CN101065499A - RHD and ABO genotyping by multiplex PCR - Google Patents

Abstract

This invention relates to a series of PCR primers that will allow the simultaneous amplification of regions of the clinically significant ABO and RHD genes.

Description

Carry out RHD and ABO gene type by multiplex PCR

Technical field

The present invention relates to the genetic analysis field.More specifically, thus the present invention relates to genotype research of experimenter is carried out the blood group analysis.

Background technology

The blood group determination that uses serological technique to carry out only can be measured quite a limited number of several significant clinically blood group at present.Nearest progress comprises the blood group determination that uses molecular genetic techniques to carry out, but measuring, this class only can be used for limited condition, for example: antenatal mensuration, this moment isolating fetal blood be used for serological research will be dangerous, perhaps patient's the blood group determination of blood transfusion repeatedly, make determination of serology become difficult because patient/blood donor's blood mixes this moment.

At present, because large-scale blood group gene type is not also carried out in restriction on the molecular genetic technique and the present relative cheap cost of serology detection method.Yet blood group serology has obvious defects.For example, it is limited or may also not have this class reagent to be used to detect the specific available amount of reagent of some blood group antigen.Therefore be not that all blood groups can both be carried out conventional determining.Will cause first alloimmunization reaction like this, the antigen that the immune blood donor's of blood recipient's blood meeting at this moment red corpuscle carries.Blood group gene type to all blood donors can obtain more fully blood testing result, and the incidence of alloimmunization reaction and transfusion reaction is subsequently reduced.

Abo blood group is the most significant in all human blood groups, can cause the direct transfusion reaction and may cause death when the inconsistent blood of input ABO.This is because A, B and O individuality carry anti-A and/or anti-B antibody (being produced by the bacterium carbohydrate antigen) in its serum, this antibody can with non-existent red corpuscle A and/or B antigenic cross-reaction in their Autoerythrocytes.The ABO consistency is relevant morbidity of blood transfusion and main causes of death, each blood donor and all necessary abo blood group of determining them of the patient that will accept blood, blood products or solid organ transplantation.

Usually the human erythrocyte's who uses the red corpuscle serology to determine to transfuse blood to use in the therapy abo blood group.Although serological technique is widely used and is cheap, the ABO gene type still medically has certain effect in the routine blood transfusion.Few A and B allelotrope can suppress two kinds of antigen series (for example A3, B3, A _E1, B _E1, A _XAnd B _X) expression.These few mutation may be by omission in the automatic ABO typing of routine, and some in them will be O type blood group by somatotype.Having in this class allelotrope much is that heterozygosis ABO gene causes, and has only with molecular genetic technique and could differentiate.Substitute the serological cutting edge technology of red corpuscle if adopt the blood grouping of molecular genetic technique to become, just will need development and application the genotypic reliable detection of ABO (Olsson (2001) Blood 98 1584-1593).

ABO organizes the A of blood group system and B antigen to be synthesized by the glycosyltransferase that is positioned at the ABO locus coding on the 9th karyomit(e).The gene of coding A glycosyltransferase is (Clausen et al (1990) J.Biol.Chem.265 1139-1145 separated at first, that clone and check order; Yamamotoet al (1990) Nature 345 229-233).The coding region of a 1062bp has been found in sequential analysis, the protein of a 41kDa of its correspondence.Show that subsequently this coding region is distributed in (Yamamoto et al (1995) Glycobiology 5 51-58 in 7 exons; Bennett etal (1995) Biochem.Biophys.Res.Commun.211 347), this gene on 9q34 across the zone of one～20kb.The continuous programming code sequence is an A101 allelotrope, the specificity of influential glycosyltransferase and the polymorphism of effectiveness all be considered to this allelic sudden change.

Influence the specificity of coded glycosyltransferase and/or the major part of effectiveness and mutate present exon 6 and 7.Yet in exon early, also also have several important sudden change (Chester ﹠amp; O1sson (2001) Trans.Med.Rev.11 295-313).The main allelic sudden change of encoding is shown in table 1.

The polymorphism of the selected Nucleotide of table 1. between the main allelotrope of the ABO of exon 6 and 7 gene

Nucleotide	261	297	467	526	703	796	802	803	1060
										A1(A101)	G	A	C	C	G	C	G	G	C
A2(A201)	-	-	T	-	-	-	-	-	Disappearance
										B(B101)	-	G	-	G	A	A	-	C	-
O1(O01)	Disappearance	-	-	-	-	-	-	-	-
										O1 v(O02)	Disappearance	G	-	-	-	-	-	-	-
O2(O03)	-	G	-	G	-	-	A	-	-

"-" expression does not change.Boldface letter is illustrated in mutagenic Nucleotide in the coded amino acid.In the bracket is the other title of allelotrope (http://www.bioc.aecom.yu.edu/bgmut.index.htm).

The Rh system is the blood group system of tool polymorphism, and is significant in blood transfusion medical science.The Rh system is relevant with hemolytic blood transfusion reaction, hemolytic disease of newborn and autoimmune hemolytic anemia.Two kinds of height homologous different genes are arranged in the Rh system.A kind of gene (RHD) encoding D polypeptide, another kind of (RHCE) coding CcEe polypeptide.RHD carries D antigen as the strongest blood group immunogen.A sizable part (15-17%) crowd is because the disappearance of RHD gene or other gene alteration and do not have this antigen (being the negative phenotype of Rh).There are four kinds of allelotypes in RHCE, and each allelotrope has determined two antigenic expression (RHCE is four kinds of allelic general names) in Ce, ce, cE or the CE combination.

Multiple (MPX) polymerase chain reaction (PCR) is a variation scheme of known round pcr, and it uses different primers right in same amplified reaction.This technology has been applied to the blood group analysis.Forefathers have generated the MPX PCR primer of the Rh D sequence that is used to increase.Avent N Det al, Blood discloses the analysis of a kind of multiple RHD gene type among 1997,89 2568-77, and this analyzes the amplification based on RHD intron 4 and 3 ' non-coding region.Subsequently, (Maaskant-van Wijk P A et alTransfusion 38, November/December 1998,1015-1021) to have generated other six kinds of RHD gene primer sequences that are used for MPX PCR.In above-mentioned disclosure, the design primer is with the different exons of amplification RHD gene.Show that also RHD analyzes the non-coding region (being intron) that needn't depend on the RHD gene, this technology has great value in antenatal RH gene type.Wagner et al, 1999, Blood, 93,385-393 discloses a kind of method based on normal PCR, and this method is used the big relatively PCR product of primer amplification.Because the size of amplified production, this PCR primer can not be used for multiple PCR method.

The contriver has prepared the primer that can be used for multiplex PCR, and described multiplex PCR is used for blood group gene type analysis, particularly RHD and the ABO gene type is analyzed.Identify and screen in MPX PCR, the increase fragment (they are less than 1315bp in this case) of suitable size of this primer, also at functional screening primer, that is to say can increase well required fragment and required fragment had specificity of the primer of selecting.

Summary of the invention

According to a first aspect of the invention, provide a kind of and carried out the method that the RHD gene type is analyzed by multiplex PCR, described method comprises to be made from the following one or more pairs of primers in experimenter's RHD gene nucleic acid and the following table (table 2) contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization:

Table 2

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA
2	198R	ggccgcgggaattcgattTGCCCCTGGAGAACCAC
			3	int1F	gccgcgaattcactagtgTGACGAGTGAAACTCTATCTCGAT
4	297R	ggccgcgggaattcgattCCACCATCCCAATACCTGAAC
			4A	296R	ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT
5	303F	gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT
			6	397R	ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT
7	403F	gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT
			8	499R	ggccgcgggaattcgattCAAACTGGGTATCGTTGCTG
8A	498R	ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG
			9	502F	gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA
9A	503F	gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA
			10	5Aluint4F (RoHar)	gccgcgaattcactagtgAAGGACTATCAGGCCACG
10A	RoHar4	gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC
			10B	RoHar8	gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG
11	599R	ggccgcgggaattcgattCACCTTGCTGATCTTCCC
			12	601F	gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA
13	697R	ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG
			14	702F	gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG
14A	701F	gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG
			15	799R	ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG
15A	798R	ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA
			16	801F	gccgcgaattcactagtgCTGGAGGCTCTGAGAGGTTGAG
17	899R	ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG
			18	901F	gccgcgaattcactagtgACTGTCGTTTTGACACACAAT
19	998R	ggccgcgggaattcgattTGTCACCCGCATGTCAG
			30	1001F	gccgcgaattcactagtgCAAGAGATCAAGCCAAAATCAGT
31	1097R	ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG
			32	MAPH-rev	gccgcgaattcactagtg
33	MAPH-forw	ggccgcgggaattcgatt

And amplification RHD gene nucleic acid.Every kind of primer shown in the table all contains one 5 ' MAPH label (preceding 18 amino acid of the primer sequence that lowercase is represented) and gene specific sequence (capitalization is represented).The MAPH label is used for assisting the amplification of nucleic acid.Especially, in case use primer that the RHD gene nucleic acid is carried out pcr amplification, just use MAPH label primer (32 and 33) that this sequence is further increased.Preferably, this two steps amplification is carried out simultaneously.As skilled in the art to understand, there is not the primer (the only primer sequence of representing by capitalization) of 5 ' MAPH label can be used for the method for the present invention RHD gene nucleic acid that increases yet.Perhaps, primer sequence can contain and the different sequence label of MAPH label shown in the table.

