNAi reagent reaches two embodiments of carrier.Fig. 3 C has shown that comprises the embodiment that the multilist that is inserted in the filled band between promotor/RNAi/ terminator component reaches carrier.Fig. 3 D and 3E show the embodiment of the multiple promoter RNAi expression cassette of sending the RNAi that is not with the shRNA precursor.

Fig. 4 A is the concise and to the point signal of making a kind of method that is packaged into the multiple promoter RNAi expression cassette in the virion.Fig. 4 B is the concise and to the point signal of making the another kind of method that is packaged into the multiple promoter RNAi expression cassette in the virion.

Fig. 5 is the synoptic diagram of an embodiment of test recombinant chou AAV (rAAV) expression construct and luciferase report construct.

Fig. 6 is the synoptic diagram according to self complementation (scAAV) RNAi expression vector of one embodiment of the invention.

Fig. 7 is the synoptic diagram of a representative promotor test builds body and report construct.

Fig. 8 A is the genomic synoptic diagram of HCV that shows the RNAi reagent position of detecting in the experiment of the present invention's description.8B is the synoptic diagram that comprises for the luciferase HCV fused replicon of the genetic elements of Nonstructural Protein.8C is the synoptic diagram that comprises for the luciferase HCV fused replicon of the HCV genetic elements of structure and Nonstructural Protein.

Fig. 9 is the synoptic diagram that merges reporter plasmid for two luciferase HCV of checking R NAi reagent.The construct of on the left comprises a 100bp HCV sequence that is fused on the luciferase genes; And comprise 3 different 100bpHCV sequences that are fused on the luciferase genes at right-hand construct.Target to one a RNAi reagent that is included in the sequence in this 100bp zone is with (if effectively) this HCV luciferase transcription product of degrading, thereby the expression of reduction (perhaps eliminating) luciferase.

Figure 10 is a graphic extension that demonstrates one of embodiment of having for triple promoter vectors of unique restriction site of the module assembly of multiple RNAi reagent, promoter element and terminator element.

Figure 11 A is the example of the sequence (SEQ ID NO 31) of triple promoter vectors of showing in Fig. 3 B.Figure 11 B/11C is the example of the sequence (SEQ IDNO 32) of triple promoter vectors of showing in Fig. 3 C.

Figure 12 is presented at and measures the result who is suppressed luciferase expression by the different RNAi reagent in target to five kind of different HCV100bp zone under the relative light unit (RLU).

Figure 13 has shown the result by different RNA i reagent inhibition luciferase expression who is expressed as the inhibition percent value.

Figure 14 has shown the reproducibility of check target to the test-results of four kinds of different RNA i reagent of a plurality of sections that come from the regional 100bp sequence of HCV5 '.

Figure 15 has shown the change that suppresses per-cent for target to five kinds of different RNA i reagent of a plurality of sections that come from the regional 100bp sequence of HCV5 ' luciferase expression of 24 hours and 48 hours after transfection.

Figure 16 has shown a plurality of sections five different RNA i reagent and the RNAi reagent of the sections of target 100bp sequence to HCV opening code-reading frame transfection after the luciferase expression of 44 hour and the 72 hour change that suppress per-cent of target to two different RNA i reagent of a plurality of sections of the regional 100bp sequence of HCV5 ', target to the regional 100bp sequence of HCV3 '.

Figure 17 A and 17B have shown the data of estimating three Pol III promotor intensity.A special shRNA sequence that is directed to fluorescence firefly luciferase mRNA (McCfrey etc., 2002) is inserted under the control of above-mentioned Pol III promotor.Product plasmid DNA and luciferase reporter plasmid cotransfection are to Huh7 cell (Figure 17 A) or 293 cells (Figure 17 B).The luciferase level is measured in transfection after 72 hours.In the triple promoter constructs that come from Fig. 3 B (three constructs on each right side, map-area), demonstrate promoters driven shRNA.

Figure 18 is presented at luciferase HCV and merges siRNA reagent different in the reporter plasmid analysis of experiments to the inhibition of luciferase expression.Luciferase HCV reporter plasmid and each siRNA reagent cotransfection be to the huh7 cell, and measured later on luciferase activity at 48 hours.

Figure 19 show needle is to the activity of the selected siRNA reagent of subgene group luciferase HCV fused replicon.The pGL3 contrast DNA (being used for the contrast of transfection efficiency) of proof siRNA reagent and trace is transfection to 29 ∑ cell together.Measure the level of Lei Niliya (renilla) and fluorescence firefly luciferase after 48 hours.

Figure 20 has shown the inhibition per-cent that comes from the luciferase signal of luciferase HCV reporter plasmid after the plasmid co-transfection with the promotor that comprises and have one or two active promotors/shRNA box.

Figure 21 has shown and has come from the inhibition per-cent that uses the luciferase signal comprise the luciferase HCV reporter plasmid that comprises C12 coding region (top), C-9 (middle) coding region or 5 ' 6 zones (bottom) after, the plasmid co-transfection of two or three active promotor/shRNA boxes.

Detailed Description Of The Invention

Before describing the compositions and methods of the invention, should be appreciated that the present invention is not limited to described detailed method, product and factor, because such method, instrument and preparation can change certainly.Should be appreciated that also that simultaneously the term that uses only is in order to describe detailed embodiment here, and do not want to limit the scope of the invention that this scope is only limited by claims.

As what here use, " " of singulative, " one " and " this " comprise plural object, unless context is clearly stipulated in addition.Thereby for example, said " factor " refers to one or more confounding factor, and said production method comprises that those have been equivalent steps known in the field and method etc.

Unless definition is arranged in addition, all technology of here using and scientific term have with the present invention under technical field in the those of ordinary skill common meaning of understanding.All publications of mentioning are incorporated herein by reference, and without any restriction, to be used for description and disclosure device, composition and method, these contents may be relevant in the described invention of the application in the publication.

In the following description, many details have been set forth more thoroughly to understand of the present invention.Yet the one or more those skilled in the art in these details also may realize the present invention apparently.On the other hand, the content known of those skilled in the art is not just here described.

The present invention relates to utilize single expression construct to send simultaneously at least three different RNAi reagent to genetic make up thing innovation, stable and the method for cell.This component and method provide stable, the lasting inhibition to target nucleic acid.

Usually, the present invention has used habitual molecular biology, microbiology, recombinant DNA technology, cytobiology and the virological method in this area.Such technology is illustrated in the literature fully, referring to, Maniais Fritsch ﹠amp for example; Sambrook, Molecular cloning; Lab guide(1982); Dna clone: Practical Approach, volume I and 11 (D.N.Glover, ed.1985); Oligonucleotide is synthetic(M.J.Gait, ed.1984); Nucleic acid hybridization(B.D.Hames ﹠amp; S.J.Higgins, eds. (1984)); Animal cell culture(R.I.Freshney, ed.1986); With RNA viruses: Practical Approach, (Alan, J.Cann, Ed., Oxford University Press, 2000).

" carrier " is a replicon, and for example plasmid, phage, virus formulation body or clay wherein can assemble other DNA sections.Carrier is commonly used at transit cell and expressible dna sections.

" promotor " or " promoter sequence " is one section can and start in conjunction with RNA polymerase the DNA regulatory region transcribe in cell, transcribe to as if the small nut of polynucleotide or polypeptid coding sequence such as messenger RNA(mRNA), nuclear candy body RNAs, nucleolar RNA s or by the RNA of any any kind of transcribing of rna plymerase i, II or III.

When such nucleic acid during transfered cell this cell just by nucleic acid external source or allos or plasmid institute " conversion ", " transduction " or " transfection ", for example, as one with the complex body of transfection reagent or be packaged in the virion.The DNA of this conversion may or can not integrate (covalently bound) to the genome of cell.For eukaryotic cell, in the cell of stable conversion, transfering DNA has been integrated in the host cell karyomit(e) or has maintained outside the karyomit(e), so that this transfering DNA is inherited by daughter cell during cellular replication or this transfering DNA is that the non-cell that copies, breaks up wherein exists lasting episome.

Term " RNA interference " or " RNAi " generally refer to such process, and wherein double stranded rna molecule or short-hairpin RNA have changed the expression of nucleotide sequence, and they have basic or homology completely.Term " RNA kind " or " RNAi reagent " refer to the RNA sequence of the initiation RNAi of one section uniqueness; And term " RNAi expression vector " refers to comprise according to embodiments of the present invention the carrier of three above RNAi kinds.

Fig. 1 is simplified flow chart, and it has shown the step of method 100, wherein can use according to multiple promoter RNAi expression construct of the present invention.At first, in step 200, constructed a target to the multiple promoter RNAi expression cassette of specified disease target.Secondly, in step 300, multiple promoter RNAi expression cassette is connected to suitable virus and sends in the construct.This viral RNA i expresses and to send construct and then be packaged in the virion in step 400, and this virion is delivered in the target cell that needs treatment in step 500.The details that these steps comprise and composition describe in detail below.

Multiple promoter RNAi expression construct based on virus according to the present invention can utilize many working specifications well known in the art to produce by synthetic or zymetology means, and utilize the standard recombinant dna technology to come purifying, these technology are documented in, for example, the people such as sambrook Molecular cloning: lab guideSecond edition, cold spring port are published, the cold spring port, and NY (1989), and according in for example U.S. HHS section, national health research centre (NIH) carries out about the described rules of recombinant DNA Guide to research.In a preferred embodiment, this multiple promoter RNAi expression cassette utilizes phosphoramidite or analogue to synthesize according to working specification well known in the art.

Fig. 2 A and 2B are the sketches of multiple promoter RNAi expression cassette according to embodiments of the present invention.Fig. 2 A has shown to have three promotors/embodiment of the multiple promoter expression cassettes (10) of RNAi/ terminator component (being presented at 20), and Fig. 2 B shows an embodiment of the multiple promoter expression cassettes (10) with five promotors/RNAi/ terminator component (being presented at 20).P1, P2, P3, P4 and P5 represent promoter element.RNAi1, RNAi2, RNAi3, RNAi4 and RNAi5 represent five different RNAi kind sequences.T1, T2, T3, T4 and T5 represent termination element.Multiple promoter RNAi expression cassette according to the present invention can comprise three or more promotor/RNAi/ terminator component, the number of the promotor that wherein comprises at any multiple promoter RNAi expression cassette/RNAi/ terminator component is subject to, for example, selected delivery system (for example, some viruses, such as AAV, the restriction of relatively strict size is arranged) the packing size; Cytotoxicity, and maximal effective dose (for example, the validity when the expression of four RNAi sequences is treated to be used as is identical with the effect of ten RNAi sequences expression).

Three or more RNAi kinds all has different sequences in the box that includes promotor/RNAi/ terminator component; That is to say that RNAi1 RNAi2, RNAi3, RNAi4 and RNAi5 are different each other.Yet the promoter element in any box may be the same (that is to say that for example, the sequence of two or more P1, P2, P3, P4 and P5 may be the same); All promotors of box inside can be different each other arbitrarily; The promoter element that only occurs in arbitrary box inside once perhaps may be arranged and occur twice or the set of above promoter element.Similarly, the terminator element in arbitrary box may be the same (that is to say that for example, two or more sequences may be the same among T1, T2, T3, T4 and the T5, such as 4 or the continuous stretching area of more T residues); All terminator elements of arbitrary box inside can differ from one another; The terminator element that only occurs in arbitrary box inside once perhaps may be arranged and occur twice or the set of above terminator element.Preferably, all different to reduce the possibilities that the DNA recombination event occurs between component and/or box at each promoter element and terminator element that comprises in the promotor of any box/RNAi/ terminator component.In addition, in a preferred embodiment, the promoter element and the terminator element that are used for each promotor/RNAi/ terminator component are complementary each other; That is to say that promotor and terminator are taken from them and are present in natively wherein same gene.

Fig. 3 A, 3B and 3C show multiple promoter RNAi expression construct carrier, wherein include the selectivity embodiment of the multiple promoter RNAi expression cassette that can express short shRNAs.ShRNAs be short double chain form wherein the sense and antisense chain connected by hairpin loop.In case express, shRNAs is formed to the RNAi kind.Picture frame A, B represent three different promoter elements with C, and arrow has been indicated the direction of transcribing.TERM 1, TERM2 represent three different terminator sequences with TERM3, and shRNA-1, shRNA-2 represent three different shRNA kinds with shRNA-3.Multiple promoter RNAi expression cassette in this embodiment reaches the arrow that is labeled as TERM3 from the picture frame that is labeled as A.In three promotor/RNAi terminator components (20) of Fig. 3 A demonstration each is on the same direction in this box, simultaneously Fig. 3 B demonstration is for shRNA-1 and the shRNA-2 promotor/RNAi/ terminator component in one direction, shRNA-3 promotor/RNAi/ terminator component (for example, is transcribed on two chains that occur in carrier) in the opposite direction.

