CN101052721A

CN101052721A - Botryosphaeria rhodina polypeptide

Info

Publication number: CN101052721A
Application number: CNA2005800341202A
Authority: CN
Inventors: 柯克·M·施诺尔; 莱纳·兰格; 珀尼尔·U·博尔韦格
Original assignee: Novo Nordisk AS
Current assignee: Novo Nordisk AS
Priority date: 2004-08-06
Filing date: 2005-08-06
Publication date: 2007-10-10

Abstract

The invention relates to functional polypeptides secreted from Botryospaeria rhodina CBS 247.96.

Description

The polypeptide of Botryosphaeria Rhodina

Invention field

The present invention relates to by cotton look two spores (Diplodiagossypina) with preserving number CBS 274.96 preservations, different name is the coded functional polypeptide of polynucleotide that comprises among the mRNA of Botryospaeria rhodina.The invention still further relates to these polypeptide of coding or help the polynucleotide of their expression or the construct of these polynucleotide, and the method for preparing this polypeptide.The invention still further relates to the purposes of the composition that comprises this polypeptide and this polypeptide.

Background technology

Botryosphaeria rhodina (Berk.﹠amp; M.A.Curtis) Arx, (different name Diplodiagossypina Cooke).The report of having delivered at present about the feature description of this biology is considerably less; People such as Selbmann have reported exopolysaccharide (exopolysaccharide) production (the Selbmann L of Botryosphaeria rhodina in 2003, Stingele F and Petruccioli M (2003) .Exopolysaccharide production by filamentous fungi:the example ofBotryosphaeria rhodina.Antonie van Leeuwenhoek, 84:2, pp.135-145).There is one piece of independent patent to relate to and uses the sweetener (CH654567-A) of Botryosphaeria rhodina hydroxylation β-damascone as tobacco.Can also produce jasmonic (EP1118672-A) by this biology that ferments.Before reported the existence of cellobiohydrolase (cellobiohydrolases) (WO 03/000941-A2) and Sumylact L (WO 01/49878-A).

In the seeking of new enzyme, also know by possible material standed for being carried out specific enzymatic determination and screen so new enzyme.This method is subjected to the restriction of the operability of enzymatic determination, and can not still unknown functional enzyme or the polypeptide of identified activity.

In addition, full gene sequencing (whole genome sequencing) is the currently known methods of a kind of acquisition from the information on all genes of specific microorganism, for example people such as Fleischmann; Wholegenome sequences and assembly of Haemophilus influenzae Rd; Nature 269:496-512; (1995) as described in.

Most of enzymes of industrial application are all by the enzyme of microorganism secretion in the medium.But it is encoded secreted protein that the genome of microorganism has only percentum.For example, subtilis (Bacillus subtilis) genome or its immediate affinity species have only 4% to be encoded secreted protein.(people such as Van Dijl: Protein transport pathways in Bacillus subtilis:a ge-nome-based road map; In " Basillus subtilis and it ' s closest relatives "-Fromgenes to cells; P.337-355; A.L.Sonenshein compiles; ASM Press 2002).

One of shortcoming of gene order-checking is that the overwhelming majority of institute's calling sequence is that the non-secretion of coding is proteinic.

Especially, for example for the fungi, another shortcoming of gene order-checking is that genomic size is bigger a lot of times than bacterial genomes, thereby finds that by this method gene will expend more cost and time for eukaryote.

The cDNA random sequencing (expressed sequence tag, or claim EST) be the means that another kind can be found secretory protein.Usually, the EST method has two shortcomings with regard to the evaluation of secretory protein: 1) depend on the used inductive condition in cDNA library that is checked order, have only cDNA seldom, be generally 0.5%-15% or even the cDNA encoded secreted protein of 1-5%; 2) all clones are from cDNA pond (pool), and this cDNA pond is to get with mRNA that each special genes exists pro rata biology from these.

Another kind of known method is signal capture (signal trapping), and this method comes the gene of identification code signal peptide to comprise Nucleotide by merging with the outer reporter gene translation of the born of the same parents that self lack signal.

Summary of the invention

The genome of microorganism comprises the different gene of thousands of kinds, some of them coded polypeptide, some coding RNAs.The such functional polypeptide of genes encoding that has only limited quantity in the microbial genome, they by this microorganism secretion in the medium to realize its external function.

These polypeptide can be produced in the successive process with significant amount, and do not destroy the cell that produces these polypeptide, from this point see they industrial be interesting.

The objective of the invention is to identify and provide by the polypeptide that plays functional effect with the Botryosphaeria rhodina excretory of preserving number CBS 274.96 preservations, to Botryosphaeria rhodina, because these polypeptide not only can be used for industrial use, and can be with industry relevant process/method and output production.

The present invention provides isolated polypeptide in aspect first, it is selected from:

(a) comprise the polypeptide of aminoacid sequence, described aminoacid sequence with by SEQ ID NO:2,4,6,8,10,12,14,16,18,20,22,24,26, the mature polypeptide that is comprised in 28,30 32,34,36,38,40 and 42 groups that constitute has at least 90% identity;

(b) by the nucleotide sequence encoded polypeptide, this nucleotides sequence is listed under the height stringent condition and polynucleotide probes hybridization, and described polynucleotide probes is selected from:

(i) complementary strand of nucleotide sequence, described nucleotide sequence are selected from SEQ ID NO:1, and 3,5,7,9,11,13,15,17,19,21,23,25,27,39,31,33, the zone of 35,37,39 and 41 encoding mature polypeptide,

The (ii) complementary strand of the cDNA sequence that is comprised in the nucleotide sequence, described nucleotide sequence is selected from SEQ ID NO:1, and 3,5,7,9,11,13,15,17,19,21,23,25,27,39,31,33, the zone of 35,37,39 and 41 encoding mature polypeptide,

Wherein said polypeptide has the NO:2 by SEQ ID, the function of the corresponding mature polypeptide that is comprised in 4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40 and 42 groups that constitute.