Method of the present invention has some advantages, and 10 zones because it can increase simultaneously promptly have the exons 1 to 10 of the RHD gene of very big clinical meaning.This comprises common RHD allelotrope (comprising the D mutation of significant clinically part and reduction).Especially, it comprises exons 10, a sudden change that causes the Del phenotype is wherein arranged, and this is described in Gassner C, Doescher A, DrnovsekTD, Rozman P, Eicher NI, Legler TJ, Lukin S, Garritsen H, KleinrathT, Egger B, Ehling R, Kormoczi GF, Kilga-Nogler S, Schoenitzer D, Petershofen EK. (2005) Transfusion 45 (4) 527-538 Presence of RHD inserologically D-are among the C/E+ individuals:a European multicenter study.This method can be carried out more fully blood test, and the incidence of alloimmunization reaction and transfusion reaction is subsequently reduced.

The advantage of present method is that also it can distinguish some common part D phenotypes that produced by heterozygosis RHD-RHCE gene, comprises DV and DVI phenotype.These phenotypes do not produce the fragment of expection after amplification.The DVI phenotype is more common relatively, and an example just appears in per 4000 people in West Europe blood lineage's individuality.At least eight hereditary bases and DV phenotypic correlation are arranged, at least four hereditary bases and DVI phenotypic correlation are arranged.Follow-up further analysis to the MPX product can pick out all known DV phenotypes.The individuality of DVI phenotype lacks a large amount of D epi-positions, and can by the blood transfusion or gestation and to RHD antigen alloimmunization.In Britain, DVI type mother quilt somatotype artificially is the D feminine gender, so they will accept anti-D to prevent alloimmunization.Yet, if the blood donor of DVI phenotype is the D feminine gender by somatotype, just alloimmunization may take place when their blood is defeated by " really " D feminine gender individual.The gene type that uses analytical procedure of the present invention to carry out can be discerned the people of DVI type, and they can be got rid of and prepare blood transfusion to outside the blood supply crowd of D negative individuals.

The advantage of present method is that also it can be used for analysis to the blood supply experimenter that grows up.This is for example very important the sicklemia patient for the experimenter of the frequent blood transfusion of frequent acceptance.

The DHAR phenotype is caused by heterozygosis RHCE-RHD gene, and wherein the exon 5 of RHCE is replaced (Beckers E A et al, Br J Haematol.1996 Mar by RHD; 92 (3): 751-7.).But the DHAR red corpuscle is expressed a small amount of the significant D epi-position of number.These individualities may be Rh D feminine gender by somatotype when using conventional serological analysis, and their blood just is defeated by the individuality of D feminine gender possibly.These individualities will be by immunity.DHAR is a kind of very rare blood group.Analytical procedure of the present invention can detect the DHAR phenotype.

Preferably, at least a primer that uses in present method is labeled so that detect amplified production.It is suitable that to be labeled as those skilled in the art known.For example, be required with one of described primer of 6-FAM mark.

The nucleic acid that uses in this one side of the present invention and following one side can derive from any suitable source again, for example includes but not limited to blood, buccal smear, urine, amniotic fluid.Preferably, nucleic acid comes autoblood.

Blood can be used by any way, for example uses in the mode that exsomatizes.Particularly, can carry out method of the present invention, perhaps for example carry out method of the present invention from the sample of the blood of blood donation to sending to pass to the blood of individuality to directly taking from the individual patient's that transfuses blood the blood that for example needs.

Nucleic acid is preferably DNA, most preferably is genomic dna.

Annealing temperature can be 54-63 ℃.Preferably, annealing temperature is about 60 ℃.Most preferably, annealing temperature is 60 ℃.

Method of the present invention can combine so that other blood group genes are carried out gene type with other MPX PCR method.MPX PCR：ABO/MNS/P1/RHCE/LU ( Lutheran ) /KE ( Kell ) /LE ( Lewis ) /FY ( Duffy ) /JK ( Kidd ) /DI ( Diego ) /YT ( Cartwright ) /XG/SC ( Scianna ) /DO ( Dombrock ) /CO ( Colton ) /LW/CH/RG ( Chido/Rodgers ) /Hh/XK/GE ( Gerbich ) /CROM ( Cromer ) /KN ( Knops ) /IN ( Indian ) /OK/RAPH/JMH ( JohnMiltonHagen ) /IGNT/P/GIL/。

Nucleic acid with the inventive method amplification can detect with any suitable method.For example, the nucleic acid that obtains of amplification can have the suitable nucleic acid probe hybridization of sequence to be detected at this with specificity.The suitable nucleic acid probe for example form of gene chip provides.Preferably, gene chip comprise can with the nucleic acid probe of specificity at the nucleic acid hybridization of other blood group genotypes.

In a preferred method of the present invention, RHD gene nucleic acid and following one or more pairs of primers are to contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; And 18,19, preferably with all above-mentioned primers to contacting.

In another preferred embodiment, RHD gene nucleic acid and following one or more pairs of primers are to contacting: 1,2; 3,4A; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; And 30,31, preferably with all above-mentioned primers to contacting.

Most preferably, RHD gene nucleic acid and following all primers are to contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31.

According to a second aspect of the invention, provide a kind of and carried out the method that the RHD gene type is analyzed by multiplex PCR, described method comprises that the RHD gene nucleic acid that makes from the experimenter contacts with at least a primer that is selected from following table (table 2A), and wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization:

Table 2A

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA
4	297R	ggccgcgggaattcgattCCACCATCCCAATACCTGAAC
			4A	296R	ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT
5	303F	gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT
			6	397R	ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT
7	403F	gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT
			8A	498R	ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG
9	502F	gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA
			9A	503F	gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA
10	5Aluint4F (RoHar)	gccgcgaattcactagtgAAGGACTATCAGGCCACG
			10A	RoHar4	gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC
10B	RoHar8	gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG
			11	599R	ggccgcgggaattcgattCACCTTGCTGATCTTCCC
11A	598R	ggccgcgggaattcgattTGTGACCACCCAGCATTCTA
			12	601F	gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA
13	697R	ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG
			14	702F	gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG
14A	701F	gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG
			15	799R	ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG
15A	798R	ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA
			17	899R	ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG
18	901F	gccgcgaatt cactagtgACTGTCGTTTTGACACACAAT
			19	998R	ggccgcgggaattcgattTGTCACCCGCATGTCAG
31	1097R	ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG

And amplification RHD gene nucleic acid.As understood by one of ordinary skill in the art, need to use one

Primer is increased with acquisition.Two kinds of primers all can be selected from table 2A, and perhaps a kind of primer is selected from table 2A and uses in conjunction with any suitable another kind of primer, and described another kind of primer is for for example being selected from primer or any other suitable primer of table 2.Primer is to using separately or use with other primers.Preferably, present method comprises RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31.

In another preferred embodiment, present method comprises RHD gene nucleic acid and following one or more pairs of primers contacting: 1 and 2; 5 and 6; 10 and 11; 12 and 13; 14 and 15; And 18 and 19.

In still another preferred embodiment, present method comprises RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2; 3,4A; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; And 30,31.

In this method of the present invention and method subsequently, primer is to can using respectively or be used in combination, with for example one of amplification, several or all purpose exon.

As described in a first aspect of the present invention of front, every kind of primer shown in the table 2 all contains one 5 ' MAPH label (preceding 18 amino acid of the primer sequence that lowercase is represented) and gene specific sequence.As understood by one of ordinary skill in the art, there is not the primer (the only primer sequence of representing by capitalization) of 5 ' MAPH label can be used for the method for the present invention RHD gene nucleic acid that increases yet.Perhaps, primer sequence can contain and the different sequence label of MAPH label shown in the table.

According to a third aspect of the invention we, provide a kind of and carried out the method that the ABO gene type is analyzed by multiplex PCR, described method comprises to be made from the following one or more pairs of primers in experimenter's ABO gene nucleic acid and the following table (table 3) contacting: 20,21; 22,23; 24 or 24A, 25; 26,27 and 28,29, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization:

Table 3

Primer number	The primer title	Sequence (5 '-3 ')
			20	int1-49f	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG
21	int2+62r	ggccgcgggaattcgattATTGGCTGCTGTGGTCA
			22	int3-33f	gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC
23	int4+52r	ggccgcgggaattcgattAAGGGAGGCACTGACATTA
			24	int5-44f	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC
24A	int5-367f	gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC
			25	int6+31r	ggccgcgggaattcgattAGTCACTCGCCACTGCC
26	ABO432f	gccgcgaattcactagtgcCACCGTGTCCACTACTATG
			27	ABO766r	ggccgcgggaattcgattTGTAGGCCTGGGACTGG
28	ABO723f	gccgcgaattcactagtgGGAGGCCTTCACCTACG
			29	ABO1147r	ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And amplification ABO gene nucleic acid.Preferably, with the above-mentioned primer of ABO gene nucleic acid and all to contacting.