Fig. 3 C shows by the DNA region separation to increase each box of the distance between promotor/RNAi terminator component.The DNA of this insertion is called as " filling " DNA, can be the length between 5-5000 Nucleotide.Between promotor, one or more stuffer can be arranged.For multiple stuffer, they can be same or different length.This fills preferably different sequence of dna fragmentation.This filling dna fragmentation can be for increasing the size of multiple promoter box of the present invention in order to allow it to be suitable for becoming corresponding delivery vector.The length of this stuffer is that the size by the specific support relevant with the multiple promoter carrier needs defined.For example, stuffer amounts to long 4000 Nucleotide (nt) in order to satisfy rightly the big or small needs of AAV carrier in one embodiment.In other embodiments, stuffer amounts to 2000nt in order to satisfy rightly the big or small needs of the AAV carrier of self complementation.Other variant also can use.

Fig. 3 D and 3E have shown multiple promoter RNAi expression construct, and it includes the selectivity embodiment that can express without the multiple promoter RNAi expression cassette of the RNAi kind of hairpin loop.In two width of cloth figure, P1, P2, P3, P4, P5 and P6 represent promoter element (arrow has been indicated transcriptional orientation); And T1, T2, T3, T4, T5 and T6 represent termination element.In two width of cloth figure, RNAi1 sense strand and RNAi1 antisense strand (a/s) are complementary equally, and RNAi2 sense strand and RNAi2 antisense strand (a/s) are complementary, and RNAi3 sense strand and RNAi3 antisense strand (a/s) are complementary.

In the embodiment that Fig. 3 D shows, it is to transcribe (by P1, P2 and P3) from a chain that all three RNAi have adopted sequence, and these three RNAia/s sequences are transcribed (by P4, P5, P6) from complementary strand simultaneously.In this specific embodiment, the termination element of RNAi1 a/s (T4) drops on promotor P1 and RNAi 1 has between the adopted sequence; And the termination element of RNAi1 (T1) drops between RNAi 1a/s sequence and its promotor P4.These motifs be repetition so that if the top chain that shows among Fig. 3 D is called (+) chain and the bottom is called (-) chain, this from left to right movement of element will meet with P1 (+), T4 (-), RNAi1 (justice and a/s are arranged), T1 (+), P4 (-), P2 (+), T5 (-), RNAi2 (justice and a/s are arranged), T2 (+), P5 (-), P3 (+), T6 (-), RNAi3 (justice and a/s are arranged), T3 (+) and P6 (-) successively.

In another shown embodiment of Fig. 3 E, all RNAi sense and antisense sequences are transcribed from same chain.Fig. 3 A may be used to application-specific to the embodiment of shown any one multiple promoter RNAi expression cassette of 3E to those skilled in the art, and can be group thing or variant.

In some embodiments, can the variable promotor of working strength.For example, the use of three or more strong promoter (such as Pol III type promotor) may cause burden to cell, transcribes necessary available Nucleotide or the component of other cell by for example exhausting.In addition or in addition, the use of several strong promoters can cause the toxic level that RNAi reagent is expressed in cell.Thereby the one or more promotors in multiple promoter RNAi expression cassette may be weaker than other promotor in the box in some embodiments, and perhaps all promotors can be lower than expressed rna i reagent on the level of maximum rate in this box.Promotor also can by or do not modified by molecular engineering, perhaps opposite, for example, obtain transcribing of weak level by controlling element.

Promotor can be tissue-specific or cell-specific.The promotor that term " tissue-specific " refers to when being applied to promotor can instruct the target nucleotide sequence to carry out the selective expression to specific type of tissue (for example liver), and lacks on the other hand the expression of same target nucleotide sequence in another kind of specific type of tissue (for example brain).Such tissue-specific promoter comprises such as Ick, myogenin or thyl.The promotor that term " cell-specific " refers to when being applied to promotor can instruct the target nucleotides sequence to be listed in selective expression in the cell of particular type, and in same in-house another kind of specific cell type, lack on the other hand same target nucleotide sequence expression (referring to, for example, Higashibata, Deng. J.Bone Miner.Res.Jan19 (1): 78-88 (2004); Hoggatt, etc., Circ.Res., Dec.91 (12): 1151-59 (2002); Sohal, etc., Circ.Res.Jul89 (1): 20-25 (2001); And Zhang, etc., Genome Res.Jan 14 (1): 79-89 (2004)).Term " cell-specific " refers to also when being used for promotor that promotor can promote the target nucleotides sequence to be listed in the selective expression in the zone of single organization inside.Additionally, promotor be composing type with regulatable.In addition, promotor can be modified in order to have different specificitys.

Term " composing type " refers to when being used for promotor that this promotor still can instruct transcribing of nucleotide sequence that one section operability connects lacking under the condition that stimulates (for example, heat-shocked, chemistry, light etc.).Usually, constitutive promoter can instruct the basically expression of the encoding sequence of arbitrary cell and tissue.The promotor that is used for transcribe rna i kind is constitutive promoter preferably, such as the promotor for ubiquitin, CMV, β Actin muscle, histone H 4, EF-lalfa or pgk gene, it is controlled by rna plymerase ii, the promoter element of perhaps being controlled by rna plymerase i.In preferred embodiments, use is by the promoter element of rna plymerase iii control, such as U6 promotor (U6-1, U6-8, U6-9 etc.), H1 promotor, 7SL promotor, human Y promotor (hY1, hY3, hY4 (and referring to Maraia, etc. Nucleic Acids Res22 (15): 3045-52 (1994)) and hY5 ((referring to Maraia, etc., NucleicAcids Res3552-59 (1994)), functional hybridization and the combination of human MRP-7-2 promotor, adenovirus VA1 promotor, human tRNA promotor, 5s ribosome-RNA(rRNA) promotor and above-mentioned any promotor 24 (18):.

Additionally in some embodiments, perhaps preferred those allow the promotor of RNAi kind inducible expression.This area has been known many systems for inducible expression and has been used such promotors, yet comprises and be not limited to system that tsiklomitsin replys and lac operon-repressor system (referring to WO 03/022052 A1; With US 2002/0162126 A1), the moulting hormone regulation system, the promotor of perhaps being regulated by regulator or the metallothioneins promotor (being regulated by inorganic metal) of glucocorticosteroid, progesterone, oestrogenic hormon, RU-486, steroidal, Triiodothyronine, cyclic amp, cytokine, vitamin d family.

One or more enhanser also may be present in this virus multiple promoter RNAi expression construct to increase the expression of target gene.Be suitable for the enhanser that embodiment of the present invention is used comprise those Apo E HCR enhansers of having described recently, cmv enhancer (referring to, Xia etc., Nucleic Acids Res31-17 (2003)), reach other enhanser well known in the art.

In one embodiment of the invention, the ApoE enhancer element can be added on the multiple promoter box of the present invention.The ApoE enhanser is the enhancer element that derives from apo E or ApoE of about 155 base pairs (bp).The ApoE enhanser of one or more copy can be added in multiple promoter box of the present invention first, upstream or downstream (upstream or the downstream that perhaps surpass three promotors) of second and/or the 3rd promotor.ApoE is lipophorin, can regulate and control combination, internalization and the catabolism of lipoprotein particle and is for low-density lipoprotein (ApoB/E) acceptor with for the aglucon of hepatic tissue ApoE acceptor.With the hereditary enhanser of ApoE gene-correlation be the controlling elements of eucaryon, can increase transcribing of liver specificity nucleic acid.The ApoE enhanser may be positioned at the position of liver specificity promotor upstream or downstream 2000 Nucleotide, and may have one or more copy.

By the RNAi sequence of multiple promoter RNAi expression cassette of the present invention coding cause siRNAs s (that is to say mammalian cell do not have virose weak point, double-stranded RNA s) expression.As long as they do not have showed cell toxicity, the length of RNAi kind of the present invention does not have specific limited.RNAi can be, for example, 15 to 49bp length, and preferred 15 to 35bp length, and preferred 19 to 29bp length.The double-stranded RNA part of RNAis is homology completely, perhaps owing to sequence mispairing (corresponding nucleotide on each chain is not complementary), protrusion (chain lacks corresponding complementary nucleotide) etc. cause comprising the non-matching part.Such non-matching part does not have to form or bring into play under the inconsistent prerequisite of effect with RNAi significantly and can tolerate at them.

As long as RNAi reticent target gene effectively, can be flush end or cohesive end (cantilevered) according to the terminal point of RNAi kind of the present invention.The end structure of cohesive end (cantilevered) not merely is limited to 3 ' cantilever, but as long as product RNAi can induce the RNAi effect, 5 ' cantilevered structure is includable.In addition, cantilevered Nucleotide number can be that any quantity is as long as product RNAi can induce the RNAi effect.For example, if any, cantilever may be comprised of 1 to 8 Nucleotide; Preferably it is comprised of 2 to 4 Nucleotide.

The present invention use the RNAi kind can have stem-ring structure precursor (shRNA) wherein the end of double-stranded RNA connected by strand joint RNA.The length of the single-stranded loop part of shRNA can be 5 to 20bp, and preferably 5 arrives 9bp.

Any one nucleotide sequence of transcribing can be the target for multiple promoter RNAi expression cassette of the present invention.Possible target for this RNAi is such gene, yet for example be not limited to developmental character gene (for example, adhesion molecule, cyclin-dependent kinase inhibitor, Wnt family member, Pax family member, wing spiral family member, cytokine/lymphokine and their acceptor, growth/differentiation factor and their acceptor, neurohumor and their acceptor); Oncogene (for example ABL1, BCL1 BCL2, BCL6, CBFA2, CBL, CSF1R, ERBA, ERBB, EBRB2, ETS1, ETS1, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS, PIM1, PML, RET, SRC, TAL1, TCL3 and YES); Tumor suppressor gene (for example APC, BRCA1, BRCA2, MADH4, MCC, NF1, NF2, RB1, TP53, and WT1); And enzyme (for example acc synthase and oxydase, ACP desaturase and hydroxylase, the ADP-glucose pyrophosphorylase, ATPases, ethanol dehydrogenase, amylase, amyloglucosidase, catalase, cellulase, chalcone synthase, chitinase, cyclo-oxygenase, decarboxylase, dextrinase, DNA and RNA polymerase, tilactase, dextranase, glucose oxidase, particle is in conjunction with starch synthase, GTPase, helicase, hemicellulase, intergrase, inulinase, saccharase, isomerase, kinases, Sumylact L, lipase, lipoxygenase, N,O-Diacetylmuramidase, the nopaline synthase, the octopine synthase, Rohapect MPE, peroxidase, Phosphoric acid esterase, Phospholipid hydrolase, Starch phosphorylase, phytase, the plant-growth regulator synthase, polygalacturonase, proteolytic enzyme and peptase, Starch debranching enzyme, recombinase, reversed transcriptive enzyme, RUBISCO, topoisomerase, and zytase); The structure gene of virus is such as housing and envelope protein matter; The gene of bacterium relates to such as those and copying or constitutional features, perhaps copies or the gene of constitutional features from other relating to of pathogenic agent; In addition, multiple promoter RNAi expression cassette of the present invention can be used for target to specific sequence, described specific sequence is to cause symptom allelotrope in the disease (such as SCA) of euchromosome domination, the allelotrope that causes the Huntington pathology perhaps causes the glue protogene allelotrope of osteogenesis imperfecta peculiar.An important aspect of the present invention be by the virus infection that siRNA removes can not cause to cells infected any injury (Gitlin, etc. Nature418:430-434 (2002)).This feature of the present invention is different from method of the prior art, wherein remove come from the destruction that causes infected cell under the apoptotic effect that mammalian hosts virus can cause in immunity system or by virus (Guidotti etc. Annu.Rev.Immunol.19:65-91 (2001)).Thereby this aspect of the present invention provides an effective RNAi reagent to remove virus under acellular causes a disease condition.

Select the sequence of RNAi kind as the basis take the genetic sequence of target target nucleotide sequence; And preferably take target nucleotide sequence conservative region as benchmark.For example, select for the treatment virus infection or when making up the RNAi sequence of RNAi vaccine, preferred sequence is those sequences conservative between this virus kind even between the subspecies.Virus variation is very fast as known in the art, and the selection of conserved sequence will keep the effect of RNAi as far as possible within for some time.When selecting the RNAi sequence with treatment cancer or other disease, preferred sequence is those sequences conservative between gene or oncogene variant.