Another aspect of the present invention relates to isolating enzyme, and it is selected from:

(a) comprise the enzyme of aminoacid sequence, described aminoacid sequence has at least 90% identity with the aminoacid sequence that is selected from the maturing enzyme of the secreted zytase of the Botryosphaeria rhodina bacterial strain of CBS preserving number 274.96 preservations, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase (endo-arabinase) and peptic peptidase.

(b) by nucleotide sequence coded polypeptide, this nucleotides sequence be listed in the height stringent condition down be selected from following polynucleotide probes and hybridize:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preserving number, and encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, B-Polyglucosidase, inscribe arabinase and peptic peptidase

The complementary strand of the cDNA sequence that (ii) nucleotide sequence comprised, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preserving number, and the encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase;

Wherein said enzyme has the function that is selected from zytase, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase.

Other aspect of the present invention provides the polynucleotide of code book invention polypeptide; The constructs that comprises the polynucleotide of this polypeptide of encoding, wherein said polynucleotide are operably connected with the regulating and controlling sequence that one or more instruct this polypeptide to produce in host cell; Comprise the recombinant expression vector of constructs of the present invention and comprise the recombinant host cell of constructs of the present invention.

Another aspect of the present invention provides the method for preparation polypeptide of the present invention, comprising:

(a) the strain system of cultivating the nucleotide sequence that comprises code book invention polypeptide is to produce described polypeptide, and wherein said strain is to express this polypeptide of justacrine; And

(b) reclaim this polypeptide.

Other aspect of the present invention provides the composition that comprises polypeptide of the present invention, and prepares such method for compositions, comprises polypeptide of the present invention and mixed with excipients.

Other aspect of the present invention provides polypeptide of the present invention or comprises the purposes of composition in multiple application of described polypeptide.

Sequence table

The present invention comprises the information of sequence table form, and it invests among the application and on the data carrier together with the application and submits to.The content of data carrier is all incorporated this paper by reference into.Be selected from SEQ ID NO:1,3,5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35, the zone of the encoding mature polypeptide of 37,39 and 41 sequence, coding is selected from SEQ ID NO:2 respectively, 4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38, the mature polypeptide of 40,42 sequence.So the mature polypeptide sequence that comprises among the regional code SEQ ID NO:2 of the encoding mature polypeptide of SEQ ID NO:1, the mature polypeptide sequence that comprises among the regional code SEQ ID NO:4 of the encoding mature polypeptide of SEQ ID NO:3, the rest may be inferred.

Description of drawings

There is not accompanying drawing.

Detailed Description Of The Invention

Definition

As following used, term " A_DNAGroup " refer to the NO:1 by SEQ ID, the group of 3,5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39 and 41 nucleotide sequences that form. Therefore, be contained in or be selected from by " A when mentioning_DNAGroup " sequence set that forms (or is contained in or is selected from " A_DNAGroup ") nucleotide sequence the time, refer to that this sequence is contained in or is selected from the NO:1 by SEQ ID, the group of 3,5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39 and 41 nucleotide sequences that form.

As following used, term " E_DNAGroup " refer to the NO:1 by SEQ ID, the group of 3,5,7,9,11,13,15,17,33,35,37,39 and 41 nucleotide sequences that form. Therefore, be contained in or be selected from by " E when mentioning_DNAGroup " sequence set that forms (or is contained in or is selected from " E_DNAGroup ") nucleotide sequence the time, refer to that this sequence is contained in or is selected from the NO:1 by SEQ ID, the group of 3,5,7,9,11,13,15,17,33,35,37,39 and 41 nucleotide sequences that form.

Similarly, as following used, term " B_PolypeptideGroup " refer to the NO:2 by SEQ ID, the group of 4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40 and 42 peptide sequences that form. Therefore, be contained in or be selected from by " B when mentioning_PolypeptideGroup " sequence set that forms (or is contained in or is selected from " B_PolypeptideGroup ") peptide sequence the time, refer to that this sequence is contained in or is selected from the NO:2 by SEQ ID, the group of 4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40 and 42 peptide sequences that form.

Similarly, as following used, term " D_PolypeptideGroup " refer to the NO:2 by SEQ ID, the group of 4,6,8,10,12,14,16,18,34,36,38,40 and 42 peptide sequences that form. Therefore, be contained in or be selected from by " D when mentioning_PolypeptideGroup " sequence set that forms (or is contained in or is selected from " D_PolypeptideGroup ") peptide sequence the time, refer to that this sequence is contained in or is selected from the NO:2 by SEQ ID, the group of 4,6,8,10,12,14,16,18,34,36,38,40 and 42 peptide sequences that form.

Term used herein " homogeneity " is interpreted as the homology between two amino acid sequences or two nucleotide sequences. For the present invention, the homogeneity degree be use Vector NTI program 7.1 editions (Informax inc., 7600 Wisconsin Avenue, Suite#1100, Bethesda, MD 20814, AlignX USA) determines. Clustal W algorithm (Thompson is used in the amino acid comparison, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.Nucleic Acids Research, 22:4673-4680) generate. Parameter below also using: it is 10 that breach generates point penalty (gap opening penalty), it is 0.05 that breach extends point penalty (gap extension penalty), and it is 8 that breach separates point penalty scope (gap separation penalty range). Pairing comparison (pairwise alignment) parameter is Ktuple=1, breach point penalty (gap penalty)=3, notch length generates point penalty (gap length opening penalty)=10, breach extends point penalty=0.1, window size (window size)=5, diagonal (diagonals)=5. Article two, the definite of homogeneity degree also is to use aforesaid identical algorithms and software kit between the nucleotide sequence, and for example use following setting: the breach point penalty is 10, and the notch length point penalty is 10. Pairing comparison parameter is Ktuple=3, breach point penalty=3, window=20.