Every kind of primer shown in the table 3 all contains one 5 ' MAPH label (preceding 18 amino acid of the primer sequence that lowercase is represented) and gene specific sequence (capitalization is represented).The MAPH label is used for assisting the amplification of nucleic acid.Especially, in case use primer that the ABO gene nucleic acid is carried out pcr amplification, just use MAPH label primer that this sequence is further increased.Preferably, this two steps amplification is carried out simultaneously.As skilled in the art to understand, there is not the primer (the only primer sequence of representing by capitalization) of 5 ' MAPH label can be used for the method for the present invention ABO gene nucleic acid that increases yet.Perhaps, primer sequence can contain and the different sequence label of MAPH label shown in the table.

Above-mentioned primer is with the gene specific mode ABO exon 2,4,6 and 7 that increases, and therefore can specially determine allele-specific at given allelic oligonucleotide probe by using.The primer sequence of selecting has been got rid of any known ABO nucleotide polymorphisms wittingly, to be gene specific rather than allele-specific.By this primer the ABO gene amplification of being undertaken is made and can discern all known ABO mutation by sequence specific oligonucleotide.

Blood can be used by any known way, for example uses in the mode that exsomatizes.Particularly, can carry out method of the present invention to directly taking from the individual patient's that transfuses blood the blood that for example needs, perhaps to sending the blood of passing to individuality for example to carry out method of the present invention from the blood sample of blood donation.

Nucleic acid is preferably DNA, more preferably genomic dna.

Annealing temperature can be 54-63 ℃.Preferably, annealing temperature is about 57 ℃.Most preferably, annealing temperature is 57 ℃.

The method of third aspect present invention can combine so that other blood group genes are carried out gene type with other MPX PCR method.MPXPCR：RHD/MNS/P1/RHCE/LU ( Lutheran ) /KE ( Kell ) /LE ( Lewis ) /FY ( Duffy ) /JK ( Kidd ) /DI ( Diego ) /YT ( Cartwright ) /XG/SC ( Scianna ) /DO ( Dombrock ) /CO ( Colton ) /LW/CH/RG ( Chido/Rodgers ) /Hh/XK/GE ( Gerbich ) /CROM ( Cromer ) /KN ( Knops ) /IN ( Indian ) /OK/RAPH/JMH ( JohnMiltonHagen ) /IGNT/P/GIL/。

Nucleic acid by the third aspect present invention amplification can detect as stated above.

Preferably, this method comprises that the ABO gene nucleic acid that makes from experimenter's blood contacts with the one or more pairs of of following primer centering, preferably with following whole primers to contacting: 20,21; 22,23; 24,25; 26,27; And 28,29.

Perhaps, this method comprises that the ABO gene nucleic acid that makes from experimenter's blood contacts with the one or more pairs of of following primer centering, preferably with following whole primers to contacting: 20,21; 22,23; 24A, 25; 26,27; And 28,29.

According to a forth aspect of the invention, provide a kind of and carried out the method that the ABO gene type is analyzed by multiplex PCR, described method comprises making from the ABO gene nucleic acid of experimenter's blood and contacts with at least a primer in being selected from following table (table 3) that wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization:

Table 3

Primer number	The primer title	Sequence (5 '-3 ')
			20	int1-49f	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG
21	int2+62r	ggccgcgggaattcgattATTGGCTGCTGTGGTCA
			22	int3-33f	gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC
23	int4+52r	ggccgcgggaattcgattAAGGGAGGCACTGACATTA
			24	int5-44f	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC
24A	int5-367f	gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC
			25	int6+31r	ggccgcgggaatt cgattAGTCACTCGCCACTGCC
26	ABO432f	gccgcgaattcactagtgcCACCGTGTCCACTACTATG
			27	ABO766r	ggccgcgggaattcgattTGTAGGCCTGGGACTGG
28	ABO723f	gccgcgaattcactagtgGGAGGCCTTCACCTACG
			29	ABO1147r	ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And amplification ABO gene nucleic acid.As understood by one of ordinary skill in the art, need to use a pair of primer to obtain amplification.Two kinds of primers all can be selected from table 3, and perhaps a kind of primer is selected from table 3 and uses in conjunction with any suitable another kind of primer.Primer is to using separately or use with other primers.Preferably, present method comprises ABO gene nucleic acid and following one or more pairs of primers contacting: 20 and 21; 22 and 23; 24 or 24A and 25; 26 and 27; 28 and 29.

In a preferred embodiment, present method comprises ABO gene nucleic acid and following one or more pairs of primers contacting: 20 and 21; 22 and 23; 24 and 25; 26 and 27; 28 and 29.

In another embodiment, present method comprises ABO gene nucleic acid and following one or more pairs of primers contacting: 20 and 21; 22 and 23; 24A and 25; 26 and 27; 28 and 29.

According to a fifth aspect of the invention, a kind of method of carrying out ABO and the analysis of RHD gene type by multiplex PCR is provided, described method comprises to be made from the following one or more pairs of primers in the ABO gene of experimenter's blood and RHD gene nucleic acid and the following table (table 4) contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 15A; 16,17; 18,19; 20,21; 22,23; 24 or 24A, 25; 26,27; 28,29 and 30,31, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization:

Table 4

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA
2	198R	ggccgcgggaattcgattTGCCCCTGGAGAACCAC
			3	int1F	gccgcgaattcactagtgTGACGAGTGAAACTCTATCTCGAT
4	297R	ggccgcgggaattcgattCCACCATCCCAATACCTGAAC
			4A	296R	ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT
5	303F	gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT
			6	397R	ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT
7	403F	gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT
			8	499R	ggccgcgggaattcgattCAAACTGGGTATCGTTGCTG
8A	498R	ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG
			9	502F	gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA
9A	503F	gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA
			10	5Aluint4F (RoHar)	gccgcgaattcactagtgAAGGACTATCAGGCCACG
10A	RoHar4	gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC
			10B	RoHar8	gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG
11	599R	ggccgcgggaattcgattCACCTTGCTGATCTTCCC
			11A	598R	ggccgcgggaattcgattTGTGACCACCCAGCATTCTA
12	601F	gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA
			13	697R	ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG
14	702F	gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG
			14A	701F	gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG
15	799R	ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG
			15A	798R	ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA
16	801F	gccgcgaattcactagtgCTGGAGGCTCTGAGAGGTTGAG
			17	899R	ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG
18	901F	gccgcgaattcactagtgACTGTCGTTTTGACACACAAT
			19	998R	ggccgcgggaattcgattTGTCACCCGCATGTCAG
30	1001F	gccgcgaattcactagtgCAAGAGATCAAGCCAAAATCAGT
			31	1097R	ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG
20	int1-49f	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG
			21	int2+62r	ggccgcgggaattcgattATTGGCTGCTGTGGTCA
22	int3-33f	gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC
			23	int4+52r	ggccgcgggaattcgattAAGGGAGGCACTGACATTA
24	int5-44f	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC
			24A	int5-367f	gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC
25	int6+31r	ggccgcgggaattcgattAGTCACTCGCCACTGCC
			26	ABO432f	gccgcgaattcactagtgcCACCGTGTCCACTACTATG
27	ABO766r	ggccgcgggaattcgattTGTAGGCCTGGGACTGG
			28	ABO723f	gccgcgaattcactagtgGGAGGCCTTCACCTACG
29	ABO1147r	ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And amplification RHD and ABO gene nucleic acid.Preferably, with the above-mentioned primer of nucleic acid and all to contacting.

As described in several respects before of the present invention, every kind of primer shown in the table 4 all contains one 5 ' MAPH label (preceding 18 amino acid of the primer sequence that lowercase is represented) and gene specific sequence (representing with capitalization).As understood by one of ordinary skill in the art, there is not the primer (the only primer sequence of representing by capitalization) of 5 ' MAPH label can be used for method of the present invention increase RHD and ABO gene nucleic acid yet.Perhaps, primer sequence can contain and the different sequence label of MAPH label shown in the table 4.

Preferably, present method comprises ABO gene and RHD gene nucleic acid and following one or more pairs of primers contacting, preferably with whole primers to contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; 18,19; 20,21; 22,23; 24,25; 26,27; And 28,29.

Perhaps, present method comprises ABO gene and RHD gene nucleic acid and following one or more pairs of primers contacting, preferably with whole primers to contacting: 1,2; 3,4; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; 20,21; 22,23; 24A, 25; 26,27; 28,29; And 30,31.

Blood can be used by any known way, for example uses in the mode that exsomatizes.Particularly, can carry out method of the present invention to directly taking from the individual patient's that transfuses blood the blood that for example needs, perhaps to sending the blood of passing to individuality for example to carry out method of the present invention from the blood sample of blood donation.

Nucleic acid is preferably DNA, more preferably genomic dna.

Annealing temperature can be 54-63 ℃.Preferably, annealing temperature is about 60 ℃ or about 57 ℃.Most preferably, annealing temperature is 60 ℃.

The method of fifth aspect present invention can combine so that other blood group genes are carried out gene type with other MPX PCR method.MPX PCR：MNS/P1/RHCE/LU ( Lutheran ) /KE ( Kell ) /LE ( Lewis ) /FY ( Duffy ) /JK ( Kidd ) /DI ( Diego ) /YT ( Cartwright ) /XG/SC ( Scianna ) /DO ( Dombrock ) /CO ( Colton ) /LW/CH/RG ( Chido/Rodgers ) /Hh/XK/GE ( Gerbich ) /CROM ( Cromer ) /KN ( Knops ) /IN ( Indian ) /OK/RAPH/JMH ( JohnMiltonHagen ) /IGNT/P/GIL/。

The nucleic acid that method amplification by fifth aspect present invention obtains can detect as stated above.

