CN101057857B - Composition for preventing and improving Parkinson disease and its preparation method - Google Patents
Composition for preventing and improving Parkinson disease and its preparation method Download PDFInfo
- Publication number
- CN101057857B CN101057857B CN2006100259079A CN200610025907A CN101057857B CN 101057857 B CN101057857 B CN 101057857B CN 2006100259079 A CN2006100259079 A CN 2006100259079A CN 200610025907 A CN200610025907 A CN 200610025907A CN 101057857 B CN101057857 B CN 101057857B
- Authority
- CN
- China
- Prior art keywords
- weight portion
- vitamin
- alcar
- compositions
- fruit bat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a combination of vitamin B group, which can effectively improve paralysis agitans. The invention also discloses the combination of LA and ALCAR with low dosage, which can effectively inhibit disorder of mitochondria function caused by elliptone, the expression level of synapse I and ubiquitin is increased, the oxidation injury is increased and anti-oxidation GSH level is reduced. The invention also discloses a mitochondria nutrescin compound, combined with low-concentration LA and ALCAR and vitamin B, and is more effective for paralysis agitans prevention and treatment.
Description
Technical field
The present invention relates to the neurodegenerative diseases field, relate in particular to the prevention and the improvement of Parkinson's disease.
Background technology
The pathomechanism of Parkinson's disease (PD) is many-sided.From dopamine (DA) metabolism, the minimizing of DA is the important step that PD takes place in the DA neuron, and its anabolic rate-limiting enzyme---tyrosine hydroxylase (TH) needs tetrahydropteridine and O
2, Fe
2+Deng the fellowship of cofactor, and TH is active and content is all lower; DOPA decarboxylase (DDC) is its prothetic group with pyridoxal 5-phosphate then, and in addition, the effect of free radical is the another kind of mechanism that PD produces, and oxidation very easily takes place dopamine itself, in vivo (Fe under the monoamine oxidase, MAO effect
3+Participate in) generation H
2O
2And O
2+, when body was in oxidative stress status, it is not normal that metabolism just takes place DA, becomes the endogenous toxin, simultaneously, and Fe
2+/ Fe
3+Participate in forming neural melanin, functional defect appears in catalase and glutathione peroxidase with free radical scavenging function, further suppresses mitochondrion NADH electrontransport resplratory chain, and the activity of blocking-up composite I causes the accumulation of free radical, on the other hand, and Fe
2+Variation will have influence on the synthetic of heme in the mitochondrion, cause the dysfunction of composite I V, mitochondrial damage is further aggravated, not only normal tricarboxylic acid cycle process can't be carried out, and finally makes the DA neuronal death.
No matter it is by poisonous substance MPTP or the Parkinson's disease (PD) that is caused by gene damage, all relevant with oxidative damage (Betarbet et al., 2002 that ever-increasing evidence has demonstrated; Ebadi etal., 1996; Kondo, 1996; Schapira et al., 1990).At present, adopt the method treatment PD of opposing oxidative damage and protection striatum dopamine (DA) serotonergic neuron mostly, for example: with Mazindol blocking-up DA receptor; With Dizocilpin maleate sealing nmda receptor; Strengthen neuronic survival rate by giving brain derived neurotrophic factor; For example V is provided
E, V
CDeng polyphenoils; Or suppress monoamine oxidase, MAO with Selegiline.Yet all these methods are because all have a side effect, and very ineffective.
Mitochondrion is that the source of oxidant also is the object of its attack simultaneously, and the effect that the decline of mitochondrion antioxidant and metabolite level thereof might injured nerve cell anti-oxidative defense mechanism causes neurodegenerative diseases such as senile dementia (AD), PD.
VB5, VB6, VB11, VB12 do the time spent separately and have certain effect for the improvement and the life-time dilatation of PD fruit bat motor capacity, but can't reach motor capacity and all very effective effect of life-span, even can run into the antipodal phenomenon of the effect of the two.
Data shows, diet to old rat adds acetyl-L-carnitine (ALCAR) and/or R-thioctic acid (LA), can improve the mitochondrion apoptosis that increases along with aging, reduces the oxidative damage degree that mitochondrion suffered, and the consciousness of enhancing senile rat, and motion vigor.And report that with ALCAR and LA coupling, improving aspect the mitochondrion apoptosis of senile rat more effectively than single use, the ALCAR of use in conjunction and LA consumption are big, and think that the big more effect of consumption is good more.
Therefore, this area presses for provides a kind of compositions, and its used dosage is little, safe, can more effectively suppress mitochondrial oxidative damage simultaneously, thereby prevents, treats and improve Parkinson's disease.
Summary of the invention
The present invention aims to provide a kind of compositions, and its production and use.
Aspect first, provide a kind of compositions of the present invention, it contains two kinds or multiple (as the 2-12 kind) chondriosome nutrient, and perhaps described compositions is made of two kinds or multiple (as the 2-12 kind) chondriosome nutrient.
In another preference, described chondriosome nutrient is selected from down group: R-thioctic acid, acetylcarnitine, vitamin B5, vitamin B6, VB11, vitamin B12, coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin or creatine.
In another preference, described compositions contains:
(a) vitamin B12;
(b) one or more are selected from down the vitamin B group of group: vitamin B5, vitamin B6, VB11.
In another preference, above-mentioned component (b) is a vitamin B5; Perhaps above-mentioned component (b) is vitamin B5 and vitamin B6.
In another preference, above-mentioned component (b) comprises vitamin B5, vitamin B6 and three kinds of vitamin B group of VB11 simultaneously.
In another preference, above-mentioned compositions also contains
(c) one or more are selected from down the chondriosome nutrient of group: R-thioctic acid or acetylcarnitine.
In another preference, described compositions contains:
(i) 5-150 weight portion vitamin B5;
(ii) 2-1000 weight portion vitamin B6;
(iii) 0.4-40 weight portion VB11;
(iv) 0.003-1 weight portion vitamin B12;
And component (i)+(ii)+(iii)+(iv) accounts for the 10-100% of composition total weight.Preferably component (i)+(ii)+(iii)+(iv) accounts for the 20-90% of composition total weight.
In another preference, described compositions contains:
(i) 15-50 weight portion vitamin B5;
(ii) 50-300 weight portion vitamin B6;
(iii) 1-10 weight portion VB11;
(iv) 0.01-0.2 weight portion vitamin B12.
In another preference, described compositions also contains:
(v) 100-350 weight portion R-thioctic acid
(vi) 100-2000 weight portion acetylcarnitine;
And component (i)+(ii)+(iii)+(iv)+(v)+(vi) account for the 15-100% of composition total weight.Preferably component (i)+(ii)+(iii)+(iv)+(v)+(vi) account for the 30-90% of composition total weight.
In another preference, described compositions also contains:
(v) 150-250 weight portion R-thioctic acid
(vi) 180-500 weight portion acetylcarnitine.
In another preference, described compositions contains (1) R-thioctic acid and (2) acetylcarnitine.
In another preference, described compositions contains:
(1) 100-350 weight portion R-thioctic acid;
(2) 100-2000 weight portion acetylcarnitine;
And component (1)+(2) account for the 10-100% of composition total weight.Preferably component (1)+(2) account for the 20-90% of composition total weight.
In another preference, described compositions contains:
(1) 150-250 weight portion R-thioctic acid;
(2) 180-500 weight portion acetylcarnitine.
In another preference, described compositions also contains:
(3) 5-150 weight portion vitamin B5;
(4) 2-1000 weight portion vitamin B6;
(5) 0.4-40 weight portion VB11;
(6) 0.003-1 weight portion vitamin B12;
And component (1)+(2)+(3)+(4)+(5)+(6) account for the 15-100% of composition total weight.Preferably component (1)+(2)+(3)+(4)+(5)+(6) account for the 30-90% of composition total weight.
In another preference, described compositions also contains:
(3) 15-50 weight portion vitamin B5;
(4) 50-300 weight portion vitamin B6;
(5) 1-10 weight portion VB11;
(6) 0.01-0.2 weight portion vitamin B12.
In another preference, described compositions also contains pharmaceutically acceptable carrier.
Aspect second of the present invention, a kind of preparation of compositions method is provided, it comprises step: 1. two kinds or multiple chondriosome nutrient are mixed, form compositions.
In another preference, the chondriosome nutrient in the described preparation method is selected from down group: R-thioctic acid, acetylcarnitine, vitamin B5, vitamin B6, VB11, vitamin B12, coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin or creatine.
In another preference, it comprises step: step 1. in, with (a) vitamin B12 with (b) be selected among vitamin B5, B6 or the B11 one or more vitamin B group and mix, make compositions.
In another preference, it comprises step: step 1. in, sneak into again (c) one or more be selected from down the group chondriosome nutrient: R-thioctic acid or acetylcarnitine make compositions.
In another preference, it comprises step: step 1. in, also comprise sneak into one or more be selected from down the group extra chondriosome nutrient: coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin or creatine.
In another preference, step 1. in, with (i) 5-150 weight portion vitamin B5; (ii) 2-1000 weight portion vitamin B6; (iii) 0.4-40 weight portion VB11; (iv) 0.003-1 weight portion vitamin B12 is mixed, and makes compositions.
In another preference, it comprises step: also comprise and sneaking into (the v) R-thioctic acid of 100-350 weight portion and (vi) the acetylcarnitine of 100-2000 weight portion mixes, and makes compositions in 1. in step.
In another preference, it comprises step: step 1. in, (1) R-thioctic acid and (2) acetylcarnitine are mixed, make compositions.
In another preference, it comprises step: step 1. in, also comprise sneak into one or more be selected from down the group extra chondriosome nutrient: coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin or creatine.
In another preference, it comprises step: step 1. in, (1) 100-350 weight portion R-thioctic acid and (2) 100-2000 weight portion acetylcarnitine are mixed, make compositions.
In another preference, it comprises step: step 1. in, also comprise and sneak into (3) 5-150 weight portion vitamin B5; (4) 2-1000 weight portion vitamin B6; (5) 0.4-40 weight portion VB11; (6) 0.003-1 weight portion vitamin B12 is mixed, thus the compositions of making.
Aspect the 3rd of the present invention, the purposes of above-mentioned compositions is provided, described compositions is used to prepare prevention, treat or improve the medicine of Parkinson's disease, or is used to the dietary supplement for preparing the prevention or improve Parkinson's disease.
Aspect the 4th of the present invention, a kind of prevention, treatment are provided or have improved the method for Parkinson's disease, described method is to need the object of treatment to use one or more (more preferably 2 kinds or multiple) chondriosome nutrients.
In another preference, described chondriosome nutrient is selected from down group: R-thioctic acid, acetylcarnitine, vitamin B5, vitamin B6, VB11, vitamin B12, coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin or creatine.
In another preference, described method is to need the object of treatment to use effective dose:
(a) vitamin B12;
(b) one or more are selected from down the vitamin B group of group: vitamin B5, vitamin B6, VB11.
In another preference, described Therapeutic Method is to return the experimenter who needs to apply effective dose:
(c) one or more are selected from down the chondriosome nutrient of group: R-thioctic acid or acetylcarnitine.
In another preference, described Therapeutic Method is to return the experimenter who needs to apply effective dose: (1) R-thioctic acid and (2) acetylcarnitine.
Thus, the invention provides a kind of compositions, its dosage is little, and is safe, can more effectively suppress mitochondrial oxidative damage, reaches prevention, treats and improve the purpose of Parkinson's disease.
Description of drawings
Fig. 1 has shown the depression effect that LA, ALCAR and combination pretreatment thereof descend to the caused mitochondrial membrane potential of rotenone.
Fig. 2 has shown that LA, ALCAR and combination pretreatment thereof are to the active depression effect that descends of the caused mitochondrion composite I of rotenone.
Fig. 3 has shown the depression effect that LA, ALCAR and combination pretreatment thereof descend to the caused ATP level of rotenone.
Fig. 4 has shown that LA, ALCAR and combination pretreatment thereof discharge the depression effect that increases to the caused cytochrome C of rotenone.
Fig. 5 has shown the depression effect that LA, ALCAR and combination pretreatment thereof descend to the caused GSH level of rotenone.
Fig. 6 has shown LA, ALCAR and the combination pretreatment depression effect that caused protein oxidation damage increases to rotenone thereof.
Fig. 7 has shown LA, ALCAR and combination pretreatment thereof the depression effect to the DNA damage of the caused oxidation of rotenone.
Fig. 8 has shown the depression effect that LA, ALCAR and combination pretreatment thereof raise to the caused ROS of rotenone.