Within the scope of the invention, term " functional polypeptide " (functional polypeptide) refers to such polypeptide, it can be by cellular expression and secretion, and consists of the operating unit that can operate according to its function that should realize according to the cell design. Alternatively, this polypeptide will possess predetermined function may need co-factor (co-factors). An example of functional polypeptide is polypeptide or the enzyme with catalytic activity, and it helps the reaction in the cell catalysis cell peripheral environment. Other example has the polypeptide that serves as semiochemicals. Other example also has the polypeptide of exercising for sensor (acceptor) function of ambient parameter (chemical substance in the cell peripheral environment), or the polypeptide (antimicrobial (many) peptides) with activity of anti-other biology, or the structural intergrity of cell made the polypeptide contributed.

In this article, the term that uses about the part of amino acid sequence or polypeptide " ripe zone " (mature region) refers to part (portion), zone (region), territory (domain) or the section (section) of the functional polypeptide of conduct maturation in amino acid sequence or the polypeptide.

Term used herein " nucleotide sequence of encoding mature polypeptide " refers to count from first amino acid whose triplet of encoding mature polypeptide, until the zone of last amino acid whose triplet of encoding mature polypeptide.

In this article, about the term " GH " that certain enzyme of the present invention is used, for example " GH10 " is the family classification system by the glycosyl hydrolase (glycosyl hydrolase enzymes) of B.Henrissat foundation. The numeral of GH back refers to different families. This categorizing system is known to those skilled in the art. See Henrissat B., A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem.J.280:309-316 (1991); Henrissat B., Bairoch A, New families in the classification of glycosyl hydrolases based on amino acid sequence similarities, Biochem.J.293:781-788 (1993); Henrissat B., Bairoch A., Updating the sequence-based classification of glycosyl hydrolases, Biochem.J.316:695-696 (1996); Davies G., Henrissat B., Structures and mechanisms of glycosyl hydrolases, Structure 3:853-859 (1995).

Polypeptide of the present invention

Polypeptide of the present invention is thought the polypeptide of this specific cells execution function all by Botryosphaeria rhodina CBS 274.96 secretions.

In Botryosphaeria rhodina CBS 274.96 genomes, thousands of possible genes are arranged, wherein, 21 kinds of B of this genomic polynucleotide encoding_PolypeptideThe functional mature polypeptide of included secretion in the group, these polypeptide have been accredited as functional, and are translated into functional polypeptide and secretion by selected host cell.

Therefore, Botryosphaeria rhodina CBS 274.96 expresses and secretion B_PolypeptideIncluded functional mature polypeptide in the group, and in the genome of this specific bacterial strain, A_DNAThe zone of the encoding mature polypeptide of the sequence of group is coding B_PolypeptideThe gene of included mature polypeptide in the group sequence. In addition in specific embodiment, when cultivating with comprising A_DNADuring Escherichia coli (E.coli) host that the polynucleotides in the zone of the encoding mature polypeptide of the sequence of group transform, all B that encode_PolypeptideThe gene of included mature polypeptide can be expressed in the group, and their corresponding mature polypeptides can be secreted. By the sequence of these 21 peptide sequences of comparison and homology or the homogeneity of known array, demarcated the concrete function of these polypeptide. At least 14 kinds in the functional polypeptide of these 21 kinds of secretions are determined to be enzyme and/or similar enzyme.

Therefore, the invention provides and be selected from following isolated polypeptide:

(a) have the polypeptide of amino acid sequence: described amino acid sequence be selected from B_PolypeptideThe amino acid sequence of included mature polypeptide has at least 90% homogeneity in the group;

(b) by nucleotide sequence coded polypeptide: described nucleotides sequence is listed under the height stringent condition and is selected from following polynucleotide probes hybridization:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is selected from A_DNAThe zone of the encoding mature polypeptide of group sequence;

(ii) complementary strand of the cDNA sequence that comprises of nucleotide sequence, described nucleotide sequence is selected from A_DNAThe zone of the encoding mature polypeptide of group sequence;

Wherein this polypeptide shows corresponding B_PolypeptideThe function of the mature polypeptide sequence of group.

In a specific embodiment, polypeptide of the present invention is selected from by the inventor and separates and with the secreted enzyme of Botryosphaeria rhodina of CBS preservation accession number (accession No.) 274.96 preservations, the enzyme group that namely is comprised of zytase, serine easterase, peroxidase, GH 61A polypeptide, GH 61 B polypeptide, GH 61C polypeptide, GH 61D polypeptide, β-glucosyl enzym, inscribe arabinase and peptic peptidase.

The present invention also provides the enzyme that is selected from following separation:

(a) comprise the enzyme of such amino acid sequence, described amino acid sequence has at least 90% homogeneity with the amino acid sequence that is selected from the maturase in the group that forms with the secreted zytase of the Botryosphaeria rhodina bacterial strain of CBS preserving number 274.96 preservations, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, β-glucosyl enzym, inscribe arabinase and peptic peptidase.

