CN101065485B

CN101065485B - LNA oligonucleotides and the treatment of cancer

Info

Publication number: CN101065485B
Application number: CN2005800409084A
Authority: CN
Inventors: L·S·卡耶洛夫; M·阿斯克伦德; M·韦斯特加德; C·罗森鲍姆; M·韦森巴赫; B·汉森
Original assignee: American Businessmen Anlong Pharmaceutical Co Ltd; Enzon Pharmaceuticals Inc
Current assignee: American Businessmen Anlong Pharmaceutical Co Ltd
Priority date: 2004-11-09
Filing date: 2005-11-09
Publication date: 2011-12-07
Anticipated expiration: 2025-11-09
Also published as: CN101065485A; DK1824975T3; ES2353638T3; ES2353638T9; ATE482271T1; ZA200704254B; DE602005023772D1

Abstract

The present disclosure concerns LNA oligonucleotides having a (sub)sequence of the general formula 5'- ( Me Cx )(Tx,) Me CXAs Astscscsastsgsgs MeCXAX (G x) (c)-3',and preferably of the general formula 5'- Me C XTX), MeCXAsastscscsastsgsgs Me CxAx G x c-3', wherein capital letters designate a n LNA nucleotide analogue selected from .beta. -D-oxy-LNA, .beta. -D-thio-LNA, .beta.-D-amino-LNA and a-L-oxy-LNA, small letters designate a deoxynucleotid e, and underline designates either an LNA nucleotide analogue as defined above or a deoxynucleotide. Such LNA oligonucleotides exhibit surprisingly good properties with respect to inhibition of the expression of Survivin by means of an anti-sense mechanism, and thereby lead to reduction or inhibition of tumour development in vivo. The LNA oligonucleotides are superior to other L NA oligonucletides targeting Surviving mRNA measured by functional read outs such as apoptosis induction and proliferation inhibition, and is potent in down- regulatingSurvivin mRNA and protein in transfected cancer cell lines, and induce apoptosis in combination with Taxol superior compared to other LNA oligonucleotides.

Description

LNA oligonucleotide and cancer therapy

Invention field

The invention provides the pharmaceutical composition that is used for the treatment of cancer.Said composition comprises specific LNA oligonucleotide, and the latter has superior performance aspect the expression that suppresses Survivin.The present invention also provides treatment method for cancer and plurality of reagents box.

Background of invention

Existence albumen is one of the most attractive new cancer target thing.In nearly all tumor type, detect high-caliber existence albumen, emphasized the clinical effect of this albumen in cancer.The rising of existence albumen in tumour expressed, usually with the cancer return of prognosis mala, increase and relevant to the resistance for the treatment of (radiation and chemotherapy).Existence albumen is not expressed the fact of (a few exceptions is arranged) in the normal adult tissue, make existence albumen become crucial oncogene.

Apoptosis protein inhibitor (IAP) existence albumen participates in the biology incident of 2 keys: (i) control cell proliferation (mitotic division) and (ii) regulate apoptosis (apoptosis).In addition, existence albumen plays an important role in tumor vessel takes place.

Compare with taxol with independent siRNA, target being combined in of proteic siRNA and taxol of surviving causes the enhanced cell apoptosis induction (Zangemeister-Wittke 2003 in the SHEP cell; Ann.N.Y.Acad.Sci.1002:90-94).

Wang etc., 2003; Zhonghua Xue Ye Za Zhi 24,351-54. " Survivinantisense RNA enhances TaxoHnduced apoptosis in leukemia cellline HL-60 ".

In applicant International Patent Application Publication No. WO 2004/069991A2 more early, many possible antisense LNA oligonucleotide have been described.But, in the prior art, the wonderful superperformance of LNA oligonucleotide disclosed herein is not described as yet.

The invention summary

First main aspect of the present invention relates to composition of liquid medicine, and it is included in the LNA oligonucleotide in the aqueous carrier, and described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

5′-( ^Me C _x)(T _x) ^MeC _xA _s A _st _sc _sc _sa _st _sg _sg _s ^MeC _xA _x( G _x)(c)-3′(SEQ?ID?NO.28)，

Preferably, have 16-20 Nucleotide/LNA nucleotide analog altogether, and comprise following (son) sequence:

5′- ^Me C _xT _x ^MeC _xA _sa _st _sc _sc _sa _st _sg _sg _s ^MeC _xA _x G _xc-3′(SEQ?ID?NO.1)，

Wherein the capitalization representative is selected from the LNA nucleotide analog of β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA, and lowercase is represented deoxynucleotide, UnderscoreRepresent LNA nucleotide analog or deoxynucleotide as defined above, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and subscript " x " is represented phosphorothioate bond or phosphodiester bond between adjacent nucleotide/LNA nucleotide analog; And

Described aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.

Second main aspect of the present invention relates to composition of liquid medicine, it is included in the conjugate in the aqueous carrier, described conjugate partly is made up of LNA oligonucleotide and at least one non-nucleotide/non-polynucleotide that are covalently bound on the described oligonucleotide, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

5′- ^Me C _xT _x ^MeC _xA _sa _sc _sc _sa _st _sg _sg _s ^MeC _xA _x G _xc-3′(SEQ?ID?NO.1)，

The 3rd aspect of the present invention relates to pharmaceutical composition, it is included at least a taxane compounds and LNA oligonucleotide in pharmaceutically acceptable carrier, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

Weight ratio in the wherein said composition between taxane compounds and the LNA oligonucleotide is in 50: 1 to 1: 25 scope.

The 4th main aspect of the present invention relates to pharmaceutical composition, it is included at least a taxane compounds and conjugate in pharmaceutically acceptable carrier, described conjugate partly is made up of LNA oligonucleotide and at least one non-nucleotide/non-polynucleotide that are covalently bound on the described oligonucleotide, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

The weight ratio of taxane compounds and LNA oligonucleotide is in 50: 1 to 1: 25 scope in the wherein said composition.

Weight ratio in the wherein said composition between the LNA oligonucleotide of taxane compounds and the conjugate part is in 50: 1 to 1: 25 scope.

The 5th main aspect of the present invention relates to the application of LNA oligonucleotide in pharmaceutical compositions, described pharmaceutical composition is used for the treatment of to be suffered from or the easy Mammals of cancer stricken disease, especially people, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

Wherein the capitalization representative is selected from the LNA nucleotide analog of β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA, and lowercase is represented deoxynucleotide, UnderscoreRepresent LNA nucleotide analog or deoxynucleotide as defined above, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and subscript " x " is represented phosphorothioate bond or phosphodiester bond between adjacent nucleotide/LNA nucleotide analog.

The 6th main aspect of the present invention relates to the application of conjugate in pharmaceutical compositions, described pharmaceutical composition is used for the treatment of to be suffered from or the easy Mammals of cancer stricken disease, especially people, described conjugate partly is made up of LNA oligonucleotide and at least one non-nucleotide/non-polynucleotide that are covalently bound on the described oligonucleotide, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

The 7th main aspect of the present invention relates to treating to be suffered from or the easy method of the Mammals (especially people) of cancer stricken disease, this method comprises the steps: the first kind of pharmaceutical composition that comprises the LNA oligonucleotide to the one or more treatment effective doses of administration, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

The 8th main aspect of the present invention relates to treating to be suffered from or the easy method of the Mammals (especially people) of cancer stricken disease, this method comprises the steps: the first kind of pharmaceutical composition that comprises conjugate to the one or more treatment effective doses of administration, described conjugate partly is made up of LNA oligonucleotide and at least one non-nucleotide/non-polynucleotide that are covalently bound on the described oligonucleotide, described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

The 9th main aspect of the present invention relates to test kit, and it comprises

(a) first kind of component, its contain one or more injection solution dosage the LNA oligonucleotide and

(b) second kind of component, it contains one or more injection solutions of one or more taxane compounds;

Wherein said LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

Wherein the weight ratio between at least a LNA oligonucleotide in the solution dosage of at least a taxane compounds in a kind of solution of second kind of component and first kind of component is in 50: 1 to 1: 25 scope.

The of the present invention ten main aspect relates to test kit, and it comprises

(a) first kind of component, its contain solid form the LNA oligonucleotide and

(b) second kind of component, it contains the buffered soln of the described LNA oligonucleotide of suitable reprovision (for example, dissolving or suspension);

The accompanying drawing summary

Fig. 1 has shown with contrast SEQ ID NO.25 and has compared the stability of SEQ ID NO.2 in people and mice plasma.At 37 ℃, 20 μ M concentration, incubation oligonucleotide 0-, 1-, 2-, 4-, 24-, 48-or 96-hour.Even digestion did not detect the degraded product of SEQ ID NO.2 after 96 hours yet in any serum.

Fig. 2 A has shown the existence albumen decrement adjusting in the 15PC3 prostate cancer cell of SEQ ID NO.2 transfection.With 1,10 and 25nM SEQ ID NO.2 transfection 15PC3 cell, and, regulate by western blot analysis existence albumen

decrement time point

12,24 and 48 hours.Results SEQ ID NO.2 or simulation cells transfected, and contrast existence protein expression.Monitor Bcl-2 albumen simultaneously.

Fig. 2 B has shown with negative control SEQ ID NO.24 and has compared with simulation process, is handling the 15PC3 cell after 24 hours with SEQID NO.2, use ELISA to survive proteic quantitatively.Use the SEQ ID NO.2 of 4 concentration of 0.04-5nM, or the negative control SEQID NO.24 of 5nM, transfection 15PC 3 cells.

Fig. 2 C shown with 5nM SEQ ID NO.24 or mock and compared, after handling with 5 nM SEQID NO.2, and the expression of 3 different isotypes of existence protein mRNA in the 15PC3 cell (existence albumen total length, existence albumen 2B and existence albumen Δ ex3).With the expression stdn of expressing with respect to GAPDH, and compare with the average expression in the cell of simulation process.Obviously, SEQ ID NO.2 energy decrement is regulated the people living albumen isotype of all expression, and negative control SEQ ID NO.24 can not.

Fig. 3 shown in 15PC 3 cells handle 13-72 hour with SEQ ID NO.2 after, the apoptosis that records by inductive caspase 3/7 activity.In 5 concentration of 0.2-100nM, with SEQ ID NO.2 or negative control SEQ ID NO.24 transfection 15PC3 cell.As mean value, present with respect to simulation process and to induce multiple from 3 independent experiments.Display standard deviation on each bar.

Fig. 4 shown with 5nM or 25nM SEQ ID NO.2 and handled the HeLa cell, cause early stage and late period apoptotic dose-dependently induce, dye measured as annexin V-FITC/P I by flow cytometry.The negative control oligonucleotide SEQ ID NO.24 of same concentrations is cell death inducing not.

Fig. 5 uses SEQ ID NO.2 to handle after 13-72 hour the propagation of 15PC3 prostate cancer cell after having shown transfection.With 0.2,1,5,25 and SEQ ID NO.2 or the negative control oligonucleotide SEQ ID NO.24 of 100nM, transfection 15PC3 cell.Shown with untreated analog cell and compared the relative number of viable cell.Data source is from 3 independent experiments.Display standard deviation on each bar.SEQ ID NO.2 causes the dose-dependent inhibition to propagation, and negative control SEQ ID NO.24 can not.

Fig. 6 A shown in 15PC 3 prostate cancer cells with SEQ ID NO.22, SEQ IDNO.2 or after taxol treatment 24-72 hour, the apoptosis that records by inductive caspase 3/7 activity.Handle cell with the SEQ ID NO.22 of 10nM or SEQ ID NO.2 and taxol (10nM or 100nM), 0.1%DMSO is as carrier combinedly.As mean value, present with respect to simulation process and to induce multiple.After 48 hours and 72 hours, the combination pair cell apoptosis induced of SEQID NO.2 and taxol has all shown clearly additive effect.

Fig. 6 B has shown with 2nM SEQ ID NO.2 or 2nM SEQ ID NO.2 associating 10nM taxol treatment after 24 hours and 48 hours, the existence protein mRNA expression in the 15PC3 cell.Analyze to express by qPCR,, and compare with the expression level in the cell that simulation (0.1%DMSO) is handled with the expression stdn of expressing with respect to GAPDH.Discovery is at two kinds of processing schemes and two time points, and the existence protein mRNA all is subjected to decrement and regulates.

Fig. 6 C has shown that in the combined treatment that contrasts SEQ ID NO.24,10nM SEQ ID NO.27 (negative control of SEQID NO.26) or every kind of oligonucleotide of 10nM with 10nM SEQ ID NO.26 (Bc1-2 is specific), 10nMSEQ ID NO.2,10nM existence protein mRNA in the 15PC3 cell and Bc1-2mRNA express after 24 hours.Analyze all by qPCR and express,, and compare with the expression level in the cell of simulation process with the expression stdn of expressing with respect to GAPDH.SEQ ID NO.26 is that Bc1-2 is specific, and no matter is as independent reagent or combined with control compound (SEQ ID NO.24 or SEQ ID NO.27), and existence albumen is not had any effect.SEQ ID NO.2 is a kind of strong cell death inducer, and no matter is as independent reagent or combined with control compound (SEQ ID NO.24 or SEQ ID NO.27), and existence albumen and Bc1-2 expression are all had effect.