Fig. 9 has shown that (α-synuclein) and mRNA thereof express the influence that changes to the caused synaptophysin I of rotenone for LA, ALCAR and combination pretreatment thereof.
Figure 10 has shown the influence that LA, ALCAR and combination pretreatment thereof raise to the caused synaptophysin I of rotenone and ubiquitin (ubiquitin) level.
Figure 11 has shown the influence of VB5 to the male fruit bat climbing of PD ability.
Figure 12 has shown the influence of VB5 to the male life span of drosophila melanogaster of PD.
Figure 13 has shown the influence of VB5 to the female fruit bat climbing of PD ability.
Figure 14 has shown the influence of VB5 to the female life span of drosophila melanogaster of PD.
Figure 15 has shown the influence of VB12 to the male fruit bat climbing of PD ability.
Figure 16 has shown the influence of VB12 to the male life span of drosophila melanogaster of PD.
Figure 17 has shown the influence of VB12 to the female fruit bat climbing of PD ability.
Figure 18 has shown the influence of VB12 to the female life span of drosophila melanogaster of PD.
Figure 19 has shown the influence of VB6 to the male fruit bat climbing of PD ability.
Figure 20 has shown the influence of VB6 to the male life span of drosophila melanogaster of PD.
Figure 21 has shown the influence of VB6 to the female fruit bat climbing of PD ability.
Figure 22 has shown the influence of VB6 to the female life span of drosophila melanogaster of PD.
Figure 23 has shown the influence of VB11 to the male fruit bat climbing of PD ability.
Figure 24 has shown the influence of VB11 to the male life span of drosophila melanogaster of PD.
Figure 25 has shown the influence of VB11 to the female fruit bat climbing of PD ability.
Figure 26 has shown the influence of VB11 to the female life span of drosophila melanogaster of PD.
Figure 27 has shown the influence of VB5+VB12 to the male fruit bat climbing of PD ability.
Figure 28 has shown the influence of VB5+VB12 to the male life span of drosophila melanogaster of PD.
Figure 29 has shown the influence of VB5+VB12 to the female fruit bat climbing of PD ability.
Figure 30 has shown the influence of VB5+VB12 to the female life span of drosophila melanogaster of PD.
Figure 31 has shown the influence of VB6+VB11+VB12 to the male fruit bat climbing of PD ability.
Figure 32 has shown the influence of VB6+VB11+VB12 to the male life span of drosophila melanogaster of PD.
Figure 33 has shown the influence of VB6+VB11+VB12 to the female fruit bat climbing of PD ability.
Figure 34 has shown the influence of VB6+VB11+VB12 to the female life span of drosophila melanogaster of PD.
Figure 35 has shown the influence of VB5+VB6+VB11+VB12 to the male fruit bat climbing of PD ability.
Figure 36 has shown the influence of VB5+VB6+VB11+VB12 to the male life span of drosophila melanogaster of PD.
Figure 37 has shown the influence of VB5+VB6+VB11+VB12 to the female fruit bat climbing of PD ability.
Figure 38 has shown the influence of VB5+VB6+VB11+VB12 to the female life span of drosophila melanogaster of PD.
Figure 39 has shown that LA+ALCAR, VB5+VB6+VB11+VB12 and LA+ALCAR+VB5+VB6+VB11+VB12 pretreatment to the caused mitochondrial injury of MPP, further cause the depression effect of cell death phenomenon.
Figure 40 has shown the influence of LA to the male fruit bat climbing of PD ability.
Figure 41 has shown the influence of LA to the male life span of drosophila melanogaster of PD.
Figure 42 has shown the influence of LA to the female fruit bat climbing of PD ability.
Figure 43 has shown the influence of LA to the female life span of drosophila melanogaster of PD.
Figure 44 has shown the influence of ALCAR to the male fruit bat climbing of PD ability.
Figure 45 has shown the influence of ALCAR to the female fruit bat climbing of PD ability.
Figure 46 has shown the influence of ALCAR to the PD life span of drosophila melanogaster.
Figure 47 has shown the influence of LA+ALCAR to PD fruit bat climbing ability.
Figure 48 has shown the influence of LA+ALCAR to the PD life span of drosophila melanogaster.
Figure 49 has shown the expression of interior tyrosine hydroxylase of PD fruit bat model body and synaptophysin I.
1. female PD fruit bat, 2. male PD fruit bat, 3. female non-PD fruit bat, 4. male non-PD fruit bat
Figure 50 has shown the effect that LA expresses male PD fruit bat synaptophysin I.
1. non-PD fruit bat contrast, the contrast of 2.PD fruit bat, 3.LA10
Figure 51 has shown the effect that LA expresses female PD fruit bat synaptophysin I.
1. non-PD fruit bat contrast, the contrast of 2.PD fruit bat, 3.LA10
Figure 52 has shown the effect that LA expresses male PD fruit bat synaptophysin ImRNA.
Figure 53 has shown LA, the VB6 influence to PD fruit bat nervous system dopamine neuron.
1.Uas-DDC-gal4 fruit bat (the male parent fruit bat of PD fruit bat) 1 day, 2.PD fruit bat contrast 1 day, 3.uas-DDC-gal4 fruit bat 20 days, 4.PD fruit bat contrast 20 days, the 5.PD fruit bat was used VB620 days, and the 6.PD fruit bat was used LA20 days
Figure 54 has shown the effect that VB5, VB6, VB11, VB12, LA express male PD fruit bat synaptophysin I.
1. non-PD fruit bat contrast, the contrast of 2.PD fruit bat, 3.VB5,4.VB6,5.VB11,6.VB12,7.LA
Figure 55 has shown that VB5+VB6+VB11+VB12 (is VB
s) effect that male PD fruit bat synaptophysin ImRNA is expressed.
The specific embodiment
The inventor is surprised to find that low dose of acetylcarnitine (ALCAR) and R-thioctic acid (LA) coupling through study extensively, can suppress the senile degeneration of neurocyte effectively.
The inventor also is surprised to find that, with vitamin (Vit) B
5With vitamin B
6, B
11, B
12In one or more vitamin B group couplings (especially be with vitamin (Vit) B
5, B
6, B
11And B
12Four kinds of vitamin couplings), can produce cooperative effect, thereby more effectively improve Parkinson's disease.
In another preference, the inventor further finds, with the ALCAR and the LA of low dose, and vitamin (Vit) B
5, B
6, B
11And B
12Coupling, the effect of improving Parkinson's disease is better.
Definition
As used herein, term " contain " or " comprising " comprised " comprising ", " basically by ... constitute " and " by ... constitute ".
As used herein, term " basically by ... constitute " refer in compositions, except containing neccessary composition or necessary component, also can contain a spot of and not influence the submember and/or the impurity of effective ingredient.For example, can contain sweeting agent to improve taste, antioxidant in case oxidation, and other this areas additive commonly used.
As used herein, term " effective dose " is meant and can produces function or amount active and that can be accepted by people and/or animal to people and/or animal.
As used herein, term " ALCAR ", " acetylcarnitine " and " acetyl-L-carnitine " are used interchangeably, and all are meant the acetyl derivative of L-carnitine.
As used herein, term " pharmaceutically or on the bromatology acceptable carrier " refers to be used for the treatment of agent administration or the edible carrier of health product, comprises various excipient and diluent.This term refers to some carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find discussing fully about pharmaceutically acceptable excipient in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of Chinese medicine is learned, as water, saline, glycerol and ethanol.In addition, also may there be complementary material in these carriers, as wetting agent or emulsifying agent, pH buffer substance etc.Come from LA, ALCAR, VitB
5, VitB
6, VitB
11And VitB
12Deng the inessential composition outside the chondriosome nutrient, and other inessential compositions (for example other complementary medical material or food materials), be also included within pharmaceutically or on the bromatology in the definition of acceptable carrier.
As used herein, term " neccessary composition " refers to the chemical substance as necessity of active component, i.e. chondriosome nutrients such as LA, ALCAR, VitB5, VitB6, VitB11 and VitB12.Each composition also can use with " the acceptable salt of physiology " or " acceptable acid of physiology or the deutero-salt of alkali " form.Described salt includes, but is not limited to: the salt that forms with following mineral acid: example hydrochloric acid, sulphuric acid, nitric acid, phosphoric acid and the salt that forms with organic acid, organic acid then refers to acetic acid, oxalic acid, succinic acid, tartaric acid, methanesulfonic acid and maleic acid.Other salt comprise the salt that forms with alkali metal or alkaline-earth metal (as sodium, potassium, calcium or magnesium), with the form (when with this form administration, can change into active part in vivo) of " prodrug " of ester, carbamate or other routines.
As used herein, term " compositions of the present invention " comprises pharmaceutical composition, food composition and/or dietary supplement, as long as they contain or are made up of two or more chondriosome nutrients that are selected from down group basically: R-thioctic acid, acetylcarnitine, vitamin B5, vitamin B6, VB11, vitamin B12, coenzyme Q10, thiamine (VB1), riboflavin (VB2), nicotinic acid (VB3), biotin (VB7) or creatine.
As used herein, " chondriosome nutrient " is meant the nutrient that can the protective wire plastochondria avoid oxidative damage and can improve mitochondrial function, comprise those 1. the protective wire plastochondria exempt from oxidative stress, as antioxidant and metallo-chelate; 2. repair mitochondrial membrane; 3. functional reparation and prevent the mitochondrion oxidative damage is as the substrate or the coenzyme of cyclophorase; 4. induce the expression of 2 phase antioxidases.
As used herein, term " unit dosage form " is meant for taking convenience, becomes single to take required dosage form preparation of compositions of the present invention, includes but not limited to various solid formulation (as tablet), liquid agent, capsule, slow releasing agent.Contain for prevention, treatment in the described unit dosage form or improve the effective compositions of the present invention of Parkinson's disease.
As used herein, " weight portion " or " parts by weight " is used interchangeably, described weight portion can be any one fixed with milligram, the gram number or the kilogram numerical table show weight (as 1mg, 1g, 2g, 5g or 1kg etc.).For example, a compositions that is made of 1 parts by weight of component a and 9 parts by weight of component b can be 1 gram component a+9 gram components b, also can be the compositions that 10 gram component a+90 gram components b etc. constitute.In described compositions, a certain percentages of ingredients content=(the parts by weight sum of the parts by weight/all components of this component) * 100%.Therefore, in the compositions that is made of 1 parts by weight of component a and 9 parts by weight of component b, the content of component a is 10%, and components b is 90%.
Compositions of the present invention can be directly used in prevention, alleviate or the treatment Parkinson's disease, or can with other medicines or dietary supplement co-administered.
Chondriosome nutrient
Can contain one or more chondriosome nutrients that are selected from down group in the compositions of the present invention: R-thioctic acid, acetylcarnitine, vitamin B5, vitamin B6, VB11 or vitamin B12.Chondriosome nutrient composition of the present invention contains or is made of among 1. VitB12+VitB5, VitB6, the VitB11 one or more basically or contains or be made of 2. R-thioctic acid+acetylcarnitine basically or contain or be made of 3. R-thioctic acid+acetylcarnitine+VitB5+VitB6+VitB11+VitB12 basically.Usually, 1. one or more among VitB12+VitB5, VitB6, the VitB11 or 2. R-thioctic acid+acetylcarnitine or 3. the weight of R-thioctic acid+acetylcarnitine+VitB5+VitB6+VitB11+VitB12 account for the 15-99% of composition total weight, preferably 30-90%, more preferably 50-90%.The material of surplus is an acceptable carrier pharmaceutically or on the bromatology.In preference, the present composition does not contain contained other drug in the treatment Parkinson's disease at present usually, L-DOPA for example, selegiline etc.
Be applicable to that representational other chondriosome nutrients of the present invention comprise (but being not limited to): coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin and creatine.
1. coenzyme Q10 (CoQ): be positioned at an electron carrier in the mitochondrial inner membrane, it can be stablized the respiratory chain component and can work (people such as Ebadi, 2001 as a kind of mitochondrion antioxidant; Ernster, 1994; People such as Frei, 1990).In multiple mitochondrion disease, comprise PD, Heng Tingdunshi disease He Shi ataxia, CoQ has active influence (people such as Beal, 1998 for the change of clinical treatment and biochemical indicator; People such as Ebadi, 2001; People such as Shults, 2002).In the mice of handling with MPTP, CoQ can alleviate the neurotoxicity that MPTP causes, and improves striatal dopamine level, increases striatal mitochondrion quantity and ATP synthetic quantity, and strengthens activity (Beal, 2003 of mitochondrion complex in the striatum; Ebadi et al., 2001; Ebadi et al., 1996), weaken that the oxidant that is caused by MPTP increases and striatum in the dopamine loss (Beal et al., 1998 that cause by MPTP; Ebadi etal., 2001).Clinical studies show PD patient high doses applied CoQ can slow down the disease symptom process that disables, and dosage reaches as high as 1200mg/d.Therefore CoQ can slow down the deterioration (Shults et al., 2002) of PD symptom safely.