(i) complementary strand of nucleotide sequence, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preserving number, and encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase

The (ii) complementary strand of the contained cDNA sequence of nucleotide sequence, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preserving number, and the encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase;

In a specific embodiment, described enzyme is to be selected from following isolating enzyme:

(a) have the enzyme that has the aminoacid sequence of at least 90% identity with following aminoacid sequence, described aminoacid sequence is selected from D _PolypeptideThe maturing enzyme that is comprised in the sequence of group;

(b) by nucleotide sequence coded enzyme, this nucleotides sequence is listed under the height stringent condition and polynucleotide probes hybridization, and described polynucleotide probes is selected from:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is selected from E _DNAThe zone of the encoding mature enzyme of group sequence;

The complementary strand of the cDNA sequence that (ii) nucleotide sequence comprised, described nucleotide sequence is selected from E _DNAThe zone of the encoding mature enzyme of group sequence;

Wherein this enzyme shows corresponding D _PolypeptideThe function of the maturing enzyme of group.

Polypeptide of the present invention is an isolated polypeptide, preferably, the preparation of polypeptide of the present invention comprises other peptide materials that may accompany natively with it of maximum 90 weight % (other peptide materials of lower per-cent is preferred, for example maximum 80 weight %, maximum 60 weight %, maximum 50 weight %, maximum 40 weight %, maximum 30 weight %, maximum 20 weight %, maximum 10 weight %, maximum 9 weight %, maximum 8 weight %, maximum 7 weight %, maximum 6 weight %, maximum 5 weight %, maximum 4 weight %, maximum 3 weight %, maximum 2 weight %, maximum 1 weight %, and maximum  weight %).Therefore, preferred isolated polypeptide of the present invention is 92% pure, and polypeptide promptly of the present invention constitutes at least 92 weight % of all peptide materials that exist in the preparation, and preferred higher weight percent, for example at least 94% is pure, at least 95% is pure, and at least 96% is pure, and at least 96% is pure, at least 97% is pure, at least 98% is pure, and at least 99% is pure, and 99.5% pure at the most.The form that polypeptide of the present invention especially is preferably pure basically.Particularly, preferably, described polypeptide is " (essentially) pure form basically ", and promptly the polypeptide prepared product is substantially free of and natural other peptide material that accompanies of this polypeptide.This can realize by for example adopting the recombinant methods polypeptide of knowing.

Polypeptide of the present invention can be synthetic the manufacturing, and is naturally occurring, or its combination.In a specific embodiment, polypeptide of the present invention can be from microorganism, prokaryotic cell prokaryocyte for example, and archeobacteria cell or eukaryotic cell obtain.These cells can also be to change by genetically engineered.

In a specific embodiment, polypeptide of the present invention is such enzyme, and it specifically is to show best enzymic activity at about 20 ℃ under about 60 ℃ temperature at about 10 ℃ to about 80 ℃.

In a specific embodiment, polypeptide of the present invention is such enzyme, and it specifically is high to 80 ℃ at height to 100 ℃, more specifically is that height is stable on the function to 60 ℃ temperature.

In a specific embodiment, polypeptide of the present invention is such enzyme, and its demonstration is selected from B _PolypeptideOrganize included maturing enzyme enzyme at least 20%, specifically be at least 40%, for example at least 50%, specifically be at least 60%, for example at least 70%, more specifically be at least 80%, for example at least 90%, more specifically be at least 95%, at least 100% enzymic activity for example.

In a specific embodiment, polypeptide of the present invention comprises, contains, or is made up of such aminoacid sequence: this aminoacid sequence be selected from B _PolypeptideThe peptide sequence of organizing included maturing enzyme has at least 90% identity, and particularly at least 95%, for example at least 96%, for example at least 97%, more specifically be at least 98%, for example at least 99% or even 100% identity.

In a specific embodiment, polypeptide of the present invention comprises, contains, or is made up of such aminoacid sequence: this aminoacid sequence be selected from B _PolypeptideThe peptide sequence of organizing included maturing enzyme has at least 50% identity, specifically is at least 60%, specifically is at least 65%, specifically is at least 70%, specifically is at least 75%, specifically is at least 80% or more specifically is at least 85% identity.

In a specific embodiment, amino acid sequence of polypeptide of the present invention and B _PolypeptideOrganize included maturing enzyme and have maximum 10 amino acid (for example 10 amino acid), specifically be maximum 5 amino acid (for example 5 amino acid), for example maximum 4 amino acid (for example 4 amino acid), for example maximum 3 amino acid (for example 3 amino acid), specifically be maximum 2 amino acid (for example 2 amino acid), for example 1 amino acid whose difference.

Polypeptide of the present invention can be from natural origin, for example Botryosphaeria rhodina CBS274.96 strain or the isolating wild type peptide of other wild-type strains, but so artificial variant is also contained in the present invention, polypeptide wherein of the present invention is suddenlyd change, for example by in the function and/or other character that keep this polypeptide, described polypeptide is added, replace and/or lack one or more amino acid.

Therefore, polypeptide of the present invention can be artificial variant, wherein, comprises by B _PolypeptideOrganize included maturing enzyme, or an amino acid whose displacement has taken place at least, disappearance and/or insertion by its aminoacid sequence of forming.

Polypeptide of the present invention also comprises the nucleic acid of the functional fragment of the functional fragment of aminoacid sequence as herein described and the aminoacid sequence as herein described of encoding, comprise the fragment of Botryosphaeria rhodina strain excretory maturing enzyme with 274.96 preservations of CBS preserving number as described herein, comprise from described Botryosphaeria rhodina strain excretory zytase with 274.96 preservations of CBS preserving number, serine easterase, peroxidase, the GH61A polypeptide, the GH61B polypeptide, the GH61C polypeptide, the GH61D polypeptide, beta-glucosidase enzyme, the fragment of the enzyme of selecting in inscribe arabinase and the peptic peptidase.