Fig. 7 A and 7B have shown the cell cycle analysis with the 15PC3 cell of SEQ ID NO.2 and taxol treatment.With 2nM SEQ ID NO.2 transfection 15PC3 cell, and be exposed to 10nM taxol (in 0.1%DMSO) or carrier (0.1%DMSO).Use the propidium iodide staining cell, and 24 hours and 48 hours (Fig. 7 a) or 24 hours (Fig. 7 b) back by facs analysis, and compare with the 15PC3 cell of the similar processing of 10nM negative control SEQ ID NO.24.This mensuration shown independent and with the specific effect of the combined SEQ ID NO.2 of taxol.When cell cycle arrest, G2 or even the cell fraction of G4 phase increase.The cell of handling with SEQ ID NO.2 was stuck in the cell cycle, caused G1: the G2 ratio is 1: 1 (by contrast, simulation process be 1: 0.25), and the not effect of negative control SEQ ID.NO 24 cell cycle.The taxol combined with SEQ ID NO.2 causes further stagnation, observes G1: the G2 ratio is 1: 3.

Fig. 8 has shown the interior character of body of SEQ ID NO.2 and SEQ ID NO.2 associating taxol.2 different dosing regimes (A and B) that provide among the following little figure with this figure, administered compound.Use two schemes, accept and the group of the SEQ I D NO.2 that taxol is combined and the group of single reagent processing or salt solution (mock), all observe tumor weight and reduce by contrast after 27 days.

Fig. 9 has shown tumor analysis, behind the injection SEQ ID NO.2, has shown the mRNA and the proteic level of existence that reduce in tumour.In 2 weeks, in tumour, use salt solution or 25mg/kg SEQ ID NO.2 (50 μ l volume) 6 times.After the last administration 24 hours, take a sample.

Figure 10 A shown according to embodiment 19, carry out whole body therapeutic with PBS buffered SEQ ID NO.2 preparation after, the content of the SEQ ID NO.2 in the primate stump-tailed macaque liver.Recovery from illness animal (R) keeps not handling for 4 weeks, and shows after this stage and can detect SEQID NO.2 in the tissue.

Figure 10 B has shown the result identical with 10A, but in kidney, rather than in liver.

Detailed Description Of The Invention

The contriver has realized that the LNA oligonucleotide of particular category can pass through antisense mechanism, is suppressing to show wonderful good character aspect the existence protein expression.As can be seen, the LNA oligonucleotide of this particular category (no matter individually still with the combined ground of taxane compounds) can suppress the proteic expression of existence, thereby causes the minimizing or the inhibition of in-vivo tumour development from embodiment.

LNA oligonucleotide as herein described is by the proteic LNA oligonucleotide SEQ ID NO.2 representative of surviving of strong target.Understand (read out) (for example apoptosis-inducing and propagation inhibition) by function and record, this compound is better than other LNA oligonucleotide of target existence protein mRNA.In addition, SEQ ID NO.2 guide material standed for is effective aspect decrement is regulated existence protein mRNA in the cancerous cell line of transfection and albumen.In addition, guide's material standed for SEQ ID NO.2 and the combined cell death inducing of taxol, more excellent such as other LNA oligonucleotide of this combination.In embodiment 21, shown to SEQ ID NO.2 and SEQ ID NO.23 the general introduction of the vitro data that SEQ IDNO.22 and SEQ ID NO.21 obtain.

Xenotransplantation studies show that the existence albumen in the mouse tumor that single reagent handles reduces, and when using with chemotherapy drugs in combination, causes the tumor growth inhibition in the body in the nude mice.This is that the target proteic antisense oligonucleotide of surviving reveals effect with the taxol combination table first in vivo.End user mouse prostate cancer xenograft models PC3 carries out effect test in the body.And SEQ ID NO.2 has good toxicological properties, does not observe significant clinical indication in the intravenously MTD of stump-tailed macaque research.

The LNA oligonucleotide

Useful LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises (son) sequence:

Wherein the capitalization representative is selected from the LNA nucleotide analog of β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA, and lowercase is represented deoxynucleotide, Underscore(promptly ^Me CWith G) represent LNA nucleotide analog as defined above OrDeoxynucleotide, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and subscript " x " is represented phosphorothioate bond or phosphodiester bond between adjacent nucleotide/LNA nucleotide analog, and wherein the nucleotide units in bracket (promptly ( ^Me C _x), (T _x), ( G _x) and (c)) represent the unit of an optional existence separately.

Term " this paper definition LNA oligonucleotide ", " according to LNA oligonucleotide of the present invention ", etc., refer to " LNA oligonucleotide " defined above, referring to SEQ ID NO.1 and 28, and following embodiment, variant, salt, prodrug etc.

The LNA nucleotide analog is selected from β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA.Figure below has been explained the nucleotide analog of these modifications:

B representative nuclear base wherein, i.e. VITAMIN B4 (A), cytosine(Cyt) (C), thymus pyrimidine (T), guanine (G), or methyl-cytosine(Cyt) ( ^MeC).For β-D-amino-LNA, R is substituting group or the hydrogen on the theheterocyclic nitrogen atom.R can be, for example, hydrogen, methyl, ethyl, propyl group, benzyl, etc., maybe can represent be connected (link) with functional group.

In one embodiment, the LNA nucleotide analog is selected from β-D-oxygen-LNA, β-D-sulphur-LNA and β-D-amino-LNA.In another embodiment, the LNA nucleotide analog is selected from β-D-oxygen-LNA and α-L-oxygen-LNA.In present the most preferred embodiment, all LNA nucleotide analogs all are β-D-oxygen-LNA.

When using in this article, term " Nucleotide " refers to 2-deoxyribosyl (or ribose) unit, its by its number one carbon atom bonding to one of nitrogenous base VITAMIN B4 (A), cytosine(Cyt) (C), thymus pyrimidine (T), uridylic (U) or guanine (G) on, and its pass through it No. three and/or No. five carbon atom bonding on phosphodiester between nucleosides or thiophosphoric acid ester group.

(son) sequence SEQ ID NO.28 has at least 12 Nucleotide/LNA nucleotide analog, but preferably, should (son) sequence be represented by at least 13 Nucleotide/LNA nucleotide analog, particularly at least 14 Nucleotide/LNA nucleotide analogs.Except (son) sequence SEQID NO.28, LNA oligonucleotide defined above can comprise 1-4 extra Nucleotide and/or LNA nucleotide analog, especially extra Nucleotide, for example 1,2,3, or 4 extra 2-deoxynucleotide.Thereby typically, described LNA oligonucleotide has 12-20 altogether, or 13-20, or 14-20 Nucleotide/LNA nucleotide analog.Preferably, the LNA oligonucleotide has 14-19 altogether, for example 14-18 or 15-18 or 16-18 or 14-17 or 15-17 or 16-17 Nucleotide/LNA nucleotide analog.Most preferably, the LNA oligonucleotide is the compound of sequence SEQ ID NO.28, be that the LNA oligonucleotide has 14-16 Nucleotide/LNA nucleotide analog, for example 14 Nucleotide/LNA nucleotide analogs, 15 Nucleotide/LNA nucleotide analogs or 16 Nucleotide/LNA nucleotide analogs of amounting to.

Therefore, when all nucleotide units in the bracket are not when all existing, a preferred variant is such, wherein have 5 '-terminal ( ^Me C _x) (T _x), and (i) lack 3 '-terminal ( G _x) (c) (provide the 14-polymers), or (ii) exist ( G _x), and lack (c) (the 15-polymers is provided), or (iii) wherein exist ( G _x) (c) (provide the 16-polymers).Another preferred variant is such, wherein have 3 '-terminal ( G _x) (c), and (i) lack 5 '-terminal ( ^Me C _x) (T _x) (the 14-polymers is provided), or (ii) have (T _x), and lack ( ^Me C _x) (the 15-polymers is provided).A preferred embodiment is such, wherein have 5 '-terminal (T _x), and wherein have 3 '-terminal ( G _x) (the 14-polymers is provided).

About underlined unit, preferably, ^Me C _xRepresent the LNA nucleotide analog.Thereby, all ^Me C _x, AWith GCan represent the LNA nucleotide analog, or ^Me C _xCan represent deoxynucleotide, and AWith GCan represent the LNA nucleotide analog, etc.

Preferably (son) sequence SEQ ID NO.1 has 16 Nucleotide/LNA nucleotide analog.Except (son) sequence SEQ ID NO.1, LNA oligonucleotide defined above can comprise 1-4 extra Nucleotide and/or LNA nucleotide analog, especially extra Nucleotide, for example 1,2,3, or 4 extra 2-deoxynucleotide.Thereby typically, described LNA oligonucleotide has 16-20 Nucleotide/LNA nucleotide analog altogether.Preferably, the LNA oligonucleotide has 16-19 altogether, for example 16-18 or 16-17 Nucleotide/LNA nucleotide analog.Most preferably, the LNA oligonucleotide is the compound of sequence SEQ ID NO.1, and promptly the LNA oligonucleotide has 16 Nucleotide/LNA nucleotide analogs altogether.

Should be noted that the subsequence A of SEQ ID NO.28 _s A _st _sc _sc _sa _st _sg _sg _s ^MeThe subsequence A of C and SEQ ID NO.1 _sa _st _sc _sc _sa _st _sg _sg _s ^MeC is expressed as complete phosphorothioate, referring to subscript " s ".Although be not preferred at present, think one and also may can be replaced by other key by two described phosphorothioate bonds, phosphodiester bond especially, and the not serious stability that diminishes described LNA oligonucleotide.Thereby, such variant, one of them or two phosphorothioate bonds are replaced by for example phosphodiester bond, also in desired extent of the present invention.

The way of illustrative example of SEQ ID NO.28 and specific (son) sequence of 1 is the SEQ ID NO.2-20 that lists in table 1.

Table 1-LNA oligonucleotide

SEQ ID NO. sequence and design design

In table 1, capitalization (not having subscript) is represented β-D-oxygen-LNA nucleotide analog (β-D-oxygen-LNA); But, the subscript of capitalization back " α " (G for example ^α) expression, the LNA nucleotide analog is α-L-LNA nucleotide analog (α-L-oxygen-LNA), lowercase is represented deoxynucleotide, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and does not have subscript to represent phosphodiester bond between adjacent nucleotide/LNA nucleotide analog.All LNA-C monomers be 5-methyl-C ( ^MeC).

In attractive embodiment, the LNA oligonucleotide comprises and is selected from following (son) sequence: SEQ ID NO.:2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.More particularly, the LNA oligonucleotide is to be selected from following compound: SEQ IDNO.:2, and 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.In present the most preferred embodiment, the LNA oligonucleotide comprises (son) sequence SEQ ID NO.2.Even more preferably, the LNA oligonucleotide is the compound with SEQ ID NO.2.

The preparation of LNA oligonucleotide

The document of following disclosed method and wherein quoting, can prepare LNA nucleotide analog component of thing (β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA), referring to, for example,

WO 03/095467 A1; D.S.Pedersen, C.Rosenbohm, T.Koch (2002) Preparation of LNA Phosphoramidites, Synthesis 6,802-808; M.D.

L.

T.Bryld, A.E. B.Verbeure, G.Gaubert, P.Herdewijn, J.Wengel (2002) o-L-ribo-configured Locked Nucleic Acid (o-l-LNA): Synthesis and Properties, J.Am.Chem.Soc., 124,2164-2176; S.K.Slngh, R.Kumar, J.Wengel (1998) Synthesis of Novel Blcyclo[2.2.1] Ribonucleosides:2 '-Amino-and 2 '-Thlo-LNA Monomerlc Nucleosides, J.Org.Chem.1998,63,6078-6079; C.Rosenbohm, S.M.Christensen, M.D.

D.S.Pedersen, L.E.Larsen, J.Wengel, T.Koch (2003) Synthesis of 2 '-amino-LNA:a new strategy, Org.Biomol.Chem.1,655-663; With WO 2004/069991A2.

Can be as embodiment and WO 99/14226, WO 00/56746, and WO 00/56748, WO00/66604, WO 00/125248, and WO 02/28875, and WO 2002/094250 and WO03/006475 are described, preparation LNA oligonucleotide.Thereby, the nucleic acid chemistry oligomerization technology that can use the those of ordinary skill of organic chemistry filed to know, preparation LNA oligonucleotide.Usually, use phosphoramidite oligomerization circulation means (S.L.Beaucage and R.P.Iyer, Tetrahedron, 1993,49,6123 of standard; S.L.Beauca ge and R.P.Iyer, Tetrahedron, 1992,48,2223), but also can use for example H-phosphonic acid ester chemistry, phosphotriester chemistry.