CoQ (Ernster, 1994) in the body, LA, and the level of carnitine (Liu et al., 2002) will degenerate with the age replenishes LA, ALCAR or CoQ and can improve decay (Beal, 2003 year relevant with the age in cognitive function and nerve degeneration; Liu et al., 2002.a).
2. thiamine (VB1): thiamine (VB1) is the precursor of diphosphothiamine coenzyme, and the VB1 phosphorylated forms diphosphothiamine, and it is the cofactor that comprises the plurality of enzymes of cyclophorase; VB1 has important function for the metabolism of acetylcholine and from the release of presynaptic neuron.Existing report is pointed out in the dementia of neurodegenerative disease and other form, for example the enzymatic activity that VB1 relies in AD patient's brain and the peripheral tissues all reduces (Higdon, 2003), comprising the pyruvic dehydrogenase in the mitochondrion and ketoglurate dehydrogenase (Butterworth and Besnard, 1990; People such as Gibson, 1988; People such as Rao, 1993), this causes mitochondrial apoptosis, cause proteinic oxidation in the mitochondrion, further influence the Km value of diphosphothiamine again, form vicious cycle, cause the imbalance of brain function, and this functional defect can be reversed (Harman, 1988 by the VB1 of high dose; Heroux et al., 1996).Therefore, the peculiar brain dysfunction of normal and pathologic aging may be alleviated by the VB1 of high dose.Find out that thus taking VB1 might be effective drug candidate of control PD.
3. riboflavin (VB2): riboflavin (VB2) is the coenzyme F MN of mitochondrion composite I and II and the precursor of FAD.Because VB2 derivant FAD is glutathion reductase (a catalysis generation reduced glutathion), the coenzyme of xanthine oxidase (catalysis generation uric acid) and anhydroleucovorin reductase (but the catalysis homocystine generates methionine), might pass through to influence electron transport chain so VB2 lacks, thereby the metabolism of antioxidase and homocystine produces remote-effects to the brain function.Homocystine level rising simultaneously (Duan et al., 2002; Kruman et al., 2002; Seshadriet al., 2002) and the level of reduced glutathion (Shukitt-Hale et al., 1998) and uric acid (Ames et al., 1981) reduce all relevant with cognitive dysfunction with aging.With FMN and FAD is that the mitochondrion composite I of cofactor exists defective in patient PD.The product oxygen site that Physiology Experiment recently and pathology experiment will mainly be worked is limited on the FMN group of mitochondrion composite I, and generally believed that unlike former viewpoint product oxygen site is on the ubiquinone of mitochondrion composite I II, this finds further to have proved the importance (Liu that improves PD mitochondrion composite I defective, Y., Fiskum, G., and Schubert, D.2002d).Existing clinical research shows that to take high dose VB2 (oral, per 8 hours 30mg) remove the red meat in the food simultaneously, can improve some patients' PD motor capacity (Coimbra andJunqueira, 2003), this prompting can improve PD patient's VB2 sensitive mechanism by this therapy, as glutathion consumption, the cumulative bad Mitochondrial DNA Mutation, disordus plastochondria albumen composition and iron metabolism are unusual or the like.VB2 may stimulate cyclophorase to make it active and rise, and can change the Km value of FMN/FAD.But VB2 is again the important coenzyme of the monoamine oxidase, MAO (MAO) on the mitochondrial outer membrane, and its increase might make the dopamine decomposition in the dopamine system increase, and is unfavorable for the improvement of the symptom of PD.Therefore the application of VB2 must be arranged in pairs or groups meticulously with other chondriosome nutrients, prevents the generation of side effect.
4. nicotinic acid (VB3): nicotinic acid and niacin amide general designation nicotinic acid are the precursors of NAD and NADP.In mitochondrion and Cytoplasm, the nicotinic acid of high dose can improve level people such as (, 2002) Ames of NAD/NADP, increases the affine chance of mitochondrion composite I to substrate, further improves enzymatic activity.NADH and NADPH be the still substrate of mitochondrion composite I and coenzyme not, also is a kind of endogenous antioxidant simultaneously.VB3 uses in mice that MPTP handles and poly-ADP-ribose polymerase knock-out mice can resist neurotoxicity, and can reduce the ATP that nerve damage and focal cerebral ischemia, malonic acid and MPTP cause and consume (Beal, 2003).NADH can also synthesize by the stimulation of endogenous dopamine, alleviates PD patient's muscular movement damage and recognition function imbalance (Birkmayer and Birkmayer, 1989; Kuhn andMuller, 1997).When also having report proof VB3 and VB2 shared mitochondrion composite I deficiency disorders there is certain curative effect, as mitochondrial encephalopathy, lactic acidosis disease and brain shock.And PD patient's VB3 intake obviously reduces (Hellenbrand et al., 1996), needs suitably to replenish.
5. biotin (VB7): comprise pyruvate carboxylase as the cyclophorase of cofactor with VB7, acetyl-CoA carboxylase, propionyl CoA carboxylase, and holocarboxylase synthetase etc. participate in intravital carbohydrate metabolism, fatty acid is synthetic and the metabolic process of several amino acids.VB7 shortage (particularly in anemia of pregnant woman) in the crowd is quite general, (Mocket al., 2002.a; Mock et al. 2002b), and directly causes generation (Atamna, the Erlitski , ﹠amp of mitochondrial aging and oxidant; Ames, 2005).VB7 is compensating group (Mock for the carboxyl that relies on biotin on above-mentioned four kinds of enzyme molecules, 1989), wherein first three kind is the single-minded enzyme of mitochondrion, and metabolite feedback response in the catalysis tricarboxylic acid cycle all provides precursor---the S-(3-carboxy-propionyl)-coenzyme-A of heme simultaneously.Lack the activity that VB7 will reduce these enzymes, and the Beta-methyl crotonocyl-CoA and the glycine that accumulate in the mitochondrion during VB7 shortage react (Mock, 1989), cause the aminoacid in the mitochondrial matrix to exhaust.Therefore, lack the shortage that VB7 will cause mitochondrion S-(3-carboxy-propionyl)-coenzyme-A and glycine, further cause the shortage of heme.
6. creatine (creatine): creatine (creatine) is by arginine (arginine), glycine (glycine) and the synthetic material of methionine (methionine) three seed amino acids.Creatine can be synthetic voluntarily in organs such as liver, kidney, pancreas; Also can absorb from diet.Creatine between Cytoplasm and mitochondrion/phosphagen conversion system can utilize a kind of uniqueness mitochondrion creatine kinase (CK) recombined isomer and work as a kind of dimensional energy buffer: intracellular creatine, phosphoric acid can be changed mutually according to the metaboilic level and the ATP concentration of cell with phosphagen (phosphocreatine).Creatine can improve the conversion of creatine/phosphagen and suppress the unlatching (Beal, 2003) in mitochondrial permeability transhipment hole.ATP is the energy supply material of body anaerobic metabolism, but its molecular weight poor stability greatly and in vivo and in vitro, and the little chemical stability of creatine molecular weight is good, has in vivo to lay in meaning widely.Vegetarian with 45 youths is in the double blind experiment that object was carried out, the cross matching of placebo shows that oral six weeks of creatine additive (5g/ days) equally all have remarkable effect people such as (, 2003) Rae for intellectual work and the high efficiency work of needs.Equally, creatine also has been used to comprise the treatment of the multiple nervous system disease of PD and Huntington Chorea.
In the present invention, the chondriosome nutrient composition that can be effective to prevent, improve and treat Parkinson's disease includes but not limited to: 1. one or more among VitB12+VitB5, VitB6, the VitB11; 2. R-thioctic acid+acetylcarnitine; 3. R-thioctic acid+acetylcarnitine+VitB5+VitB6+VitB11+VitB12.For the mammal that suffers from Parkinson's disease, use the compositions that above-mentioned chondriosome nutrient is prepared into, can obtain the effect of significantly promoting.Described compositions is a pharmaceutical composition; Or be food composition.
In a kind of optimal way of the present invention, employing is selected from following component and prepares described compositions: VitB12, VitB5, VitB6, VitB11, described component can two kinds, three kinds or four kinds of combination in any, and a kind of preferred compound mode is VitB12+VitB5+VitB6+VitB11.
In a kind of preference of the present invention, adopt the form of R-thioctic acid+acetylcarnitine use in conjunction, improve greatly than being applied in separately on the effect, and on dosage, reduce greatly.
In addition, in a preference of the present invention, when adopting the combination of 1. VitB12+VitB5+VitB6+VitB11, join R-thioctic acid+acetylcarnitine 1., can reach more excellent effect.
Therefore, the compositions that is used for preventing, improving or treat Parkinson's disease of the present invention contains one or more that choose wantonly among vitamin B12 and vitamin B5, B6 or the B11.When containing the component vitamin B12 in the compositions, also contain the component vitamin B5, in vitamin B6 or the VB11 one or more, such as, described compositions includes but not limited to: the compositions of vitamin B12+vitamin B5, the compositions of vitamin B12+vitamin vitamin B6, the compositions of vitamin B12+VB11, the compositions of vitamin B12+vitamin B5+vitamin B6, the compositions of vitamin B12+vitamin B5+VB11, the compositions of vitamin B12+vitamin B6+VB11, or the compositions of vitamin B12+vitamin B5+vitamin B6+VB11.
In a preference, described compositions contains:
(i) 5-150 weight portion vitamin B5, preferably 15-50 weight portion, more preferably 25-35 weight;
(ii) 2-1000 weight portion vitamin B6, preferably 50-300 weight portion, more preferably 80-150 weight portion;
(iii) 0.4-40 weight portion VB11, preferably 1-10 weight portion, more preferably 2.5-5.5 weight portion;
(iv) 0.003-1 weight portion vitamin B12, preferably 0.01-0.2 weight portion, more preferably 0.07-0.15 weight portion;
And component (i)+(ii)+(iii)+(iv) accounts for the 10-100% of composition total weight; Preferably, component (i)+(ii)+(iii)+(iv) accounts for the 20-90% of composition total weight; More preferably, component (i)+(ii)+(iii)+(iv) accounts for the 40-90% of composition total weight.
The compositions that is used for preventing, improving or treat Parkinson's disease of the present invention contains R-thioctic acid and acetylcarnitine.
In a preference, described compositions contains:
(1) 100-350 weight portion R-thioctic acid, preferably 150-250 weight portion, more preferably 180-220 weight portion;
(2) 100-2000 weight portion acetylcarnitine, preferably 180-500 weight portion, more preferably 180-300 weight portion;
And component (1)+(2) account for the 10-100% of composition total weight; Preferably, component (1)+(2) account for the 20-90% of composition total weight; More preferably, component (1)+(2) account for the 40-90% of composition total weight.
In a kind of optimal way of the present invention, component (1) exists in the proper ratio with (2), and (1) is 1:10-10:1 with the weight ratio of (2); Preferred, component (1) is 1:5-5:1 with the weight ratio of (2); Most preferred, component (1) is 1:1-3:1 with the weight ratio of (2).
As a kind of particularly preferred compositions of the present invention, it is as follows that it contains component: (a) 5-150 weight portion vitamin B5, preferably 15-50 weight portion, more preferably 25-35 weight; (b) 2-1000 weight portion vitamin B6, preferably 50-300 weight portion, more preferably 80-150 weight portion; (c) 0.4-40 weight portion VB11, preferably 1-10 weight portion, more preferably 2.5-5.5 weight portion; (d) 0.003-1 weight portion vitamin B12, preferably 0.01-0.2 weight portion, more preferably 0.07-0.15 weight portion; (e) 100-350 weight portion R-thioctic acid, preferably 150-250 weight portion, more preferably 180-220 weight portion; (f) 100-2000 weight portion acetylcarnitine, preferably 180-500 weight portion, more preferably 180-300 weight portion; And component (a)+(b)+(c)+(d)+(e)+(f) accounts for the 15-100% of composition total weight; Preferably, component (i)+(ii)+(iii)+(iv) accounts for the 30-90% of composition total weight; More preferably, component (i)+(ii)+(iii)+(iv) accounts for the 50-90% of composition total weight.