According to a sixth aspect of the invention, a kind of method of carrying out ABO and the analysis of RHD gene type by multiplex PCR is provided, described method comprises making from the ABO gene of experimenter's blood and RHD gene nucleic acid and contacts with one or more primers in the following table (table 4A) that wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization:

Table 4A

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA
4	297R	ggccgcgggaattcgattCCACCATCCCAATACCTGAAC
			4A	296R	ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT
	5	303F	gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT
6					397R	ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT
	7	403F	gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT
8A				498R	ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG
9		502F	gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA
	9A			503F	gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA
	10	5Aluint4F (RoHar)	gccgcgaattcactagtgAAGGACTATCAGGCCACG
10A				RoHar4	gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC
	10B	RoHar8	gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG
11				599R	ggccgcgggaattcgattCACCTTGCTGATCTTCCC
	11A	598R	ggccgcgggaattcgattTGTGACCACCCAGCATTCTA
	12	601F	gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA
13					697R	ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG
	14	702F	gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG
14A				701F	gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG
15		799R	ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG
	15A			798R	ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA
	17	899R	ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG
18					901F	gccgcgaattcactagtgACTGTCGTTTTGACACACAAT
	19	998R	ggccgcgggaattcgattTGTCACCCGCATGTCAG
31					1097R	ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG
	20	int1-49f	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG
21					int2+62r	ggccgcgggaattcgattATTGGCTGCTGTGGTCA
	22	int3-33f	gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC
23					int4+52r	ggccgcgggaattcgattAAGGGAGGCACTGACATTA
	24	int5-44f	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC
24A				int5-367f	gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC
	25	int6+31r	ggccgcgggaattcgattAGTCACTCGCCACTGCC
26				ABO432f	gccgcgaattcactagtgcCACCGTGTCCACTACTATG
	27	ABO766r	ggccgcgggaattcgattTGTAGGCCTGGGACTGG
28				ABO723f	gccgcgaattcactagtgGGAGGCCTTCACCTACG
	29	ABO1147r	ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And amplification RHD and ABO gene nucleic acid.As understood by one of ordinary skill in the art, need to use a pair of primer to obtain amplification.Two kinds of primers all are selected from table 4A, and perhaps a kind of primer is selected from table 4A and for example primer or any other suitable primer of table 4 use in conjunction with any suitable another kind of primer.Primer is to using separately or use with other primers.

Preferably, present method comprises ABO gene and RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; 18,19; 20,21; 22,23; 24,25; 26,27; And 28,29.

Perhaps, present method comprises ABO gene and RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2; 3,4; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 18,19; 20,21; 22,23; 24A, 25; 26,27; 28,29; And 30,31.

According to a seventh aspect of the invention, provide one or more following PCR primers, wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization:

Table 4A

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA
4	297R	ggccgcgggaattcgattCCACCATCCCAATACCTGAAC
			4A	296R	ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT
	5	303F	gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT
6					397R	ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT
	7	403F	gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT
8A				498R	ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG
9		502F	gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA
	9A			503F	gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA
	10	5Aluint4F (RoHar)	gccgcgaattcactagtgAAGGACTATCAGGCCACG
10A				RoHar4	gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC
	10B	RoHar8	gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG
11				599R	ggccgcgggaattcgattCACCTTGCTGATCTTCCC
	11A	598R	ggccgcgggaattcgattTGTGACCACCCAGCATTCTA
	12	601F	gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA
13					697R	ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG
	14	702F	gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG
14A				701F	gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG
15		799R	ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG
	15A			798R	ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA
	17	899R	ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG
18					901F	gccgcgaattcactagtgACTGTCGTTTTGACACACAAT
	19	998R	ggccgcgggaattcgattTGTCACCCGCATGTCAG
31					1097R	ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG
	20	int1-49f	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG
21					int2+62r	ggccgcgggaattcgattATTGGCTGCTGTGGTCA

22	int3-33f	gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC
				23	int4+52r	ggccgcgggaattcgattAAGGGAGGCACTGACATTA
24	int5-44f	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC
			24A	int5-367f	gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC
25	int6+31r	ggccgcgggaattcgattAGTCACTCGCCACTGCC
			26	ABO432f	gccgcgaattcactagtgcCACCGTGTCCACTACTATG
27	ABO766r	ggccgcgggaattcgattTGTAGGCCTGGGACTGG
			28	ABO723f	gccgcgaattcactagtgGGAGGCCTTCACCTACG
29	ABO1147r	ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

As mentioned above, every kind of primer shown in the table 4A all contains one 5 ' MAPH label (preceding 18 amino acid of the primer sequence that lowercase is represented) and gene specific sequence (representing with capitalization).The present invention also provides the primer that does not have 5 ' MAPH label (the only primer sequence of being represented by capitalization) shown in the table 4A on one or more.This class primer can be used for increasing RHD and ABO gene nucleic acid.As understood by one of ordinary skill in the art, the primer sequence of representing with capitalization in table 4A can change by adding for example different sequence label of other sequence.

Can have or not have above-mentioned MAPH label in use according to primer of the present invention.The primer that does not have label has following sequence:

Primer number	The primer title	Sequence (5 '-3 ')
			1	101F	CCATAGAGAGGCCAGCACAA
2	198R	TGCCCCTGGAGAACCAC
			3	int1F	TGACGAGTGAAACTCTATCTCGAT
4	297R	CCACCATCCCAATACCTGAAC
			4A	296R	AGAAGTGATCCAGCCACCAT
	5	303F	TCCTGGCTCTCCCTCTCT
6					397R	GTTGTCTTTATTTTTCAAAACCCT
	7	403F	GCTCTGAACTTTCTCCAAGGACT
8					499R	CAAACTGGGTATCGTTGCTG
	8A	498R	ATTCTGCTCAGCCCAAGTAG
	9	502F	CTTTGAATTAAGCACTTCACAGA
9A				503F	TTGAATTAAGCACTTCACAGAGCA
10		5Aluint4F (RoHar)	AAGGACTATCAGGCCACG
	10A			RoHar4	CTGAAAGGAGGGAAACGGAC
10B		RoHar8	GGGCAGTGAGCTTGATAGTAGG
	11			599R	CACCTTGCTGATCTTCCC
11A		598R	TGTGACCACCCAGCATTCTA
12		601F	AGTAGTGAGCTGGCCCATCA
	13				697R	CTTCAGCCAAAGCAGAGGAG
14		702F	CTGGGACCTTGTTAGAAATGCTG
	14A			701F	ACAAACTCCCCGATGATGTGAGTG
	15	799R	CAAGGTAGGGGCTGGACAG
15A
		798R	GAGGCTGAGAAAGGTTAAGCCA

16	801F	CTGGAGGCTCTGAGAGGTTGAG
				17	899R	GGCAATGGTGGAAGAAAGG
18	901F	ACTGTCGTTTTGACACACAAT
				19	998R	TGTCACCCGCATGTCAG
30	1001F	CAAGAGATCAAGCCAAAATCAGT
				31	1097R	GTGGTACATGGCTGTATTTTATTG
20	int1-49f	GTGAGAGAAGGAGGGTGAG
				21	int2+62r	ATTGGCTGCTGTGGTCA
22	int3-33f	CTGCTCCTAGACTAAACTTC
				23	int4+52r	AAGGGAGGCACTGACATTA
24	int5-44f	CTGCCAGCTCCATGTGAC
			24A	int5-367f	GATTTGCCCGGTTGGAGTC
25	int6+31r	AGTCACTCGCCACTGCC
			26	ABO432f	CACCGTGTCCACTACTATG
27	ABO766r	TGTAGGCCTGGGACTGG
			28	ABO723f	GGAGGCCTTCACCTACG
29	ABO1147r	CAGAGTTTACCCGTTCTGC

Where primer of the present invention can be in office uses in the method.Especially, primer sequence can be used as probe or primer.Preferably, primer is used for the gene type analysis, especially for the blood group analysis, in particular for the method for RHD and/or the analysis of ABO gene type.

In use, the paired use described in primer such as the inventive method.Preferred primer is to as follows:

1，2；

3,4 or 4A;

5，6；

7,8 or 8A;

9 or 9A or 10 or 10A or 10B, 11 or 11A;

12，13；

14 or 14A, 15 or 15A;

16，17；

18，19；

20，21；

22，23；

24 or 24A, 25;

26，27；

28,29; And

30，31。

Can carry out mark so that can easily detect to primer.

Primer of the present invention and the primer that uses in the methods of the invention can be changed by the technician.For example, the length of primer can change.To make the T of primer like this _mChange.Will influence the annealing temperature of PCR reaction like this.The length that can select primer is so that the T of primer _mValue is lower than 70 ℃.

Can carry out the displacement of base and not influence the RHD specificity that PCR reacts at 5 ' end of primer.

Preferably, primer forms double-stranded Δ G value less than-10kcal/mol.