The method for sequence homology comparison and RNAi sequence selection has been known in this area.Identity per-cent determines and can finish by mathematical algorithm between two or more sequences.Preferably, nonrestrictive example is the algorithm (1988) of Myers and Miller; The search similarity method (1988) of Pearson and Lipman; And the algorithm of Karlin and Altschul (1993).Preferably, use computer to carry out these mathematical algorithms.Such example includes, but are not limited to: the CLUSTAL gene program on the Personal Computer (can be from Intelligenetics, Mountain View obtains among the Calif .); ALIGN program (version 2 .0), GAP, BESTFIT, FASTA, Megalign, (use Jotun Hein, Martinez, the Needleman-Wunsch algorithm), TFASTA in DNAStar Lasergene (see www.dnastar.com) and the Wisconsin genetics software package, version 8 (can be from GeneticsComputer Group (gcg), 575 Science Drive Madison Wis. obtain among the USA).Homology comparison with this program can be carried out with the parameter that default parameter or operator select.The CLUSTAL program was described in detail by Higgins.The ALIGN program take mayer and Miller as benchmark; And blast program is take the algorithm of Karlin and Altschul as benchmark; The software of carrying out the BLAST analysis can obtain (http://www.ncbi.nim.nih.gov/) by the National Center forBiotechnology Information.

In order to carry out sequence alignment, a sequence is as consensus sequence, and sequence to be tested is compared with it.When using a sequence alignment algorithm, to be tested and consensus sequence input computer is specified the subsequence coordinate if necessary, and specified sequence algorithm routine parameter.Then, take the program parameter of appointment as benchmark, sequence comparison algorithm calculates sequence to be tested (s) with respect to the sequence identity percentage of consensus sequence.

The target sequence that is usually suppressed by RNAi need to be between target sequence and RNAi molecule sense strand very high sequence homology.In some embodiments, it is about 70% that such homology is higher than, and can be to be higher than about 75%.Preferably, it is about 80% that homology is higher than, and be higher than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.In the embodiment of using multiple promoter RNAi expression construct target virus infection, the homology of 15 to 30 continuous nucleotide sequences may not have to arrive the level above 90% even 80% between the subspecies genome that virus is different--even in conservative zone--.Target sequence and the sequence homology between the RNAi sense strand for some subspecies can be 80% or lower in this case.

On the other hand, when the target gene of biology does not demonstrate kind, during height sequence homology between subspecies or the variant, multiple promoter RNAi expression construct of the present invention is useful especially, and each the RNAi kind in the multiple promoter RNAi expression cassette can be used for locating the different sites of target gene (s) or variant or subspecies set at this moment.

Except take the conservative region of target sequence as the RNAi sequence of selection of reference frame, selecting the RNAi sequence can other the factor be benchmark.Although there have been many effort to design for differentiating sequence--the feature that this discriminating sequence is based on target sequence is (for example, GC percentage composition, translation initiation codon position or based on the sequence similarity of the sequence library of the RNAi homology that is used for the search suggestion) and be effective at RNAi--choice criteria, can't foretell that the countless possible RNAi candidate sequences corresponding to target can cause the RNA silent reaction of reality with very high confidence level at present.Opposite, usually, produce and detect special candidate rna i polynucleotide sequence to determine whether the interference that target is expressed is initiated out.

A main problem of current antiviral therapy is the resistance variant to occur, usually be called escape mutant (Gitlin etc. J.of Virol.79; 1027-1035, (2005)).An aspect of of the present present invention can be suppressed the escape mutant of appearance.In some embodiments of the present invention the selection of many RNAi sequence for the treatment of virus infection is based on from the escape mutant in the cell that is infected by strand RNAi sequence.The escape mutant that occurs is to be determined by the treatment of carrying out with the expression construct that comprises the RNAi single stranded sequence after cell is by virus infection.The cell that includes resistance virus is collected and viral genome is checked order.The main mutant that sequencing result shows suppresses for opposing virus.Produce multiple promoter RNAi expression construct of the present invention, it includes based on the RNAi sequence of target gene order and the additional point mutation sequence that is used for opposing RNAi treatment.

As described, the exercisable terminator element that is connected to of the RNAi coding region of multiple promoter RNAi expression cassette.In one embodiment, terminator comprises the extension region with four or more thymidine residues.In a preferred embodiment, the terminator element of all uses all is different, and is complementary with promoter element, and both come from same gene.Such terminator comprises the terminator of SV40 poly A, Ad VA1 gene, 5S ribosomal RNA gene and human t-RNA.In addition, promotor and terminator can mix and mate, as common use RNA pol 11 promotors and terminator.

In addition, can dispose multiple promoter RNAi expression cassette so that multiple clone site and/or specific limited site can be located by certain strategy, can remove easily or replace such as promotor, RNAi and terminator element.And multiple promoter RNAi expression cassette can be by small oligonucleotide component assembling, and this component is used restriction site and/or the complementary sticking end of locating tactfully.One of carrier is carrier has comprised the plasmid with multiple connexon according to embodiments of the present invention, and wherein all sites all are specific (although this are not absolute requirement).

Then, each promotor is inserted into and has formed a basic box with three or more promotors in the specific site that designs, and all promotors can have different directions.Then, annealing primer has formed threefold representation vector construction body on the specific site that is inserted into each promotor downstream.Such insertion can move to, and for example, use is on the AAV skeleton of two specific restriction enzyme sites (identical or different) of threefold representation carrier insertion point flank.

In the step 300 of Fig. 1, multiple promoter RNAi expression cassette is connected on the delivery vector.That multiple promoter RNAi expression cassette inserts and be used for effectively transduce and the construct of expressed rna i reagent is to derive from viral and can hold virus and send in various kinds of cell.Can the be well known in the art any genetic engineering technique of the production of this construct is realized, includes but not limited to, standard round pcr, oligonucleotide are synthetic, digestion with restriction enzyme, connection, conversion, plasmid purification and dna sequencing.Construct preferably includes, and for example, multiple promoter RNAi expression construct is packaged to the required sequence of virion and/or allows multiple promoter RNAi expression construct to be inserted into the genomic sequence of target cell.The virus formulation body also can comprise the gene that allows virus replication and propagation, although such gene is cis in preferred embodiments.In addition, the virus formulation body can comprise gene or the genetic sequence in the natural or modified genome in any known life entity.For example, preferred virus formulation body has comprised the sequence that copies on bacterium.

This construct also can comprise additional genetic elements.It is unrestricted and can be selected by those skilled in the art to be included in component kind in the construct.For example, additional genetic elements can comprise reporter gene, such as one or more fluorescent mark albumen (such as GFP or RFP), enzyme that is easy to detect such as beta-galactosidase enzymes, luciferase, β-glucuronidase, embryo's alkaline phosphatase of E.C. 2.3.1.28 or secretion; The albumen such as hormone or the cytokine that perhaps can be used for immunoassay.Other genetic elements that can be used for embodiment of the present invention comprises the element of those coded proteins--described protein can bring the selective growth advantage to cell, for example adenosine deaminase, aminoglycoside phosphotransferase, Tetrahydrofolate dehydrogenase, Totomycin-β-phosphotransferase perhaps encode and can be provided at the protein of the biosynthesis ability that lacks in the auxotroph.If comprise the reporter gene along multiple promoter RNAi expression cassette, so inherent ribosome entry site(RES) (IRES) sequence also can be included in wherein.Preferably, additional genetic elements is connected operably and is controlled by promotor/enhanser independently.

Viral delivery systems based on suitable virus can be used for sending multiple promoter RNAi expression construct of the present invention.In addition, can use the hybrid virus system.The selective dependency of viral delivery systems is in many kinds of parameters, the target tissue of for example sending, the transduction efficiency of system, pathogenic, immunity and toxicity etc.Consider the diversity that can use the target disease that multiple promoter RNAi expression cassette of the present invention disturbs, the viral system that neither one is single can be fit to all application.When selecting viral delivery systems to be applied among the present invention, it is very important selecting such system, comprises the virion of multiple promoter RNAi expression cassette in the described system preferably: 1) renewable and stable propagation; 2) can be purified to very high titre; With 3) can regulate and control targeted delivery (be delivered to destination organization or organ with multiple promoter RNAi expression construct and without large-scale diffusion); 4) can express in the mode of composing type or adjustable type.

Generally speaking, according to genome be incorporated in the host cell chromosome (oncogenic retrovirus and beans shape virus) or mainly as karyomit(e) outward episome be present in the nucleus, five kinds of modal viral delivery systems that are applicable to gene therapy are divided into two classes.This differentiation is to determine every kind of important factor for the suitability of specific end use carrier; Nonconformity type carrier can, in some cases, the genetic expression that in non-proliferative cell, regulate to continue, if but in the cell of division, need to keep stable hereditary change, integrating vector just becomes the instrument of selection.

For example, in one embodiment of the invention, used the virus from Parvoviridae family.Parvoviridae is one and has the genomic strand of about 5000 length of nucleotides, non-coating dna virus family.One of member is adeno associated virus (AAV), this virus be the dependency parvovirus need and other virus (general is adenovirus or simplexvirus) coinfection so that initiation and keep an infectious cycle that productive efficiency is arranged.Lack in the situation of a such helper virus, AAV still has the ability through the combination of regulation and internalization infection or transduces to target cell, infiltrates the nucleus of non-division and division cells.

In case enter nucleus, virus is opened shell and from many different these transforming genes of formal representation--wherein the most stable is the monomer of annular.AAV will be integrated in the cellular genome of stable transduction of 1-5% (Nakai, etc., J.Virol.76:11343-349 (2002).The expression of this transforming gene can be stable especially and one about using AAV to send in the research of factors IX, the dog body Model factor IX proteins of continuous expression treatment level still after this virus is directly invaded 5 years.Because progeny virus is not infected by AAV and produces in the situation that lacks helper virus, the degree of transduction only is subject to infects this viral initiator cell.This feature is so that AAV becomes preferred gene therapy vector of the present invention.And, be different from retrovirus, adenovirus and hsv, AAV demonstrate the pathogenic and toxicity that lacks the mankind (Kay, etc., Nature.424:251 (2003) and Thomas, etc., Nature Reviews, Genetics4:346-58 (2003)).

Usually, the genome of AAV comprises only two genes.At least four different protein that " rep " genes encoding uses in dna replication dna." cap " gene product is comprised three protein of this capsid with generation by montage differently.When genome was packaged to the virus at initial stage, only inverted terminal repeat sequence (ITRs) was essential sequence; Rep and cap can delete and can be replaced by the heterologous sequence of candidate from this genome.Yet this protein requirement copies and will be packaged to based on the allos construct of AAV the virion at initial stage in order to make, and rep and cap protein must be cis.Provide this subsidiary function by helper virus coinfection in general, all adenovirus described above or simplexvirus also show as cis with the form of one or more DNA expression plasmid.Two genes since this genome is usually only encoded, not surprisingly, as means of delivery, AAV is limited in the bale capacity of 4.5kb strand.Yet although this big or small restriction may limit those genes that are used for gene therapy that can transmit, it does not have impact packing and the expression of short sequence such as RNAi on the contrary.

The purposes of AAV in RNAi uses show in such experiment, wherein AAV be used for external transmission shRNA with the expression that suppresses p53 and Caspase 8 (Tomar etc., Oncogene.22:5712-15 (2003)).Along with cloning suitable sequence in digestible AAV-2 carrier, in the HEK293 cell, produced communicable AAV virion and be used for infecting HeLa S3 cell.Shown interior living Caspase 8 and p53 level a dose-dependent minimizing has been arranged.The people such as Boden also use AAV external transmission shRNA be suppressed at HIV in the tissue culture system copy (Boden, etc., J.Virol.77 (21): 115231-35 (2003)), as what estimate by the p24 product that in the substratum of remainder, exists.

Yet, the also mandatory declaration of technology barrier when using AAV to be used for multiple promoter RNAi expression construct as carrier.For example, different percentage ratio human populations can have the neutralizing antibody for certain AAV serotype.Yet, since several AAV serotypes are arranged, some type being carried the rapid minimizing of individual per-cent of neutralizing antibody, other serotype can be used or intend type and also can use.Have at least eight kinds of different serotypes identified, although and other many types are separated is not also described fully.Another restriction is, as one possible for the immunoreactive result of AAV, only can carry out once based on the treatment of AAV; Yet, use serotype that replace, the non-human origin can allow repeat administration.The composition of route of administration, serotype and transfer gene group all can affect tissue specificity.

AAV system another restriction in use that utilizes the unmodified of multiple promoter RNAi expression construct is but that the transduction energy efficiency is low.Stable transduction may be limited to the cell of 5-10% in the body.Yet this area has known that diverse ways promotes stable transduction level.A method is to utilize the plan type, wherein uses the cap protein packing AAV-2 genome that derives from other serotype.For example, replace the AAV-5cap gene by using the AAV-2 counterpart, the people such as Mingozzi in about 15% liver cell, increased stable transduction (Mingozzi, etc., J.Virol.76 (20): 10497-502 (2002)).The people such as Thomas use AAV8 housing gene transduceed in vivo 30% mouse liver cell (Thomas, etc., J.Virol.In press).The people such as virionGrimm ( Blood.2003-02-0495) use AAV-1, AAV-3B, AAV-4, AAV-5 and AAV-6 limit the plan type of AAV-2 to be used for Study on tissue culture.The highest transforming gene expression level is to be induced by the plan C-type virus C particle that uses AAV-6; Produced than 2000% the transforming gene expression nearly of AAV-2 height.Thereby the present invention plans to realize transduction level highly with the AAV of a plan type, corresponding increasing that brings RNAi multiple promoter expression construct to express.