Can also contain one or more representational other chondriosome nutrients in the compositions of the present invention: 8-1200mg weight portion ubiquinone
10, 4-200mg weight portion thiamine, 2-240mg weight portion riboflavin, 20-800mg weight portion nicotinic acid, 1-20mg weight portion biotin and 0.5-12mg weight portion creatine.
In another preference, described compositions contains:
(i)VB5?15mg
(ii)VB6?50mg
(iii)VB11?2mg
(iv)VB12?0.05mg。
In another preference, described compositions contains:
(1) R-thioctic acid 100mg,
(2) acetylcarnitine 100mg.
In another preference, described compositions contains:
(a) R-thioctic acid 100mg,
(b) acetylcarnitine 100mg
(c)VB5?15mg
(d)VB6?50mg
(e)VB11?2mg
(f)VB12?0.05mg。
As a kind of particularly preferred compositions of the present invention, also contain pharmaceutically in the described compositions or acceptable carrier or excipient on the bromatology: the 50-1000 weight portion.
Pharmaceutical composition of the present invention or dietary supplement can be made the dosage form of any routine by conventional method, and preferred slow release formulation can make that neccessary composition slowly stablize, release constantly.
Described slow release formulation can make by the method for routine, a kind of preferable methods is to use excipient as clad material, and neccessary composition is coated on wherein, forms coating slow/controlled release preparation, or neccessary composition is written in the sustained-release matrix, form matrix type slow/controlled release preparation.Another method for optimizing is that neccessary composition is made separately salt, utilizes the dissolubility difference of different salt that each neccessary composition is progressively discharged, and produces long-acting.
Compositions provided by the invention can decide according to the dosage form and the route of administration of required preparation, those skilled in the art adopt the conventional pharmaceutical composition or the preparation method of food composition can prepare compositions of the present invention after with reference to compositions provided by the present invention and proportioning.A kind of preferable methods is earlier fat-soluble neccessary composition to be made solution with adding water dissolution behind the cosolvent hydrotropy more earlier, and the water solublity neccessary composition is directly made solution with water dissolution, then the solution of fat-soluble neccessary composition and the solution of water solublity neccessary composition are mixed, thereby make compositions provided by the invention.
Compositions provided by the invention is used to prevent and the usage and dosage that improves Parkinson's disease is 100-350mgLA and 100-2000mgALCAR every day; Or every day 4-150mgVitB
5, 2-1000mgVitB
6, 0.4-40mgVitB
11And 0.003-1mgVitB
12Or every day 100-350mgLA, 100-2000mgALCAR, 4-150mgVitB
5, 2-1000mgVitB
6, 0.4-40mgVitB
11And 0.003-1mgVitB
12
The compositions that is used for preventing and improves Parkinson's disease provided by the invention also can include, but are not limited to following one or more representational other chondriosome nutrients: coenzyme Q10, thiamine, riboflavin, nicotinic acid, biotin and creatine, its usage and dosage are oral ubiquinone
108-1200mg/ days, oral thiamine 4-200mg/ days, oral Riboflavin Tetrabutyrate-240mg/ days, oral nicotinic acid 20-800mg/ days, oral biotin 1-20mg/ days, oral creatine 0.5-12mg/ days.
A kind of preferable methods is a makeup energy when taking, and as taking carbohydrate, fruit drink simultaneously, thereby provides the auxiliary energy that is used to prevent and improve Parkinson's disease, promotes the synthetic of mitochondrial ATP.Required additional energy is probably at the 50-150 calorie.
When being used for pharmaceutical compositions or food composition, the effective dose of used chondriosome nutrient composition can change with the order of severity of pattern of using and disease to be treated.
Dosage form for compositions of the present invention has no particular limits, and can be any dosage form that is applicable to that mammal is taken; Preferably, described dosage form can be selected from: granule, capsule, tablet, powder agent, oral liquid, suspension or Emulsion.
In another optimal way of the present invention, described compositions is added in water, non--beverage, solid food, the dish-cookings such as orange juice beverage, such as adding in Sucus Vitis viniferae or the Sucus Mali pumilae as a kind of dietary supplement.Preferably add in the meals that 50-150 caloric heat at least can be provided.
In another optimal way of the present invention, go to school acceptable carrier or excipient of described food is selected from: filler, disintegrating agent, lubricant, fluidizer, effervescent, correctives, clad material, meals goods or slow/controlled releasing agent.
In another optimal way of the present invention, described compositions is a unit dosage form, and every dose contains 100-350mgLA and 100-2000mgALCAR; Or contain 4-150mgVitB
5, 2-1000mgVitB
6, 0.4-40mgVitB
11And 0.003-1mgVitB
12Or contain 100-350mgLA, 100-2000mgALCAR, 4-150mgVitB
5, 2-1000mgVitB
6, 0.4-40mgVitB
11And 0.003-1mgVitB
12Can also contain one or more representational other chondriosome nutrients in every dose: the 8-1200mg ubiquinone
10, 4-200mg thiamine, 2-240mg riboflavin, 20-800mg nicotinic acid, 1-20mg biotin and 0.5-12mg creatine.
When preparation of compositions is become unit dosage form, take the compositions 1-3 agent of described unit dosage form every day; Preferred, as to take described unit dosage form every day compositions 1-2 agent.
Compositions provided by the invention can give by approach such as oral.Solid-state carrier comprises: starch, lactose, dicalcium phosphate, microcrystalline Cellulose, sucrose and kaolin, and liquid carrier comprises: culture medium, Polyethylene Glycol, nonionic surfactant and edible oil (as Semen Maydis oil, Oleum Arachidis hypogaeae semen and Oleum sesami).Normally used adjuvant also can advantageously be comprised in pharmaceutical compositions, for example flavoring agent, pigment, antiseptic and antioxidant such as vitamin C, BHT and BHA.
From being easy to prepare the position with administration, preferred pharmaceutical composition is a solid-state composition, and especially tablet and solid are filled or the capsule of liquid filling.Oral administration is preferred.
Preferred dosage form is that those can guarantee that nutrient slowly and stably replenished to mitochondrion in 24 hours, and a kind of mode is to carry chondriosome nutrient composition with suitable carriers, makes chondriosome nutrient composition slowly discharge.Such as with excipient (as hydroxypropyl methylcellulose) as clad material, chondriosome nutrient is wrapped in wherein, form spherical particle (coating slow/controlled release preparation); Or chondriosome nutrient is written into (matrix type slow/controlled release preparation) in the matrix sustained release tablet (as hydroxyethyl-cellulose).
Should be understood that also can to contain other human body in the chondriosome nutrient composition of the present invention necessary or to the human body beneficial but do not influence or do not produce the composition of direct drug effect.In addition, according to doctor's guidance, compositions of the present invention also can be used jointly with the treatment of other routine or the medicine of prevention Parkinson's disease.
The medicine that compositions of the present invention can be used for preparing prevention, improves or treat the cell mitochondrial metabolism disorder; Perhaps, compositions of the present invention can be used for preparing the medicine of prevention, improvement or treatment Parkinson's disease.
The inventor utilizes the fruit bat Parkinson's disease model (by synaptophysin I transgenic type fruit bat and uas-DDC drosophila hybrid gained) that changes synaptophysin I gene over to, parkinson fruit bat model tormulation synaptophysin I, and losing at the back generation dopamine neuron of growing up, occur the inclusions that the filament shape contains synaptophysin I in the neuron, obstacle appears in motor function.Because this fruit bat model possesses the basic feature of human body Parkinson's disease, therefore can utilize this genetic method to carry out the research of Parkinson's disease.
The inventor finds that VB5, VB6, VB11 and VB12 are cooperated with on the PD fruit bat model, and motor capacity and the life-span of PD fruit bat improve significantly.
The LA that makes time spent 50X dosage group separately is all effective to motor capacity and the life-span of PD fruit bat, and ALCAR has only prolonged the life-span of PD fruit bat, to not influence of motor capacity.During the two synergy, 10X dosage group is better than the independent effect of 10X dosage LA to the effect of PD fruit bat motor capacity.
VB5, VB6, VB11, VB12, LA and ALCAR synergy to each other is better than the effect of single medicine, and the more stable and safety of curative effect under the synergy condition.In the experiment of the mitochondrial injury that MPP processing cell causes, the inventor finds the pretreated cell survival rate of LA+ALCAR+VB5+VB6+VB11+VB12, than LA+ALCAR pretreatment or the pretreated cell survival rate height of VB5+VB6+VB11+VB12.
The inventor utilizes the chronic rotenone model (5nM of SK-NM-C, 4 weeks) reproduced the toxic effect of rotenone as an external PD model to mitochondrial function, several aspects such as PD pathological characters, mitochondrial function and oxidation and anti-oxidative damage biomarker are investigated, with LA (0.1,1,10,100uM), ALCAR (0.1,1,10,100uM) carry out 4 all pretreatment with the combination of their different component.The molecular pathology performance of PD is the mitochondrial function defective.In this cell model, the release of complex 1 active reduction, the increase of ATP waste and cytochrome enzyme C on the mitochondrial inner membrane after rotenone is handled increases.Two kinds of chondriosome nutrients of the LA of suitable dose and ALCAR have therapeutical effect to the mitochondrion after handling with rotenone.The most effective dosage is the LA of 10uM and the ALCAR of 100uM, and after both mix use, and effective dose appears at 0.1 and 1uM, and this best proportioning is more single with much effective than any.The such chondriosome nutrient of LA and ALCAR can effectively suppress the generation and the oxidative damage of the cell oxygen-derived free radicals that rotenone causes.
The present invention proves that chondriosome nutrient VB5, VB6, VB11, VB12, LA and ALCAR and various combination thereof have different curative effects on PD fruit bat model, and VB5, VB6, VB11 and VB12 use in conjunction, or the effect of LA and ALCAR use in conjunction is better than the independent effect of medicine.LA and ALCAR have certain effect to the accumulation that suppresses the mitochondrial dysfunction of PD cell model, oxidative damage and prevention synaptophysin I and ubiquitin.And two kinds of medicines of LA and ALCAR mixture of (0.1-1uM) when low concentration shows a kind of positive coopertive effect, and it is all effective that this any medicine than 10 times of concentration of independent usefulness comes that rotenone is handled the mitochondrial function disorder and the oxidative damage that cause.In addition, the protective effect of LA+ALCAR+VB5+VB6+VB11+VB12 pair cell is better than the combination of LA+ALCAR or VB5+VB6+VB11+VB12.
Major advantage of the present invention is:
1, by neccessary composition is organically combined, many target spots, multi-faceted the synergism of bringing into play;
2, composition is natural, has no side effect, and is suitable for taking for a long time;
3, with low cost, practicability and effectiveness;
4, effect is obvious.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is usually according to the normal condition or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise all percentage ratio and umber by weight.
Embodiment 1-3
Preparation compositions No.1-3
|
|
|
|
Compositions No.1 | Compositions No.2 | Compositions No.3 | |
R-thioctic acid (mg) | 100 | 200 | 350 |
Acetyl-L-carnitine (mg) | 120 | 200 | 1500 |
LA and ALCAR are mixed by above-mentioned prescription, make compositions No.1-3.
Embodiment 4-6
Preparation compositions No.4-6
|
|
|
|
Compositions No.4 | Compositions No.5 | Compositions No.6 | |
VitB 5(mg) | 5 | 30 | 150 |
VitB 6(mg) | 2 | 100 | 800 |
VitB 11(mg) | 0.4 | 4 | 40 |
VitB 12(mg) | 0.003 | 0.1 | 1 |
With VitB
5, VitB
6, VitB
11And VitB
12Mix by above-mentioned prescription, make compositions No.4-6.
Embodiment 7-9
Preparation compositions No.7-9
|
|
|
|
Compositions No.7 | Compositions No.8 | Compositions No.9 | |
R-thioctic acid (mg) | 100 | 200 | 350 |
Acetyl-L-carnitine (mg) | 120 | 200 | 1500 |
VitB 5(mg) | 5 | 30 | 150 |
VitB 6(mg) | 2 | 100 | 800 |
VitB 11(mg) | 0.4 | 4 | 40 |
VitB 12(mg) | 0.003 | 0.1 | 1 |
With LA, ALCAR, VitB
5, VitB
6, VitB
11And VitB
12Mix by above-mentioned prescription, make compositions No.7-9.