For some monomer, longer coupling time and/or repetition coupling and/or the more spissated coupling reagent of use may be necessity or useful.

The phosphoramidite that uses typically carries out coupling with the substep productive rate of gratifying＞95%.Usually, with for example iodine/pyridine/H ₂O realizes the oxidation of three valent phosphors (III) to pentavalent phosphorus (V).Go after the protection, this can produce phosphodiester bond between natural nucleosides.Under the situation of phosphorothioate bond between the preparation nucleosides, the following sulfuration (thiolation) step: the common (iodine/pyridine/H for example that will be used for phosphodiester bond between synthetic nucleosides ₂O) oxidation replaces with and uses ADTT reagent ((0.01M is at acetonitrile: oxidation pyridine 9: among the 1v/v) for xanthane hydride.Also can use other sulfuration reagent, for example Beaucage and PADS.Synthetic effectively thiophosphoric acid LNA oligonucleotide, substep coupling productive rate＞=98%.

Use the phosphoramidite method, also can synthesize the LNA oligonucleotide that comprises β-D-amino-LNA, β-D-sulphur-LNA and/or α-L-LNA effectively, substep coupling productive rate 〉=98%.

Use disposable anti-phase purification column and/or reversed-phase HPLC and/or from ethanol or butanols, precipitate, can realize the purifying of LNA oligonucleotide.Use capillary gel electrophoresis, reversed-phase HPLC, MALDI-MS, and ESI-MS confirm the purity of synthetic LNA oligonucleotide.

Salt

The LNA oligonucleotide can use with multiple pharmacologically acceptable salt.This term is meant as used herein, and the expectation biological activity that keeps the LNA oligonucleotide also shows the salt of the minimum toxicological effect of not expecting.The non-limiting example of this class salt can form with organic amino acid, base addition salt and metallic cation be formation such as zinc, calcium, bismuth, barium, magnesium, aluminium, copper, cobalt, nickel, cadmium, sodium, potassium for example, or with by ammonia, N, the positively charged ion that N-dibenzyl-ethylenediamin, D-glycosamine, Tetrylammonium or quadrol form forms; Or its combination, for example Weibull zinc salt etc.

This class salt is to be formed by the LNA oligonucleotide with phosphodiester group and/or thiophosphoric acid ester group, and is the salt that for example forms with appropriate base.These salt comprise, for example are derived from the nontoxic metal-salt of periodic table of elements Ia, Ib, IIa and IIB family metal, particularly suitable an alkali metal salt, for example lithium salts, sodium salt or sylvite, or alkaline earth salt, for example magnesium salts or calcium salt.They also comprise zinc salt and ammonium salt, and the salt that forms with the organic amine that is fit to, the for example unsubstituted or hydroxyl of described amine replace one-, two-or three-alkylamine, particularly one-, two-or three-alkylamine, or the salt that forms with quaternary ammonium compound, for example with N-methyl-N-ethylamine, diethylamine, triethylamine, single-, two-or three-(2-hydroxy lower alkyl) amine for example single-, two-or three-(2-hydroxyethyl) amine, 2-hydroxyl-tert-butylamine or trihydroxymethylaminomethane, N, N-two low alkyl groups-N-(hydroxy lower alkyl) amine is N for example, and the salt that N-dimethyl-N-(2-hydroxyethyl) amine or three-(2-hydroxyethyl) amine or N-methyl D-glycosamine or quaternary ammonium compound form is 4-butyl ammonium for example.Preferred lithium salts, sodium salt, magnesium salts, zinc salt or sylvite, special particular certain cancers.

Prodrug

In one embodiment, the LNA oligonucleotide can be the form of prodrug.In fact, oligonucleotide is electronegative ion.Because the lipophilic character of cytolemma is compared with neutral or lipophilic equivalent, the cell of oligonucleotide is taken in and is reduced.By use preceding regimen (referring to for example Crooke, R.M. (1998) in Crooke, S.T.Antisense researchand Application.Springer-Verlag, Berlin, Germany, vol.131, pp.103-140), can avoid this polarity " obstacle ".In this scheme, prepare the LNA oligonucleotide in shielded mode, make that the LNA oligonucleotide is a neutral when using.Can remove the mode of blocking group when taking in the LNA oligonucleotide, design these blocking groups with cell.The example of these blocking groups is S-ethanoyl thio-ethyl (SATE) or S-valeryl thio-ethyl (tertiary butyls-SATE).These blocking groups are nuclease resistances, can optionally be removed in cell.

Conjugate

In the context of the present invention, term " conjugate " is intended to represent heterogeneous molecule, it passes through covalently bound LNA oligonucleotide described herein (that is the compound that, comprises nucleosides or nucleoside analog sequence) and one or more non-nucleotide or non-polynucleotide part and forms.

Therefore, the LNA oligonucleotide for example right and wrong Nucleotide or non-polynucleotide partly put together or form mosaic, described non-nucleotide or non-polynucleotide partly comprise peptide nucleic acid(PNA) (PNA), albumen (for example antibody of target protein), macromole, the low-molecular-weight drug material, fatty acid chain, saccharide residue, glycoprotein, polymkeric substance (for example polyoxyethylene glycol), micelle formation group, antibody, carbohydrate, the receptors bind group, steroide is cholesterol for example, polypeptide, intercalator is acridine derivatives for example, long-chain alcohol, branch-shape polymer, phosphatide and other lipophilic group or their combination etc. can be arranged with dimerization or dendritic structure as this oligomeric compounds.LNA oligonucleotide or conjugate also can be puted together or further be conjugated to active drug substance, for example acetylsalicylic acid, Ibuprofen BP/EP, sulfa drug, antidiabetic drug, antiseptic-germicide, chemotherapy compound or microbiotic.

Puting together of this mode can given beneficial property aspect the pharmacokinetic characteristic of LNA oligonucleotide.Particularly, the cell of having realized increase of puting together of this mode is taken in.

In one embodiment, the LNA oligonucleotide is connected to and forms conjugate on the part, and described part is to take in respect to the cell of antisense LNA oligonucleotide in order to increase conjugate.This put together can appear at terminal position 5 '/3 '-OH, but part also can appear at sugar and/or base place.More specifically, the somatomedin that can put together of antisense LNA oligonucleotide can comprise Transferrins,iron complexes or folic acid.Can prepare Transferrins,iron complexes-polylysine-oligonucleotide complex or folic acid-polylysine-oligonucleotide complex, be used for taking in by the cell of expressing high-caliber Transferrins,iron complexes or folacin receptor.Other example of conjugate/part is a cholesterol moiety, and the duplex intercalator is acridine for example, and poly-L-Lysine is with the linking group of one or more nuclease resistances single thiophosphate ester etc. " end-blocking " for example.

Wagner etc., Proc.Natl.Acad.Sci.USA 87, and 3410-3414 (1990) has described the preparation of taking in the transferrin complex of protein of the carrier in the cell as oligonucleotide.Low etc., United States Patent (USP) 5,108,921 have described by folacin receptor endocytosis cell and have sent folic acid-macromole conjugate, comprise and send antisense oligonucleotide.Also referring to, Leamon etc., Proc.Natl.Acad.Sci.88,5572 (1991).

Pharmaceutical composition

Should be appreciated that to the present invention relates to pharmaceutical composition that it comprises LNA oligonucleotide or conjugate as defined above, and pharmaceutically acceptable carrier, for example aqueous carrier.This pharmaceutical composition is preferably suitable for injection.

The guidance of preparation of pharmaceutical compositions is found in " the Remington:The Science and Practice of Pharmacy " of Alfonso R.Gennaro and hereinafter.

Pharmaceutically acceptable carrier, for example tackiness agent and assistant agent are part of pharmaceutical compositions.Capsule, tablet and pill etc. can contain for example following compounds: as Microcrystalline Cellulose, natural gum or the gelatin of tackiness agent; Starch or lactose as vehicle; Stearate as lubricant; Various sweeting agents or correctives.For capsule, dose unit can contain liquid vehicle, for example fatty oil.Equally, the dressing of sugared agent or intestines agent can be the part of dose unit.Pharmaceutical composition also can be active pharmaceutical ingredient (comprising the LNA oligonucleotide) and the emulsion that can form the lipid of micelle emulsion.

The LNA oligonucleotide can mix with any material that does not damage expectation function, or mixes with the material of additional expectation function.These materials can comprise other medicines, comprise other nucleoside compound.

For parenteral, subcutaneous, intracutaneous or topical application, said preparation can comprise the conditioning agent and the antiseptic-germicide of sterile diluent (for example water), buffer reagent, tension force and ionic strength.Active compound can prepare together with carrier, and this carrier can promote to take in, protection avoids degraded or protection avoids discharging from body immediately, comprises implant or microcapsule with exhibit controlled release properties.Use for intravenously, preferred carrier is physiological saline (0.9%) or phosphate buffered saline (PBS).

Preferably, the LNA oligonucleotide is included in the unit formulation to be enough to being treated the amount that does not produce serious side effects among the patient to patient's delivery treatments significant quantity at this, for example in pharmaceutical acceptable carrier or thinner.

In the preferred embodiment of pharmaceutical composition, the LNA oligonucleotide is formulated in the aqueous carrier, and more particularly, this aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.

Term " aqueous carrier " is meant that the pharmaceutical composition of being discussed is a liquid form, and this liquid vehicle mainly is made up of water, promptly at least 80% (w/w) or at least 90% (w/w) or even the carrier of at least 95% (w/w) form by water.Also can use other liquid component, for example ethanol, DMSO, ethylene glycol etc.

This aqueous carrier preferably comprises and keeps the buffer reagent of pH in the 4.0-8.5 scope.Preferably, this buffer reagent will keep pH in the scope of 5.0-8.0, for example in the scope of 6.0-7.5.

Ionic strength/the tension force of pharmaceutical composition also is important.Therefore, this composition of liquid medicine generally has the ionic strength in the 20-2000mM scope, for example in the scope of 50-1500mM, perhaps in the scope of 100-1000mM.

First and second main aspect advantageously with top further provide about the explanation of LNA oligonucleotide, conjugate and pharmaceutical composition and preferably combined.Think that following embodiment represented benefit of the present invention fully.

In one embodiment, the LNA nucleotide analog is selected from β-D-oxygen-LNA, β-D-sulphur-LNA and β-D-amino-LNA, or is selected from β-D-oxygen-LNA and α-L-oxygen-LNA, and particularly, all LNA nucleotide analogs all are β-D-oxygen-LNA.

Another can with the combined embodiment of foregoing in, the LNA oligonucleotide has 16-19, for example 16-18 of amounting to or 16-17,16 Nucleotide/LNA nucleotide analogs more especially.Perhaps, the LNA oligonucleotide has and amounts to 12-18, for example 13-18 or 14-17,14 or 15 Nucleotide/LNA nucleotide analogs more especially.

Another can with the combined embodiment of foregoing in, the LNA oligonucleotide comprises and is selected from following (son) sequence: SEQ ID NO.:2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.More specifically, the LNA oligonucleotide is to be selected from following compound: SEQ ID NO.:2, and 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.More preferably, the LNA oligonucleotide comprises (son) sequence SEQ ID NO.2, and most preferably, the LNA oligonucleotide is the compound with SEQ ID NO.2.

Another can with the combined embodiment of foregoing in, composition also comprises at least a taxane compounds (further details is referring to following " combination medicine ").More specifically, the weight ratio between taxane compounds and the LNA oligonucleotide (the LNA oligonucleotide part of conjugate) is in 50: 1 to 1: 25 scope in the described composition.About second aspect, if described at least one non-nucleotide/non-polynucleotide partly comprise taxane compounds, it may be preferred.

Combination medicine

Pharmaceutical composition can also comprise other medicament, and it is selected from chemotherapy compound, anti-inflammatory compound, antiviral compound, cell growth-inhibiting compound, anti-angiogenic compounds, anti-proliferative compounds, short apoptosis compound, signal transduction modulators and kinase inhibitor.