Another viral delivery systems that uses promotor RNAi expression construct of the present invention be one based on the viral system of Retroviridae (Retroviridae) family.Retrovirus comprises the single stranded RNA animal virus with two specific characteristics.At first, retroviral genome is diploid, is comprised of the RNA of two copies.The second, the enzyme reverse transcription of this RNA process virion association is to double-stranded DNA.Therefore this double-stranded DNA or provirus can be integrated into host genome and be delivered to progeny cell as the stable integrated element of this host genome from parent cell.

In some embodiments, slow virus is for retroviral preferred member of the present invention.Usually use blister talcum viral glycoprotein (VSV-G) to intend the type lentiviral vectors, and risen and be derived from: Human Immunodeficiency Virus (HIV)--the cause of disease of people's AIDS-like disease (AIDS); Sheep encephalitis-chronic progressive external pneumonia, it can cause encephalitis (visna) or pneumonia in sheep; Equine infectious anemia virus (EIAV), it causes autoimmune hemolytic anemia and encephalopathic in horses; Feline immunodeficiency virus (FIV), it causes immune deficiency in feline; In ox, cause lymphadenopathy and lymphocytotic bovine immunodeficiency virus (BIV); The immunodeficiency virus of ape (SIV), it causes immune deficiency and encephalopathic in the non-human Primates.Carrier based on hiv virus usually keeps＜5% parent's genome, and＜25% genome is to merge to enter the packing construct, has minimized the generation possibility of recovering replication HIV.Development by self-inactivation carrier has further increased biological safety, self-inactivation carrier has comprised in the deletion of the controlling element in long terminal repeat downstream, has eliminated carrier and has mobilized transcribing of the packaging signal that needs.

The reverse transcription of retrovirus rna gene group occurs in the tenuigenin.Be different from C-type retrovirus, and the slow virus cDNA--that other virokine is combined with each other is called as preinitiation complex--can cross nuclear membrane and occur to be shifted and to transduce Unseparated Cell.As if the constitutional features of this virus cDNA--DNA aileron--help to enter efficiently nucleus.This aileron depends on the complete of central polypurine zone (cPPT) on the pol gene that is positioned at virus, so the carrier of most slow virus origin has kept this sequence.Slow virus has widely tropism, low struvite potential, and cause forming integrative vector.Main restriction is to integrate to cause tumour to generate in some use.Using the main advantage transgenosis in most tissue or cell type of lentiviral vectors is to continue.

Being used for the construct based on slow virus of expressed rna i reagent preferably includes sequence from long terminal repetition (LTRs) 5 ' and 3 ' of slow virus.More preferably this virus formulation body includes an inactivation coming from slow virus or 3 ' LTR of self-inactivation.LTR can make by self-inactivation according to any means well known in the art.In a preferred embodiment, the U3 element of 3 ' LTR comprises the sequence of enhanser disappearance, and preferred enhanser is TATAbox, Sp1 and NF-kappa B site.As the result of 3 ' LTR oneself inactivation, the provirus that is incorporated into host genome will comprise 5 ' LTR of an inactivation.The LTR sequence can be the LTR sequence from any slow virus kind.In addition, can use promoter sequence in the virus formulation body to replace U3 sequence from slow virus 5 ' LTR.This can increase the titre of the virus of recovering from package cell line.Also can comprise simultaneously an enhancer sequence.

Other virus or non-viral system well known to those skilled in the art can be used for transmitting multiple promoter RNAi expression vector of the present invention to target cell, comprise that yet the genetically deficient adenovirus that is not limited to stably keep in vivo by being integrated into host cell the encoding viral transforming gene-transposon carrier is (referring to Yant, Deng. Nature Biotech.20:999-1004 (2002)); Derive from sindbis alphavirus (Sindbis virus) or Xi Menli the gram forest virus (Semliki forest virus) system (referring to Perri, etc., J.Virol.74 (20): 9802-07 (2002)); Derive from the system of Avian pneumo-encephalitis virus or Sendai virus; Perhaps lack the dna sequence dna of bacterium little cyclic DNA carrier (referring to Chen, etc., MolecularTherapy.8 (3): 495-500 (2003)).The little cyclic DNA of describing in the open No.2004/0214329 of the U.S. has been showed the carrier that is used for transcribing Nucleotide with continuing the height level.The characteristics of this circular vectors are to lack the bacterium sequence of expression silencing, and may comprise a unidirectional locus specificity recombinant product sequence except expression cassette.

In addition, hybrid virus system can be used for two or more viral system's useful property of combination.For example, the site-specific integration machine of wild-type AAV can be coupled efficient internalization and the nuclear target characteristic of adenovirus.The AAV that exists in adenovirus or the simplexvirus has experienced the replication cycle of a high yield; Yet, lacking in the situation of subsidiary function the specificity site of AAV genome conformity to the karyomit(e) 19.The genomic integration of AAV needs AAV rep protein expression.Because conventional AAV carrier has been deleted all virogenes that comprise rep, they can not be integrated on the karyomit(e) 19 specifically.Yet this feature can develop in suitable crossing system.In addition, non-viral genetic elements can be used for being implemented in the required characteristic requirements of delivery system of a virus, allows the genetic elements of locus specificity restructuring such as those.

In the step 400 of Fig. 1, multiple promoter RNAi expression construct is packaged in the virion.Any means well known in the art can include for the production of its genome of infectious virus particle a copy of this virus multiple promoter RNAi expression construct.Fig. 4 A and 4B show for the other method of packaging book invention multiple promoter RNAi expression construct to the virion of being sent.Method in Fig. 4 A has been used packing cell, this cell is stably expressed according to cis viral multiple promoter RNAi expression construct is bonded to the needed virus protein of virion, and be used for specific virus delivery system necessity or preferably other sequence (for example, copy the sequence that needs, structural protein and virus assembling) and that enter for tissue or viral origin or artificial source's part.In Fig. 4 A, multiple promoter RNAi expression cassette is connected to (step 300) on the viral delivery vector, and product virus multiple promoter RNAi expression construct is used for cell (step 410) in the transfection packing.Packing cell is the replication-competent virus sequence then, expresses virus protein and packaging virus multiple promoter RNAi expression construct to infectious virus particle (step 420).Package cell line can be the arbitrary cell system that can express virus protein, however comprise be not limited to 293, HeLa, A549, PerC6, D17, MDCK, BHK, bing cherry, phoenix, Cf2Th or other those skilled in the art's clone of knowing or making arbitrarily.For example, in U.S. Patent No. 6,218, the package cell line of describing in 181.

Additionally, can not stably express the clone of necessary virus protein can be by the effective production of two or more construct cotransfections with the practical function particle.Such construct includes viral multiple promoter RNAi expression construct, and another plasmid (s) includes the nucleic acid of the coding permission functional virus of cells produce (copying and pack construct) institute proteins necessary and other subsidiary function.The method that Fig. 4 B shows has been used and has been used for those virus replication product and packaging genes of stably not expressing of packing.In this example, promotor RNAi expression construct is connected in the viral delivery vector (step 300) then the carrier that copies required virus sequence and infectious virus particle product with one or more expression and carries out cotransfection (step 430).The cellular replication virus sequence is expressed virus protein and packaging virus multiple promoter RNAi expression construct (step 420) to infectious virus particle.

Package cell line or copy and pack construct and may not express the env gene product.In these embodiments, the gene of encoded packets membranin can provide at an independent construct and that is to say and viral multiple promoter RNAi expression construct cotransfection.Because envelope protein is responsible for the host range of virion to a certain extent, virus can be the plan type.As what describe in the above, " plan type " virus is to have the virion that comes from virus envelope protein, and this virus is not the virus of this genome origin.Those skilled in the art can select suitable plan type to be used for the delivery system of use and the cell of target.Except giving the specificity host range, the plan type of selection can be permitted virus and is concentrated into very high titre.Additionally virus can be carried out plan type (for example, have a liking for the environment coating and only allow to infect the murine cell, and the ambitendency coating allows to infect human and murine cell) to the environment envelope protein matter of having a liking for that the specificity kind infects by being used for restriction.In addition, the part of genetic modification can be used for the cell-specific target, such as being used for hepatocellular asialoglycoprotein, perhaps is used for the siderophilin of receptor modulators combination).

After producing in package cell line, the virion that comprises multiple promoter RNAi expression cassette carries out purifying and quantitative (titration).Purification strategy comprises density gradient centrifugation, and is perhaps preferred, column chromatography.

Viral multiple promoter RNAi expression cassette of the present invention can be especially suitable for use as treatment means or the prophylactic vaccine of processing disease.For example, multiple promoter RNAi expression construct can be introduced in cancer cell or the tumour to suppress to keep the expression of carcinogenic disease/necessary gene of tumour generation phenotype.Similarly, multiple promoter RNAi expression construct can be introduced in the cell of infecing pathogenic agent such as virus to suppress one or more expression of keeping the necessary gene of pathogenic agent.Multiple promoter RNAi expression construct can be to come the target initiation or keep disease or the required gene of symptom as vaccine.

Viral multiple promoter RNAi expression construct of the present invention can be used for the treatment of cancer, comprise solid tumour and leukemia, comprise: apudoma, choristoma, branchioma, malignant carcinoid syndrome, the innocent tumour heart trouble, malignant tumour (for example, Walker, the basilar cell, the basophilia squamous cell, brown Pierre Si, conduit, the Ehrlich tumour, original position, Krebs 2, the Merkel cell, cement, non-small cell lung, oat cell, nipple, inocarcinoma, segmental bronchus, bronchogenic spread, squamous cell, and transitional cell), histocyte is disorderly, leukemia (B cell for example, cell mixing, null cell, the T cell, chronic T cell, the HTLV-II association, acute lymphoblastic, chronic lymphocytic, mastocyte and spinal cord), pernicious hystiocytosis, Hodgkin's disease, little immunoproliferating, non-Hodgkin lymphoma, plasmoma, reticuloendotheliosis, melanoma, chondroblastoma, chondroma, chondrosarcoma, fibroma, fibrosarcoma, giant cell tumor, histiocytoma, lipoma, liposarcoma, mesothelioma, myxoma, myxosarcoma, osteoma, osteosarcoma, Ewing sarcoma, synovioma, adenofibroma, adenolymphoma, sarcocarcinoma, chordoma, cranium pharynx knurl, dysgerminoma, progonoma, mesenchymoma, mesonephroma, myosarcoma, ameloblastoma, cementoma, odontoma, teratoma, thymoma, trophoblastic tumor, gland cancer, adenoma, cholangioma, cholesteatoma, cylindroma, cystadenocarcinoma, cystadenoma, lymphangiosarcoma, myosarcoma, myxosarcoma, malignant tumor of ovary, rhabdosarcoma, sarcoma (for example, You Yin, experiment, Kao Boxi, and mastocyte), neoplasm (for example, bone, breast, Digestive tract, colorectum, liver, pancreas, hypophysis, testis, eye socket, head, and neck, central nervous system, the sense of hearing, pelvis, respiratory tract and apparatus urogenitalis) neurofibroma, and cervical atypism hyperplasia, and for other situation treatment wherein cell do not become dead or transform.In addition, multiple promoter RNAi expression construct of the present invention can be used to the associating of therapeutic modality with other, such as chemotherapy, surgical operation, psychrotherapy, high temperature, radiotherapy etc.

The gene that participates in that pathogenic agent copies, pathogenic agent is sent or keep infection can carry out target through viral multiple promoter RNAi expression construct.Viral multiple promoter RNAi construct like this can be used for the treatment of the cell (for example vaccine) that is in the danger that is infected by pathogenic agent or infected cell.Can be comprised by the pathogenic agent of multiple promoter RNAi expression construct of the present invention and method treatment the virus from Parvoviridae family, papovaviridae (comprising papillomavirus etc.), Adenoviridae, herpetoviridae (comprising herpes virus type 1 to 7), Poxviridae, have a liking for Hepadnaviridae, small nut grain nucleic acid virus (Ke Saji A and Ke Saji B virus and ECHO virus), calicivirus section, Reoviridae, the toga Viraceae, (encephalitis), flavine Viraceae (encephalitis), Arenaviridae, Retroviridae, bunyaviridae, coronaviridae, orthomyxovirus section, Paramyxoviridae, Rhabdoviridae and inovirus section, general bacterium, mycobacterium, fungi, malaria, trypanosome Schistosoma etc.