The synergism of LA and ALCAR (cytologic experiment)
Material
ALCAR (available from German Sigma-Tau company) and LA (R-a-lipoic acid tris salt is available from German Viatris company); ADP and rotenone (available from sigma company); DCF-DA, JC-1, Hoechst33258 and TRITC coupling mouse IgG antibody (available from Molecular Probes company); Protein oxidation injury testing reagent box (available from Chemicon International Inc.Temecula company); Anti-8 hydroxyl guanosine antibody (available from TrevigenGaithersburg MD company); BCA protein quantification test kit (available from PIERCE company); Anti-a-synuclein monoclonal antibody (available from Calbiochem company); Anti-ubiquitin modified antibodies (available from DAKO company); IQTM SYBER green (available from Bio-Rad company); FITC and TRITC coupling goat anti-rabbit antibody (available from Sino-American Biotech company); Immunoblotting assay reagent (available from Santa Cruz biotech company); Calf serum (available from Hyclone company); Two anti-(available from Invitrogen companies); GSH assay kit (building up bio-engineering research institute) available from Nanjing.
Cell culture and processing
The neural fibroblast of SK-N-MC is cultivated in the MEM culture medium of Earle ' s buffer, adds 15% calf serum, 5mM glucose, 2mM glutamic acid, 1mM Sodium Pyruvate, non essential amino acid, the penicillin of 50U/ml and streptomycin in the culture medium.Add in the culture medium around the combination cultivation of LA and ALCAR and these two kinds of medicines.The concentration of LA and ALCAR is respectively: 0.1,1.0,10, the combination of 100uM and variable concentrations: 0.1uM LA+ALCAR0.1uM, 1uM+1uM, 10uM+10uM, 0.1uM+1uM, 0.1uM+10uM. wash 4 weeks of culture medium culturing (Sherer et al., 2002) of changing 5nM later on or not having the 5nM rotenone for 3 times with MEM.LA and ALCAR storing solution are dissolved in the aseptic PBS buffer.Rotenone is dissolved in the ethanol.Control cells adds ethanol and PBS.Conventional cell culture changes culture medium weekly three times in 24 orifice plates, wait cell to cover with the cultivation of going down to posterity afterwards weekly.
Mitochondrial membrane potential is analyzed (MMP)
Measure mitochondrial membrane potential (Tirosh et al with JC-1,2000), JC-1 is a kind of two emission light, the molecular probe of electromotive force sensitivity, when the mitochondrion current potential is very low or low concentration monomer transmitting green light (529nm) when existing, the then own polymerization red-emitting of high concentration (590nm).Two kinds of compositions are all very responsive to electromotive force, and the ratio of HONGGUANG and green glow can provide the analysis of mitochondrion electromotive force.5X10
4(blk/clrbtm Costar) detects fluorescence to cell culture in 96 orifice plates specially.Cell was hatched 15 minutes for 37 degrees centigrade with the JC-1 of 10uM/ml.Use the PBS washed twice after hatching, with dual wavelength/(Flex Station_384 is available from Molecular Devices, USA) in pair light microplate reader detection
The activity analysis of mitochondrion composite I
SK-N-MC cell method separate mitochondria (the Humphries and Szweda of differential centrifugation, 1998) the .3x107 cell PBS washed twice of pre-cooling, with extracting buffer re-suspended cell (0.25M sucrose, 5mM Tris-HCl buffer, pH7.5, with 1mM EDTA pH8.0) and grind with the glass grinding device, there is not broken cell to use centrifugal 15 minutes of 600g, centrifugal 25 minutes of suspension 10000g, the mitochondrion precipitation is with extracting the medium washing once, the active kinetics of mitochondrion composite I reduces mensuration (Smith1967) by measuring DCPIP at the absorption light value of 600nm.
The ATP horizontal detection
But the cell of saturable digitonin and the bioluminescent reagents box of quantitative protein concentration have been used in the measurement of ATP level.
After cell covers with in 96 orifice plates.Siphon away buffer, at each aerial 0.25M sucrose 100ul that adds, 20mMMOPS, the 0.05mg/ml digitonin is transferred PH to 7.4, places room temperature 3 minutes.Change the digitonin buffer that contains 0.25M sucrose again into, 20mM MOPS, 20mM EDTA, transfer PH to 7.4 to place 5 minutes, dry also with the buffer 100ul that contains 0.25M sucrose, 20mM MOPS, 20mM EDTA, the 5mM inorganic phosphate, the buffer of 1mM ADP, transfer pH value to 7.4 to add by following arrangement: some are only with buffer; Some add 5mM acetone acid and 1mM L MALIC ACID; Some add 5mM glutamic acid and 1mM L-Fructus Mali pumilae; Some add 1.0uM rotenone and 10mM succinic acid; Add the 2mM antimycin A at last, 2mM ascorbic acid and 0.1mM TMPD.Hatched 1 hour for 37 degrees centigrade, add 1.6M perchloric acid 20ul and 15u16N potassium carbonate 3000g again and came the sedimentation cell fragment in centrifugal 10 minutes.With bioluminescence analytical system ATP Analysis level, survey protein concentration with BCA protein quantification test kit.
Cytochrome C discharges and detects
Cell is to cover with on coverslip in the MEM culture medium.Remove the bag MTGFM that buffer adds 37 degrees centigrade of preheatings (1:100,1uM).37 degrees centigrade hatch 1 hour after, with the growth buffer washed cell of fresh preheating.The careful cleaning buffer solution of removing adds the preprepared growth buffer that contains 3.7% formaldehyde, hatches 15 minutes for 37 degrees centigrade then.Cell is several times washed with the PBS flushing in fixing back.The methanol of the cell reuse of having fixed 100% was subzero 20 degrees centigrade of infiltrations 5 minutes.Infiltration back with PBS wash 3 times each 10 minutes.BSA room temperature treatment with 5% 1 hour uses cytochrome C antibody (Mus 1:1000) to be diluted to the 1%BSA incubated at room 1 hour then.Washed cell 3 times each 5 minutes with PBS, the BBS incubated at room of usefulness FITC coupling murine antibody (1:500) dilution 1 hour.Washed 3 times each 10 minutes with PBS, hatched 1 hour with 2ug/ml DAPI.The flushing cell is also analyzed with Laser Scanning Confocal Microscope.
The GSH horizontal detection
Cell is grown on the 100mm plate, makes cell (1x10 with the NACL solution of 0.4ml0.9%
7) fragmentation, the cell pellet uniform particles distributes.4 degrees centigrade of 3000g; Centrifugal 10 minutes, collect supernatant.Analyze GSH based on DTNB with the GSH assay kit, and under 412nm, measure with spectrophotometer.GSH is the index and the expression of cell protein, as the GSH level percentage of reference cell.
Protein carbonylation detects
Measure for protein carbonylation, cell is grown on the 100mm plate.Collect solvable and insoluble protein fragments by described above with the Western-Blotting method.Protein carbonylation is measured with protein oxidation injury testing reagent box.
12% the SDS of the protein of concise and to the point step: 5ul (3ug/ul) and equivalent and the 1xDNPH mixed dissolution of doubling dose.Substitute DNPH with reference to solution with reference to reaction with the 1x primer.Room temperature reaction carries out after 15 minutes adding 1.5 times neutralization solution and stops.Transfer to nitrocellulose filter behind the 15ug protein 12%SDS-PAGE electrophoresis, add 1%BSA/PBS-T (PBS comprise 0.05% both mix 20) room temperature and shook 1 hour.Film in the anti-dinitrophenylation hydrazone of the rabbit of 1:150 antibody 4 degrees centigrade spend the night.PBS-T washes 3 times caudacorias incubated at room 1 hour in horseradish peroxidase goat-anti rabbit coupling antibody.The autoradiography exposed plate.
The DNA oxidative damage
The 8 hydroxyl guanosine antibody that the scheme (1:300) that provides with the manufacturer is allotted are surveyed the DNA oxidative damage, and cell is grown on the 12mm coverslip, mixes 10 minutes under subzero 20 degrees celsius with 70% ethanol.TRITC-coupling anti-mouse antibody is used as two and resists.Use the laser confocal microscope imaging.Red fluorescence quantizes each cell.The data description mean+/-standard deviation of 3 independent experiments.Detect minimum 200 cells.
The DNA oxidative damage is also used the comet electrophoretic analysis.This conventional method was verified (Olive etal, 1990,2005 by forefathers; Tice et al, 2000).The insulin with 0.25% and the culture fluid of dilution are handled cell are scattered.0.6% the low melting-point agarose of the cell of 10ul (1x104) and 90ul is coated with the agarose of the normal melting point of one deck 1% rapidly 37 degrees centigrade of mixing on microscope slide.Microscope slide is immersed the 100ml mixed solution, and (10mM Tris pH10), adds the DMSO of 10mlTriton X-100 and 10ml for 2.5MNaCl, 100mM EDTA.Inserted in the electrophoretic buffer (PH is greater than 13 for 300Mm NaOH, 1Mm EDTA) 4 degrees centigrade then 20 minutes, and made DNA loose before electrophoresis.Electrophoresis ran 20 minutes under the 28mA condition at 4 degrees centigrade of 0.73V/cm.Microscope slide immerses 0.4M Tris, and pH7.5 is with the 2ug/ml DAPI covered afterwards of fading.Cell connects 0lympus DP70 microscopic examination with 0lympus BX61 a_60 oil mirror (f-number=1.25).With DAPI nuclear being faded excites with UV laser (380nm).With Image-ProPlus software analysis image.From each model, select 50 at random, and measure the index of the tail of a comet as this model DNA oxidative damage.The data description mean+/-standard deviation of 3 independent experiments.
Active oxygen detects
Cell covers with in 24 orifice plates.Siphon away culture fluid, in each hole, add 500ul0.25M sucrose, 20mMMOPS, the 0.05mg/ml digitonin is transferred pH to 7.4, and room temperature was placed 3 minutes.Reuse contains 0.25M sucrose, 20mMMOPS, and the digitonin buffer of 20mM EDTA is transferred pH to 7.4, and room temperature was placed 5 minutes, after drying.Add again and contain 0.25M sucrose, 20mM MOPS, 20mM EDTA, the 5mM inorganic phosphate, 1mM ADP, 5mM glutamic acid, the breathing buffer of 1mM L MALIC ACID is transferred pH to 7.4 and is added 10uM carboxyl H
2DCFDA measured under 37 degrees centigrade condition mitochondrial ROS30 minute.Replace buffer, wash, cell is moved on to the Eppendorf pipe, and carry out the cell counting analysis with PBS.
Synaptophysin I and ubiquitin horizontal detection
Fluorescence immunoassay labelling method and Western blotting detect the distribution and the level of synaptophysin I and ubiquitin.Detect with the fluorescence immunoassay labelling method, cell is grown on the coverslip of 12mm, synaptophysin I and ubiquitin someone were (Arima et al1999, Zhang et al, 2004) to revise concise and to the point step as follows through some: cell subzero 20 degrees centigrade with methanol mixed 10 minutes, with PBS wash the back with 5% BSA room temperature treatment 1 hour.Giving a baby a bath on the third day after its birth time adds synaptophysin I murine antibody (1:200) and ubiquitin (1:500) rabbit antibody in the mixed cell solution in back, incubated at room half an hour, next washes 3 times with PBS.Adding FITC coupling sheep anti-mouse antibody (1:100) and TRITC coupling goat anti-rabbit antibody (1:100) afterwards gives a baby a bath on the third day after its birth inferior after hatching half an hour under 37 degrees celsius again.Added the 5ug/mlHoechst33342 incubated at room afterwards 10 minutes, after washing 3 times with PBS, cell is placed glycerol/PBS (9:1) mixture, use the micro-oily sem observation of LSM510META_ Germany _ Zeiss laser co-focusing then with 63x/1.4HCxPlanAPO.Synaptophysin I excites with argon laser (488nm), and ubiquitin excites with helium laser (543nm), and DNA excites with UV laser (364nm).
Detect with Western blotting, cell is collected, protein is extracted, make on the experiential basis that Westernblotting detects forefathers and to revise, concise and to the point step is as follows: the dissolved buffer (50mMTris-HCl of cell, 250mM NaCl, 5mM EDTA, 50mM NaF, 1%NP40,2ug/ml aprotinin, 2ug/mlleupeptin, 1mM phenylmethylsulfonyl fluoride, 700U/ml DNaseI, the above reagent of 1%beta-mercaptoethanol is all available from Sigma company).With the quantitative soluble protein of BCA protein quantification test kit, the Coomassie brilliant blue leveling detects insoluble protein.Equal protein matter adds changes film behind the 15%SDS-PAGE electrophoresis to nitrocellulose filter, with 5%BSA add TBS-T (20mM Tris, 500mM NaCl, 0.1% both mix 20) room temperature shakes and fixes 2 hours.When film soaks in synaptophysin I murine antibody (1:2000) or ubiquitin (1:500) rabbit antibody, 4 degrees centigrade of overnight incubation.Afterwards with TBS-T washing six times, each 5 minutes.Add and two anti-(synaptophysin I1:4000 sheep anti-mouse antibody, ubiquitin 1:1000 goat anti-rabbit antibody) mutually link coupled horseradish peroxidase, room temperature 1-2 hour.The fluorescent radiation autography makes light reaching the film.