In an interesting variant, other medicament is at least a chemotherapy compound.The suitable example of this based chemotherapy compound is to be selected from following compound: adrenal cortex hormones drug, for example prednisone, dexamethasone (dexamethasone) or dexamethasone (decadron); Altretamine (Hexalen, hexamethylmelamine (HMM)); Amifostine (amifostine pin pulvis); Aminoglutethimide (Cytadren); Amsacrine (M-AMSA); Anastrozole (Arimidex); Male sex hormone, for example testosterone; Asparaginase (Elspar); Bacille Calmette-Guerin vaccine; Than card Shandong ammonia (Casodex); Bleomycin (bleomycin sulfate); Busulfan (Myelosan); Carbon platinum (Paraplatin); Ka Mositing (BCNU; BiCNU); Chlorambucil (Leukeran); The chlorine deoxyadenine (2-CDA, CldAdo, leustatin); Cis-platinum (platinol); Cytosine arabinoside (cytarabine); Dacca bag piperazine (DTIC); Actinomycin D (actinomycin-D, cosmegen); Daunorubicin (daunorubicin hydrochloride); Docetaxel (taxotere); Zorubicin (adriomycin); Epirubicin; Estramustine (emcyt); Oestrogenic hormon, for example female acid of hexene (DES); Etopside (VP-16, etoposide, Etopophos); Fludarabine (fludara); Flutamide (eulexin); 5-FUDR (floxuridine); 5 FU 5 fluorouracil (5-FU); Gemcitabine (strong selecting); Goserelin (zodalex); Trastuzumab (Si Tumanbu); Hydroxyurea (hydrea); Darubicin (hydrochloric acid darubicin); Ifosfamide; IL-2 (reconstituted inter leukin-2, rIL-2); Interferon alpha (intronA, roferon A); Rinotecan (camptosar); Leuprorelin acetate (Leuprolide); LEVAMISOLE HCL (ergamisole); Lomustine (CCNU); Mustine hydrochlcride (mustargen, mustargen); Melphalan (L-Sarcolysinum); Mercaptopurine (purinethol, 6-MP); Methotrexate (mexate); Mitomycin-C (mutamucin); Mitoxantrone (novantrone); Sostatin (kind peaceful); (2-sprays Si Tading to deoxycoformycin, nipent); Plicamycin (Plicamycin, mithracin); Prorocarbazine (procarbazine hydrochloride); U-9889; Tamoxifen (Nolvadex/Nolvadex-D); Safe plain (taxol); Teniposide (is defended and is sprouted, VM-26); Thio-tepa; Hycamtin (topotecan hydrochloride); Tretinoin (vesanoid, alltrans tretinoin); Vinealeucoblastine(VLB) (valban); Vincristine(VCR) (vincristine sulphate) and vinorelbine (nvelbine).

In a variant, the invention provides pharmaceutical composition, it comprises (a) one or more LNA oligonucleotide and reaches (b) one or more other chemotherapy compounds that work by non-antisense mechanism.When using with the LNA oligonucleotide, this based chemotherapy compound (for example can use (for example Plicamycin and oligonucleotide), sequential use separately, use Plicamycin and oligonucleotide for some time, re-use another kind of medicament and oligonucleotide) or make up with one or more other these based chemotherapy compounds combinations or with radiotherapy.All chemotherapy compounds well known by persons skilled in the art, clear those compounds of describing all are introduced into this paper above comprising, as with the combination therapy of compound of the present invention.

In a preferred embodiment, pharmaceutical composition and taxane compounds combined administration.Term " taxane compounds " be intended to comprise taxol (

), D51-7059, docetaxel, taxotere, modified Taxan and 10-deacetyltaxol.Taxol ( ) be to separate that (Pacific Ocean) Japanese yew is the diterpene of the bark of yewtree (Ta xu s brev ifolia) from the west, and the class therapeutical agent of representative with Taxan ring system.Taxan and analogue thereof are by preparing from 10-deacetylate Baccatine III (available from the precursor of Ramulus et folium taxi cuspidatae needle and sprig) partial synthesis and by complete synthesis obtaining.See Holton., etc., J.A m.Chem.Soc.116:1597-1601 (1994) and Nicolaou etc., Nature 367:630 (1994).Taxol demonstrates curative effect in the clinical trial of several human tumors.See McGuire etc., Ann.Int.Med.11:237-279 (1989); Holmes etc., J.Natl.Cancer Inst.83:1797-1805 (1991); J.Natl.Cancer Inst.86:18-24 (1994) such as Kohn; With Kohn etc., American Society for Clinical Oncology 12 (1993).Modified Taxan or 10-deacetyltaxol are that those have the compound with the taxane-ring of modified side chain.Many these analogues have improved character, for example than higher water-soluble and stable of naturally occurring taxol.These analogues are well known by persons skilled in the art, and for example are disclosed in United States Patent (USP) the 5th, 278, No. 324,5,272, No. 171,5,254,580,5,250, No. 683,5,248, No. 796 and 5,227, in No. 400, their disclosure is all quoted as a reference at this.Taxol and taxotere can pass through the method preparation among WO93/18210, EP0 253 739, EP 0 253 739 and the WO92/09589, and their disclosure is all quoted as a reference at this.In specific embodiment, taxane compounds is taxol or taxotere.

Weight ratio in the described composition between taxane compounds and the LNA oligonucleotide is typically in following ranges: 50: 1 to 1: 25, and for example 25: 1 to 1: 25 or 10: 1 to 1: 25 or 1: 1 to 1: 25 or 50: 1 to 1: 10 or 1: 1 to 1: 50 or 25: 1 to 1: 10.

Therefore, the 3rd aspect of the present invention relates to pharmaceutical composition, it is included at least a taxane compounds and LNA oligonucleotide in pharmaceutically acceptable carrier, and described LNA oligonucleotide has 12-20 Nucleotide/LNA nucleotide analog altogether, and comprises following (son) sequence:

5 '- ^Me C _xT _x ^MeC _xA _sa _st _sc _sc _sa _st _sg _sg _s ^MeC _xA _x G _xC-3 ' (SEQ ID NO.1), wherein the capitalization representative is selected from the LNA nucleotide analog of β-D-oxygen-LNA, β-D-sulphur-LNA, β-D-amino-LNA and α-L-oxygen-LNA, and lowercase is represented deoxynucleotide, UnderscoreRepresent LNA nucleotide analog or deoxynucleotide as defined above, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and subscript " x " is represented phosphorothioate bond or phosphodiester bond between adjacent nucleotide/LNA nucleotide analog; And

The 3rd and the 4th main aspect advantageously with top further provide about the explanation of LNA oligonucleotide, conjugate and pharmaceutical composition and preferably combined.Think that following embodiment represented benefit of the present invention fully.

Another can with the combined embodiment of foregoing in, LNA oligonucleotide (or conjugate) and taxane compounds are present in the aqueous carrier.Preferably, described aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength (about other details of buffer reagent also referring to top) of 20-2000mM.

About the 4th aspect, it may be preferred that described at least one non-nucleotide/non-polynucleotide partly comprise taxane compounds.

In another embodiment, pharmaceutical composition of the present invention can contain the other antisense compounds of one or more LNA oligonucleotide and second kind of nucleic acid target material of one or more targets.Can be together or successively use the compound of 2 kinds or multiple combination.

And, can unite with radiotherapy etc. and use the medicine that comprises the LNA oligonucleotide, also referring to experimental section.

Methods of treatment

Pharmaceutical composition is special relevant with treatment for cancer.

The disease that pharmaceutical composition of the present invention and method are preferably used for treating or preventing cancer causes, in particular for treating the cancer that may occur in the tissue, for example lung cancer, breast cancer, colorectal carcinoma, prostate cancer, carcinoma of the pancreas, lung cancer, liver cancer, thyroid carcinoma, kidney, the cancer of the brain, carcinoma of testis, cancer of the stomach, intestines (intestine) cancer, intestines (bowel) cancer, spinal cord cancer, hole cancer, bladder cancer, urinary tract cancer, ovarian cancer, incidence cancer, hematological system cancer, skin carcinoma, cancer of the stomach or osteocarcinoma.

Invention as herein described comprises prevention or treatment method for cancer, and it comprises to the adjusting of people's administering therapeutic significant quantity of this treatment of the needs proteic LNA oligonucleotide of surviving, and includes but not limited to the LNA oligonucleotide of high dosage.The present invention comprises that also short-term uses the application of regulating the proteic LNA oligonucleotide of existence.Normally, the cell of non-cancer divides with the distinctive frequency of particular cell types.When cell has changed into the cancer state, can produce the not controlled cell proliferation and the necrocytosis of minimizing, therefore mixed and disorderly cell fission or cell growth are the signs of cancerous cells type.The example of cancer types includes but not limited to, non Hodgkin lymphoma, hodgkin's lymphoma, leukemia (acute leukemia for example, acute lymphoblastic leukemia for example, acute myelocytic leukemia, chronic myeloid leukemia, lymphocytic leukemia, multiple myeloma), colorectal carcinoma, the rectum cancer, carcinoma of the pancreas, breast cancer, ovarian cancer, prostate cancer, renal cell carcinoma, liver cancer, cholangiocarcinoma, choriocarcinoma, cervical cancer, carcinoma of testis, lung cancer, bladder cancer, melanoma, the incidence cancer, the cancer of the brain, the cancer at unknown former position, knurl, the peripheral nervous system cancer, the central nervous system cancer, tumour (for example, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendothelial sarcoma, synovioma, mesothelioma, ewing's tumor, leiomyosarcoma, rhabdosarcoma, squamous cell carcinoma, rodent cancer, gland cancer, syringocarcinoma, sebaceous carcinoma, papillary carcinoma, papillary carcinoma, cystadenocarcinoma, medullary carcinoma, lung bronchogenic carcinoma, spermocytoma, embryonal carcinoma, wilms' tumor, small cell lung cancer, epithelial cancer, neurospongioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic tumor, Oligodendroglioma, meningioma, neuroblastoma and retinoblastoma), heavy chain disease, shift or be any disease or the illness of feature with uncontrolled or abnormal cell growth.

Xiang Guan Cancerous disease is to be selected from following those especially: acute myelocytic leukemia, diffusivity B cell lymphoma, acute lymphoblastic leukemia, liver cancer, kidney, urinary tract cancer, and colorectal carcinoma.

Term " cancer " is meant the malignant tumour of epithelial origin.Epithelium covers or the surface of lining inside and outside body.The example of epithelium is that skin and lining are at body cavity and internal's (for example intestines, bladder, uterus etc.) mucous membrane and serous coat.Epithelium also can extend into darker organized layer to form body of gland, for example mucus secretion gland.Term " sarcoma " is meant the malignant tumour that is grown by reticular tissue (for example cartilage, fat, muscle, tendon and bone).Term used herein " neurospongioma " is intended to contain the malignant tumour that originates from neurogliocyte.

Think that composition of the present invention is suitable especially to the relevant cancer form of treatment tumour.Such treatment can be combined with radiotherapy.

The 5th, the 6th, the 7th and the 8th main aspect advantageously with top further provide about the explanation of LNA oligonucleotide, conjugate and pharmaceutical composition and preferably combined.Therefore, the composition of mentioning aspect main the 5th, the 6th, the 7th and the 8th preferably as to top defines at " pharmaceutical composition " and " combination medicine " undefined pharmaceutical composition.Think that further following embodiment represented benefit of the present invention fully.

The disease of mentioning can be any disease defined above, but preferably is selected from acute myelocytic leukemia, diffusivity B cell lymphoma, acute lymphoblastic leukemia, liver cancer, kidney, urinary tract cancer, and colorectal carcinoma.

Another can with the combined embodiment of foregoing in, the LNA oligonucleotide comprises and is selected from following (son) sequence: SEQ ID NO.:2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.More specifically, the LNA oligonucleotide is to be selected from following compound: SEQ ID NO.:2, and 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 and 20, especially be selected from SEQ ID NO.2,3,4,5,6,7,8,9 and 10.More preferably, the LNA oligonucleotide comprises (son) sequence SEQID NO.2, and most preferably, the LNA oligonucleotide is the compound with SEQ ID NO.2.

Aspect the 5th and the 6th are main another can with the combined embodiment of foregoing in, composition also comprises at least a taxane compounds (other details is referring to top " combination medicine ").More specifically, the weight ratio between taxane compounds and the LNA oligonucleotide (the LNA oligonucleotide part of conjugate) is in 50: 1 to 1: 25 scope in the described composition.About second aspect, it may be preferred that described at least one non-nucleotide/non-polynucleotide partly comprise taxane compounds.

Aspect the 7th and the 8th are main another can with the combined embodiment of foregoing in, with LNA oligonucleotide or the co-administered described at least a taxane compounds of conjugate (other details is referring to top " combination medicine ").More specifically, the weight ratio between taxane compounds of using and the LNA oligonucleotide (the LNA oligonucleotide part of conjugate) is in 50: 1 to 1: 25 scope.About the 8th aspect, it may be preferred that described at least one non-nucleotide/non-polynucleotide partly comprise taxane compounds.

With reference to aforementioned embodiment, taxane compounds may reside in the first kind of pharmaceutical composition that comprises LNA oligonucleotide (or conjugate).In this case, in the described composition weight ratio between taxane compounds and the LNA oligonucleotide (or LNA oligonucleotide part of conjugate) preferably in 50: 1 to 1: 25 scope.Perhaps, taxane compounds may reside in the second kind of pharmaceutical composition that does not comprise LNA oligonucleotide (or conjugate).In this case, first kind of pharmaceutical composition and second kind of pharmaceutical composition can side by side be used, and perhaps first kind of pharmaceutical composition and second kind of pharmaceutical composition are successively used.