Artificial variant can use standard technique known in the art to make up, and screens subsequently usually and/or the character evaluation.Standard technique comprises classical mutagenesis, for example carries out uv irradiating or handles cell with chemical mutagen by pair cell, and is described as people such as Gerhardt (1994); Vivo gene reorganization (shuffling), described as WO 97/07205, external reorganization, as Stemmer, (1994) or WO 95/17413 are described, and random mutagenesis is as people such as Eisenstadt E.. and (1994) are described; Round pcr, for example people (1991) such as Poulsen is described; Family's reorganization (family shuffling), as people such as J.E.Ness, Nature Biotechnology, vol.17, pp.893-896 (1999) is described; Site-directed mutagenesis, as people such as Sambrook (1989), Molecular Cloning, A Laboratory Manual, ColdSpring Harbor, NY is described.Generality about nucleotide subsitution is described people such as visible Ford, and 1991, Protein Expression and Purification 2, p.95-107.

Such standard gene engineering method can also be used to preparing multifarious variant nucleotide sequence library from the gene of one or more parent enzyme of the present invention (parent enzyme) of encoding, in proper host cell, express these enzyme variants, and select suitable variant.(Reetz MT can be set up with multiple methods known in the art in multifarious library; Jaeger KE, in Biocatalysis-fromDiscovery to Application, Fessner WD compiles, Vol.200, pp.31-57 (1999); Stemmer, Nature, vol.370, p.389-391,1994; Zhao and Arnold, Proc.Natl.Acad.ScL, USA, vol.94, pp.7997-8000,1997; Or people such as Yano, Proc.Natl.Acad.ScL, USA, vol.95, pp 5511-5515,1998).

In an embodiment preferred of the present invention, (in artificial variant and the wild-type enzyme) amino acid whose change is slight from saying so in nature, and promptly it is: the amino-acid substitution of not remarkably influenced Protein Folding and/or active conservative property; Little disappearance is generally 1 to about 30 amino acid; Little amino or C-terminal extend, for example aminoterminal methionine residues; The little joint peptide that reaches about 20-25 residue; Or help the segment of purifying to extend (small extension) by changing net charge or other functions, such as polyhistidine tract (poly-histidine tract), antigenic epitopes (antigenic epitope) or in conjunction with territory (binding domain).

Below each the group in be the example of preservative replacement: basic aminoacids (arginine, Methionin and Histidine), acidic amino acid (L-glutamic acid and aspartic acid), polare Aminosaeren (glutamine and l-asparagine), hydrophobic amino acid (leucine, Isoleucine, Xie Ansuan and methionine(Met)), die aromatischen Aminosaeuren (phenylalanine, tryptophane and tyrosine) and p1 amino acid (glycine, L-Ala, Serine and Threonine).The amino-acid substitution that does not change generally speaking or damage protein function is known in the art, and for example H.Neurath and R.L.Hill are in (1979, Academic Press, New York) described in the The Proteins.The replacement of normal generation is Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and above-mentioned reverse displacement.

In a specific embodiment, described amino acid change has such character, makes the physics-chem characteristic of polypeptide be changed.For example, the amino acid change that is carried out can improve enzyme thermostability, change substrate specificity, change best pH or the like.

Particularly, at polypeptide of the present invention, particularly be selected from B _PolypeptideIn the those polypeptides of the mature polypeptide that is comprised in the group, the number that produces described displacement, disappearance and/or the insertion of artificial variant mostly is 10 most, as maximum 9, for example maximum 8, more preferably maximum 7, for example maximum 6, for example maximum 5, most preferably maximum 4, for example maximum 3, as maximum 2, particularly maximum 1.

At artificial variant described in the specific embodiment is such variant, and it is compared with parent enzyme in comprising people's animal, has change, the preferred immunogenicity, particularly allergenicity that reduces.Term " immunogenicity " is interpreted as artificial variant in this article when being applied to animal, comprises causing immunoreactive ability change, that particularly reduce when being applied to animal in intravenously, skin, subcutaneous, the oral and tracheae.Term " immune response " refers to that in this article using of this artificial variant cause for example change of the level of IgE, IgG and IgM of immunoglobulin (Ig) in this animal body, or the change of this animal body inner cell factor level.Method, the preparation of location (mapping) proteinic immunogenicity/antigenic epitopes have the immunogenic antibody of change and measure immunoreactive method and be known in the art, and for example among WO 92/10755, WO 00/26230, WO 00/26354 and the WO 01/31989 description arranged.Term " allergenicity " is interpreted as the ability that this artificial variant causes the change of IgE production in the animal particularly to reduce herein, and combination is from the ability of the IgE of this animal.Especially, owing to the allergenicity (calling absorption allergenicity (respiratory allergenicity) again) that the described polypeptide variants of use in the animal tracheae is produced is that this paper is interested especially.

In another embodiment, polypeptide of the present invention is that this nucleotides sequence is listed at least highly tight condition by so nucleotide sequence coded polypeptide, under the particularly high degree stringent condition, and is selected from the hybridization of following polynucleotide probes:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is selected from A _DNAThe zone of the encoding mature polypeptide of group sequence;

The (ii) complementary strand of contained cDNA sequence in the nucleotide sequence, described nucleotide sequence is selected from A _DNAThe zone of the encoding mature polypeptide of group sequence;

The (iii) fragment of (i) or coding secrete polypeptide (ii), described secrete polypeptide has B _PolypeptideThe function of the corresponding mature polypeptide that is comprised in the group.

(J.Sambrook, E.F.Fritsch, and T.Maniatus, 1989, Molecular Cloning, ALaboratory Manual, second edition, Cold Spring Harbor, New York).