The reverse transcription primer set and reverse transcriptional PCR quantitatively
The cDNA chain is synthetic with reverse transcription XL (available from Takara, Shiga, Japan company) by the total RNA of lug and a small amount of dNTP.Primer is with reference to Sherer et al., and 2002: the positive primer of β-actin, sequence are tcaccatggatgatgatatcgcc; The anti-primer sequence of β-actin is ccacacgcagctcattgtagaagg; The positive primer of synaptophysin I is aggactttcaaaggccaagg; Synaptophysin I anti-primer is tcctccaacatttgtcacttgc.These two pairs of primers can make the boundary-intersected of strumae.With the repeatedly circulation of RT-PCR instrument increase with reach quantitative purpose (Bio-Rad, Hercules, CA).The amount of these two kinds of PCR products is quantitative in this stepping line trace of the last annealing of each circulation by the fluorescence receptor of IQTM SYBER.Be reflected to contain in the positive and negative 25ul system of 200nmol and finish because of thing.The expression of each templet gene with 2-
CTMethod is calculated.Target sequence increase and begin image data again in certain size.2-
CTBe described in the curvilinear motion of gene expression in the cell after the processing.Be standard a: _ C with the expression of actin and the cell (control) that does not have to handle
T=_ C
T, Rotenone-_ C
T, Control=(C
T, synuclein-C
T, actin)
Rotenone-(C
Tsynuclein-C
T, actin)
Control.mRNA the result of level recently representing with cell after handling and Control cell.
The result
The effect of MMP
As Figure 1A (distribution of JC-1 under laser confocal microscope) and Figure 1B (quantity of fluorescence reading Analysis JC-1), the contrast reference frame, rotenone is handled and is caused the fluorescence excitation of mitochondrial membrane green by red stain, the ratio of red light intensity/green intensity reduces, and illustrates that rotenone induces mitochondrial depolarization.And LA, the pretreatment of ALCAR and combination thereof can effectively suppress this effect, and wherein LA+ALCAR (0.1 μ M or 1 μ M) is the most effective.LA10 μ M or ALCAR100 μ M are equally effective.Cell after handling through rotenone with LA or (2002) such as ALCAR pretreatment and Shere did like that at 200 μ M H
2O
2The middle processing had same effect (as Fig. 1 C) in 2 hours.Owing to add and do not add H after rotenone is handled
2O
2Same effect is not so our following all analyses add H
2O
2..
The result shows that low dosage LA+ALCAR (0.1 μ M or 1 μ M) can suppress mitochondrial depolarization most effectively.
The active analysis result of composite I
Measure the active power of mitochondrion composite I with variable concentrations DCPIP.As shown in Figure 2, find that the rotenone processing makes the vigor of composite I descend 30% than reference frame, and LA (10,100 μ M), ALCAR (100 μ M), the pretreatment of LA+ALCAR (0.1,1 μ M) can prevent this decline.And LA+ALCAR (0.1,1 μ M) is than LA, and any single concentration of ALCAR is all more effective.
The result shows that low dosage LA+ALCAR (0.1 μ M or 1 μ M) can prevent most effectively that the vigor of composite I from descending.
The ATP analysis result
Rotenone can effectively reduce the ability (Fig. 3) that cell produces ATP.LA (10 μ M) and ALCAR (100 μ M) can both effectively suppress the ATP level to be reduced.LA+ALCAR (0.1,1 μ M) also obviously suppresses the ATP level to be reduced, but the mixing of higher concentration (all being 10 μ M) just loses the effect of inhibition, and the LA of high concentration (100 μ M) loses the inhibition effect too.
The result shows that the decline that high concentration LA+ALCAR pair cell produces the ability of ATP does not have inhibitory action, and low dosage LA+ALCAR (0.1 μ M or 1 μ M) can effectively suppress the decline of this ability.
Cytochrome C discharges the result who analyzes
The release of cytochrome C can be judged by image: (Fig. 4)
1) well protected with reference to cell display line plastochondria, cytochrome C is on mitochondrion.Compound orange display line plastochondria is rich in cytochrome C on the image.The cell that rotenone was handled is orange less compared with the reference cell;
2) the cell showed cell pigment C that handles of rotenone is discharged into the cytosol from mitochondrion, colored spots is tailed off and disperses.
The result shows that LA (10 μ M) and ALCAR (100 μ M) have the effect of the release that suppresses cytochrome C, and low dosage LA+ALCAR (being 1 μ M) can effectively suppress the release of cytochrome C.
Antioxidation GSH level result
Rotenone is handled and is caused the GSH significantly sacrificing.With LA (0.1-100 μ M is except 1 μ M), the GSH loss (Fig. 5) that ALCAR (1-100 μ M is except 10 μ M) can protect rotenone to cause.LA (10 μ M) and ALCAR (100 μ M) are two kinds and act on valid density separately.
The result shows, the GSH loss that low dosage LA+ALCAR (being 1 μ M) can protect rotenone to cause most effectively.
The effect of protein carbonylation
Protein carbonylation is an important indicator of protein oxidation damage, and we analyze the back with Western blotting and survey the insoluble protein fragment with the DNPH reaction.As shown in Figure 6, compare the cell protein carbonylation rising (b) that rotenone was handled with reference frame (a).With the LA processing protein carbonylation there is not influence.ALCAR100 μ M handles protein carbonylation and obviously is suppressed.
The result shows that low dosage LA+ALCAR (0.1 μ M or 1 μ M) handles the effect that the obvious suppression protein carbonylation is arranged, and the use (10 μ M+10 μ M) of uniting of higher concentration does not suppress effect.
The effect of DNA oxidative damage
8 hydroxyl guanosine antibody fade cell, the maker of DNA oxidative damage (redness).Identical cell Hoechst33342 labeled cell nuclear morphology.Shown in Fig. 7 A and 7B, the cell 8 hydroxyl guanosine immunoreactivities that rotenone is handled raise.The cell of many DNA oxidative damages shows that broken karyomorphism is the characteristic of apoptosis.LA (10 μ M) and ALCAR (100 μ M) reduce by 8 hydroxyl guanosine immunoreactivities.
The result shows that low dosage LA+ALCAR (0.1 μ M or 1 μ M) can suppress the immunoreactive rising of 8 hydroxyl guanosines that rotenone causes.
The effect that ROS detects
Because mitochondrion is source and the target of ROS, detects that mitochondrial function that rotenone handled damages and whether be accompanied by the ROS increase oxidative damage time with DCF.As shown in Figure 8.
The result shows that the sample ROS that rotenone was handled significantly increases, and LA (10uM) and ALCAR (100uM) have remarkable protective effect to this.In addition, both low concentrations are united the defencive function that use (0.1+0.1 μ M and 1+1 μ M) also has couple ROS to increase.
The expression of synaptophysin I and ubiquitin and the analysis result of distribution
The PD symptom shows the accumulation of synaptophysin I and ubiquitin in the Cytoplasm, we are called the Lu Yishi corpusculum. and the expression of synaptophysin I and ubiquitin can be with the image of Western blotting analytical control .Western blotting and quantitative result shown in Fig. 9 A and 9B. compares with Control (a). the models show after rotenone is handled goes out the solubility level of synaptophysin I, and carrying out pretreatment with the ALCAR of the LA of 0.1-100uM or 0.1-100uM can be to because the increase of the synaptophysin I expression that rotenone causes has inhibitory action.Both also have tangible effect when the concentration of 0.1+0.1uM and 1+1uM is mixed.
The mRNA level of synaptophysin I detects with the RT-PCR method, in the cell of handling as Fig. 9 rotenone that C is shown in the amount of the mRNA of synaptophysin I with reference to having compared tangible minimizing, at the LA of 10uM and the ALCAR of 100uM, both reach the reference frame level in the mRNA level of concentration 0.1+0.1uM and 1+1uM recovery synaptophysin I.
The distributions rotenone of analyzing synaptophysin I and ubiquitin with immunofluorescence causes synaptophysin I and ubiquitin level rising (Figure 10) in the Cytoplasm.With the LA of 10uM and the ALCAR and both synaptophysin I and the rising of ubiquitin level in the mixture of concentration 0.1+0.1uM and 1+1uM matter capable of inhibiting cell of 100uM.
The result shows:
Low dosage LA+ALCAR (0.1 μ M or 1 μ M) can obviously suppress the increase that synaptophysin I expresses;
Low dosage LA+ALCAR (0.1 μ M or 1 μ M) can make the mRNA level of synaptophysin I recover to reach the reference frame level;
Low dosage LA+ALCAR (0.1 μ M or 1 μ M) can suppress synaptophysin I and the rising of ubiquitin level in the Cytoplasm.
The synergism of LA and ALCAR (experiment of PD fruit bat behavioristics)
Material and method
Change the fruit bat Parkinson's disease model (by synaptophysin I transgenic type fruit bat and Uas-DDC-gal4 drosophila hybrid gained) (available from the U.S.) of synaptophysin I gene over to, parkinson fruit bat model tormulation synaptophysin I, and losing at the back generation dopamine neuron of growing up, occur the inclusions that the filament shape contains synaptophysin I in the neuron, obstacle (seeing Figure 49) appears in motor function.This fruit bat model possesses the basic feature (Feny, 2000) of human body Parkinson's disease.
From fruit bat emergence beginning, male and female are experiment separately, and fruit bat is divided into 0X at random, 0.2X, 1X, 5X, 10X, 20X, a plurality of experimental grouies such as 50X, every group comprises each 170-300 left and right sides fruit bat of male and female, the female parent of PD fruit bat (being α-syn fruit bat) itself is not expressed synaptophysin I, emergence in the time of back 3 days its motor capacity test value be identical with the PD fruit bat, can be used as non-PD contrast (non-PD).
All fruit bats are cultivated with culture tube under 12 hours illumination conditions all 25 ℃, 50-60% humidity.
The fruit bat culture medium adopts corn yeast culture medium (wherein the yeast powder that dissolving is good adds and stirs) when temperature drops between 60-70 ℃, and adds the growth of propanoic acid mould fungus inhibition; Culture medium is heated to below the boiling postcooling to 45 ℃, adds related drugs to desired concn (0X, 0.2X, 1X, 5X, 10X, 20X, dosage such as 50X).Ready-made culture medium covers with gauze, adds bottle stopper after the water evaporates and puts into the refrigerator preservation.6 days shelf-lifves
The culture medium adding method thereof: (a) final quantity of solvent is as the criterion by the 10ml/100g culture medium, and matched group only adds the 10ml solvent; Water miscible medicine is directly with 6ml water dissolution (can be made into concentrated solution in advance); Fat-soluble medicine earlier with the water that adds 6ml behind the sucrose acid fat hydrotropy again (because of the medicine distinct methods slightly variant), cosolvent can be used dimethyl sulfoxine, DMSO (<10%), the sour fat (<0.5%) of sucrose, polysorbas20 etc.; (b) be adjusted accordingly when making up a prescription according to physicochemical characteristicses such as the heat resisting temperature of various medicines, illumination reaction, dissolubility, do not add simultaneously when water soluble drug and fat-soluble medicine are used with.(c) wherein 5X, 10X, 20X, 50X, 100X dosage group are illustrated in the mg number of medicine contained in the 100g culture medium respectively.
Climbing aptitude tests experiment: the beginning in back 3 days of sprouting wings certainly, carried out once in per 6 days.With diameter 27mm, the glass tubing of long 110mm is as testing tube, making a number of altitude apart from bottle end 80mm place, 10 fruit bats Guan Zhonghou that packs into, vibrations make fruit bat fall the pipe end gently, and record is climbed to 80mm and highly reached above fruit bat quantity, follow-on test 10 times during 10 seconds, and highly reach above fruit bat quantity according to the 80mm of these 10 times records and calculate every fruit bat and climb to the probit that 80mm highly locates at every turn, with this climbing index as this pipe fruit bat.
Simultaneously, fruit bat was changed a subculture in 3 days, write down per 3 days fruit bat death toll simultaneously, utilized EXCEL software to make survival rate-emergence age curve in view of the above, and its life-span is investigated.