Another can with the combined embodiment of foregoing in, LNA oligonucleotide (or conjugate) and any taxane compounds are present in the aqueous carrier.Preferably, described aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength (about other details of buffer reagent also referring to top) of 20-2000mM.

About the 6th and the 8th main aspect, it may be preferred that described at least one non-nucleotide/non-polynucleotide partly comprise taxane compounds.

Test kit

The present invention also provides the plurality of reagents box, and it can be used for the therapeutic treatment to the patient that these needs are arranged.

In a variant, this test kit comprises the set that is used for combination therapy, and described combination therapy promptly uses LNA oligonucleotide (or its conjugate) and one or more taxane compounds to treat.

Therefore, the 9th main aspect of the present invention relates to test kit, and it comprises:

Weight ratio between at least a LNA oligonucleotide in the dosage of at least a taxane compounds in a kind of solution of wherein said second kind of component and first kind of component is in 50: 1 to 1: 25 scope, and/or

Wherein the injection solution dosage of LNA oligonucleotide comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.In a preferred embodiment, buffer reagent (for example salt solution or buffer saline) has the ionic strength of pH and the 100-500mM of 6.0-8.0.In a most preferred embodiment, salt solution or buffer saline have the ionic strength of pH and the 120-250mM of 7.0-8.0.

Comprise the similar reagents box of the conjugate of LNA oligonucleotide and non-nucleotide/non-polynucleotide part, also constitute one aspect of the present invention through suitable variation.

Should be appreciated that the LNA oligonucleotide (or conjugate of LNA oligonucleotide and non-nucleotide/non-polynucleotide part) of injection solution dosage and taxane compounds preferably respectively such as top " pharmaceutical composition " and " combination medicine " following definition.

If the pharmaceutical composition of liquid form is in the danger under the condition that can diminish LNA oligonucleotide stability, can preferably prepare the finished product that contains the LNA oligonucleotide of solid form, for example as freeze-dried material, and with such solid form preservation product.Then, before using, can this product of reprovision (for example, dissolving or suspension).

Therefore, the of the present invention ten main aspect relates to test kit, and it comprises

(a) first kind of component, its contain solid form the LNA oligonucleotide and

(b) second kind of component, it contains the salt solution or the buffered soln (for example buffer saline) of the described LNA oligonucleotide of suitable reprovision (for example, dissolving or suspension), and preferably, described buffered soln has the ionic strength of pH and the 20-2000mM of 4.0-8.5;

The mentioned reagent box preferably also comprises about making up the written guide of first kind and second kind component.

Use

Pharmaceutical composition of the present invention can be used in many ways, and what this depended on expectation is part or systemic treatment and zone to be treated.Use can be (a) oral (b) through lung, for example, comprise and pass through atomizer by sucking or being blown into powder or aerosol; In the tracheae, in the nose; (c) part comprises epidermis, transdermal, eye and comprises vagina and the mucosal delivery of rectum; Or (d) parenteral, comprise intravenously, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; Or encephalic, for example sheath is interior or Intraventricular is used.In one embodiment, the LNA oligonucleotide is by intravenously, intraperitoneal, per os, use or be applied directly to target organ partly or as injecting.

Think that at present only form of medication is by intravenous infusion or oral.

Dosage

Dosage depends on the seriousness and the reactivity of morbid state to be treated, and sustainable several days of the course of treatment is to some months, or until realize to cure or reach alleviating of morbid state.By measuring the intravital medicine of patient or, also can estimating best dosage regimen by the surrogate mark.

Optimal dose can change with the relative potency of each oligonucleotide.Generally speaking, it can be based on finding effective EC in the animal model in vitro and in vivo ₅₀Estimate.Usually, dosage is per kilogram of body weight 0.01 μ g to 1g, and can every day, weekly, every month or use one or many every year, or even used once in per 2 to 10 years, or continuous infusion several hours is until some months.The repetition rate of administration can be estimated according to the residence time and the concentration of the medicine of being measured in body fluid or tissue.Success may wish that the patient accepts to keep the recurrence of treatment with the preventing disease state after treating.Think that at present optimal dosage is per kilogram of body weight 0.01mg to 100mg, for example 0.1mg to 40mg or 0.5mg to 10mg.Such dosage can be used once every day, but more preferably lower frequency, and for example weekly 1-3 time, lasting 1-4 week.Can continue to keep treatment, for example every month 1-4 time, or even lower frequency, for example annual 1-10 time.

Be not limited to any concrete theory, estimate that the combined effect (reaching synergy potentially) of chemotherapy compound and LNA oligonucleotide of the present invention will make and might reduce chemotherapy compound or LNA oligonucleotide or this both dosage.

Other purposes

LNA oligonucleotide of the present invention also can be used as research reagent, is used for diagnosis, treatment and prevention.Under study for action, this antisense LNA oligonucleotide can be used for specificity and suppresses proteic the synthesizing of surviving in cell and the experimental animal, is convenient to the functional analysis to target thus, or estimates it intervenes target as treatment availability.In diagnosis, this antisense LNA oligonucleotide can be used for detecting with quantitative cell and the existence protein expression in organizing, and this realizes by RNA trace, in situ hybridization or similar techniques.For treatment, doubtful suffer from and can treat by using antisense LNA oligonucleotide of the present invention by regulating the disease that the existence protein expression treats or the animal or human of illness.

Treatment animal (particularly mouse and rat) and treatment people's method also is provided, described animal and human's suspection suffers from or tends to suffer from and relevant disease or the illness of existence protein expression, and described method realizes by one or more antisenses LNA oligonucleotide or the conjugate of administering therapeutic or prevention significant quantity.

The present invention also provides the method for regulating existence protein expression in the cell or tissue, and this method comprises that the pharmaceutical composition that defines with the LNA oligonucleotide of this paper definition or conjugate, particularly this paper contacts this cell or tissue, so that regulate the existence protein expression.

In addition, the invention provides the method for regulating the expression of gene that relates in the Cancerous disease, it comprises with the pharmaceutical composition of the LNA oligonucleotide of this paper definition or conjugate, particularly this paper definition and this gene or from the RNA of this gene and contacts regulatory gene expression thus.This gene protein gene of preferably surviving.

Another aspect of the present invention relates to the method for cell death inducing, and it comprises with the pharmaceutical composition of this paper definition and this cell or from the RNA of this cell and contacting, thus cell death inducing.Apoptosis induced can be in external or body.This is induced and can cause in raji cell assay Raji or in the tissue sample or in the Mammals that lives.

Another aspect of the present invention relates to the method that prevents or reduce cell proliferation, and it comprises with the pharmaceutical composition of this paper definition and this cell or from the RNA of this cell and contacting, and prevents thus or reduces cell proliferation.That breeds prevents or reduces can be in external or body.This prevents and can carry out in raji cell assay Raji or in the tissue sample or in the Mammals that lives.

Experiment

The present preferred examples of the LNA oligonucleotide of this paper definition is LNA oligonucleotide SEQID NO.2.The following examples have been explained the wonderful good character of this LNA oligonucleotide, but think that other LNA oligonucleotide that comprises (or having) sequence SEQ ID NO.1 or SEQ ID NO.28 has similar interesting character.

Embodiment 1: monomer is synthetic

According to disclosed method and the document wherein quoted, preparation LNA monomer members and derivative thereof, referring to:

WO?03／095467?A1

D.S.Pedersen，c，Rosenbohm，T.Koch(2002)Preparation?of?LNA?Phosphoramidites，Synthesis6，802-808。

M.D. L. T.Bryld，A.E.

B.Verbeure，G.Gaubert，P，Herdewijn，J.Wengel(2002)α-L-ribo-configured?Locked?Nucleic?Acid(α-l-LNA)：Synthesisand?Properties，J.Am.Chem.Soc.，124，2164-2176。

S.K.Stngh，R.Kumar，J.Wengel(1998)Synthesis?of?Novel?Blcycio[2，2，1]Ribonucleosides：2'-Amino-and?2′-Thio-LNA?Monomeric?Nucleosides，J.Org.Chem.1998，63，6078-6079。

C.Rosenbohm，S.M.Christensen，M.D.

D.S.Pedersen，L.E.Larsen，J.Wengel，T.Koch(2003)Synthesis?of?2′-amino-LNA：a?new?strategy，Org.Blomol.Chem.1，655-663.D.S.Pedersen，T，Koch(2003)Analogues?of?LNA(Locked?Nucleic?Acid)。Synthesis?of?the?2′-Thio-LNA?Thymine?and?5-Methyl?Cytoslne?Phosphoramidites，Synthesis?4，578-582。

Embodiment 2: oligonucleotide is synthetic

Expedite 8900/MOSS synthesizer ( MUltiple 0Ligonucleotide SYnthesis SYstem) go up use phosphoramidite method, with the scale synthetic oligonucleotide of 1 μ mol or 15 μ mol.For more massive synthetic, use

Oligo Pilot.

When end of synthesis, (have DMT), at room temperature used ammoniacal liquor 1-2 hour, oligonucleotide under the cracking from the solid support, and at 65 ℃ of further deprotections 4 hours down.By this oligonucleotide of reversed-phase HPLC (RP-HPLC) purifying.After removing the DMT group, oligonucleotide characterizes by AE-HPLC, RP-HPLC and CGE, and further confirms molecular weight by ESI-MS.More details as follows.

The preparation of LNA-solid support:

The preparation of LNA succinyl-half ester

5 '-O-DMT-3 '-hydroxyl-LNA monomer (50Omg), succinyl oxide (1.2 equivalent) and DMAP (1.2 equivalent) are dissolved among the DCM (35m1).This reactant at room temperature stirs and spends the night.NaH with 0.1M ₂PO ₄, after pH 5.5 (2x) and salt solution (1x) extraction, use anhydrous Na ₂SO ₄Further dry organic layer filters and evaporation.Yield with 95% obtains this half ester derivatives, and it uses without being further purified promptly.

The preparation of LNA-upholder

The half ester derivatives (90 μ mol) of above preparation is dissolved among the minimum DMF, adds DIEA and pyBOP (90 μ mol) and also mixed 1 minute together.With the mixture of this preactivate and LCAA-CPG (

, 300mg) is manually mixing and stirring in the synthesizer in 80-120 order footpath.After following 1.5 hours of the room temperature, filter upholder, and wash with DMF, DCM and MeOH.After the drying, last sample is defined as 57 μ mol/g and (sees Tom Brown, Dorcas J.S.Brown.Modernmachine-aided methods of oligodeoxyribonucleotide synthesis.In:F.Eckstein compiles, Oligonucleotides and Analogues A PracticalApproach.Oxford:IRL Press, 1991:13-14).

The extension of oligonucleotide

By using 0.1M5 ' in the acetonitrile-amidite solution of O-DMT-protection and the DCI (4 in the acetonitrile; the 5-dicyano imidazole) (0.25M) as activator; carry out the coupling of phosphoramidite (A (bz), G (ibu), 5-methyl-C (bz)) or T-β-cyanoethyl-phosphoramidite.By using the xanthane muriate (at acetonitrile: the 0.01M in the pyridine 10%) carry out vulcanization reaction.Remaining reagent is those that use always during oligonucleotide synthesizes.The scheme that supplier provides is optimized suitably.

The RP-HPLC purifying

Post: Xterra RP ₁₈

Flow velocity: 3ml/min

Damping fluid: 0.1M ammonium acetate pH8 and acetonitrile

Abbreviation

DMT: dimethoxytrityl

DCI:4, the 5-dicyano imidazole

The DMAP:4-Dimethylamino pyridine

DCM: methylene dichloride

DMF: dimethyl formamide

THF: tetrahydrofuran (THF)

DIEA:N, the N-diisopropylethylamine

PyBOP: phosphofluoric acid benzotriazole-1-base-oxygen base-tripyrrole Wan Phosphonium

Bz: benzoyl

Ibu: isobutyryl

The design of embodiment 3:LNA oligonucleotide

Table 2-LNA oligonucleotide

SEQ ID NO. sequence and design design

In table 2, capitalization (not having subscript) is represented β-D-oxygen-LNA nucleotide analog (β-D-oxygen-LNA); But, the subscript of capitalization back " α " (G for example ^α) expression, the LNA nucleotide analog is α-L-LNA nucleotide analog (α-L-oxygen-LNA), lowercase is represented deoxynucleotide, subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/LNA nucleotide analog, and does not have subscript to represent phosphodiester bond between adjacent nucleotide/LNA nucleotide analog.All LNA-C monomers all be 5-methyl-C ( ^MeC).Use disclosed sequence (Genbank accession number NM_001168), compound be designed to the different zones of target people living protein rna,

The measurement of embodiment 4:Tm

The measurement of the melting temperature(Tm) of compound (Tm): with 3 μ M SEQ ID NO.2 at 10mM sodium phosphate/100mM NaCl/0.1nM EDTA, solution among the pH 7.0 and its complementary DNA/RNA (3 μ M, at 10mM sodium phosphate/100mM NaCl/0.1nM EDTA, among the pH 7.0) mixed 1 minute at 90 ℃, and be cooled to room temperature.Then, raise 1 ℃, temperature is increased to 95 ℃ from 25, determine the Tm of duplex by per minute.In the table 7 of embodiment 21, shown the Tm of SEQ ID NO.2.