Can change to comprise other parts of sequence to be identified by shortening or prolonging this primer according to the primer of seventh aspect present invention and the primer that before the present invention, uses in several respects, or change by moving primer sequence along sequence to be identified.Equally, can be one or more by changing, preferably no more than five, more preferably no more than three, the mode of more preferably no more than two Nucleotide slightly changes primer again.Resulting primer is called as functional mutation, and promptly specificity also constitutes a part of the present invention at the mutation of the original primer of identical sequence.

According to an eighth aspect of the invention, provide a kind of gene chip, described chip has a plurality of probe sequences that adhere to, and makes one or more PCR products that produce by aforesaid method to be identified.Preferably, gene chip contains abundant probe sequence, and making all can be detected by all possible PCR product that produces with aforesaid method.

As understood by one of ordinary skill in the art, method of the present invention can be carried out with any other methods of genotyping combination.For example, the method that RHD and ABO gene are carried out gene type can be carried out with the method combination of other blood gene or any other gene being carried out gene type.Preferably, all methods of genotyping all pass through to use multiplex PCR to carry out.Particularly preferably, use a series of primers to increase and treat the specific nucleotide sequence of somatotype.Preferably, used primer all has 5 ' identical sequence label, makes available subsequently specificity at all nucleotide sequences of the primer amplification of sequence label.

Description of drawings

To and only the method according to this invention and primer be described referring to figs. 1 to Figure 11 below by the mode of embodiment, wherein:

Fig. 1 illustrates the positioning design of RHD primer;

Fig. 2 is illustrated in the RHD primer of the following exon that is used in the RHD MPX PCR method of the present invention to increase: the alternative primer (Fig. 2 H) of exons 1 (Fig. 2 A), exon 2 (Fig. 2 B), exon 3 (Fig. 2 C), exon 4 (Fig. 2 D), exon 5 (Fig. 2 E), exon 6 (Fig. 2 F), exon 7 (Fig. 2 G), exon 7, exon 8 (Fig. 2 I), exon 9 (Fig. 2 J), exons 10 (Fig. 2 K);

Fig. 3 shows according to RHD primer sequence of the present invention;

Fig. 4 shows the RHD primer mixture that uses in the method according to the invention;

Fig. 5 A shows according to ABO primer sequence of the present invention, Fig. 5 B shows the primer location in the ABO gene order, and wherein hypographous letter representation gene-specific primer sequence, lowercase represent that intron sequences, capitalization represent that exon sequence, bold-type letter represent the allelic Nucleotide of important resolution.The Nucleotide numbering of numeral in the ABO gene coded sequence.A ^IThe allelotrope sequence is consensus sequence and is shown among this figure;

Fig. 6 illustrates the gel electrophoresis result of RHD gene amplification product, and described amplified production is from the right RHD MPX PCR reaction of primer that comprises exon 8 according to the present invention;

Fig. 7 illustrates the gel electrophoresis result of ABO gene amplification product, and described amplified production reacts from ABO MPX PCR according to the present invention;

Fig. 8 illustrates the gel electrophoresis result of RHD and ABO gene amplification product, and described amplified production is from right RHD and the ABO MPX PCR reaction of primer that comprises exon 8 according to the present invention;

Fig. 9 A shows according to alternative ABO primer sequence of the present invention, Fig. 9 B shows the primer location in the ABO gene order, and wherein hypographous letter representation gene-specific primer sequence, lowercase represent that intron sequences, capitalization represent that exon sequence, bold-type letter represent the allelic Nucleotide of important resolution.The Nucleotide numbering of numeral in the ABO gene coded sequence.A ^IThe allelotrope sequence is consensus sequence and is shown among this figure;

Figure 10 illustrates the gel electrophoresis result of ABO gene amplification product, and described amplified production reacts from ABO MPX PCR according to the present invention; And

Figure 11 illustrates the gel electrophoresis result of RHD gene amplification product, and described amplified production is from the right RHD MPX PCR reaction of primer that comprises exon 8 according to the present invention;

Figure 12 shows according to primer of the present invention.

Embodiment

Embodiment

The RHD design of primers

Design or screening primer can be amplified by RHD MPX PCR reaction of the present invention with the exon sequence of the exons 1 to 10 that guarantees to comprise among the RHD.The positioning design of RHD primer is shown in Fig. 1.The RHD primer is shown in Fig. 3.

(Molecular Biology Insights Inc.) carries out design of primers to use Oligo v6.0 primer-design software.Oligo v6.0 software can carry out multiple ratio to (multiplexed) to one group of primer sequence by the electronics mode, and this just can detect any conflict between the primer and can check whether may form primer dimer.Understand self dimerization or find that primer is incompatible with other most of primers multiple ratio centering if find primer, will redesign primer.Select a pair of primer sequence so that they are compatible, that is to say that the formation of primer dimer is restricted.The length of selecting primer is so that the T of primer _mValue is below 70 ℃.

Also use a kind of based on network program NetPrimer (PREMIER BiosoftInternational) to assess primer, this program provides a formation that is up to 100% scoring and checks primer dimer to each primer.By selecting the highest primer of scoring from the result of NetPrimer, and select those compatible primers of other primer of the maximum number that obtains from Oligo V6.0 result, it is right primer can be selected to multiple ratio.

The design primer comprises that to guarantee the zone of being increased the RHD gene has known single nucleotide polymorphism (SNP) to be detected.The position that this often means that primer is positioned among the intron sequences that surrounds the purpose exon.The SNP position of RHD gene is drawn in the sequence data of this gene, and RHD sequence data (intron and exon) and the sequence data of closely-related gene RHCE are compared.Combine by MPX PCR and gene chip and can detect mutation RHD allelotrope.

Fig. 2 shows an example of the primer of RHD exons 1 to 10.The primer that is used for RHDMPX is checked at the RHCE sequence, to guarantee the specificity of primer to the RHD gene.

Fig. 2 A shows the RHD of exons 1 (representing with italic) and the sequence alignment of RHCE.Difference in this exon between two genes marks with underscore.The position (double underline) that has also shown three SNP:

SNP Allelotrope

C8G reduction D3 type

G48A RHD W16X (the negative allelotrope of RHD)

C121T RHD Q41X (the negative allelotrope of RHD)

(101F 198R) represents (not having the MAPH label) with runic in the position of primer sequence.

Similarly, Fig. 2 B to Fig. 2 K shows the RHD of exon 2 to 10 and sequence, SNP and the primer of RHCE.

Owing to find the initial exon 2 forward primer RHD RHC that increases too that not only increases, so primer sequence is changed into Legler, T J et al., Transfusion Medicine 200111, disclosed sequence among the 383-388.10 kinds of different primers having tested exon 2 altogether are to obtain the RHD specificity.Six kinds of primers of exon 2 are tested, and have introduced the change of base in this time series.Test these primers and be the less product of exon 2 because they can increase, but the variation of sequence and fail to produce the RHD specificity.

Most of primer has 3 ' RHD specificity end, but two kinds of primers and RHD and RHCE sequence complementation (exon 2 reverse primer and exon 8 reverse primers) are arranged.Exon 5 forward primers are crossed over a zone of sequence, and there is an inset in this zone but does not have in RHD in RHCE.

For exon 4 and 5, previously disclosed reverse primer sequence also can use (Maasltant-van Wijk et al., Transfusion, 38, 1015-1021,1998).

The ABO design of primers

The ABO primer is shown in Fig. 5 A.The design primer is with the exon 2,4,6 and 7 of amplification ABO gene.In a design, in order to optimize the amplification in the multiple reaction, need 400bp or shorter PCR product, therefore select primer to divide two portions increase exon 7: 7A and 7B.Fragment 7B length is 461 base pairs, but it is easy to increase under these conditions and need introduces all known allelic mutation in this dna sequence dna.The design primer is to comprising all known mutations in this exon, and primer is opposite to the non-Variable Area of intron.In Fig. 5 B, to differentiate allelic sudden change and represent with runic, the expression of target Nucleotide numbering is used in their positions in the encoding sequence of gene.After the primary design, in primer int5-44F, found a kind of polymorphism of intron 5.Discern other intron 5 gene-specific primers and int5-367F changed in the analysis and (seen Fig. 9 A and 9B).The purpose of microarray is by determining allele-specific with gene specific PCR product bonded oligonucleotide probe, and this also is the purpose that we screen ABO specificity and the specific primer of exon.

Primer sequence redesigns.All primers form and hair clip formation all using Oligo v6.0 primer-design software to carry out checking with assessment melting temperature(Tm), possible primer dimer.Select primer length so that its melting temperature(Tm) is～60 ℃.The sequence of primer is shown in following table:

Numbering	MAPH PCR primer	The ABO exon	Sequence (5 '-3 ')
				20 21	int1-49f int2+62r	2	gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG ggccgcgggaattcgattATTGGCTGCTGTGGTCA
22 23	int3-33f int4+52r	4	gccgcgaattcactagtgCCTGCTCCTAGACTAAACTTC ggccgcgggaattcgattAAGGGAGGCACTGACATTA
				24 25	int5-44f int6+31r	6	gccgcgaattcactagtgCTGCCAGCTCCATGTGAC ggccgcgggaattcgattAGTCACTCGCCACTGCC
26 27	ABO432f ABO766r	7A	gccgcgaattcactagtgCCACCGTGTCCACTACTATG ggccgcgggaattcgattTGTAGGCCTGGGACTGG
				28 29	ABO723f ABO1147r	7B	gccgcgaattcactagtgGGAGGCCTTCACCTACG ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

The concrete multi-primers of ABO specific amplification.Lowercase is represented the MAPH sequence label.Capitalization is represented the gene specific sequence.