Life span of drosophila melanogaster is learned, the test data of climbing ability is all utilized the EXCEL software processes.。
The result
See Figure 40-48.
The result shows that the 20X of LA, 50X dosage group can be improved the climbing ability of PD fruit bat, prolong its life-span to a certain extent; 5X, 10X, 20X dosage group can suppress the expression of synaptophysin I preferably at mRNA level and protein level, but 50X dosage group is comparatively outstanding aspect the protection dopamine neuron.The 5X of ALCAR, 10X, 20X dosage group all can effectively prolong the life-span of PD fruit bat, but the climbing ability of PD fruit bat is not all had influence.
The 10X of LA+ALCAR, 20X dosage group all can effectively prolong the life-span of PD fruit bat, and the LA that effect is better than 10X dosage group acts on separately, and the 5X of LA+ALCAR, 20X dosage group all can effectively improve the climbing ability of PD fruit bat.
VitB
5, VitB
6, VitB
11And VitB
12Synergism
Experimental technique identical with described in the embodiment 11.The dosage method for expressing of VitB5, VitB6, VitB11 and VitB12 slightly different (seeing Table 1-7) only.
The dosage of VitB5, VitB6, VitB11 and VitB12 is expressed as follows shown in the 1-7:
Table 1
Table 2
Table 3
Table 4
Table 5
Table 6
Table 7
The result
1. see Figure 11-14.
The result shows that the independent use of VB5 can prolong the life-span of the male fruit bat of PD, but its climbing ability is not had effect.To female PD fruit bat, VB5 is not except having the ability of climbing the improvement effect, low dosage (1X 5X) does not have obvious influence to the life-span, high dose have life-saving effect (20X, 100X).
2. see Figure 15-18.
The result shows that the independent use of VB12 can improve the climbing ability of the male fruit bat of PD, but its life-span is not had the prolongation effect.To female PD fruit bat, VB12 is not so good as male to the improvement effect of climbing ability, and is less to its life-span influence.
3. see Figure 19-22.
The result shows that the independent use of VB6 can prolong the life-span of the male fruit bat of PD, but its climbing ability is not had effect, and VB6 can protect dopamine neuron simultaneously.To female PD fruit bat, VB6 can prolong its life-span, but its climbing ability is not had effect.
4. see Figure 23-26.
The result shows that VB11 effect does not separately all have obvious influence to climbing ability and the life-span of male PD fruit bat.To female PD fruit bat, VB11 has small improvement effect to its climbing ability and life-span.
5. see Figure 27-30.
The result shows that the VB5+VB12 synergy does not all have obvious influence to climbing ability and the life-span of male PD fruit bat.Under the VB5+VB12 synergy, all indeterminate to the climbing ability and the influence in life-span of female PD fruit bat.
6. see Figure 31-34.
The result shows that VB6, VB11, VB12 three's synergy all do not have obvious influence to climbing ability and the life-span of male PD fruit bat.Similarly, VB6, VB11, VB12 three's synergy all do not have obviously influence to climbing ability and the life-span of female PD fruit bat yet.
7. see Figure 35-38.
The result shows that when VB5, VB6, VB11, VB12 synergy, 1X, 20X, three dosage combinations of 100X all had a significant effect to climbing ability and the life-span of male PD fruit bat.For female PD fruit bat, when VB5, VB6, VB11, VB12 synergy, 1X, 10X, four dosage of 20X, 100X make up the effect of having clear improvement of climbing ability, and little to the life-span effect.
In sum, though VB5, VB6, VB11 and VB12 have depression effect (seeing Figure 54) in varying degrees to being expressed in of synaptophysin I, but do separately a little less than the influence of time spent to motor capacity and life-span, when in twos, three kinds of compositions make up, certain effect is arranged, when four kinds of composition synergy, the climbing ability of PD fruit bat is improved and life-time dilatation has obvious effect, mechanism wherein may with the depression effect relevant (seeing Figure 55) to synaptophysin I expression.
LA, ALCAR, VitB
5, VitB
6, VitB
11And VitB
12Synergism
Material and method
After the neural fibroblast of SK-N-MC is handled 72 hours with LA, ALCAR, VB5, VB6, VB11, VB12, adding MTTP (250 μ m) handled 72 hours, remove culture medium, adding 5mg/mLMTT hatched 3 hours under 37 ℃ of conditions, measure the absorbance value under the 550nm, with the absorbance value of 550nm index as cytoactive.
Table 8: each experimental group adding medicine scale
LA(μmol/L) | ALCAR(μmol/L) | VB5(mg/L) | VB6(mg/L) | VB11(mg/L) | VB12(mg/L) | |
Matched |
0 | 0 | 0 | 0 | 0 | 0 |
LA+ |
1 | 1 | 0 | 0 | 0 | 0 |
VB5+VB6+VB11+ |
0 | 0 | 10 | 10 | 10 | 14 |
LA+ALCAR+VB5+VB6+VB11+ |
1 | 1 | 10 | 10 | 10 | 14 |
The result
See Figure 39.
The result shows, LA, ALCAR, VitB5, VitB6, VitB11 and VitB12 coupling, and its protective effect to the Parkinson's disease cell model strengthens 3% than LA and ALCAR coupling, strengthens 8% during than VitB5, VitB6, VitB11 and VitB12 coupling.
LA, VitB
5, VitB
6, VitB
11And VitB
12And joint effect is to the influence of PD fruit bat synaptophysin I gene expression with to the protective effect of dopamine neuron
Material and method
The fruit bat Parkinson's disease model that utilizes synaptophysin I gene as hereinbefore is as investigating object, maternal fruit bat (α-syn fruit bat) or male parent fruit bat (uas-DDC-gal4 fruit bat with the PD fruit bat, be the DDC fruit bat) as non-PD contrast, fruit bat raising and administration, and equal employing methods identical such as dosage with previous embodiment 10-13.When fruit bat reaches corresponding age, in each experimental group, randomly draw under 4 ℃ of conditions of fruit bat of some (about 200) its broken end is drawn materials, head homogenate is centrifugal, isolate protein and RNA composition, according to carrying out the RT-PCR experiment of synaptophysin Iwestern-bloting or mRNA with cytologic experiment part similar methods; Perhaps with the fruit bat cranial anatomy, take out nervous tissue and carry out immunohistochemical experiment, method is with reference to cytology's part experiment content.
The result
See Figure 50-51.
The result shows that the LA of 10X dosage has depression effect to the expression of synaptophysin I.
See Figure 52.
The result shows that the LA of 20X dosage has depression effect to synaptophysin I expression of gene.
See Figure 53.
The result shows, VitB
6Can stop losing of PD fruit bat dopamine neuron with the LA of 20X dosage.
See Figure 54.
The result shows, LA, VitB
5, VitB
6, VitB
11And VitB
12Expression to synaptophysin I all has depression effect respectively.
See Figure 55.
The result shows, VitB
5+ VitB
6+ VitB
11+ VitB
12Synaptophysin I expression of gene there is depression effect.
Discuss
The present invention is directed to the multifactorial pathogenesis of PD, selection 6 kinds of nutrients that reparation has certain effect at mitochondrial injury are as main constituents, by various combination, unite in different loci respectively and play a role, ensure mitochondrial homergy function, to reach prevention effect to PD.
Particularly, pantothenic acid (VB5) is coenzyme A (CoA) precursor, partly form by the phosphopantetheine of coenzyme A and fatty acid synthase, thereby very important to the generation of acetyl-CoA.Pantothenic acid lacks makes the synthetic decline of heme in the monkey, and causes anemia (Plesofsky-Vig, 1996).Mitochondrion complex IV reduces (Brambl and Plesofsky-Vig, 1986) in the cephalo fungus of shortage pantothenic acid, and the iron content of complex IV also reduces (Brambl andPlesofsky-Vig, 1986), and this has caused the disappearance of mitochondrion complex IV.Fatty acid and pantothenic acid are to guarantee heme biosynthesis precursor---the micro material of S-(3-carboxy-propionyl)-coenzyme-A regular supply, and the shortage of any one will be synthesized by reducing heme with the egg-white injury similar mechanism.Have now found that surpassing 70 kinds of enzymes utilizes coenzyme A that pantothenic acid produces or derivant as reaction substrate.
VB6 is the precursor of pyrrole diindyl aldehyde 5-phosphoric acid (PLP), PLP is the synthetic necessary coenzyme of DA, also participate in synthetic (the Scholnick et al. of heme directly, 1972), people in the U.S. about 10% takes in vitamin B6 less than half (the Wakimoto and Block that recommends intake every day (RDA), 2001), thus VB6 be metabolic critical limitation factor.Heme lack perhaps be a factor decaying of mitochondrion in ageing process and neurocyte (Atamna et al., 2002.a).Heme is a major function form of ferrum in the cell, and it is synthetic that it inserts ferroprotoporphyrin IX at mitochondrion by ferrochelatase.Heme lacks the mitochondrion complex IV that makes in the brain cell to be reduced, and activates nitric acid oxidation thing synzyme, change amyloid precursor protein matter, and environment is constant in destruction ferrum and the zinc.The generally shortage of ferrum and B6 causes its cognitive difficulties, and child's iron deficiency can be delayed development (Benton, 2001 of CNS; Tamura et al., 2002).Thereby heme lacks or perhaps dysregulation is that (Atamna et al., 2002.a), but this still can be prevented by additional VB6 for an important and avertible part of neural deterioration process.
Folic acid (VB11) is the synthesis material of the derivant of various carbon tetrahydrofolates, nucleic acid synthetic with methylation reaction in play important effect, these reaction pair brain normal functions are most important.Folic acid deficiency will influence the synthetic of nuclear DNA or mtDNA, reduce the utilizability of purine and dTMP.Compare with cytoplasmic tetrahydrofolate synzyme, mitochondrion contains higher levels of folic acid coenzyme.The mitochondrion of central lobe acid coenzyme contains more glutamate, Glu long-chain, be distributed with notable difference in this and the liver, it is closely related with cognitive power damage, parkinson, Alzheimer and other kinds dementia disease that folate level reduces or homocystine content raises.(Carl?et?al.,1996)
VB12 has physiological action widely, but just has activity after need being converted into methylcobalamin and actimide, in the mankind's tissue, have two kinds of biochemical reactions to need the participation of vitamin B12: a kind of is the reaction of synthesizing methionine from homocysteine, wherein the tetrahydrofolic acid that produces participates in the synthetic of DNA, and it is synthetic to participate in thymidylic acid indirectly; Another kind is that the Isosuccinic acid coenzyme A changes succinate coenzyme A into, participate in tricarboxylic cycle, thereby to the formation of lipoprotein in the neural myelin, the functional completeness of the myelinated nerve fiber of protection maincenter and periphery plays an important role.Participate in protein and lipid metabolism etc. widely simultaneously.VB12 is strong to neurotropism, the neural myelin of reparation is arranged, promote regeneration.
(Duan et al. on a parkinson animal model, 2002) and with discovery plasma levels of homocysteine among the patient of L-DOPA treatment increase, and this homocysteine levels and VB11, VB12 and pyridoxal 5-phosphate salt level have negative correlation (Miller et al., 2003).
Alpha-lipoic acid (LA) and reduction form dihydrolipoic acid thereof are the coenzyme of ketoglurate dehydrogenase and the coenzyme of pyruvic dehydrogenase; Belong to multi-functional polyphenoils, can remove free radical, the antioxidant that recirculation produces other (comprises glutathione, vitamin C, CoQ and sulfur hydrogen reduction albumen, these all steps can both recirculation produce vitamin E), and chelating catalytic metal (for example ferrum) prevents the generation of free radical; Induce the generation phase 2 enzyme.
Acetyl-L carnitine (ALCAR) is the acetyl derivative of L-carnitine, can pass mitochondrial membrane, long-chain fatty acid can be changed over to the mitochondrion energy supply, increases the level of cardiolipin, increases Repiration and is counted as secondary antioxidants.Carnitine levels in animal (the comprising the mankind) tissue is with age growth descend (Costell etc., 1989; Liu etc., 2002a; Maccari etc., 1990) thus reduce the mitochondrial membrane integrity.For big mice; studies show that of animals such as dog class; additional ALCAR can improve and old and feeble relevant cognitive power obstacle; promote neuranagenesis; the neuroprotective cell avoids the mitochondrion uncoupling agents and inhibitor is poisoned; alleviate brain local anemia and the nerve injury after the perfusion again, improve glutathione and GABA level in the brain.