The stability of embodiment 5:SEQ ID NO.2 in people and mice plasma

At 37 ℃, at the different time Along ent, 20 μ M SEQ ID NO.2 and SEQ ID NO.24 are at people and mice plasma (Lithium heparinate (Taconic, M﹠amp; B)) stability in: 0,1,2,4,24,48 and 96 hours.Also comprised commercial available ladder (on PAGE, can see 10 and 20 polymers) (referring to Fig. 1).

Embodiment 6: external model: cell cultures

Antisense compounds is to the influence of target nucleic acid expression, can be in the various kinds of cell type any in detect, condition is that target nucleic acid exists with measurable level.But target thing endogenous expression, or the instantaneous or stable transfection of the nucleic acid by the described nucleic acid of coding is expressed.

The expression level of target nucleic acid can use for example rna blot analysis, quantitative PCR, ribonuclease protecting test to determine routinely.For the example purpose provides following cell type, but other cell type also can use routinely, and condition is that the target thing is expressed in selected cell type.

Cell is cultivated in suitable culture medium as described below, and remains on 37 ℃, 95-98% humidity and 5%CO ₂In.Cell goes down to posterity 2-3 time weekly routinely.

15PC3: PC-3 15PC3 is by doctor F.Baas, NeurozintuigenLaboratory, and AMC, The Netherland is so kind as to give, and cultivates in DMEM (Sigma)+10% foetal calf serum (FBS)+Glutamax I+ gentamicin.

PC3: PC-3 PC3 is available from ATCC, and cultivation is in the F12Coon ' s that contains glutamine (Gibco)+10%FBS+ gentamicin.

518A2: human melanoma cancerous cell line 518A2 is by doctor B.Jansen, Section ofexperimental Oncology, Molecular Pharmacology, Department ofClinical Pharmacology, University of Vienna is so kind as to give, and cultivates in DMEM (Sigma)+10% foetal calf serum (FBS)+Glutamax I+ gentamicin.

Embodiment 7: external model: handle with antisense oligonucleotide

Cell cultures and transfection: with the 15PC3 cell inoculation in 12-porocyte culture plate, at 37 ℃ of (5%CO ₂), adding 10%FBS, growth is 2 days among the DMEM of Glutamax I and gentamicin.When cell 60-70% converges, use Lipofectamine 2000 (10 μ g/ml), with the oligonucleotide (0.2-25nM) of different concns in duplicate transfection they.Basically of (1994, JBC 269:16416-16424) such as Dean, carry out transfection.In brief, be used in the Lipofectamine incubation cell 10 minutes among the OptiMEM, add oligonucleotide subsequently to cumulative volume 0.5ml transfection mixture/hole.After 4 hours, remove transfection mixture, washed cell is in suitable growth medium, in 37 ℃ of growths about 20 hours (mRNA analysis) or 12-72 hour (analysis of protein).Then, harvested cell carries out albumen and RNA analysis.

Embodiment 8: external model: the extraction of RNA and cDNA are synthetic

Total RNA separates

Use RNeasy mini test kit (Qiagen), separate total RNA.Use the PBS washed cell, (RTL Qiagen) directly adds in the hand-hole with the cell lysis buffer solution of having added 1% mercaptoethanol.Behind the several minutes,, handle sample according to manufacturer's specification sheets.

Synthesizing of first chain

According to manufacturer's specification sheets (Qiagen), use OmniScript reversed transcriptive enzyme test kit to carry out the synthetic of first chain.To each sample, the total RNA of 0.5 μ g is adjusted to 12 μ l, and with 0.2 μ l many (dT) _12-18(0.5 μ g/ml) (Life Technologies), 2 μ l dNTP mixtures (every kind of 5mM), 2 μ l 10X RT damping fluids, 0.5 μ l RNAguard ^TMThe RNA enzyme inhibitors (33 units/ml, Amersham) and 1 μ l OmniScript reversed transcriptive enzyme mix, subsequently 37 ℃ of incubations 60 minutes, and 93 ℃ of hot deactivations 5 minutes.

Embodiment 9: external model: the oligonucleotide of expressing by PCR in real time analysis existence albumen, Bc1-2 or existence protein splice variants suppresses

In order to determine the relative existence protein mRNA level in the acid-treated and untreated cell of oligonucleoside, use iCycler from BioRad, in quantitative PCR analysis, use the cDNA that is produced.With 5 times of cDNA dilutions, getting 8 μ l mixes mutually with 52 μ l Taqman probe master mixtures, the latter is contained 30 μ l Platinum Quantitative PCRSuperMix UDG 2x PCR master mixtures (Invitrogen), 3 μ l 20x Taqman probes and primer mixture (forward primer: 5 ' AAGGACCACCGCATCTCTACA (SEQ IDNO:29), final concentration 0.9 μ M. reverse primer: 5 ' CCAAGTCTGGCTCGTTCTCAGT (SEQ ID NO:30), final concentration 0.6 μ M, with taqman probe: FAM-CGAGGCTGGCTTCATCCACTGCC-TAMRA (SEQ ID NO:31), final concentration 0.1 μ M) and 19 μ l H2O.60 μ l are distributed in 2 holes (96 hole flat board) each hole 25 μ l.For people Bc1-2, the PCR primer is:

Forward primer: 5 ' CATGTGTGTGGAGAGCGTCAA 3 ' (final concentration in the mensuration; 0.6 (SEQ ID NO:32) reverse primer: 5 ' GCCGGTTCAGGTACTCAGTCA 3 ' (final concentration in mensuration μ M); μ M) 0.6 (SEQ ID NO:33), the PCR probe is: 5 ' FAM-CCTGGTGGACAACATCGCCCTGT-TAMRA 3 ' (final concentration in the mensuration; μ M) 0.1 (SEQ ID NO:34).For existence protein splice variants PCR, primer and concentration below using.Splice variant 1 (fully) forward primer 5 '-GGCCGAGGCTGGCTTCAT-3 ' (SEQ the IDNO:35) (final concentration 0 in the mensuration, 6 μ M) reverse primer 5 '-TGCTTTTTATGTTCCTCTATGGG-3 ' (SEQ ID NO:36) (final concentration 0, the 6 μ M in the mensuration).Splice variant 2 (2B) forward primer 5 '-GGCCGAGGCTGGCTTCAT-3 ' (SEQ ID the NO:35) (final concentration 0 in the mensuration, 3M) reverse primer 5 '-AAGTGCTGGTATTACAGGCGT-S ' (SEQ ID NO:37) (final concentration 0, the 3 μ M in the mensuration).Splice variant 3 (Δ Ex3) forward primer 5 '-GGCCGAGGCTGGCTTCAT-3 ' (SEQ ID NO:35) (final concentration 0, the 3 μ M in the mensuration) reverse primer 5 '-ATTGTTGGTTTCCTTTGCATG-S ' (SEQ ID NO:38) (the final concentration 0.3 μ M in the mensuration).Taqman probe 5 '-FAM-CACTGCCCCACTGAGAACGAGCCAGACT-TAMRA-3 ' (SEQ ID NO:39) (the final concentration 0.1 μ M in the mensuration).

Primer and probe are available from Proligonucleotide (France).In order to make any variance criteriaization in the specimen preparation,, use Taqman mensuration reagent (4310884E), quantitative endogenous GAPDH mRNA from the pre-exploitation of AppliedBiosystems according to manufacturer's specification sheets.Use is from 2 times of diluents of untreated 15PC 3 cells (expressing existence albumen and GAPDH) synthetic cDNA, the typical curve of formation determination.The PCR program is as follows: 50 ℃ are carried out 2min, and 95 ℃ are carried out 10min, then 40 95 ℃ 15 seconds, the circulation of 60 ℃ of 1 min.Use iCycler iQ real-time detecting system software, determine the relative quantity of existence protein mRNA from the threshold values circulation of calculating.Referring to Fig. 6 B, 6C, 9 and 2C.

Embodiment 10: analyzed in vitro: the western blot analysis of existence protein level

Western blot:

By Western blot, determine of the external influence of existence albumen oligomer to existence protein level in the cells transfected.

Harvested cell, cracking in the 50mMTris-HCl pH 6.8,10% glycerine, 2.5%SDS, 5mM DTT and the 6M urea that have added protease inhibitor cocktail (Roche).Use BCA protein determination kit (Pierce), measure total protein concentration.According to manufacturer's specification sheets (Invitrogen), on the 12%Bis-Tris gel in the MOPS damping fluid, run 50 μ g total proteins, and trace is to pvdf membrane.After in sealing damping fluid (having added the PBS-T of 5% low fat milk powder), being incubated overnight, with film with polyclone anti--1: 500 diluent of existence protein antibodies Novus500-201 is incubated overnight, then with 1: 1000 diluent incubation of anti--Bcl (DAKO) 1 hour.Then with film with two anti-(two anti-or the antibody that AP puts together that the HRP of dilution in 1: 1000 puts together) incubation from Invitrogen from DAKO, and use color development immunity detection reagent (Invitrogen) or chemoluminescence ECL ⁺Detection kit (Amersham) manifests existence albumen and Bcl2.Referring to Fig. 2 A.

Embodiment 11: analyzed in vitro: the elisa assay of existence protein level

The cell of cracking results, and, use R﹠amp according to manufacturer's recommendation; D Systems people living protein D uoSet IC ELISA (catalog number (Cat.No.) DYC647) measures existence albumen.Referring to Fig. 2 B.

Embodiment 12: analyzed in vitro: use the Antisense Suppression of antisense oligonucleotide to the people living protein expression

According to the present invention, use disclosed sequence (GenBank accession number NM_001168), designed the oligonucleotide of the different zones of a series of target people living protein rnas.Referring to table 2-LNA oligonucleotide.

Estimate the LNA oligonucleotide and in the 15PC3 cell, knock down the potentiality of (knockdown) existence protein mRNA.With data representation is to regulate per-cent with respect to the decrement of simulation cells transfected.By PCR in real time monitoring transcript steady state, and with respect to the stdn of GAPDH transcript steady state, referring to table 3.Notice that all LNA C are 5-methyl-cytosine(Cyt)s.

Table 3

Few thing 4-8-3-1 design	Few thing 4-8-4 design	IC ₅₀[nM]	IC ₇₅[nM]
				SEQ?ID?NO.23	2.5(0.5)	6.2(1.6)
SEQ?ID?NO.2		2.9(0.4)	4.8(0.3)

Experiment is carried out 3 times at least.Numeral in the bracket is a standard deviation.

Embodiment 13: the apoptosis-inducing of antisense LNA oligonucleotide and propagation suppress

The cultivation of cell: at 37 ℃, 95% humidity and 5%CO ₂, in the DMEM that contains 10% foetal calf serum, Glutamax I and gentamicin (Sigma), cultivate 15PC3.At 37 ℃, 95% humidity and 5%CO ₂, cultivating cervical cancer cell in the MEM that contains 10% foetal calf serum, Glutamax I and gentamicin (Sigma) is HeLa.When reaching 60-70% and converge, use Lipofectamine 2000 (5 μ g/ml) transfectional cell.

Activated caspase 3/7 active measurement

Transfection day before yesterday, the 15PC3 cell is seeded among the DMEM in white 96 orifice plates (Nunc 136101) with the density of 10000 cells in every hole.Next day, washed cell once adds the OptiMEM that 72 μ l contain 5 μ g/ml Lipofectamine 2000 (Invitrogen) subsequently in the OptiMEM of preheating.The cell incubation after 7 minutes, is added the oligonucleotide that 18 μ l dilute in OptiMEM.Final oligonucleotide concentration is in 0.2nM arrives the scope of 100nM.Handle after 4 hours, cell is washed in OptiMEM, and add the DMEM that 100 μ l contain serum.After the oligonucleotide processing, make the specified time of cellular-restoring, then from CO ₂Incubator takes out them, and balance is to room temperature 15min.100 μ l extremely sensitive caspase 3/7-GloTM reagent (Promega) are directly added to cell, and with dull and stereotyped incubation 20min.Record luminous (luciferase activity) in Luminoskan Ascent device (Thermo Labsystems).Luciferase activity is measured as the relative light unit (RLU/s) of per second.Use Ascent software 2.4.2, analytical data.Use MS Excel, generate and induce multiple figure with respect to mock.

By with caspase 3/7 inhibitor incubation cells transfected, confirm caspase 3/7 specificity of apoptosis reaction.The cell of staurosporine, camptothecine or taxol induced is as positive control (referring to Fig. 3,6A and table 4 add embodiment 21).