Especially, the polynucleotide of the involved such nucleotide sequence of polypeptide of the present invention are coded, and described nucleotide sequence is selected from: A _DNAThe zone of encoding mature polypeptide of group sequence, perhaps with it because the degeneracy of genetic code and different sequence.More specifically, polypeptide of the present invention is coded by the polynucleotide of being made up of such nucleotide sequence, and described nucleotide sequence is selected from: A _DNAThe zone of encoding mature polypeptide of group sequence, perhaps with it because the degeneracy of genetic code and different sequence.

A _DNANucleotide sequence or its subsequence in the zone of the encoding mature polypeptide of the sequence of group, and B _PolypeptideThe aminoacid sequence of the mature polypeptide that comprises in the group or its fragment can be used for designing polynucleotide probes, with according to method well known in the art, identify in the strain system that never belongs to together or plant and the DNA of clones coding enzyme of the present invention.Especially, such probe can be used for according to the Southern western blot procedure of standard and target belongs to or the genome of kind or cDNA hybridization, to identify and the corresponding gene of separating wherein.Such probe can be considerably shorter than whole sequence, but length should be at least 15, and preferably at least 25, more preferably at least 35 Nucleotide, for example length is at least 70 Nucleotide.But preferably this polynucleotide probes is long at least 100 Nucleotide.For example, it is long that this polynucleotide probes can be at least 200 Nucleotide, and at least 300 Nucleotide are long, and at least 400 Nucleotide are long, or at least 500 Nucleotide are long.Can also use longer probe, for example at least 600 Nucleotide are long, and at least 700 Nucleotide are long, and at least 800 Nucleotide are long, or at least 900 polynucleotide probes that Nucleotide is long.DNA and rna probe can use.Probe carries out mark usually and detects corresponding gene and (for example use ³²P, ³H, ³⁵S, vitamin H or avidin).

Therefore, can be from the genomic dna of such other organism preparation or cDNA library screening hybridize with above-mentioned probe and the DNA of the enzyme of the present invention of encoding.Can separate by agarose or polyacrylamide gel electrophoresis or other isolation technique from the genome of other such organism or other DNA.DNA or separated DNA from the library can be transferred to and are fixed on nitrocellulose or other the suitable solid support material.In order to identify and be selected from A _DNAThe Nucleotide in zone of encoding mature polypeptide has required homology and/or identity in the group sequence, or homology and/or same clone or DNA with it, uses the solid support material that has fixed DNA in the Southern trace.

For the purpose of the present invention, " hybridization " means the polynucleotide probes hybridization of described nucleotide sequence and mark, and described probe is highly under high degree stringent condition and be selected from A _DNAThe nucleotide sequence hybridization in the zone of the sequence encoding mature polypeptide of group.Molecule with polynucleotide probes hybridization can detect with X-ray film or any method known in the art under these conditions.When no matter when using term " polynucleotide probes " herein, should understand such probe and contain at least 15 Nucleotide.

In an interested embodiment, described polynucleotide probes is to be selected from A _DNAThe complementary strand of the nucleotide sequence in the zone of the encoding mature polypeptide of the sequence of group.

In another interested embodiment, described polynucleotide probes is that coding is selected from B _PolypeptideThe complementary strand of the nucleotide sequence of the enzyme of group.In another interested embodiment, described polynucleotide probes is the complementary strand in the mature polypeptide encoded zone of nucleotide sequence, and described nucleotide sequence is selected from A _DNAThe zone of the encoding mature polypeptide of the sequence of group.

For length is the long probe of at least 100 Nucleotide, highly to the utmost point Gao Du stringent condition is defined as and follows standard Southern western blot procedure, in 42 ℃, at 5X SSPE, 5X Darhardt ' s solution, 1.0%SDS, 100 μ g/ml through shearing and in the salmon sperm DNA of sex change, carrying out prehybridization and hybridization.Preferably, the long probe of described at least 100 Nucleotide does not contain more than 1000 Nucleotide.For length is the long probe of at least 100 Nucleotide, washs 3 times each 15 minutes at last down with 0.1xSSC, 0.1%SDS (high tight degree) at 60 ℃; Particularly wash 3 times each 15 minutes down with 0.1xSSC, 0.1%SDS (high tight degree) at 68 ℃.

Though be not particularly preferred, also consider to use shorter probe, for example length is the probe of about 15 to 99 Nucleotide, for example length arrives about 70 Nucleotide for about 15.For so short probe, stringent condition is defined as follows standard Southern western blot procedure, at beguine according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) method of calculation calculate the Tm value low about 5 ℃ to about 10 ℃ temperature, at 0.9MNaCl, 0.09M Tris-HCl pH7.6,6mM EDTA, 0.5%NP-40,1X Denhardt ' s solution, the 1mM trisodium phosphate, 1mM SODIUM PHOSPHATE, MONOBASIC (sodium monobasic phosphate), 0.1mM ATP, with carry out prehybridization in the 0.2mg/ml yeast rna, hybridization and hybridization back are cleaned.

For length is the short probes of about 15 Nucleotide to about 99 Nucleotide, under low about 5 ℃ to 10 ℃ temperature than Tm calculated value, solid support material is added 0.1%SDS washing 1 time 15 minutes with 6XSCC, use the 6XSSC washed twice then, each 15 minutes.