In the step 500 of Fig. 1, multiple promoter RNAi expression construct is delivered to needs the treatment express cell.Then multiple promoter RNAi expression construct of the present invention can then put into animal to affect therapeutic process at external introducing cell, perhaps directly is administered to organism, organ or cell by vivo medicine-feeding.Preferred delivering method by sending of virus infection; Yet the arbitrarily suitable delivering method that can be used for multiple promoter RNAi expression construct all is spendable.The carrier that utilizes any suitable working specification to include the multiple promoter box can be administered to mammalian hosts, and many such working specifications have been known in this area.

Nucleic acid can be introduced in tissue or the host cell by many approach, comprises virus infection, microinjection or Vesicle fusion.Injection also may be used for the muscle administration, as Furth etc. Anal.Biochem.115 (205): 365-368 (1992) describes.Nucleic acid can cover on the gold grain, and by the partickle bombardment device described in the document or " particle gun " (referring to falling into Tang etc., Nature.356:152-154 (1992)) be delivered to intradermal, wherein gold grain is bombarded to skin cells then by the DNA packaging.

Another can be used for delivering method of the present invention comprised use as Daviset etc. in U.S. Patent No. 6,509, the Cyclosert of description in 323 ^TMTechnology.Cyclosert ^TMTechnology platform is based on the glucose cup-shaped cycle repetition molecule that is called as cyclodextrin.Cyclodextrin molecular " cup " can form " inclusion mixture " with other molecule to Cyclosert ^TMPolymer and other parts make up to improve stability or increase the target part becomes possibility.In addition, usually cyclodextrin to be considered to the mankind are safe (independent cyclodextrin improve the solubleness of FDA approval and IV medicine at large)

The carrier that comprises the multiple promoter box can be prepared into for injection or the goods of administration by dissolving in water-based or non-aqueous solution, suspension and emulsification, and non-aqueous solution can be for example oil, synthetic glycerin fatty acid ester, high-grade aliphatic ester or propylene glycol; And if necessary, can use conventional additive for example expanding material, isotonic agent, suspension agent, emulsifying agent, stablizer and sanitas.

In addition, the carrier that comprises the multiple promoter box can be prepared into pharmaceutical composition together with suitable, pharmaceutically acceptable carrier or diluent.In the pharmacopedics formulation, the carrier that comprises the multiple promoter box can individually dosed or and other pharmacy activity component associating or combination medicine-feeding.Those skilled in the art can be readily appreciated that the dosage level of the carrier that comprises the multiple promoter box can be used as the function of expression level of RNAi kind in the relative difficulty or ease of the natural character of delivery system, target cell transformation, the target cell etc. and changes.

Embodiment

Hepatitis C virus (HCV) is a kind of disease that can use multiple promoter RNAi expression construct treatment of the present invention.--nearly 400 ten thousand--infected HCV now according to the statistical information of disease control and prevention center compilation, almost 2% American.Originally, most HCV people infects and do not demonstrate any symptom; Yet, also finally cause liver cirrhosis or hepatocellular carcinoma above 80% the hepatic diseases chronic and progressively development that will develop into.To cause the main reason of liver transplantation and cause 8000 to 10000 American death every year at U.S. HCV.World Health Organization's estimation has the infected above 100,000,000 seven thousand ten thousand in the whole world, at the 10-30% of some national infection rate up to total population.

HCV is just strand coating RNA viruses, belongs to flavine Viraceae family.Virion entered cell after the infectious cycle of HCV usually started from receptor-mediated binding and internalization effect.In tenuigenin, open after the shell, comprise genomic RNA positive-sense strand can with host cell machine translator direct interaction.Lack methylating of 5 ' cap, RNA has formed a sufficient secondary structure at 5 ' non-translational region (UTR), and wherein the UTR direct combination that inherent ribosome entry site(RES) (IRES) is provided and allowed the 40S subunit is with the initial step as translation program.

The HCV genome, the length of about 9600 Nucleotide, a long opening code-reading frame of the polyprotein by name of having encoded (in Fig. 8 A, showing).Virus protein is produced with the precursor forms that connects from polyprotein, and polyprotein is cut into matured product by the enzyme in multiple virus and the cell subsequently.The structural protein of having encoded in these genes comprise core and envelope glycoprotein, and name is because they are complete structural constituent in the progeny virus particle like this.Non-institutional protein provides for example RNA polymerase of dependenc RNA of indispensable function, also is produced.The virion copy machine is set up in the tenuigenin of infected cell and just rna transcription can be become the minus strand intermediate.Therefore, HCV genome cell is simultaneously as the template of self-replication and the messenger RNA(mRNA) that is used for translation encoding viral albumen.Minus strand is transcribed back positive chain RNA, has therefore increased the quantity of normal chain copy in the cell.In this stage, positive chain RNA can interact again with the host cell machine translator or, if the accumulation of enough structural proteins has been arranged, be packaged into virion.Along with the release from cell, virus repeats in whole infectious cycle.

Embodiment 1: for the exploitation of sending the AAV-2 expression vector of shRNA sequence in the body

The shRNA via infectious particle is sent test before, suitable expression plasmid is fabricated and verifies.Have at least two features to need to consider when design multiple promoter RNAi expression construct: 1) construct must effectively be packed and enter the progeny virus particle; With 2) plasmid must provide high-caliber shRNA to express.In addition, in order to detect multiple promoter RNAi expression construct, the means of assessment transfection and transduction efficiency must be arranged.

The AAV-2 carrier that has been mixed (gut) by rep and cap sequence provides the skeleton (referring to hereinafter the rAAV carrier) that is used for viral RNA i expression construct.This carrier has been widely used in the AVV research and the needs that high-level efficiency is packed have had good understanding.U6 and H1 promotor have been used for the expression of shRNA sequence, although there is the report show needle that the same shRNA of each promotor independent drive is had very in various degree inhibition.Yet, if such variation exists the promotor in the vector construction to replace at an easy rate.

In fact the same with any viral delivery systems, the rAAV carrier must satisfy specific normal size in order to effectively packed.Generally speaking, the rAAV carrier lengths must be 4300-4900 Nucleotide (McCarty, etc. Gene Ther.8:1248-1254 (2001)).When the rAAV carrier is lower than this restriction, necessary adding stuffer (Muzyczka, etc. Curr.Top.Microbiol.Immunol.158:970129 (1992)).Additionally, rAAV multiple promoter RNAi expression construct must load two or more multiple promoter RNAi expression cassettes.

Here in the embodiment of described rAAV carrier, about 400 Nucleotide of each promotor/RNAi/ terminator length component have stayed enough spaces and have been used for holding a plurality of promotors/RNAi/ terminator assembly at each expression cassette.Additionally, can in rAAV multiple promoter RNAi expression construct, add one or more selected marker boxes for use in the transfection efficiency of assessment rAAV expression construct, and allow to use the rAAV expression construct of sending through the virion that infects to come the transduction efficiency of target cell is quantized.

Initial check expression vector has driven the expression of shRNA kind, this shRNA kind according to proved have the sequence that suppresses from the luciferase activity ability of report construct design (referring to, Elbashir, etc. Embo.J.20 (23): 6877-6888 (2001)).The element of RNAi box comprises promotor, shRNA and terminator sequence, is short and utilizes long, complementary oligonucleotide independently from new assembling, and this oligonucleotide uses multiple clone site to be cloned in the virus vector then.Commercial available expression vector codes luciferase function product as the report thing so that proof shRNA regulates and control the target sequence ability of (as shown in Figure 5) downwards.

Although the shRNA for luciferase before was verified, the effect of the shRNA that is sent by rAAV is at first assessed external.Utilize standard technique will detect and report the cell of construct transfection to license.The rAAV expression construct of using incoherent shRNA sequence to replace luciferase specificity shRNA is used as in test negative contrast.By the level of fluorescence microscopy assessment selected marker thing and the relative percentage of direct estimation transfection efficiency thus.Active for the inhibition of assessing shRNA, the commercial reagents box of Application standard is measured the activity of luciferase.Additionally, use quantitative PCR in real time analysis (Q-PCR) technical Analysis from the parallel laboratory test plate, to gather in the crops the also RNA of purifying.With respect to the activity that records from the cell pyrolysis liquid that uses uncorrelated shRNA kind to process, the activity minimizing above 90% has shown that shRNA has the height function.

Carry out subsequent experimental with the impact of assessment shRNA for the luciferase reporting system, this system is transfected to mouse liver, exists with the people such as McCaffrey Nature.The work of delivering on the 418:38-39 (2002) is similar.The nucleic acid that is delivered to mouse by the water power infection protocol mainly is positioned at liver.Very similar with the principle of domination cotransfection in cell cultures, when coming from many plasmids of mixture injection usually all expression construct penetrate into identical cell.Therefore, though proved the tail vein injection program can only the transfection liver in 5-40% liver cell (McCaffrey, etc. Nature Biotech.21 (6): 639-644 (2003)), cotransfection also allows reporting system and expression construct are delivered in the identical cell.

Carry for injecting altogether with the rAAV expression construct of the shRNA sequence of luciferase and the report construct of coding luciferase genes.In the animal of having accepted negative control, carry expression construct and the together altogether injection of report construct of uncorrelated shRNA.Measure the activity of luciferase based on the lysate that results from a liver part.Q-PCR measures and histologic analysis obtains standardized data with the expression of determining labelled protein thereby the remainder of liver is used for.Other method of assessment transfection efficiency comprises that ELISA that the serum from mouse is carried out measures, wherein use the 3rd be used for secretory protein such as human α 1-synalbumin (hAAT) (Yant, etc. Nature Genetics.25:35-41 (2000), also referring to McCaffrey, etc. Nature Biotech.21 (6): marker plasmid cotransfection mouse 639-644 (2003)).

In case confirmed that expression construct has function equally in the mouse model of cell in vitro culture systems and use naked DNA plasmid co-transfection, become infectious viral particle from rAAV expression construct packing and begin to test.Available AAV makes infectious particle without assistant subsystem from commerce, and this needs three independent expression construct carry out cotransfection without assistant subsystem, comprises 1) express the rAAV construct for the shRNA (flank is AAV ITRs) of luciferase; 2) construct of coding AAV rep and cap gene; With 3) include the expression construct of producing the required helper adenovirus gene of infectious titer.After the standard purification program, virion can be used for experiment.

Before mouse is injected into the rAAV particle, set up a cover reporting system in the mouse liver.Hydrodynamic transfection is used to send luciferase report construct and for the expression plasmid for hAAT of transfection efficiency difference between the control animal.It is active in order to produce the report thing of enough levels that mouse is allowed to recover several days.

In liver, proved conclusively after the luciferase report activity, by portal vein or tail vein the rAAV particle has been injected normal C57B1/6 mouse.The rAAV particle that carries uncorrelated shRNA expression construct is used as negative control.Originally, use higher dosage (2 * 10 ¹²Vector gene group (vg)) injects mouse, in experiment subsequently, reduce dosage to produce dose-response curve.After seven to ten days, put to death mouse, collect the sample of liver and serum.From the liver that separates, utilize luciferase analysis and previously described QPCR program to decide the related levels of liver luciferase activity and RNA.Additionally, assess the efficient of transduction by the labelled protein in the measurement liver organization serial section.

The possibility of result of experiment has very wide scope.The verified hydrodynamic transfection program in front may cause the hepatocellular transfection of 5-40%.Use the AAV-2 delivery program hepatocellular result that transduces to show the transduction efficiency of 5-10%.Although AAV may preferentially transduce by the same liver cell storehouse of initial tail intravenous injection program transfection, the cell subset of each technique influence may be nonoverlapping.If the generation former instance can be seen with respect to the minimizing that a luciferase activity is arranged for the mouse of uncorrelated shRNA kind transduction.If the latter's situation occurs, can not observe so the reduction of luciferase activity.

Must prove the AAV particle sent by the threefold representation construct in vitro inhibition luciferase--HCV fusion rotein report thing.The report construct institute transfection that the tissue culture cells of license is described in detail by Fig. 9.In addition, each cotransfection mixture all has the plasmid of coding hAAT.After cultivating 48 hours, the infectious particle that use carries for triple promotor shRNA expression plasmids of HCV carries out administration to cell.The AAV particle that comprises triple promoter constructs of expressing three kinds of uncorrelated shRNA kinds is used as negative control.The activity of measuring luciferase highly has function with the shRNA that checking AAV sends.