Behind the table 4-transfection 15PC3 cell 24 hours, the caspase 3/7 of cells transfected was measured

Caspase 3/7 is measured	Oligonucleotide	The apoptotic multiple of inducing
			Induce multiple (24 hours, 5nM)	SEQ?ID?NO.2 SEQ?ID?NO.24	3.5x 1.5x
Maximum is induced multiple (concentration, time)	SEQ?ID?NO.2 SEQ?ID?NO.24	(6.9x 25nM, 48 hours) 3.1x (100nM, 48 hours)

Annexin V-FITC flow cytometry

Transfection day before yesterday is with 0.4 * 10 ⁶The HeLa cell inoculation advances the T25 flask.On the same day of transfection, washed cell once adds the OptiMEM that 2.8ml contains 5 μ g/mlLipofectamine 2000 (Invitrogen) subsequently in 37 ℃ of OptiMEM.The cell incubation after 7 minutes, is added the oligonucleotide that 700 μ l dilute, to final concentration 5nM or 25nM in OptiMEM.The simulation cells transfected is with comparing.Handle after 4 hours, cell is washed in OptiMEM, and add the 3ml substratum.After the oligonucleotide processing, made cellular-restoring 48 hours, obtain them by scraping to get then, and in PBS, wash 2 times.With 0.2 * 10 ⁶Cell with 5 μ l annexin V-FITC and 10 μ l propidium iodides (PI-10mg/ml) at room temperature, incubation 15min in the dark.Reorganization annexin V incubation cells transfected with purifying adds annexin V-FITC then, confirms painted specificity and selectivity.In addition, use TRAIL (Apo2L) inductive HeLA cell (0.5 μ g/ml) as positive control (referring to Fig. 4).

Use MTS to measure the viable cell of measuring propagation

Transfection day before yesterday, cell is seeded among the DMEM in transparent 96 orifice plates (Scientific Orange no.1472030100) with the density of 10000 cells in every hole.Next day, washed cell once adds the OptiMEM that 72 μ l contain 5 μ g/mlLipofectamine 2000 (Invitrogen) subsequently in the OptiMEM of preheating.The cell incubation after 7 minutes, is added the oligonucleotide that 18 μ l dilute in OptiMEM.Final oligonucleotide concentration is in 5nM arrives the scope of 100nM.Handle after 4 hours, cell is washed in OptiMEM, and add the DMEM that 100 μ l contain serum.After the oligonucleotide processing, make the specified time of cellular-restoring, by adding 20 μ l tetrazole compounds [3-(4,5-dimethyl-2-yl)-5-(3-carboxymethoxyl phenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] and electron coupling reagent (azophenlyene sulfovinic acid, PES; CellTiter

AQueous One Solution CellProliferation Assay Promega), measures viable cell.In Powerwave (BiotekInstruments), measure viable cell at 490nm and 650nm.

With respect to mock (being set at 100%),, draw figure to inhibition Δ OD (the 490-650nm)/h of growth velocity at oligonucleotide concentration.Observed maximum inhibition to propagation is 70% (minimum 30%) in MTS measures.(table 5 and Fig. 5).

The propagation of the 15PC3 cell of table 5-oligonucleotide transfection suppresses

MTS surveys	Oligonucleotide	Inhibition of proliferation
			IC ₅₀(48 hours)	SEQ?ID?NO.2 SEQ?ID?NO.24	4.9nM 86.9nM

Embodiment 14: with the apoptosis-inducing of the combined SEQ ID NO.2 of taxol

Cell cultures: human prostata cancer 15PC3 cell (by Dr.F Baas, Neurozintuigen Laboratory, AMC, The Nether lands generosity provides) is inoculated in the T75-flask, reaches 8 * 10 ⁵The density of cell, and at 37 ℃ and 5%CO ₂In, growth is 2 days in the DMEM that has added 10%FBS, Glutamax and gentamicin.Inoculate back 2 days, using final concentration is the Lipofectami ne of 7.5 μ g/ml, with 2-10nM SEQ ID NO.2 transfectional cell.Of (1994, JBC 269p.1641616424) such as Dean, carry out transfection.In brief, be used in the Lipofectamine incubation cell 7-10min that dilutes among the Opt iMEM, add oligonucleotide subsequently to cumulative volume 8.7ml/T75 flask.After the transfection 4 hours, washed cell in OptiMEM was adding or is not adding in the complete growth medium of 2-100nM taxol (Sigma Aldrich), 37 ℃ of growths 12-96 hour.Harvested cell carries out that mRNA extracts, caspase 3/7 is measured, or fixing, with PI dyeing and pass through facs analysis.

Caspase 3/7 is measured: by the centrifugal specified time, and the 15PC3 cell of results equivalent, from 2500 to 10000 cells, and plating is in the DMEM of white 96 hole flat boards (Nunc 136101).With the extremely sensitive caspase 3/7-Glo of 100 μ l ^TMReagent (Promega) directly adds to the cell in 96 holes, and with dull and stereotyped incubation 1 hour, and after postponing 1 minute in addition, in Luminoskan Ascent device (Thermo Labsystems), write down luminous (luciferase activity).Luciferase activity is measured as the relative light unit (RLU/s) of per second.Use Ascent software 2.4.2, processing data, and in Excel is set up and is induced multiple figure with respect to mock.By with caspase 3/7 inhibitor (it can block activated caspase 3/7 activity) incubation cells transfected, confirm the specificity of apoptosis reaction.In addition, the cell of staurosporine, camptothecine or taxol induced is as positive control.Referring to Fig. 6.

Embodiment 15: with cell cycle analysis cell cultures and the transfection of the combined SEQ ID NO.2 of taxol: identical with embodiment 13.

Immobilization and PI dyeing: washed cell in PBS, results, and be suspended in the ice-cold PBS of 100 μ l again.Add 900 μ l ice-cold 70%, with immobilized cell be deposited in-20 ℃ standby.

Gather in the crops immobilized cell, and be suspended in 700 μ l PBS (room temperature) again.Add 300 μ l phosphoric acid salt-citrate buffer solution (0.19M Na ₂PO ₄, 4mM citric acid pH 7.8), at room temperature incubation cell 5min.Harvested cell once more, incubation 30min in PI dyeing solution (0.2% (v/v) Triton-X-100 is in PBS pH 7.4 for 1mg/ml RNA enzyme A, 33mg/ml propidium iodide).

Use Becton Dickinson FACS Calibur, carry out facs analysis.

The 15PC3 cellular exposure of SEQ ID NO.2 transfection in the taxol of different concns, and is analyzed (Fig. 7 a-c) by propidium iodide dyeing and facs analysis subsequently.This mensuration has also confirmed the additive effect of SEQ ID NO.2 and taxol, and the cell of increasing amount is trapped in G2 or even G4 phase.Referring to Fig. 7 A and 7B and embodiment 21.

Embodiment 16: the body inner model: by handling with antisense oligonucleotide, the tumor growth of the human tumor cells of growing in the body is suppressed

Model: at the 0th day, (ECACC) mixed mutually with Matrigel with the PC-3 Human Prostate Cancer Cells, and two side of body sides of female Balb/cA-nu mouse are advanced in subcutaneous injection.

Administration: according to the salt brine solution of the SEQ ID NO.2 of scheme, 2mg/ml working solution, administration volume 10ml/kg; In clinical preparation, use taxol.At the 0th day, according to the average group body weight, to animals administer.

Use: oligonucleotide is that intraperitoneal ground (referring to Fig. 8) or tumour are used (referring to Fig. 9) interiorly, taxol be intravenously use, all according to scheme.

Observe: mortality ratio (every day), body weight (2 times weekly),

Gross tumor volume: in experimentation, measure gross tumor volume weekly 2 times, and according to formula (LxD ²* 0.5) calculate, wherein L represents maximum diameter, and D is and the vertical diameter of tumor of L (mm).

Anti-tumor activity: with the average tumor weight of the tumour of control group contrast treatment.

Research finishes: by the neck dislocation, put to death animal.Weighing tumour, liver and spleen.

Tumor analysis

Total RNA separates: added in the RTL damping fluid (Qiagen) of 1% mercaptoethanol the about 20mg tumor tissues of homogenate at 400 μ l.According to manufacturer's specification sheets, use RNeasy mini test kit (Qiagen), separate total RNA.

CDNA is synthetic: according to manufacturer's specification sheets (Qiagen), use OmniScript reversed transcriptive enzyme test kit to carry out the synthetic of first chain.To each sample, the total RNA of 0.5 μ g is adjusted to 12 μ l, and with 0.2 μ l many (dT) _12-18(0.5 μ g/ μ l) (LifeTechnologies), 2 μ l dNTP mixtures (every kind of 5mM), 2 μ l 10X RT damping fluids, 0.5 μ l RNAguard ^TMThe RNA enzyme inhibitors (33 units/ml, Amersham) and 1 μ lOmniScript reversed transcriptive enzyme mix, subsequently 37 ℃ of incubations 60 minutes, and 93 ℃ of hot deactivations 5 minutes.

Administration in the tumour: through 2 weeks, use 25mg/kg SEQ ID NO.2 or salt solution 6 times (50 μ l volume).Took a sample in 24 hours after the administration the last time.With respect to 8 tumours (salt solution), the mRNA level is set up expression level with 9 tumours (SEQID NO.2).By Western blot, analyze the protein level (referring to Fig. 9) of each tumour.

PCR in real time is analyzed: for determine to handle with untreated tumour in relative existence protein mRNA level, use iCycler from BioRad, in quantitative PCR analysis, use the cDNA that produces.With 5 times of cDNA dilutions, getting 8 μ l mixes mutually with 52 μ l Taqman probe master mixtures, the latter is contained 30 μ l Platinum Quantitative PCRSuperMix UDG 2x PCR master mixtures (Invitrogen), 3 μ l 20x Taqman probes and primer mixture (forward primer: 5 ' AAGGACCACCGCATCTCTACA (SEQ IDNO:29), final concentration 0.9 μ M. reverse primer: 5 ' CCAAGTCTGGCTCGTTCTCAGT (SEQ ID NO:30), final concentration 0.6 μ M and t aqman probe: FAM-CGAGGCTGGCTTCATCCACTGCC-TAMRA-3 ' (SEQ ID NO:31), final concentration 0.1 μ M) and 19 μ l H ₂O.60 μ l are distributed in 2 holes (96 hole flat board) each hole 25 μ l.Primer and probe are available from Proligonucleotide (France).In order to make any variance criteriaization in the specimen preparation,, use Taqman mensuration reagent (4310884E), quantitative endogenous GAPDH mRNA from the pre-exploitation of Applied Biosystems according to manufacturer's specification sheets.Use is from 2 times of diluents of untreated 15PC3 cell (expressing existence albumen and GAPDH) synthetic cDNA, the typical curve of formation determination.The PCR program is as follows: 50 ℃ are carried out 2min, and 95 ℃ are carried out 10min, then 40 95 ℃ 15 seconds, the circulation of 60 ℃ of 1min.Use iCycler iQ real-time detecting system software, determine the relative quantity of existence protein mRNA from the threshold values circulation of calculating.Referring to Fig. 9.

Total protein separates and Western blot: in the 50mM Tris-HCl pH 6.8,10% glycerine, 2.5%SDS, 5mM DTT and the 6M urea that have added protease inhibitor cocktail (Roche), use the about 50mg tumor tissues of Retsch refiner homogenization.Use BCA protein determination kit (Pierce), measure total protein concentration.According to manufacturer's specification sheets (Invitrogen), on the 12%Bis-Tris gel in the MOPS damping fluid, run 50 μ g total proteins, and trace is to pvdf membrane.After in sealing damping fluid (having added the PBS-T of 5% low fat milk powder), being incubated overnight, with film with polyclone anti--1: 500 diluent of existence protein antibodies Novus 500-201 is incubated overnight, then with 1: 1000 diluent incubation of anti--Bcl (DAKO) 1 hour.Then with film with two anti-(two anti-or the antibody that AP puts together that the HRP of dilution in 1: 1000 puts together) incubation from Invitrogen from DAKO, and use color development immunity detection reagent (Invitrogen) or chemoluminescence ECL ⁺Detection kit (Amersham) is observed existence albumen and Bcl2.Referring to Fig. 9.

Embodiment 17: existence albumen antisense oligonucleotide and the external combination of radiating

There is more and more evidences to confirm the proteic association of crossing between expression and the radiation tolerance of apoptosis inhibitor albumen (IAP) existence in the scientific literature.And shown that the proteic decrement of surviving is adjusted in the external radiosensitization that causes cancerous cell line.

With the melanoma cell series JR8 of the construct transfection stably of ribozyme expression (its target existence albumen) and the transfection of M14, the proteic 50-60% decrement that causes surviving is regulated, activate and the dye apoptosis of the increase that records of propidium iodide by caspase 3, and by producing clone's mensuration (Pennati etc., 2003; J.Invest.Dermatol.120,648-54) increase of the variation of viability assessment to γ-radiating susceptibility.