Multiplex PCR blood RHD genetic analysis

Use QIAmap DNA Blood Mini kit (Qiagen Ltd.) isolation of genomic DNA from grownup's peripheral blood.The amount of the genomic dna in each sample is undertaken quantitatively by the absorbancy of measuring the 260nm place.The genomic dna sample of use standard is assessed the reliability of multiplex PCR:

R1R1＝CDe/CDe

R2R2＝cDE/cDE

rr＝cde/cde

r′r＝Cde/cde

r″r＝cdE/cde

ROr＝cDe/cde

The PCR mixture of per 25 μ l has following composition:

Per 25 μ l MPX reaction
		12.5μl 0.06μl 0.8μl 0.8μl 0.25μl 9.59μl 1μl	2x Mastermix #RHD primer mixture 100 μ M MAPH forward primers 100 μ M MAPH reverse primer Mg 2+(50mM，Bioline) H 2O 100ng/μl DNA
25μl	Cumulative volume

#2x Mastermix is a Qiagen multiplex PCR damping fluid, and wherein containing all of carrying out PCR reaction must component, comprises HotStarTaq archaeal dna polymerase, Mg ²⁺With essential dNTP.

Primer is provided by Operoil Bioteclmologies company (its predecessor is a Qiagen company).Fig. 4 has shown a kind of suitable primer mixture.The primer mixture that shows among Fig. 4 is a kind of guidance, can change to change the right ratio of used various primer primer mixture.

Have 5 ' end MAPH label and 3 ' gene specific segmental " heterozygosis " PCR primer by generation, use multiplex amplification and probe hybridization (MAPH) label PCR primer to come the multiplex amplification gene fragment.At the initial stage of PCR, will be by these heterozygosis primer amplification gene fragments.MAPH forward that contains in the PCR mixture and the reverse primer PCR product that each is gone out by the heterozygosis primer amplification that will increase.This makes multiple reaction as one man to carry out, and the most nearly 20 kinds of gene fragments that can increase in this way.People such as White (White, S et al Am.J.Hum.Genet, 2002Aug; 71 (2): 365-74) disclose a kind of MAPH version (Fig. 3) that comprises the flanking sequence that is called as " MAPH forward primer " and " MAPH reverse primer ".Flanking sequence is provided by Sanquin company.

The experimental procedure of amplification is as follows:

This is an adjustment scheme of the detailed experimental procedure in the multiplex PCR damping fluid test kit of Qiagen company.The time, the annealing temperature that have prolonged sex change have been selected the intermediate value of the scope that provides (57-63 ℃) and the intermediate value that cycle index has also been selected the scope that provides (30-45 circulation).

DHAR genomic dna sample has the intron 4 of RHCE rather than the intron 4 of RHD.Because the forward primer position of exon 5, can not amplify the product of exon 5 during with the MPX primer amplification DHAR sample of original series.Therefore, we have designed the forward primer of Alu sequence 5 ' in the intron 4 in the special zone of RHCE.The reverse primer of this primer and exon 5 (RHD specificity) is compatible.

Multiplex PCR blood ABO genetic analysis

Use QIAmap DNA Blood Mini kit (Qiagen Ltd.) or pass through improved salt analysis method (Miller et al (1988) Nuc.Ac.Res.16 1215) isolation of genomic DNA from grownup's peripheral blood.DNA concentration is determined by the spectrophotometry at 260nm place, and is diluted to 100ng/ μ L.Selected the sample of different normal abo blood groups to be used for amplification.

Per 25 μ lMPX reaction
		12.5μl 0.25μl 0.5μl 0.5μl 10.25μl 1μl	2x Mastermix #ABO primer mixture (0.5 μ M) 50 μ M MAPH forward primers 50 μ M MAPH reverse primer H 2O 100ng/μl DNA
25μl	Cumulative volume

#2x Mastermix is a Qiagen multiplex PCR damping fluid, and wherein containing all of carrying out PCR reaction must component, comprises HotStarTaq archaeal dna polymerase, Mg ²⁺With essential dNTP.

The ABO primer mixture comprises:

The ABO primer	10 μ M liquid storage volumes (μ l)
		Int1-49f int2+62r int3-33f int4+52r int5-44f int6+31r ABO432f ABO766r ABO723f ABO1147r 10mM Tris pH8 cumulative volume	2 2 2 2 2 2 2 2 2 2 20 40

Amplification is carried out in 0.2mL PCR pipe, can use PE9700 or PE2700 thermo cycler (CT), reaction conditions is as follows for Perkin Elmer/Cetus, Norwalk:

(Novex Gels, Invitrogen Inc) go up electrophoresis and assess amplified production at 3% sepharose (self-control) or 5-20% polyacrylamide gel by each reaction being got 10 μ L products.Fig. 7 has shown a representative gel, and demonstrates the robustness (robustnature) of amplified reaction.The segmental level of amplification of gene specific that the above weak bar carrying means of 700bp and 700bp is bigger is low as estimating.

In another embodiment, used following mixture:

Every 25ul MPX reaction
		12.5uL	2x Mastermix
0.25uL	The ABO primer mixture
		0.4uL	50uM MAPH forward primer
0.4uL	50uM MAPH reverse primer
		10.45uL	H 2O
1uL	100ng/uL DNA
		25uL	Cumulative volume

The ABO primer mixture liquid storage that uses in above-mentioned reaction is as follows:

The ABO primer	10uM liquid storage volume (uL)
		int1-49f	2.5
int2+62r	2.5
		int3-33f	2.5
int4+52r	2.5
		int5+367f	2.5
int6+31r	5
		ABO432f	5
ABO1147r	5
		10mM Tris pH8	72.5
Cumulative volume	100

Be used for this embodiment primer, be amplified the zone and resulting gel be shown in Fig. 9 A, Fig. 9 B and Figure 10.

Multiplex PCR blood RHD and ABO genetic analysis

Genomic dna is pressed preceding method and is separated and quantitative assay.Described in used primer mixture such as the independent RHD MPX PCR and ABO MPX PCR.But listed different in the final concentration of primer and the above-mentioned reaction in this reaction, this is because reaction mixture as follows.

25 μ l PCR mixtures are composed as follows:

Per 25 μ l MPX reaction
		12.5μl 0.085μl 0.2μl 1.3μl 1.3μl 0.6μl 8.015μl 1μl	2x Mastermix #RHD primer mixture ABO primer mixture 100 μ M MAPH forward primers 100 μ M MAPH reverse primer Mg 2+(50mM，Bioline) H 2O 100ng/μl DNA
25μl	Cumulative volume

#2x Mastermix is a Qiagen multiplex PCR damping fluid, and wherein containing all of carrying out PCR reaction must component, comprises HotStarTaq archaeal dna polymerase, Mg ²⁺With essential dNTP.

The PCR reaction is carried out as stated above, and difference is to use following program:

Amplified production is assessed as stated above.Fig. 8 has shown a representative gel, and demonstrates the robustness of amplified reaction.

In another embodiment, used following mixture:

ABO and RHD primer mixture

The ABO primer	10uM liquid storage volume (ul)
		int1-49f int2+62r int3-33f int4+52r int5-44f int6+31r ABO432f ABO766r ABO723f ABO1147r	1.25 1.25 1.25 1.25 1.25 1.25 5 5 5 5
The RHD primer	20uM liquid storage volume (ul)
		101F 198R int1F 296R 303F 397R 403F 498R 503F 598R 5Aluint4F 601F 697R 701F 798R 801F 899R 901F 998R 1001F 1097R 10mM Tris pH8 cumulative volume	1.25 1.25 12.5 12.5 1.25 1.25 2.5 2.5 2.5 2.5 2.5 1.25 1.25 1.25 1.25 1.5 1.5 1.1 1.1 1.75 1.75 16.3 100

The multiplex PCR result

MPX has amplified all products that need.These products can show by gel electrophoresis, are shown in Fig. 6 (RHD gene amplification product) and Fig. 7 (ABO gene amplification product) respectively.Perhaps, product can use the little sequenator of kapillary (Applied Biosyetems) to pass through GeneScan ^_Analysis software (Applied Biosyetems) shows.Also product having been carried out order-checking is correct amplicon with what guarantee to amplify.

The size of every kind of amplicon and the RHD exon in source thereof are shown in Fig. 6 left side.In Fig. 6, " gDNA " means genomic dna.Also marked specificity at RHDR ₀ ^HarThe product of the exon 5 of gene mutation (DHAR).This product can not obtain from the sample of the normal D positive and D feminine gender.

Also tested primer respectively to guarantee the RHD specificity.

In Fig. 7, the ABO exon that every kind of amplicon is originated is shown in the figure right side.Exon 4 is 151bp, and exon 2 is 217bp, and exon 6 is 263bp, and exon 7 A is 371bp, and exon 7 B is 461bp.The size of the numeral dna marker band in this figure left side.

In Fig. 8, RHD that every kind of amplicon is originated and ABO exon are shown in the figure right side.The size of the numeral dna marker band in this figure left side.