SEQ ID NO:2 zytase GH10

In a specific embodiment, polypeptide of the present invention is the GH10 zytase that comprises or be made up of such aminoacid sequence, described aminoacid sequence with can be from Botryosphaeria rhodina, specifically be GH 10 zytases that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the ripe GH10 zytase that comprises among the SEQ ID NO:2 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH10 zytase comprises or is made up of the sequence of the 1st to 291 of SEQ ID NO:2.In this article, the GH10 zytase is defined as the enzyme that belongs to EC 3.2.1.8 enzyme monoid alive.In this monoid inscribe hydrolysis (endohydrolyse) xylan 1,4-β-D-wood sugar glycosidic bond.Glycoside hydrolysis enzyme family 10 (GH10) also comprises the enzyme with other two kinds of known activity; Inscribe-1,3-beta-xylanase (EC:3.2.1.32); Cellobiohydrolase (EC:3.2.1.91).

SEQ ID NO:4 zytase GH11

In a specific embodiment, polypeptide of the present invention is the GH11 zytase that comprises or be made up of such aminoacid sequence, described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the GH11 zytase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the ripe GH11 zytase that comprises among the SEQ ID NO:4 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH11 zytase comprises or is made up of the sequence of the 1st to 202 of SEQ ID NO:4.In this article, the GH11 zytase is defined as the enzyme that belongs to EC 3.2.1.8 enzyme monoid alive.In this monoid inscribe hydrolyzed xylan 1,4-β-D-wood sugar glycosidic bond.Glycoside hydrolase family 11 (GH11) comprises the enzyme that only has a kind of known activity; Zytase (EC:3.2.1.8).

SEQ ID NO:6 serine easterase

In a specific embodiment, polypeptide of the present invention is a serine easterase, specifically be at or lipase or the Carboxylesterase (carboxyesterase) that comprises or form by such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the serine easterase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the ripe serine easterase that comprises among the SEQ ID NO:6 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe serine easterase comprises or is made up of the sequence of the 1st to 352 of SEQ ID NO:6.In this article, serine easterase is defined as the enzyme of the solubility ester class (the ester class of non-micella (micelle) form) in can hydrating solution.More specifically, serine easterase is to serve as at (EC 3.1.1.50) or lipase (EC.3.1.1.3) or Carboxylesterase, can hydrolysis wax-lipid (wax-esters), cutin, three acyl group fat (tracyl fats), and oil and/or fatty acid chain.Particularly, described serine easterase contains classical serine hydrolase Ser, His, Asp triplet, for example three acyl group lipase/at.

SEQ ID NO:8 candiyeast Type B lipase

In a specific embodiment, polypeptide of the present invention is candiyeast (candida) Type B lipase (EC 3.1.1.3), it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, specifically be the candiyeast Type B lipase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the candiyeast Type B lipase that comprises among the SEQ IDNO:8 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe candiyeast Type B lipase comprises or is made up of the sequence of the 1st to 431 of SEQ ID NO:8.In this article; candiyeast Type B lipase (Candida B type lipase) is defined as and tri-glyceride (triglycerides) can be hydrolyzed to DG ester (diacyl glycerides) and fatty acid anion, particularly triacylglycerol is hydrolyzed to the enzyme of DG and fatty acid anion.

SEQ ID NO:10 peroxidase

In a specific embodiment, polypeptide of the present invention is a peroxidase, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the peroxidase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the peroxidase that comprises among the SEQ ID NO:10 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe peroxidase comprises or is made up of the sequence of the 1st to 185 of SEQ ID NO:10.In this article, peroxidase be defined as belong to can catalytic oxidization-reduction the enzyme of enzyme of reaction.Therefore, they are classified as oxydo-reductase.Their formal EC number is 1.11.1.Peroxidase is with H ₂O ₂Be reduced to water, and the multiple substrate of oxidation.Therefore, peroxidase is to utilize H ₂O ₂Come the oxydo-reductase of the different oxidizing reactions of catalysis as electron acceptor(EA).

SEQ ID NO:12 GH61A polypeptide

In a specific embodiment, polypeptide of the present invention is the GH61A polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the GH61A polypeptide that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the GH61A polypeptide that comprises among the SEQ ID NO:8 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH61A polypeptide comprises or is made up of the sequence of the 1st to 218 of SEQ ID NO:12.In this article, the GH61A polypeptide is defined as provides secrete polypeptide or the protein that is selected from one or more groups following effect:

1) when uniting use, promotes the degraded of cellulosic (cellulosic) material with cellulase or cellulase mixture.

2) solvability of increase enzyme.

3) stability of increase enzyme.

4) reducing enzyme suppresses.

SEQ ID NO:14 GH61B polypeptide

In a specific embodiment, polypeptide of the present invention is the GH61B polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the GH61B polypeptide that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the GH61B polypeptide that comprises among the SEQ ID NO:14 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH61B polypeptide comprises or is made up of the sequence of the 1st to 249 of SEQ ID NO:14.In this article, the GH61B polypeptide is defined as provides secrete polypeptide or the protein that is selected from one or more groups following effect:

1) when uniting use, promotes the degraded of fibrous material with cellulase or cellulase mixture.

2) solvability of increase enzyme.

3) stability of increase enzyme.

SEQ ID NO:16 GH61C polypeptide

In a specific embodiment, polypeptide of the present invention is the GH61C polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the GH61C polypeptide that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the GH61C polypeptide that comprises among the SEQ ID NO:16 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH61C polypeptide comprises or is made up of the sequence of the 1st to 255 of SEQ ID NO:16.In this article, the GH61C polypeptide is defined as provides secrete polypeptide or the protein that is selected from one or more groups following effect:

2) solvability of increase enzyme.

3) stability of increase enzyme.