Embodiment 2: strengthen the modification of AAV transduction liver organization efficient

Although verified carrier based on AAV can be sent the sequence that needs to liver cell, the relative level that generally speaking occurs in the transduction in those tissues is suitable low.Current use AAV-2 does not obtain relevant result to send and to express in the hemophilia clinical study of blood factor IX.In order to treat hemophilia, crucial factor only is to replenish secretory protein to make it reach the level that can bring into play curative effect.Replenishing like this may occur in minority and can express in the transducer cell of a large amount of desirable proteins.Yet, because the RNAi mechanism of action is intracellular and its effect can not directly be propagated at iuntercellular, must increase the efficient of transduction so that AAV can express shRNA and be used for the treatment of.

The people such as McCarty can produce self complementary AAV carrier (scAAV), this carrier in its capsid, have simultaneously the normal chain of same expression cassette and minus strand ( Gene Ther.8:1248-1254 (2001)).This is by suddenling change 5 ' ITR and keep that 3 ' ITR is constant to be finished.By sudden change or deletion is terminal separates other non-basic AAV sequence of site, thereby eliminated possible restructuring between wild-type AAV and this construct, having created a dna profiling, wherein to be replicated in 3 ' ITR initial.In case copy machine arrives 5 ' ITR, can not occur to separate and copy to last till 3 ' ITR.Result product has normal chain and complementary minus strand, still can effectively pack.Use the scAAV carrier, the liver cell of transduction be increased to total hepatocellular 30% (Fu, etc. Molec Therapy.8 (6): 911-7. (2003)).When between the endoplasmic reticulum vacuole, sending, transduceed by the scAAV particle above 50% cerebellum pears shape neurone.The people such as Thomas report self complementary carrier can in mouse liver, produce the luciferase transgene expression level higher 50 times than the corresponding strand AAV expression vector that injects mouse liver with same dose (Thomas, etc., J.Virol.(inpress)).Although slightly descend, the relative different degree of expressing between carrier in nearly a year after the injection maintains 20 times.

Used similar strategy herein.The amount of space of--comparing suitable little with other viral delivery systems--because the size restriction related with packing rAAV multiple promoter RNAi expression construct can be used for the delivery of therapeutic sequence since use scAAV reduce by half.Therefore, the restriction of size is lowered to 2250 Nucleotide rather than can packs 4500 Nucleotide.No matter these, the size that multiple promoter RNAi expresses the h box allows such construct.Fig. 6 has shown the diagram of the inner main element of ScAAV.

Other of AAV delivery system modified the efficient that also is used to greatly increase transduction, comprises using from the Cap albumen of other serotype packing rAAV-2 vector gene group with the virion of production plan type.Even the advantage that obtains through using plan type strategy is arranged, may only be increased to 15% of total population to the limit of liver cell transduction efficiency.Yet 12 other AAV serotypes are separated and differentiate, but also do not have can specifically describe to appreciable degree.For example, one of them be AAV-8, it is separated from the rhesus monkey heart tissue at first.Do the time spent to what transduction had measuring new cap albumen, the virus of plan type is created out, and wherein strand AAV-2 genome is with AAV-8cap plan type.Carrier carries the LacZ gene so that the relative efficiency of behind the infectious particles of assessment injection increase dosage mouse liver being transduceed.To result's summary (Thomas, etc. J Virol.78 (6): 3110-22. (2004)) be presented in the following table 1:

The dose response of table 1 AAV-2/2 and AAV-2/8 (liver cell of the %heta-gal positive)

When the dosage of the contrast AAV-2/2 particle that injects increases, hepatocellular transduction there is the increase of an appropriateness.Yet the upper limit of transduction stably remains near 10%.Surprisingly, the AAV-2/8 particle of plan type 8% the liver cell of in the situation of minimum dosage, having transduceed; Compare with AAV-2/2 contrast dosage low 30-80 doubly.Additionally, surpassed transduction efficiency for AAV-2/2 in the increase that depends on dosage for the transduction efficiency of AAV-2/8, and efficient exceeds 97% when maximum dose level.Transduction efficiency in this scope can be delivered to RNAi the cell of organization internal effectively.

RAAV RNAi expression construct has been made in the similar modification of AAV.After mixing these simple modifications, produce a large amount of virions for the check in mouse model system.Check for following rAAV RNAi experiment virus: strand AAV-2/2; Strand AAV-2/8 is from complementary AAV-2/2; With from complementary AAV-2/8.

With to carry the corresponding virion of rAAV carrier of expressing uncorrelated shRNA sequence manufactured and be used for negative control.The minimizing that the luciferase activity relative level is huge and the increase of transduction efficiency are associated.

Embodiment 3A: select and check the RNAi reagent that is directed to luciferase HCV fusion plasmid

Selecting shRNAs is not a simple proposition as the useful treatment means for HCV.Except producing the problem of escaping mutant, high mutation frequency has caused the quite large-scale sequence polymorphism in carrying virulent infected person crowd, has produced to have the nearly different genotype of 31-34% in nucleotide sequence.Based on full-length gene group sequence alignment, hypotype (kind in a given genotype scope) may have the difference of 20-23%.Therefore, that the viral genome zone that has a high conservative is preferably determined and be selected for and guarantee to treat the most widely suitability.As an aligned sequences and select the example for the treatment of relevant range how, from public's database, obtain corresponding to 30 full length sequences of HCV genotype 1b virus and use Jotun Hein method and MegAlign analysis software (DNASTAR) is compared.Zone with high conservative is identified out, for example the zone (Nucleotide 75-112) in 5 ' UTR.

In order to select candidate sequence, carried out one to all published independent total lengths or near the comparison of the HCV sequence of total length; Current have 200 such sequences of surpassing representing all known genotype.Current exist several for select and the candidate regions of development RNAi treatment and fully confirmed 5 ' and 3 ' UTR zone belong to conservative region at the HCV genome.Although known because cell translation conjugated protein or potential these non-coding sequences of spatial obstacle of modulin may not be ideal target sequences, the RNAi target of a height functionalization that the people such as Yokota are verified to 5 ' UTR of Replicate Sub-system ( EMBO Rep.4 (6): 602-608 (2003)).Although confirm that several zones that have absolute certitude within 21 single nucleosides (the corresponding size of the target sequence in the shRNA kind) stretching area are useful, even related to all genotype the analysis of data shown that the conservative of a kind of like this degree is can not occur in a plurality of hypotypes of idiotype.Therefore, selection can comprise having like this and surpasses 80% zone and kept fragment in the absolute conservative genome.In the final construct of clinical front candidate, the expression of three independent shRNAs has compensated the sequence mutability, has allowed to be included in the combination therapy in the single delivery vector.

Additionally, if those conservative regions that meet choice criteria are not identified in to the genotypic analysis of all HCV, sequential analysis can be confined to genotype (1a and 1b), they account for the U.S. and infect 3/4ths of population nearly except Africa, are topmost genotype in worldwide.In addition, up-to-date, effective anti-HCV treatment adds the use of uniting of the Interferon, rabbit of polyoxyethylene glycol and virazole (a guanosine-analogue), is quite low for the efficient of genotype 1, but very high for another genotype efficient.Thereby, in patient's population of volume, exist replacing the huge needs of therapy.Because comparison only shows homology, so other choice criteria is intersected specific shortage such as relative GC content with when the search sequence database, when the final RNAi reagent of selecting to be used for to check, be used.

For example, in an experiment, to comparing from the multiple sequence of HCV hypotype 1a and 1b.Several conservative regions are confirmed to be has enough length in order to therefrom select RNAi reagent to be used for check (greater than 19 nucleosides).5 ' UTR and 3 ' UTR zone are the most conservative zones.Since the zone of homology has been identified and sufficiently long, between different genotype, also compare.Can select the zone of generally guarding in conjunction with two comparisons.Some zones, for example the long stretching area of A ' s or U ' s, G ' s and C ' s is not considered, because they are unsuitable for the target by RNAi reagent place, the zone of remaining " qualified " is used for further selecting.(opening code-reading frame) only has a general conservative zone to be identified to can be used for the HCV genotype that all are considered in whole coding region; So it is conservative in hypotype 1a and 1b that the sequence of selecting in most of examples is those.

In case the zone of " qualified " is identified, according to RNAi reagent antisense strand 5 ' end should have than 3 ' terminal low this standard of free energy selects single RNAi sequence." adjacency pair free energy " rule is used to calculate in 5 of all potential RNAi reagent of having selected ' and 3 ' free energy of terminal 5 terminal nucleosides so far.As a result of, confirmed altogether 30 potential RNAi reagent: 10 5 ' UTR (5 '-n), 12 at opening code-reading frame ORF (C-n), and 83 ' UTR (3 '-n) (see Table 2).The relative position of these RNAi target site is presented among Fig. 8 A in the HCV genome.

Table 2:RNAi sequence

RNAi reagent	The RNAi sequence '	SEQ ID NO.	The Luc-HCV reporter plasmid	The HCV position
					5′-1	gCTGTGAGGAACTACTGTCT	SEQ ID NO.1	20	IRES 43-62
5′-2	GTCTAGCCATGGCGTTAGT	SEQ ID NO.2	-	IRES 77-95
					5′-3	GGAGAGCCATAGTGGTCTG	SEQ ID NO.3	16，20	IRES 131-149
5′-4	GCGGAACCGGTGAGTACAC	SEQ ID NO.4	16	IRES 150-168
					5′-5	GTCTGCGGAACCGGTGAGTA	SEQ ID NO.5	16	IRES 146-165
5′-6	GCGAAAGGCCTTGTGGTACT	SEQ ID NO.6	16，17	IRES 270-289
					5′-7	GATAGGGTGCTTGCGAGTG	SEQ ID NO.7	16	IRES 295-313
5′-8	GAGGTCTCGTAGACCGTGCA	SEQ ID NO.8	16，17	IRES 319-338
					5′-9	gCTGTGGTACTGCCTGATA	SEQ ID NO.9	-	IRES 279-298
5′-10	gCTGCCTGATAGGGTGCTTG	SEQ ID NO.10	17	IRES 289-307
					C-1	AGATCGTTGGTGGAGTTTA	SEQ ID NO.11	-	Core 427-445
C-2	gTTGGGTAAGGTCATCGATA	SEQ ID NO.12	-	Core 696-714
					C-3	GCCGACCTCATGGGGTACAT	SEQ ID NO.13	18	Core 732-752
C-4	GGTTGCTCTTTCTCTATCT	SEQ ID NO.14	-	Core 852-870
					C-5	GGGATATGATGATGAACTG	SEQ ID NO.15	-	NS1 1300-1318
C-6	GGATGAACCGGCTAATAGC	SEQ ID NO.16	-	NS4B 6085-6113
					C-7	GGAGATGGGCGGCAACATC	SEQ ID NO.17	-	NS5A 7046-7064
C-8	GTCTTCACGGAGGCTATGA	SEQ ID NO.18	-	NS5B 8610-8629
					C-9	GTCAACTCCTGGCTAGGCAA	SEQ ID NO.19	-	NS5B 8811-8830

[0141]

RNAi reagent	The RNAi sequence #	SEQ ID NO.	The Luc-HCV reporter plasmid	The HCV position
					C-10	gTCCACAGTTACTCTCCAGG	SEQ ID NO.20	-	NS5B 9019-9037
C-11	gCCTCTTCAACTGGGCAGTA	SEQ ID NO.21	-	NS5B 9170-918B
					C-12	AGCTTAAACTCACTCCAAT	SEQ ID NO.22	-	NS5B 9196-9214
3′-1	GCTCCATCTTAGCCCTAGT	SEQ ID NO.23	19	5-23 *
					3′-2	gTCCATCTTAGCCCTAGTCA	SEQ ID NO.24	19	7-25 *
3′-3	GTCACGGCTAGCTGTGAAA	SEQ ID NO.25	19	22-40 *
					3′-4	ACGGCTAGCTGTGAAAGGT	SEQ ID NO.26	19	25-43 *
3′-5	GCTGTGAAAGGTCCGTGAG	SEQ ID NO.27	19	32-50 *
					3′-6	GGTCCGTGAGCCGCATGAC	SEQ ID NO.28	-	41-69 *^
3′-7	GCCGCATGACTGCAGAGAGT	SEQ ID NO.29	-	50-69 *^
					3′-8	ACTGGCCTCTCTGCAGATCA	SEQ ID NO.30	-	76-95 *^

The small letters representative does not copy certainly or the genomic sequence of HCV corresponding to the HCV fusion

Table 3 luciferase HCV fusion plasmid

Luciferase-HCV fusion plasmid	The HCV target region
		#
20	5 ' 1-is to-5 ' 5
		#16	5 ' 3-is to-5 ' 10
#17	5 ' 6-is to-5 ' 10
		#12	5 ' 7-is to-5 ' 10, coding region-1
#18	Coding region-3
		#9	3 ' 1-is to-3 ' 8
C2&4	Coding region-2, coding region-4
		C5	Coding region-5
C6	Coding region-6
		C7	Coding region-7
C8	Coding region-8
		C9	Coding region-9
C10	Coding region-10
		C11&12	Coding region-11, coding region-12
C6-C9-C12-3’1	Coding region-6, coding region-9, coding region-12,3 ' 1

In order to check the effect of selected RNAi sequence, directly RNAi reagent is delivered to culturing cell with luciferase HCV fusion plasmid.Representative is presented at the left side picture frame of figure for the synoptic diagram of the luciferase HCV fusion plasmid of these experiments.It includes the gene order that a coding is fused to the fluorescence luciferin zymoprotein of 100bp nucleic acid stretching area, and--RNAi reagent originates from this HCV zone--is corresponding with the HCV target sequence.Directly for the sequence RNA i reagent of 100bp intra-zone will, if effectively, degraded luciferase HCV transcription product, thereby reduce or eliminate luciferase expression.Table 3 has been enumerated the HCV target area of some corresponding luciferase HCV fusion plasmids and use.