Then, the nucleic acid that amplifies can be hybridized with other sequences in the microarray of for example gene chip.

Though herein disclosed is the condition of MPX PCR, it will be appreciated by those skilled in the art that and to use any suitable MPX PCR condition.

Claims (43)

1. one kind is carried out the method that the RHD gene type is analyzed by multiplex PCR, and described method comprises to be made from the following one or more pairs of primers in experimenter's RHD gene nucleic acid and the following table contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 1 101F gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA 2 198R ggccgcgggaattcgattTGCCCCTGGAGAACCAC 3 int1F gccgcgaattcactagtgTGACGAGTGAAACTCTATCTCGAT 4 297R ggccgcgggaattcgattCCACCATCCCAATACCTGAAC 4A 296R ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT 5 303F gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT 6 397R ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT 7 403F gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT 8 499R ggccgcgggaattcgattCAAACTGGGTATCGTTGCTG 8A 498R ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG 9 502F gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA 9A 503F gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA 10 5Aluint4F (RoHar) gccgcgaattcactagtgAAGGACTATCAGGCCACG 10A RoHar4 gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC 10B RoHar8 gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG 11 599R ggccgcgggaattcgattCACCTTGCTGATCTTCCC 12 601F gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA 13 697R ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG 14 702F gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG 14A 701F gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG 15 799R ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG 15A 798R ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA 16 801F gccgcgaattcactagtgCTGGAGGCTCTGAGAGGTTGAG 17 899R ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG 18 901F gccgcgaattcactagtgACTGTCGTTTTGACACACAAT 19 998R ggccgcgggaattcgattTGTCACCCGCATGTCAG 30 1001F gccgcgaattcactagtgCAAGAGATCAAGCCAAAATCAGT 31 1097R ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG 32 MAPH-rev gccgcgaattcactagtg 33 MAPH-forw ggccgcgggaattcgatt

And the described RHD gene nucleic acid that increases.

2. according to the process of claim 1 wherein RHD gene nucleic acid and following one or more pairs of primers: 1,2 to contacting; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; And 18,19.

3. according to the method for claim 2, wherein with RHD gene nucleic acid and following primer to contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; And 18,19.

4. according to the process of claim 1 wherein RHD gene nucleic acid and following one or more pairs of primers: 1,2 to contacting; 3,4A; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; And 18,19.

5. according to the method for claim 4, wherein with RHD gene nucleic acid and following primer to contacting: 1,2; 3,4A; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; And 18,19.

6. according to the process of claim 1 wherein RHD gene nucleic acid and following primer: 1,2 to contacting; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31.

7. according to the method for claim 2 or 3, the exons 1 to 7 and 9 of the described RHD gene that wherein increases.

8. according to claim 4,5 or 6 method, the exons 1 to 10 of the described RHD gene that wherein increases.

9. according to each method of aforementioned claim, the RHD mutation of wherein amplification part and reduction.

10. one kind is carried out the method that the RHD gene type is analyzed by multiplex PCR, described method comprises that the RHD gene nucleic acid that makes from the experimenter contacts with at least a primer that is selected from following table, and wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 1 101F gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA 4 297R ggccgcgggaattcgattCCACCATCCCAATACCTGAAC 4A 296R ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT 5 303F gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT 6 397R ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT 7 403F gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT 8A 498R ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG 9 502F gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA 9A 503F gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA 10 5Aluint4F (RoHar) gccgcgaattcactagtgAAGGACTATCAGGCCACG 10A RoHar4 gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC 10B RoHar8 gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG 11 599R ggccgcgggaattcgattCACCTTGCTGATCTTCCC 11A 598R ggccgcgggaattcgattTGTGACCACCCAGCATTCTA 12 601F gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA 13 697R ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG 14 702F gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG 14A 701F gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG 15 799R ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG 15A 798R ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA 17 899R ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG 18 901F gccgcgaattcactagtgACTGTCGTTTTGACACACAAT 19 998R ggccgcgggaattcgattTGTCACCCGCATGTCAG 31 1097R ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG

And the described RHD gene nucleic acid that increases.

11., comprise described RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2 according to the method for claim 10; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 15 or 15A; 16,17; 18,19; And 30,31.

12., comprise described RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2 according to the method for claim 10; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; And 18,19.

13., comprise described RHD gene nucleic acid and following one or more pairs of primers contacting: 1,2 according to the method for claim 10; 3,4A; 5,6; 7,8A; 9A or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; And 30,31.

14. one kind is carried out the method that the ABO gene type is analyzed by multiplex PCR, described method comprises to be made from the following one or more pairs of primers in experimenter's ABO gene nucleic acid and the following table contacting: 20,21; 22,23; 24 or 24A, 25; 26,27 and 28,29, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 20 int1-49f gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG 21 int2+62r ggccgcgggaattcgattATTGGCTGCTGTGGTCA 22 int3-33f gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC 23 int4+52r ggccgcgggaattcgattAAGGGAGGCACTGACATTA 24 int5-44f gccgcgaattcactagtgCTGCCAGCTCCATGTGAC 24A int5-367f gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC 25 int6+31r ggccgcgggaattcgattAGTCACTCGCCACTGCC 26 ABO432f gccgcgaattcactagtgcCACCGTGTCCACTACTATG 27 ABO766r ggccgcgggaattcgattTGTAGGCCTGGGACTGG 28 ABO723f gccgcgaattcactagtgGGAGGCCTTCACCTACG 29 ABO1147r ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And the described ABO gene nucleic acid that increases.

15. according to the method for claim 14, wherein with described ABO gene nucleic acid and following one or more pairs of primers to contacting: 20,21; 22,23; 24,25; 26,27; And 28,29.

16. according to the method for claim 15, wherein with described ABO gene nucleic acid and following primer to contacting: 20,21; 22,23; 24,25; 26,27; And 28,29.

17. according to the method for claim 16, wherein with described ABO gene nucleic acid and following one or more pairs of primers to contacting: 20,21; 22,23; 24A, 25; 26,27; And 28,29.

18. according to the method for claim 17, wherein with described ABO gene nucleic acid and following primer to contacting: 20,21; 22,23; 24A, 25; 26,27; And 28,29.

19. method of carrying out the analysis of ABO gene type by multiplex PCR, described method comprises making from experimenter's ABO nucleic acid and contacts with at least a primer in being selected from following table that wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 20 int1-49f gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG 21 int2+62r ggccgcgggaattcgattATTGGCTGCTGTGGTCA 22 int3-33f gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC 23 int4+52r ggccgcgggaattcgattAAGGGAGGCACTGACATTA 24 int5-44f gccgcgaattcactagtgCTGCCAGCTCCATGTGAC 24A int5-367f gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC 25 int6+31r ggccgcgggaattcgattAGTCACTCGCCACTGCC 26 ABO432f gccgcgaattcactagtgcCACCGTGTCCACTACTATG 27 ABO766r ggccgcgggaattcgattTGTAGGCCTGGGACTGG 28 ABO723f gccgcgaattcactagtgGGAGGCCTTCACCTACG 29 ABO1147r ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And the described ABO gene nucleic acid that increases.

20. according to each method of claim 14 to 18, the exon 2,4 of the described ABO gene that wherein increases, 6 and 7.

21. according to each method of claim 14 to 18, the ABO mutation of wherein increasing rare.

22. one kind is carried out the method that ABO and RHD gene type are analyzed by multiplex PCR, described method comprises to be made from the following one or more pairs of primers in experimenter's ABO gene and RHD gene nucleic acid and the following table contacting: 1,2; 3,4 or 4A; 5,6; 7,8 or 8A; 9 or 9A or 10 or 10A or 10B, 11 or 11A; 12,13; 14 or 14A, 1515A; 18,19; 20,21; 22,23; 24 or 24A, 25; 26,27; 28,29 and 30,31, wherein said primer is to comprising the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 1 101F gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA 2 198R ggccgcgggaattcgattTGCCCCTGGAGAACCAC 3 int1F gccgcgaattcactagtgTGACGAGTGAAACTCTATCTCGAT 4 297R ggccgcgggaattcgattCCACCATCCCAATACCTGAAC 4A 296R ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT 5 303F gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT 6 397R ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT 7 403F gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT 8 499R ggccgcgggaattcgattCAAACTGGGTATCGTTGCTG 8A 498R ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG 9 502F gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA 9A 503F gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA 10 5Aluint4F (RoHar) gccgcgaattcactagtgAAGGACTATCAGGCCACG 10A RoHar4 gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC 10B RoHar8 gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG 11 599R ggccgcgggaattcgattCACCTTGCTGATCTTCCC 11A 598R ggccgcgggaattcgattTGTGACCACCCAGCATTCTA 12 601F gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA 13 697R ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG 14 702F gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG 14A 701F gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG 15 799R ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG 15A 798R ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA 16 801F gccgcgaattcactagtgCTGGAGGCTCTGAGAGGTTGAG 17 899R ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG 18 901F gccgcgaattcactagtgACTGTCGTTTTGACACACAAT 19 998R ggccgcgggaattcgattTGTCACCCGCATGTCAG 30 1001F gccgcgaattcactagtgCAAGAGATCAAGCCAAAATCAGT 31 1097R ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG 20 int1-49f gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG 21 int2+62r ggccgcgggaattcgattATTGGCTGCTGTGGTCA 22 int3-33f gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC 23 int4+52r ggccgcgggaattcgattAAGGGAGGCACTGACATTA 24 int5-44f gccgcgaattcactagtgCTGCCAGCTCCATGTGAC 24A int5-367f gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC 25 int6+31r ggccgcgggaattcgattAGTCACTCGCCACTGCC 26 ABO432f gccgcgaattcactagtgcCACCGTGTCCACTACTATG 27 ABO766r ggccgcgggaattcgattTGTAGGCCTGGGACTGG 28 ABO723f gccgcgaattcactagtgGGAGGCCTTCACCTACG 29 ABO1147r ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And increase described RHD and ABO gene nucleic acid.