In colorectal cancer cell system, clear and definite association (Rodel etc., 2003 between verified existence protein expression level and the radiosensitivity; Int.J.Radiation OncologyBiol.Phys.55,1341-47).SW 480 cells with minimum radiosensitivity show existence the highest proteic spontaneous expression.In fact, behind irradiation SW480 cell 48 hours, existence albumen even incremental adjustments.On the contrary, in the most radiosensitive clone SW48, the existence protein expression is low in untreated cell, and does not increase behind irradiation.

Cross express recombinant and survive the radiosensitivity of proteic pancreas MIAPaCa-2 cancer cells not as unconverted cell.On the contrary, the pancreatic cancer cell of radiation tolerance is Panc-1, when transforming with the negative existence of dominance protein mutant, can increase radiosensitivity and caspase 3 activity (Asanuma etc., 2002; Jpn.J.Cancer Res.93,1057-62).

Handle lung cancer cell line H460 with existence albumen antisense oligonucleotide, in cell survival (Lu etc., 2004 of external reduction through the H460 of irradiation cell; Cancer Research 64,2840-45).In vivo, the delay of the tumor growth of the H460 heterograft in the nude mice of using existence albumen antisense oligonucleotide and irradiation combined treatment is greater than (Cao etc., 2004 in the mouse with independent oligonucleotide or radiation treatment; Oncogene 23,7047-52).

These data clearly illustrate that existence albumen plays an important role in radiation tolerance, and the proteic decrement of surviving is regulated the treatment benefit that can cause in the cancer field of radiation therapy.Cancer cells is to the sensitization of radiotherapy, can cause the radiation dose that reduces, thereby reduce severe side effect, even increase effect.

By with oligonucleotide transfection various clones, comprise U87 and U373 cell (glioblastoma), H460 (NSCLC) and LS 174T (colorectal carcinoma) cell, subsequently radiation treatment they, can realize the combination of SEQ ID NO.2 and irradiation.Effect will be compared with the simulation cells transfected of accepting the identical treatment scheme, and the latter will show independent radiating effect.Behind the irradiation, use MTT and produce clone's mensuration, the viability of analysis of cells.Measure and Hoechst dyeing by caspase 3 activity measurements, TUNEL, estimate apoptosis.

Embodiment 18: combination in the body of survive in the subcutaneous U87 glioblastoma heterograft in the nude mice albumen antisense oligonucleotide SEQ ID NO.2 and fractionated radiotherapy

With 2 * 10 ⁶The U87 injection cell of growth in vitro advances the right side side of body side of 6-7 male NMRI nu/nu mouse in age in week.When tumour has reached 200mm ³Mean size the time, with SEQ ID NO.2, negative control oligonucleotide SEQ ID NO.24 or 0.9%NaCl (salt solution) intraperitoneal ground processing animal.Salt brine solution injection oligonucleotide with 20mg/kg/ treatment sky.

Comprise following group under study for action, every group comprises 8 mouse.

1.0.9%NaC l intraperitoneal ground

2.SEQ ID NO.2 intraperitoneal ground

3.SEQ ID NO.24 intraperitoneal ground

4.SEQ ID NO.2 intraperitoneal ground+radiotherapy

5.SEQ ID NO.24 intraperitoneal ground+radiotherapy

6.0.9%NaCl intraperitoneal ground+radiotherapy.

According to following treatment plan, at 4 days, be divided into 4 parts, with the single dose of 3 gray(Gy)s, use to front and back radiotherapy, as two relative side fields.In radiation therapy process, with ketamine and xylazine anesthetized animal.The animal of radiotherapy is not accepted in anesthesia in an identical manner.

The treatment sky	1	2	3	4	5	6	7	8	9
										The intraperitoneal treatment	×	×	×	×	×	×
Radiotherapy			×	×	×	×

Use calipers, by two vertical measurement (d ₁And d ₂) determine tumor growth.Calculate gross tumor volume [V (t)] according to following formula:

V(t)＝0.35(d ₁(t)×d ₂(t)) ^3/2

Measure tumor growth, reach 1000mm up to tumour ³Size.

When the treatment beginning, measure the body weight of all animals, measure once weekly then.

Embodiment 19: the clinical preceding GLP toxicity research that carries out SEQ ID NO.2 in rodent and stump-tailed macaque

About SEQ ID NO.2, inter alia, before clinical, found following result in the toxicity research:

In mouse vein, in the studies on acute toxicity, find that maximum non-lethal dose is 1000mg/kg.

In rat vein, in the studies on acute toxicity, find that minimum lethal dose (MLD) is 1000mg/kg.

In stump-tailed macaque intravenously MTD research, do not find significant clinical indication, still the evidence of liver and renal toxicity is obvious in all animals.With the dosage escalation design,,, handle animal with maximal dose 160mg/kg * 3 (total dose is 930mg/kg) or 120mg/kg * 5 through 2 weeks.

In stump-tailed macaque intravenously 4 all repeated doses toxicity research, with 0,6,15 and the dosage of 60mg/kg/ time (occasion) use SEQ ID NO.2,2 times weekly, continued for 4 weeks.Accept 0,15 or 60mg/kg/ time animal groups in, to the decubation of some animal tracking 4 all non-processor.

The quick freezing tissue comprises liver and kidney sample, and is deposited in-70 ℃, is used for subsequent analysis.

Embodiment 20: the oligonucleotide content in the stump-tailed macaque tissue

Specimen preparation: liver and nephridial tissue are extracted

Chemical substance/reagent:

Proteinase K (25.1mg/ml): Sigma P4850

Phenol-chloroform-primary isoamyl alcohol (25: 24: 1 (v/v/v) uses 10mM Tris, pH:8.0, and 1mM EDTA is saturated: Sigma P2069

Igepal?CA-630：Sigma，I8896.

Extract damping fluid: 0.5%Igepal CA-630,25mM Tris pH 8.0,25mMEDTA, 100mM NaCl, pH 8.0 (regulating) with 1 N NaOH.

The Proteinase K of 1mg/ml in extracting damping fluid: preparation before each the extraction.Weighing tissue (about 100mg) (before weighing and afterwards, tissue is deposited on the dry ice).Add 500 μ l and contain the extraction damping fluid of Proteinase K (1mg/ml).Mechanically the homogenate tissue is incubated overnight homogenate at 37 ℃.

By with suitable concentration range, SEQ ID NO.2 is dissolved in the extraction damping fluid, preparation is with reference to sample.Accurately weighing 100mg is from the hepatic tissue of untreated animal (before weighing and afterwards, be deposited on the dry ice).The extraction damping fluid that will contain object of reference (contains Proteinase K, 1mg/ml) adds tissue sample, to cumulative volume 0.5ml.Mechanically the homogenate tissue is incubated overnight homogenate at 37 ℃.Use SEQ ID NO.2 detection signal from these samples, the preparation standard curve, it is encompassed in the minimum and maximum concentration of finding in the animal of processing.

Tissue sample is transferred to 2ml microminiature tube with nut.Add 1ml phenol-chloroform-primary isoamyl alcohol (25: 24: 1 (v/v/v)), acutely shake 5min.By at the centrifugal 15min of 4000RPM, realize being separated.Water (top phase) is transferred to new test tube (being applicable to vaporizer), add 500 μ l Milli-Q-H to organic phase (resistates that extracts for the first time) ₂O.Vigorous stirring test tube 5min once more is then in the centrifugal 15min of 4000RPM (SAN039 is in Room 115).Merge water (extracting and the waters of washing), and be evaporated to dried (80 ℃, under nitrogen) from 1..With the resistates reprovision in 200 μ l Milli-Q-water, at the centrifugal 15min of 4000RPM.Sample transfer in the HPLC-bottle, is used for analyzing.

The HPLC of oligonucleotide analyzes in liver and the nephridial tissue: after extraction, analyze SEQ ID NO.2 by ion-exchange HPLC:

Post: Dionex, DNA pac PA 100:2 * 50mm (protection), 2 * 250mm (analysis).

Column temperature: 42 ℃.

Volume injected: 50 μ l.

Cleaning solvent: Milli-Q-H ₂O.

Detect: UV, 260nm.

Solvent:

Buffer A: 1mM EDTA, 20mM TRIS-Cl, 10mM NaClO ₄, pH:7.6 (1 N NaOH)

Buffer B: 1mM EDTA, 20mM TRIS-Cl, 1 M NaClO ₄, pH:7.6 (1N NaOH)

Referring to Figure 10 A and 10B

Embodiment 21: the result sums up

Table 7

	?SEQ?ID?NO.2	SEQ?ID?NO.23	SEQ?ID?NO.22	?SEQ?ID?NO.21
					Size (seeing Table 2)	The 16-aggressiveness	The 16-aggressiveness	The 16-aggressiveness	The 18-aggressiveness
Design	?4-8-3-1	4-8-4	4-8-3-1	?4-10-4
					Apoptosis is at 5nM, 24 hours (see figure 3)s	3.5 doubly	2 times	Non-activity	Non-activity
Maximum cell apoptosis (see figure 3)	6.5 doubly save (25nM, 24 hours	Doubly 5.5 (25nM, 48 hours)	Doubly 2.5 (25nM, 48 hours)	Doubly 2.5 (25nM, 48 hours)
					Propagation IC50 (48 hours, the nM (see figure 5)	?5.0	n.d.	25	?25
Cell cycle arrest G2/M G1: G2 (24 hours) 0nM 2nM 2nM+10nM taxol (seeing Fig. 7 A and B)	?1∶0.25?1∶1?1∶3	n.d.	n.d.	?n.d.
					Tm (℃) complementary RNA	?75.3	n.d.	n.d.	?62.7

SEQ ID NO.2 causes the decrement of Bc1-2 to be regulated, and this does not find in negative control.

Claims

1. pharmaceutical composition, it is included in taxol and LNA oligonucleotide in pharmaceutically acceptable carrier, and the sequence of described LNA oligonucleotide is:

5′- ^MeC _sT _s ^MeC _sA _sa _st _sc _sc _sa _st _sg _sg _s ^MeC _sA _sG _sc-3′(SEQ?ID?NO.2)，

Wherein capitalization is represented β-D-oxygen-LNA, and lowercase is represented deoxynucleotide, and subscript " s " is represented the phosphorothioate bond between adjacent nucleotide/β-D-oxygen-LNA, and

Mol ratio in the wherein said composition between taxol and the LNA oligonucleotide is in 1: 1 to 10: 1 scope.

2. composition according to claim 1, the mol ratio between wherein said taxol and the LNA oligonucleotide is 1: 1.

3. composition according to claim 1, the mol ratio between wherein said taxol and the LNA oligonucleotide is 10: 1.

4. according to the composition of claim 1, wherein said pharmaceutically acceptable carrier is an aqueous carrier, and described aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.

5. pharmaceutical composition, it is included in taxol and conjugate in pharmaceutically acceptable carrier, described conjugate partly is made up of LNA oligonucleotide and at least one non-nucleotide/non-polynucleotide that are covalently bound on the described oligonucleotide, and the sequence of described LNA oligonucleotide is:

Mol ratio in the wherein said composition between the LNA oligonucleotide of taxol and the conjugate part is in 1: 1 to 10: 1 scope.

6. according to the composition of claim 5, wherein said pharmaceutically acceptable carrier is an aqueous carrier, and described aqueous carrier comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.

The composition that defines in each of claim 1-6 the preparation treatment suffer from or cancer-prone mammiferous medicine in application.

8. application according to claim 7, wherein said cancer is selected from: acute myelocytic leukemia, diffusivity B cell lymphoma, acute lymphoblastic leukemia, liver cancer, kidney, urinary tract cancer, and colorectal carcinoma.

9. according to the application described in claim 7 or 8, wherein said Mammals is behaved.

10. test kit, it comprises

(a) first kind of component, its contain one or more injection solution dosage claim 1 definition the LNA oligonucleotide and

(b) second kind of component, it contains one or more injection solutions of taxol; And

The mol ratio of the LNA oligonucleotide in the solution dosage of the taxol in a kind of solution of wherein said second kind of component and first kind of component is in 1: 1 to 10: 1 scope, and

The injection solution dosage of wherein said LNA oligonucleotide comprises and is used for pH is maintained buffer reagent in the 4.0-8.5 scope, and has the ionic strength of 20-2000mM.

11. according to the test kit of claim 10, wherein said LNA oligonucleotide comprises that also at least one is covalently bound to the non-nucleotide/non-polynucleotide part on it.

12. test kit according to claim 11, the mol ratio between wherein said taxol and the LNA oligonucleotide is 1: 1.

13. test kit according to claim 11, the mol ratio between wherein said taxol and the LNA oligonucleotide is 10: 1.