The siRNA reagent of pre-synthesis is to obtain from Dharmacon limited-liability company (Lafayette, CO).The Huh7 cell be before transfection 24 hours with every hole 9.5 * 10 ⁵The density of individual cell is seeded on 12 well culture plates.The cell of 30-40% is to merge in transfection.In 350 μ lOptiMEM (InvitrogenInc.) substratum, be mixed into the NovaFECTOR (VennNova, Pompano Beach, FL) of 15 μ l, and at room temperature cultivated 1 hour.In 50 μ l OptiMEM, be mixed into 0.05 μ g pRL-SV40 (Promega), the Luc-HCV reporter plasmid of 0.45 μ g, and the suitable RNAi reagent (amount of μ M) of 2 μ l.NovaFECTOR solution is joined in the DNA/RNAi mixture, and at room temperature cultivated 15 minutes.With OptiMEM the cell cleaning once and with 400 μ l NovaFECTOR/DNA/RNAi mixtures is carried out transfection.Then cell is contained 5%CO at 370C ₂Cultivated 1.5 hours under the air conditions.The perfect medium of a milliliter is joined in each hole, and continue to cultivate other 2.5 hours, replace with fresh perfect medium at substratum at that time.Further cultivate continuity two days.

After two days, sucking-off substratum and with cytolysis and the expression of measuring luciferase according to the dual luciferase working specification (Promega Madison, WI) of producer.Calculate with respect to the inhibition percentage with the cell of the non-specific RNAi kind transfection that does not have known interior living target based on the relevant light unit (RLUs) of normalizing luciferase.According to based on the transfection efficiency difference of Rluc activity expression data being carried out stdn, wherein Rluc comes from the pRL-SV40 plasmid with luciferase HCV fusion plasmid cotransfection.

Figure 12 shows the result by the luciferase expression inhibition of relative light unit metering, wherein by using different RNAi reagent targets to five a different HCV100bp zone; And the result that the luciferase expression that shows Figure 13 suppresses the wherein data of Figure 12 is represented as percent value.By observing these results, notice for selectively RNAi reagent realize at least 50% inhibition, and the plasmid that surpasses half has reached more than 80% the inhibition level of luciferase expression.

Figure 14 show to be used for the check target to the reproducibility of the experimental result of four kinds of different RNA i reagent of the multiple fragment of 100bp sequence in HCV5 ' zone (5 '-1,5 '-2,5 '-3, and 5 '-4).Should arrive and note each reagent test and the renaturation of overstating is fabulous.

Figure 15 show needle to five different RNAi reagent (5 '-3,5 '-4,5 '-5,5 '-6 and 5 '-7) transfection 24 of target multiple fragment to the 100bp sequence in HCV5 ' zone and after 48 hours luciferase expression suppress the change of per-cent.

Figure 16 show needle is to five different RNAi reagent (3 '-1 of two different RNAi reagent (5 '-1 and 5 '-3) of target multiple fragment to the 100bp sequence in HCV5 ' zone, target different fragment to the 100bp sequence in HCV3 ' zone, 3 '-2,3 '-3,3 '-4 and 3 '-5) and one be directed to the RNAi reagent transfection 44 of HCV opening code-reading frame zone 100bp sequence and luciferase expression suppresses per-cent after 72 hours change.

Figure 18 shows because the luciferase inhibition that causes with target of all kinds HCV genome different zones RNAi agent treated to the luciferase HCV fusion plasmid.Luciferase activity is with the measurement to huh7 cell 48 hours of RNAi reagent cotransfection.Can from these data, find out RNAi reagent effectively target HCV genome all the zone and cause the strong inhibition of luciferase report signal.

Embodiment 3B selection and check are for the RNAi reagent of luciferase HCV Replicate Sub-system

Although understood many single steps that HCV copies, still do not have up to date to find can transmitted virus the tissue culture system of life cycle to the virus research difficult.Yet, developed an external Replicate Sub-system (referring to for example, U.S. Patent No. 5,585,258; 6,472,180; With 6,127,116 to Rice, etc.).Replicon be can comprise for select and the self-replicating of the HCV geneome RNA of the marker gene of checking copying partly.After through the step in the infectious cycle, mechanical translation RNA and producer gene group by cell copy needed suitable virus protein, and selected marker, if present.Produce total length and subgenomic replicon and prove function although only nonstructural proteins is essential.The self-replicating property preservation of RNA do not rely on the expression of structure gene.Even when being present in when expressing in the genomic replicon of total length HCV, core and envelope protein matter are failed packaging gene group effectively to the infectivity particle--cause for research virus packing, the disappearance of overflowing and entering again the model system of step.In any case replicon can be recreated biological phenomena and the machine-processed part that HCV utilizes.

Except utilize luciferase or other such report thing as an alternative, the level of replicon activity can be regulated according to multiple other method.Can estimate by the relative level of observation nonstructural proteins the inhibition that HCV copies, wherein the relative level of protein is to detect by the immunofluorescence microscopy of having utilized the culture plate with commercial available HCV monoclonal antibody specific.Additionally or in addition, Q-PCR can be used for measuring the relative level from the HCV geneome RNA of each transfection situation.

The performance of siRNA reagent suppressor gene group rna replicon is to check by measurement Lei Niliya luciferase expression in by the clone of luciferase HCV fused replicon transformation.It is because of lacking corresponding sequence and being included into current check as just nonspecific contrast that five siRNAs can not test out in the sub-genome duplication subsystem.The synoptic diagram of luciferase HCV replicon is presented among Fig. 8 B and the 8C.Cell is seeded in 96 well culture plates; Cultivate through 24 hours, interferon alpha 2B (IFN), known can suppress the HCV replicon active (Blight, etc. Science.290:1972-74 (2000)), the concentration with every milliliter of 100 unit is added in the specific hole.Then carry out cultivating in other 48 hours, abandon substratum and produced in position cell extract so precise engineering surveying ground corresponding to the luciferase activity (data are demonstration not) of luciferase mRNA level.In the check to RNAi reagent, comprise 29 ∑ cells of luciferase HCV replicon (in Fig. 8 B, showing) with target RNAi reagent transfection in a plurality of zones to the HCV genome.The relative level of harvested cell, generation extract and assessment luciferase activity after 48 hours.Figure 19 has shown the result of the luciferase inhibition that produces by the siRNA reagent that points to luciferase HCV replicon different zones.The RNAi reagent of sensing from C-1 to the C-5 coding region does not have the target luciferase HCV replicon and has served as additional nonspecific contrast.Similarly the target of All Ranges can be used as establishment site for siRNA reagent in the HCV genome.

In case selected several high functionalized RNAi and respectively through check, with that their triple transfections entered the cell that carries Replicate Sub-system.A parallel control has comprised the uncorrelated RNAi kind of transfection respective numbers.Compared with respect to one group by the inhibition of the triple transfections for the parallel plate of only RNAi kind transfection to activity.

Three RNAi reagent are proved, and are that long complementary self-annealing oligonucleotide special site that generate and that be cloned into triple promotor AAV carriers is arranged for each those encoding sequence of corresponding shRNA.Cause the method for the highest transduction efficiency of liver organization system packed these constructs then according to the utilization of here describing and enter virion.The total length of the promotor of each triple promotor box/RNAi/ terminator component is little (about 400 Nucleotide); Three promotor/RNAi/ components of common connection have produced a sequence that 1200-1300 Nucleotide is long, far below the top size restriction from complementary AAV.

The inhibition activity of these particles is to test in the clone that carries replicon.Express triple promoter constructs of three incoherent shRNA kinds as negative control.Effect by above-mentioned analytical technology monitoring shRNA sequence.

Embodiment 4: the exploitation of triple promoter expression constructs

Make up triple promoter expression constructs and comprise three independent startup and terminator sequences that drive single shRNA kind expression in similar abundance level.The repetition of promoter element can be permitted the expression cassette to the integration of recombination event sensitivity; Thereby the promotor of three uniquenesses and terminator are identified and use.The synthetic of small nuclear rna s and transfer RNA (tRNA) s is to be instructed by the rna plymerase iii (pol III) under the domination of polIII specificity promoter.Owing to instructed by these controlling elements to have produced than more rich transcript, pol III promotor comprises deriving from U6 and H1 gene, be used to drive shRNA expression (referring to for example, Domitrovichand Kunkel. Nucl.Acids Res.31 (9): 2344-52 (2003); Boden, etc. Nucl.Acids Res.31 (17): 5033-38 (2003a); And Kawasaki, etc. Nucleic Acids Res.31 (2): 700-7 (2003)).

At first, in the carrier that comprises single, specific promotor (in Fig. 7, showing), carried out assessment to the relative promotor intensity of pol III specific sequence.Each promoter construct driven those demonstrated to luciferase activity have the shRNA of functional inhibition expression (Elbashir, etc. Nature.411:494-498 (2001a)).Since a large amount of data displays is arranged to the successful Application of the U6 promotor of shRNA expression, it can be used as the standard of estimating other promotor relative intensity.Most of certified promotors are quite lacked, and most length is in 200-300 Nucleotide scope.Long overlapping oligonucleotide be used to ressemble promotor and terminator and then the clone enter in the multiple clone site of shRNA flank.Promotor is supporting with the termination signal that naturally is present in gene downstream, promotor source.

The activity of commercial available report thing by cotransfection--pGL3 contrast (showing in Fig. 7) or pRLSV40 (Promega, Madison, WI Madison, WI) reduces the relative intensity in each promotor of extracorporeal evaluate.Use standard technique will check and report that the construct transfection enters permissive cell.Contrast is substituted by incoherent shRNA sequence by the functional shRNA that the check promoter construct forms wherein for luciferase.The 3rd construct of human secreted protein alpha-1 antitrypsin (hAAT) of encoding is transfected in the cell in order to estimate variation in transfection efficiency.Active for the inhibition of assessing shRNA, utilize the commercial reagents box (Promega, Madison, WI) of standard to measure luciferase activity.The luciferase expression of shRNA regulation and control reduces, and is normalized into the hAAT level, is the indirect measurement to promotor strength.Additionally or in addition, the RNA from parallel laboratory test culture plate results and purifying is carried out quantitative PCR in real time analysis (Q-PCR) for the luciferase rna level.

In case identify suitable promotor and terminator pair, just can design last triple promotor RNAi expression cassettes.Several designs of last carrier have been checked, be included in to have all three promotors in the arranged in series or reach in the clockwise direction in the clockwise direction configuration (for example, transcribing from the top of box DNA and bottom chain) and have all three promotors or any variant wherein.Three such configurations show in Fig. 3 A, 3B and 3C.

The configuration that shows in Fig. 3 B and 3C is transfected to be entered in the cell and utilizes the luciferase activity analytical study it suppresses active.The distinct rna i kind of two or more promoters driven can cause additional or collaborative inhibition, thereby, in order to be evaluated at the functional and relative intensity of each promotor in the triple promoter expression constructs of this paper, produce multiple expression cassette and detailed description in table 4.Use these kinds, the inhibition of the shRNA of each promoters driven of threefold representation inside according to luciferase analysis measure.Additionally, utilize the Q-PCR assessment by the relative level of the transcript of each promoters driven.Although hairpin RNA usually can stop from complementary person's character these rna transcriptions direct Q-PCR is originally measured, three different intimate onesize non-hair clip transcripts can insertion vector to replace using the shRNA of viral multiple promoter RNAi expression construct, wherein viral multiple promoter RNAi expression construct has the box that shows such as at Fig. 3 D and 3E.

3 type promotor: U6-1, U6-8, U6-9, long H1, human Y4, the human Y5 of following RNA Pol III, selected, synthetic and clone enter single or the multiple promoter construct in.Then luciferase specificity shRNA is cloned into the downstream of a certain promotor in the downstream of single promoter construct or the triple promoter construct (table 4).