23. according to the method for claim 22, wherein with described ABO gene and RHD gene nucleic acid and following one or more pairs of primers to contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; 18,19; 20,21; 22,23; 24,25; 26,27; 28,29; And 30,31.

24. according to the method for claim 23, wherein with described ABO gene and RHD gene nucleic acid and following primer to contacting: 1,2; 3,4; 5,6; 7,8; 9 or 10,11; 12,13; 14,15; 18,19; 20,21; 22,23; 24,25; 26,27; 28,29; And 30,31.

25. according to the method for claim 22, wherein with described ABO gene and RHD gene nucleic acid and following primer to contacting: 1,2; 3,4A; 5,6; 7,8A; 9A or 10 or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; 20,21; 22,23; 24A, 25; 26,27; 28,29; And 30,31.

26. according to the method for claim 25, wherein with described ABO gene and RHD gene nucleic acid and following one or more pairs of primers to contacting: 1,2; 3,4A; 5,6; 7,8A; 9A or 10 or 10A or 10B, 11A; 12,13; 14A, 15A; 16,17; 18,19; 20,21; 22,23; 24A, 25; 26,27; 28,29; And 30,31.

27. method of carrying out ABO and the analysis of RHD gene type by multiplex PCR, described method comprises making from experimenter's ABO gene and RHD gene nucleic acid and contacts with one or more primers in the following table that wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization: Primer number The primer title Sequence (5 '-3 ') 1 101F gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA 4 297R ggccgcgggaattcgattCCACCATCCCAATACCTGAAC 4A 296R ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT 5 303F gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT 6 397R ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT 7 403F gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT 8A 498R ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG 9 502F gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA 9A 503F gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA 10 5Aluint4F (RoHar) gccgcgaattcactagtgAAGGACTATCAGGCCACG 10A RoHar4 gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC 10B RoHar8 gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG 11 599R ggccgcgggaattcgattCACCTTGCTGATCTTCCC 11A 598R ggccgcgggaattcgattTGTGACCACCCAGCATTCTA 12 601F gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA 13 697R ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG 14 702F gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG 14A 701F gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG 15 799R ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG 15A 798R ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA 17 899R ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG 18 901F gccgcgaattcactagtgACTGTCGTTTTGACACACAAT 19 998R ggccgcgggaattcgattTGTCACCCGCATGTCAG 31 1097R ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG 20 int1-49f gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG 21 int2+62r ggccgcgggaattcgattATTGGCTGCTGTGGTCA 22 int3-33f gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC 23 int4+52r ggccgcgggaattcgattAAGGGAGGCACTGACATTA 24 int5-44f gccgcgaattcactagtgCTGCCAGCTCCATGTGAC 24A int5-367f gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC 25 int6+31r ggccgcgggaattcgattAGTCACTCGCCACTGCC 26 ABO432f gccgcgaattcactagtgcCACCGTGTCCACTACTATG 27 ABO766r ggccgcgggaattcgattTGTAGGCCTGGGACTGG 28 ABO723f gccgcgaattcactagtgGGAGGCCTTCACCTACG 29 ABO1147r ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

And increase described RHD and ABO gene nucleic acid.

28., wherein also carry out, carry out continuously or independently carry out multi-PRC reaction simultaneously for other blood genes according to each method of aforementioned claim.

29. method according to claim 28, wherein said MPX PCR reaction are about ABO/MNS/P1/RH/LU (Lutheran)/KE (Kell)/LE (Lewis)/FY (Duffy)/JK (Kidd)/DI (Diego)/YT (Cartwright)/XG/SC (Scianna)/DO (Dombrock)/CO (Colton)/LW/CH/RG (Chido/Rodgers)/Hh/XK/GE (Gerbich)/CROM (Cromer)/KN (Knops)/IN (Indian)/OK/RAPH/JMH (JohnMiltonHagen)/IGNT/P and/or GIL system and/or other any known blood group systems that maybe will know.

30. according to each method of aforementioned claim, wherein said blood exsomatizes.

31. according to each method of aforementioned claim, wherein said nucleic acid is genomic dna.

32. according to each method of aforementioned claim, wherein said annealing temperature is 54 to 63 ℃.

33. according to the method for claim 32, wherein said annealing temperature is about 57 ℃.

34. according to the method for claim 32, wherein said annealing temperature is about 60 ℃.

35. according to each method of aforementioned claim, the wherein said gene nucleic acid that amplifies subsequently with the nucleic acid probe hybridization of specificity at this sequence to be measured.

36. according to the method for claim 35, wherein said nucleic acid probe is arranged with array format.

37. according to the method for claim 35 or 36, wherein said method is arranged on the solid substrate carries out.

38. according to the method for claim 37, wherein said nucleic acid probe is attached on the gene chip.

39. according to each method of aforementioned claim, wherein at least a primer is substituted by functional mutation.

40. the PCR primer that following table is listed, wherein said primer can comprise the sequence shown in complete sequence shown in the table or the capitalization, perhaps its functional mutation: Primer number The primer title Sequence (5 '-3 ') 1 101F gccgcgaattcactagtgCCATAGAGAGGCCAGCACAA 4 297R ggccgcgggaattcgattCCACCATCCCAATACCTGAAC 4A 296R ggccgcgggaattcgattAGAAGTGATCCAGCCACCAT 5 303F gccgcgaattcactagtgTCCTGGCTCTCCCTCTCT 6 397R ggccgcgggaattcgattGTTGTCTTTATTTTTCAAAACCCT 7 403F gccgcgaattcactagtgGCTCTGAACTTTCTCCAAGGACT 8A 498R ggccgcgggaattcgattATTCTGCTCAGCCCAAGTAG 9 502F gccgcgaattcactagtgCTTTGAATTAAGCACTTCACAGA 9A 503F gccgcgaattcactagtgTTGAATTAAGCACTTCACAGAGCA 10 5Aluint4F (RoHar) gccgcgaattcactagtgAAGGACTATCAGGCCACG 10A RoHar4 gccgcgaattcactagtgCTGAAAGGAGGGAAACGGAC 10B RoHar8 gccgcgaattcactagtgGGGCAGTGAGCTTGATAGTAGG 11 599R ggccgcgggaattcgattCACCTTGCTGATCTTCCC 11A 598R ggccgcgggaattcgattTGTGACCACCCAGCATTCTA 12 601F gccgcgaattcactagtgAGTAGTGAGCTGGCCCATCA 13 697R ggccgcgggaattcgattCTTCAGCCAAAGCAGAGGAG 14 702F gccgcgaattcactagtgCTGGGACCTTGTTAGAAATGCTG 14A 701F gccgcgaattcactagtgACAAACTCCCCGATGATGTGAGTG 15 799R ggccgcgggaattcgattCAAGGTAGGGGCTGGACAG 15A 798R ggccgcgggaattcgattGAGGCTGAGAAAGGTTAAGCCA 17 899R ggccgcgggaattcgattGGCAATGGTGGAAGAAAGG 18 901F gccgcgaattcactagtgACTGTCGTTTTGACACACAAT 19 998R ggccgcgggaattcgattTGTCACCCGCATGTCAG 31 1097R ggccgcgggaattcgattGTGGTACATGGCTGTATTTTATTG 20 int1-49f gccgcgaattcactagtgGTGAGAGAAGGAGGGTGAG 21 int2+62r ggccgcgggaattcgattATTGGCTGCTGTGGTCA 22 int3-33f gccgcgaattcactagtgcCTGCTCCTAGACTAAACTTC 23 int4+52r ggccgcgggaattcgattAAGGGAGGCACTGACATTA 24 int5-44f gccgcgaattcactagtgCTGCCAGCTCCATGTGAC 24A int5-367f gccgcgaattcactagtgGATTTGCCCGGTTGGAGTC 25 int6+31r ggccgcgggaattcgattAGTCACTCGCCACTGCC 26 ABO432f gccgcgaattcactagtgcCACCGTGTCCACTACTATG 27 ABO766r ggccgcgggaattcgattTGTAGGCCTGGGACTGG 28 ABO723f gccgcgaattcactagtgGGAGGCCTTCACCTACG 29 ABO1147r ggccgcgggaattcgattCAGAGTTTACCCGTTCTGC

41. the purposes of PCR primer in the PCR reaction according to claim 40.

42. the purposes of PCR primer in the method that gene type is analyzed according to claim 40.

43. a gene chip, described chip have a plurality of probe sequences that adhere to, and make one or more PCR products that produce by each the method according to claim 1 to 39 to be identified.

Images