The present invention's fruit bat Parkinson's disease model (by synaptophysin I transgenic type fruit bat and uas-DDC drosophila hybrid gained) that changes synaptophysin I gene over to, parkinson fruit bat model tormulation synaptophysin I, and losing at the back generation dopamine neuron of growing up, occur the inclusions that the filament shape contains synaptophysin I in the neuron, obstacle appears in motor function.Because this fruit bat model possesses the basic feature of human body Parkinson's disease, therefore can utilize this genetic method to carry out the research of Parkinson's disease.
The present invention shows, VB5, VB6, VB11, VB12 do the time spent separately and have certain effect for the improvement and the life-time dilatation of PD fruit bat motor capacity, but concerning each concrete dosage, all can't reach motor capacity and all very effective effect of life-span, even can run into the antipodal phenomenon of the effect of the two; Joint effect slightly when VB5 and VB12 combination, consistent to motor capacity and the influence in life-span trend, and it is relative better with the effect of 20X dosage group to observe 1X on female PD fruit bat, but influence degree is less; When VB6, VB11 and VB12 three make up, observe medicine on the PD fruit bat motor capacity and life-span are not all had positive effect; Only when VB5, VB6, VB11 and VB12 synergy, motor capacity and life-span that we observe the PD fruit bat improve significantly, the non-PD contrast fruit bat group of being on close level.
The LA that makes time spent 50X dosage group separately is all effective to motor capacity and the life-span of PD fruit bat, and ALCAR has only prolonged the life-span of PD fruit bat, to not influence of motor capacity.During the two synergy, 10X dosage group is better than the independent effect of 10X dosage LA to the effect of PD fruit bat motor capacity.
Because the approach that VB5, VB6, VB11, VB12, LA and ALCAR play a role in vivo is different, so their synergy to each other are better than the effect of single medicine, and the more stable and safety of curative effect under the synergy condition.Cell survival rate in the MTT environment after the LA+ALCAR+VB5+VB6+VB11+VB12 pretreatment among the present invention is than LA+ALCAR pretreatment or the pretreated cell survival rate height of VB5+VB6+VB11+VB12.
The present invention utilizes the chronic rotenone model (5nM, 4 weeks) of SK-NM-C to reproduce the toxic effect of rotenone to mitochondrial function as an external PD model in the further research to mechanism of drug action.The pathological characters (accumulation of synaptophysin I and ubiquitin level increases) of (compound enzyme 1 active reduction the, MMP and ATP level reduce, cytochrome C release increase) oxidative pressure (protein acyl group and 8-OXO-dG increase for losing of glutathion, ROS) and PD.The inventor is at the PD pathological characters, mitochondrial function and oxidation and the several aspects of anti-oxidative damage biomarker, research with LA (0.1,1,10,100uM), ALCAR (0.1,1,10,100uM) and the combination of their different component carry out 4 all effects of pretreatment.
The molecular pathology performance of PD is the mitochondrial function defective.In this cell model, the release of complex 1 active reduction, the increase of ATP waste and cytochrome enzyme C on the mitochondrial inner membrane after rotenone is handled increases.Two kinds of chondriosome nutrients of the LA of suitable dose and ALCAR have therapeutical effect to the mitochondrion after handling with rotenone.The most effective dosage is the LA of 10uM and the ALCAR of 100uM, and after both mix use, and effective dose appears at 0.1 and 1uM, and this best proportioning is more single with much effective than any.The such chondriosome nutrient of LA and ALCAR can effectively suppress the generation and the oxidative damage of the cell oxygen-derived free radicals that rotenone causes.
The most obvious performance of PD symptom is the accumulation of synaptophysin I and ubiquitin.The adjusting of this explanation complex I is the key of synaptophysin I accumulation level, and the synaptophysin I of high expressed amount brings out oxidative damage.In addition, the minimizing of oxidative damage and cytochrome C also can make synaptophysin I assemble.The concrete variation of the PD cell model after rotenone is handled is the remarkable increase of synaptophysin I and ubiquitin protein in the Cytoplasm.Therefore, whether LA and ALCAR can be used to prevent the generation and the treatment of PD disease, depend on that can they stop these protein expressions and distribution.
In a word, the present invention proves that chondriosome nutrient VB5, VB6, VB11, VB12, LA and ALCAR and various combination thereof have different curative effects on PD fruit bat model, and VB5, VB6, VB11 and VB12 use in conjunction, or the effect of LA and ALCAR use in conjunction is better than the independent effect of medicine.LA and ALCAR have certain effect to the accumulation that suppresses the mitochondrial dysfunction of PD cell model, oxidative damage and prevention synaptophysin I and ubiquitin.And two kinds of medicines of LA and ALCAR mixture of (0.1-1uM) when low concentration shows a kind of positive coopertive effect, and it is all effective that this any medicine than 10 times of concentration of independent usefulness comes that rotenone is handled the mitochondrial function disorder and the oxidative damage that cause.In addition, the protective effect of LA+ALCAR+VB5+VB6+VB11+VB12 pair cell is better than the combination of LA+ALCAR or VB5+VB6+VB11+VB12.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (5)
1. a compositions is characterized in that, the chondriosome nutrient in the described compositions is made of following manner;
Described chondriosome nutrient is:
(i) 5-150 weight portion vitamin B5;
(ii) 2-1000 weight portion vitamin B6;
(iii) 0.4-40 weight portion VB11; With
(iv) 0.003-1 weight portion vitamin B12;
Or:
(i) 5-150 weight portion vitamin B5;
(ii) 2-1000 weight portion vitamin B6;
(iii) 0.4-40 weight portion VB11;
(iv) 0.003-1 weight portion vitamin B12;
(v) 100-350 weight portion R-thioctic acid; With
(vi) 100-2000 weight portion acetyl-L-carnitine.
2. compositions as claimed in claim 1 is characterized in that, described chondriosome nutrient is:
(i) 15-50 weight portion vitamin B5;
(ii) 50-300 weight portion vitamin B6;
(iii) 1-10 weight portion VB11; With
(iv) 0.01-0.2 weight portion vitamin B12;
Or:
(i) 15-50 weight portion vitamin B5;
(ii) 50-300 weight portion vitamin B6;
(iii) 1-10 weight portion VB11;
(iv) 0.01-0.2 weight portion vitamin B12;
(v) 150-250 weight portion R-thioctic acid; With
(vi) 180-500 weight portion acetyl-L-carnitine.
3. preparation of compositions method as claimed in claim 1 is characterized in that it comprises step:
1. chondriosome nutrient is mixed in the following manner, form compositions;
Described chondriosome nutrient is: (i) 5-150 weight portion vitamin B5; (ii) 2-1000 weight portion vitamin B6; (iii) 0.4-40 weight portion VB11; (iv) 0.003-1 weight portion vitamin B12;
Or: (i) 5-150 weight portion vitamin B5; (ii) 2-1000 weight portion vitamin B6; (iii) 0.4-40 weight portion VB11; (iv) 0.003-1 weight portion vitamin B12; (v) 100-350 weight portion R-thioctic acid; (vi) 100-2000 weight portion acetyl-L-carnitine.
4. method as claimed in claim 3 is characterized in that, step 1. in, with (i) 15-50 weight portion vitamin B5; (ii) 50-300 weight portion vitamin B6; (iii) 1-10 weight portion VB11; (iv) 0.01-0.2 weight portion vitamin B12 is mixed, and makes compositions;
Or with (i) 15-50 weight portion vitamin B5; (ii) 50-300 weight portion vitamin B6; (iii) 1-10 weight portion VB11; (iv) 0.01-0.2 weight portion vitamin B12; (v) 150-250 weight portion R-thioctic acid; (vi) 180-500 weight portion acetyl-L-carnitine is mixed, and makes compositions.
5. the purposes of a compositions as claimed in claim 1 is characterized in that, described compositions is used to prepare prevention, treat or improve the medicine of Parkinson's disease, or is used to prepare the dietary supplement that prevents or improve Parkinson's disease.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2006100259079A CN101057857B (en) | 2006-04-21 | 2006-04-21 | Composition for preventing and improving Parkinson disease and its preparation method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2006100259079A CN101057857B (en) | 2006-04-21 | 2006-04-21 | Composition for preventing and improving Parkinson disease and its preparation method |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101057857A CN101057857A (en) | 2007-10-24 |
CN101057857B true CN101057857B (en) | 2011-05-18 |
Family
ID=38864260
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2006100259079A Expired - Fee Related CN101057857B (en) | 2006-04-21 | 2006-04-21 | Composition for preventing and improving Parkinson disease and its preparation method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101057857B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107772165B (en) * | 2017-10-30 | 2020-11-10 | 山西大学 | Feed for accelerating growth speed of fruit fly strain and production method thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1315835A (en) * | 1998-09-01 | 2001-10-03 | 希格马托保健科学股份公司 | Antioxidant composition comprising acetyl L-carnitine and alpha-lipoic acid |
US20050238710A1 (en) * | 2004-04-23 | 2005-10-27 | Philip Connolly | Vitamin replacement as a hangover ameliorative |
-
2006
- 2006-04-21 CN CN2006100259079A patent/CN101057857B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1315835A (en) * | 1998-09-01 | 2001-10-03 | 希格马托保健科学股份公司 | Antioxidant composition comprising acetyl L-carnitine and alpha-lipoic acid |
US20050238710A1 (en) * | 2004-04-23 | 2005-10-27 | Philip Connolly | Vitamin replacement as a hangover ameliorative |
Also Published As
Publication number | Publication date |
---|---|
CN101057857A (en) | 2007-10-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Barile et al. | Riboflavin transport and metabolism in humans | |
Bottiglieri | Folate, vitamin B12, and neuropsychiatric disorders | |
Patel | Mitochondrial dysfunction and oxidative stress: cause and consequence of epileptic seizures | |
Dayal et al. | ADMA and hyperhomocysteinemia | |
Tang et al. | Innovative therapy for Classic Galactosemia—Tale of two HTS | |
JP2007516227A (en) | Pyrrole compounds and uses thereof | |
US20130295068A1 (en) | Combination preparation for improving sperm quality | |
EP2562176B1 (en) | Medicinal agent and beverage/food for preventing cerebral dysfunction and improving same | |
Weber et al. | Olesoxime in neurodegenerative diseases: Scrutinising a promising drug candidate | |
Ghatge et al. | Inborn errors in the vitamin B6 salvage enzymes associated with neonatal epileptic encephalopathy and other pathologies | |
Serrano-García et al. | Docosahexaenoic acid protection in a rotenone induced Parkinson's model: Prevention of tubulin and synaptophysin loss, but no association with mitochondrial function | |
WO2006125548A1 (en) | Use of pyrazolopyrimidine against cardiovascular diseases | |
US11369615B2 (en) | Agent for improving mitochondrial dysfunction, preventative or therapeutic agent for diseases or symptoms caused by mitochondrial dysfunction, and applications therefor | |
Song et al. | The Safety and Anti-Ageing Effects of Nicotinamide Mononucleotide in Human Clinical Trials: An Update | |
US20240115566A1 (en) | Methods of treating disorders associated with castor | |
US20230114280A1 (en) | Compositions and methods containing reduced nicotinamide riboside for prevention and treatment of neurological diseases and conditions | |
CN101057857B (en) | Composition for preventing and improving Parkinson disease and its preparation method | |
Kalani et al. | Mitochondrial mechanisms in Alzheimer’s disease: Quest for therapeutics | |
Kansara et al. | Folic acid transport via high affinity carrier-mediated system in human retinoblastoma cells | |
CN114080222A (en) | Compositions and methods for using trigonelline to produce intracellular nicotinamide adenine dinucleotide (NAD +) for treating or preventing physiological disorders or conditions | |
US20210381022A1 (en) | Integrated drug discovery platform for inborn error of metabolism disorders | |
Hansen et al. | Antisense modulation of 5, 10-methylenetetrahydrofolate reductase expression produces neural tube defects in mouse embryos | |
CA3143608A1 (en) | Use of disulfiram or its derivatives for the treatment of mitochondrial diseases or dysfunction | |
JP2011513257A (en) | Use of S-adenosylmethionine (SAM) and superoxide dismutase (SOD) for the preparation of a medicament for the treatment of Alzheimer's disease | |
Lehmann et al. | Folinic acid is neuroprotective in a fly model of Parkinson’s disease associated with pink1 mutations |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CP03 | Change of name, title or address |
Address after: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee after: Shanghai Institute of nutrition and health, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
CP03 | Change of name, title or address | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110518 |
|
CF01 | Termination of patent right due to non-payment of annual fee |