After transfection 72 hours, sucking-off substratum and dissolved cell are measured luciferase expression with the dual luciferase working specification (Promega, Madison, WI) according to producer.The cell (negative control) of comparative simulation treatment calculates the inhibition percentage based on the relevant light unit (RLUs) of standardized luciferase.An incoherent RNAi reagent is used as simulation/negative control in each experiment.Carry out luciferase RLUs stdn for transfection efficiency according to the Lei Niliya luciferase that goes out with the pRL-SV40 plasmid expression of target plasmid co-transfection.

In the construct of 293 cells (17B) shown in Huh7 cell (17A) construct shown in Fig. 3 C and Fig. 3 B, all promotors demonstrate similar activity.The rejection characteristic that can find out the shRNA in single and multiple promoter scope is similar.Data presentation shRNA is suppressed in triple promotor scopes and is similar in Huh7 and 293 cells.

Table 4: be used for assessing promotor in the construct type shown in the relatively inhibiting Fig. 3 B of each expression cassette and the 3C/shRNA and insert.

The plasmid that includes the promotor that shows among Fig. 3 B/shRNA/ box type is used to assess the relative restraining effect of the expressed shRNA reagent that goes out of multiple promoter expression cassettes.Including target to the plasmid of the shRNA construct of HCV genome different zones operationally is placed under the domination of different promoters.Table 5 is presented at shRNA under the domination of independent promotor, is included in the shRNA reagent of (namely inactivation) promotor that is positioned at that B order under controlling.Include from being connected to 5 of luciferase genes '-3 and enter in the Huh7 cell to the luciferase HCV fusion plasmid #16 of the HCV sequence in 5 '-10 zones and multiple promoter construct together cotransfection.Figure 20 show when and multiple promoter/pair shRNA expression construct rather than the luciferin enzymeinhibition has been increased during with the construct cotransfection that includes the single shRNA after being connected to single promotor.

Table 5 in Fig. 3 B, show for assessment of the promotor in the relative inhibiting construct type of single and double starting in multiple promoter expression cassettes/shRNA inset.

The external check of the triple promoter constructs of embodiment 4B:shRNA

The triple promotor boxes that show at Fig. 3 C are to use following promotor to make: U6-9 is in the A site, and U6-1 is in the B site, and U6-8 is in the C site.Promoters driven target a plurality of positions to the HCV genome the shRNA sequence transcribe or the promotor heel with in " sky " T ' s stretching area in the configuration to prevent reading over of promotor.Single promotor in contrast/shRNA construct utilizes the U6-1 promotor to make up.Single or triple promoter constructs are with the luciferase HCV reporter plasmid cotransfection that comprises different HCV target area.Figure 21 shown and used the result that luciferase suppresses behind single or the multiple promoter construct cotransfection, and wherein single the or multiple promoter construct zone that to be target to the HCV genome different and the luciferase HCV fusion plasmid of thrin are comprising the sequence that comes from HCV genome target region.Cotransfection to Huh7 cell was measured luciferase activity after 72 hours.The shRNA that can see the C-12 zone of the special HCV of being directed in the chart of the top of Figure 21 demonstrates that the luciferase reporter plasmid that comprises C-12 coding region among the HCV is had a suitable inhibition is active.When specificity for other regional shRNA of HCV by individually or as the part of multiple promoter box of the present invention and do not observe specific inhibition when expressing.Similar result can observe in middle plot, and wherein luciferase HCV reporter plasmid has comprised the sequence from C-9 coding region among the HCV.In this example, the shRNA that is directed to specifically the C-9 zone that expresses from single promotor or triple promotor box has the strongest inhibition in the shRNA reagent that had detected active.Bottom pictorialization used single or triple promoter constructs and comprises the luciferase that causes behind the reporter plasmid cotransfection in HCV5 ' 6 zones and suppress.Can see that the strongest inhibition result comes from comprises the shRNA that specificity is directed to 5 ' 6 targets in single or the multiple promoter construct.Triple promoter construct of the present invention is used for effectively suppressing the specific gene target.

Embodiment 5; Check in the body of the triple promoter construct reagent of shRNA

Be by hydrodynamic tail vein injection program to the assessment of multiple promoter construct of the present invention in vivo, the multiple promoter that shows among the use Fig. 3/shRNA plasmid DNA and suitable Fluc HCV merge reporter plasmid cotransfection mouse liver and carry out.Multiple promoter used herein/shRNA plasmid has controlled that target encodes 9 to the HCV, the expression of the shRNA kind of coding 12 and 5 ' 8 positions.Operation report construct and incoherent shRNA injection negative control mouse.In addition, use the plasmid injection mouse of expressing the Lei Niliya luciferase.This protein is used to the mouse liver transformation efficiency is carried out stdn.Injected rear 48 hours, and put to death mouse, collect liver.Use Promega luciferase test kit to detect the active and Lei Niliya luciferase activity of Fluc of liver lysate.The assessment of comparison negative control is expressed the inhibition level of inducing from the shRNA of hair clip construct.Result in the table 6 has shown that triple promoter construct of the present invention has suppressed report signal in vivo effectively.

The triple promotors of table 6/shRNA plasmid is to the inhibition per-cent of Fluc signal

Group #	n	Plasmid expression shRNA (5ug/ mouse)	Reporter plasmid (12ug/ mouse)	Luciferin RLU (being standardized as Renilla)	Compare the inhibition % of triple shRNA with non-specific shRNA contrast
						21	5	Triple promotor/shRNA (5 ' 8as, C-9s, C-12as)	C-9 (pBen71)	0.05	98％
23	5	Single non-specific 5 '-3 (non-specific shRNA)	C-9 (pBen71)	3.20	n/a
						25	5	Triple promotor/shRNA (5 ' 8as, C-9s, C-12as)	C-11/12 (pBen73)	1.00	93％
27	5	Single non-specific 5 '-3 (non-specific shRNA)	C-11/12 (pBen73)	15.10	n/a

To include by the injection of tail vein injection or hepatic vein and to express target to the infectious AVV particle of the carrier of HCV sequence and be delivered to normal mouse.Express the infectious AVV particle of three uncorrelated shRNAs negative control.Originally, used a quite high viral dosage, for example 2 * 10 ¹²The vector gene group, although follow-up experiment is used to set up dose-response curve.Using a suitable Fluc HCV to merge reporter plasmid by hydrodynamic tail vein injection program at different time injects.After injection reporter plasmid 48-72 hour, put to death mouse, collect liver and serum sample.Assess the efficient of the shRNA that AVV sends as benchmark with the Fluc activity.In addition, the liver level of the serum level of utilization monitoring hAAT or Lei Niliya luciferase decides the transfection efficiency between animal.The serum level of measuring liver enzyme alanine aminotransferase, aspartic transaminase and tumor necrosis factor alpha with guarantee overall hepatotoxicity can not be treated induced.

Embodiment 6: the shRNA for the HBV model system that copies in the body that check AAV sends

The small animal model for the shRNA expression construct effect of HCV that does not have that desirable can be used for check that AAV sends.Yet, to the check of the AAV expressed rna i construct in a substitution model system can be for assessment of liver in to the inhibition degree of virus replication.Although it must be different that the sequence of the shRNA that is sent forms at such model, the rest part of this system comprises the triple promoter expression vectors of AAV and packing composition, is keeping not changing.Used the model system for hepatitis B virus (HBV).Be included in triple promotor AAV expression construct with target to the shRNA sequence of HBV be according to the effect of the shRNA sequence of announcing up to now select (McCaffrey, etc. Nature Biotech.21 (6): 639-644 (2003); Ying, etc. Biochem.Biophvs.Res.Commun.309 (2): 482-484 (2003); Klein, etc. Gastroent.125 (1): 9-18 (2003); And Shlomai, etc. Hepatoloav.37 (4): 764-70 (2003)).Suitable AAV expression construct with three HBV specificitys of triple promoters driven shRNAs enters in the virion according to the method packing of here describing then.

By hydrodynamic transfection program mouse is carried out the injection first time with the expression plasmid that carries the HBV genome sequence and allow to set up hbv replication.In order to assess transfection efficiency, the plasmid of a coding hAAT is added into and is used for altogether injection in the mixture.The initial index of HBV activity is to use the enzyme-linked immunosorbent assay analysis to collect from hepatitis B virus surface antigen (HBsAg) and the HbcAg (HBcAg) hemorrhage, that occur by the serum the treatment animal of posterior orbit neuroplexus to assess.

Establish in mouse liver after the copying of HBV, the AAV virion of having packed triple promoter constructs of shRNAs among the coding HBV utilizes tail vein injection or hepatic vein injection and is introduced in the mouse.Use carries the AAV virion of AAV expression construct of three uncorrelated shRNAs of HBV of coding as negative control.At the terminal point of experiment, the downward modulation of HBsAg and HBcAg protein quantity in the monitoring serum sample.Additionally or in addition, the relative level by HBV RNA in the Q-PCR assessment liver organization.Come the hepatotoxicity of evaluation system by alanine aminotransferase, aspartic transaminase and tumor necrosis factor alpha in the ELISA monitoring serum.

Figure 10 is the graphic extension of the triple promotor box of a precursor embodiment, and the triple promotor boxes of this precursor have specific restriction site and can be used for inserting or removing RNAi kind or terminator element or be used for cutting off U6-9, pU6 or the U6-8 promotor that provides.In addition, arrow shows the transcriptional orientation of each three promotor/RNAi/ terminator component.Figure 11 A and 11B/11C have shown the nucleotide sequence (being respectively SEQID NO 31 and 32) in two embodiments of precursor promotor box of the present invention.Figure 10, the position of demonstration U6-9, pU6 or U6-8 promotor, and the restriction site of precursor promotor box of the present invention.

Although the present invention is described with reference to specific embodiment, it should be understood that and can make to those skilled in the art different changes and utilize equivalent to substitute within the real spirit and scope of the present invention.In addition, in order to realize that purpose of the present invention, spirit and scope can adopt many modifications to adapt to specific position, material or operation.The modification of all these classes is all within the scope of the invention.

Whole reference of here quoting are in order to help the understanding of the present invention, and they are not any limitation of the invention.

Claims (13)

1. the genetic constructs that comprises multiple promoter expression cassettes, described multiple promoter expression cassettes comprises at least three promotors/RNAi/ terminator component, wherein each promotor/RNAi/ terminator component comprises promoter element, terminator element and the sequence of the coding RNA i kind that is operably connected with promoter element and terminator element, and wherein each RNAi kind is different each other, and in the wherein said RNAi kind at least one encoded by SEQ ID NO:22.

2. according to claim 1 genetic constructs, at least one in the wherein said RNAi kind is by SEQ ID NO:6 or SEQ ID NO:19 coding.

3. according to claim 1 genetic constructs, wherein said RNAi kind is by SEQ ID NO:6,19 and 22 codings.

4. each genetic constructs in 3 according to claim 1, wherein genetic constructs also comprises this construct packing is entered necessary element in the infectious viral particle.

5. each genetic constructs in 3 according to claim 1, wherein have arbitrary box inner occur once the terminator element with occur twice or the set of above terminator element.

6. each genetic constructs in 3 according to claim 1, wherein have arbitrary box inner occur once promoter element with occur twice or the set of above promoter element.

7. each genetic constructs in 3 according to claim 1, wherein RNAi kind target is to the gene with sequence single nucleotide polymorphism (SNP) between the variant, and each RNAi kind can target to the hypotype of one or more variant.

8. each genetic constructs in 3 according to claim 1, the wherein quick virus sequence of sudden change of RNAi kind target experience.

9. according to claim 1 each genetic constructs, wherein one or more variants of the sequence target gene of RNAi kind in 3.

10. according to claim 1 genetic constructs, wherein said RNAi kind be based on the sequence of target gene, and additionally based on the sequence that has for the point mutation of opposing RNAi treatment.

11. in the claim 1 to 10 each genetic constructs for the preparation of the treatment infection with hepatitis C virus medicine in purposes.

12. each genetic constructs comprises for the preparation of the purposes in the medicine of one or more nucleic acid target that is modified at cells in the claim 1 to 10:

A) each genetic constructs packing in the claim 1 to 10 is entered virion;

B) this virion is delivered to cell; With

C) under the condition that nucleic acid target to be finished is enough to express, express from three or more RNAi kinds in each the multiple promoter expression cassettes in the claim 1 to 10,

Wherein said nucleic acid target is basically identical with the gene of finding in virus, and described virus is hepatitis C virus.

13. each genetic constructs comprises for the preparation of the purposes in the medicine of one or more nucleic acid target that is modified at cells in the claim 1 to 10:

A) each genetic constructs packing in the claim 1 to 10 is entered non-viral particle;

B) should non-viral particle delivery to cell; With

C) under the condition that nucleic acid target to be finished is enough to express, express from three or more RNAi kinds in each the multiple promoter expression cassettes in the claim 1 to 10,

Wherein said nucleic acid target is basically identical with the gene of finding in virus, and described virus is hepatitis C virus.

Images