SEQ ID NO:18 GH61D polypeptide

In a specific embodiment, polypeptide of the present invention is the GH61D polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the GH61D polypeptide that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the GH61D polypeptide that comprises among the SEQ ID NO:18 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described ripe GH61D polypeptide comprises or is made up of the sequence of the 1st to 205 of SEQ ID NO:18.In this article, the GH61D polypeptide is defined as provides secrete polypeptide or the protein that is selected from one or more groups following effect:

2) solvability of increase enzyme.

3) stability of increase enzyme.

SEQ ID NO:20 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:20 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:20 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 243 of SEQ ID NO:20.

SEQ ID NO:22 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:22 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:22 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 415 of SEQ ID NO:22.

SEQ ID NO:24 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:24 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:24 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 377 of SEQ ID NO:24.

SEQ ID NO:26 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:26 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:26 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 259 of SEQ ID NO:26.

SEQ ID NO:28 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:28 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:28 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 248 of SEQ ID NO:28.

SEQ ID NO:30 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:30 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:30 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 149 of SEQ ID NO:30.

SEQ ID NO:32 functional polypeptide

In a specific embodiment, polypeptide of the present invention is a functional polypeptide, it comprises or is made up of such aminoacid sequence: described aminoacid sequence and SEQ ID NO:32 have at least 90%, specifically be at least 95%, more specifically being at least 96%, more specifically is at least 97%, more specifically is at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.Particularly with SEQ IDNO:32 in the ripe functional polypeptide that comprises.More specifically, described ripe functional polypeptide comprises or is made up of the sequence of the 1st to 202 of SEQ ID NO:32.

SEQ ID NO:34 beta-glucosidase enzyme

In a specific embodiment, polypeptide of the present invention is a beta-glucosidase enzyme, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeria rhodina, it specifically is the beta-glucosidase enzyme that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the beta-glucosidase enzyme that comprises among the SEQ ID NO:34 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described beta-glucosidase enzyme comprises or is made up of the sequence of the 1st to 603 of SEQ ID NO:34.In this article, beta-glucosidase enzyme is defined as such β-D-glucoside-glucose hydrolysis enzyme (β-D-glucoside-glucohydrolase) (E.C.3.2.1.21), the hydrolysis of the terminal non-reducing β of its catalysis-D-glucosyl residue, and discharge β-D-glucose.For the purpose of the present invention, beta-glucosidase activity is according to people such as Venturi, 2002, and the basic step of describing among the J.Basic Microbiol.42:55-66 is measured, and has just adopted different condition as herein described.1 beta-glucosidase activity unit definition is: at 50 ℃, pH 5 times, the substrate from 100mM Trisodium Citrate, 0.01%Tween-20: 4mM is right-nitrophenyl-β-D-glucopyranoside in, per minute produce 1.0 micromolar right-nitrophenol.

SEQ ID NO:36 inscribe arabinase

In a specific embodiment, polypeptide of the present invention is the inscribe arabinase, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeriarhodina, it specifically is the inscribe arabinase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the inscribe arabinase that comprises among the SEQ ID NO:36 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described inscribe arabinase comprises or is made up of the sequence of the 1st to 301 of SEQ ID NO:36.In this article, inscribe arabinase (endo-arabinase) be defined as can hydrolysis arabinan (arabinan) enzyme.

SEQ ID NO:38 inscribe arabinase

In a specific embodiment, polypeptide of the present invention is the inscribe arabinase, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeriarhodina, it specifically is the inscribe arabinase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the inscribe arabinase that comprises among the SEQ ID NO:36 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described inscribe arabinase comprises or is made up of the sequence of the 1st to 438 of SEQ ID NO:38.In this article, the inscribe arabinase be defined as can the hydrolysis arabinan enzyme.

SEQ ID NO:40A1 peptic peptidase

In a specific embodiment, polypeptide of the present invention is a peptic peptidase, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeriarhodina, it specifically is the peptic peptidase that the Botryosphaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the peptic peptidase that comprises among the SEQ ID NO:40 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described peptic peptidase comprises or is made up of the sequence of the 1st to 396 of SEQ ID NO:40.In this article, be defined as can protein hydrolysate or the enzyme of peptide for peptic peptidase (pepsin peptidase).

SEQ ID NO:42 M43 peptic peptidase

In a specific embodiment, polypeptide of the present invention is a peptic peptidase, it comprises or is made up of such aminoacid sequence: described aminoacid sequence with can be from Botryosphaeriarhodina, it specifically is the peptic peptidase that the Botryospbaeria rhodina bacterial strain with preserving number CBS 274.96 preservations obtains, more specifically be that the peptic peptidase that comprises among the SEQ ID NO:42 has at least 90%, specifically be at least 95%, more specifically be at least 96%, more specifically be at least 97%, more specifically be at least 98%, more specifically be at least 99%, or the most specifically be 100% identity.More specifically, described peptic peptidase comprises or is made up of the sequence of the 1st to 262 of SEQ ID NO:42.In this article, be defined as can protein hydrolysate or the enzyme of peptide for peptic peptidase.

Polynucleotide

The invention still further relates to and comprise or by the polynucleotide formed of nucleotide sequence of coding polypeptide of the present invention.In a specific embodiment, described nucleotide sequence is presented at A _DNAIn the sequence of group, comprise with it because the degeneracy of genetic code and different sequence.In another embodiment, polynucleotide of the present invention are modified nucleotide sequences, and it comprises or by A _DNAThe zone of the encoding mature polypeptide of the sequence of group is formed, and itself and A _DNAThe parent nucleotide sequence that is comprised in the group is compared, and comprises at least one modification/sudden change.

Be used to separate or the technology of the polynucleotide of clones coding polypeptide is known in this area, comprise from genomic dna and separating, from cDNA preparation, perhaps both combinations.Can pass through from these genomic dna clonings polynucleotide sequence of the present invention, for example, utilize known polymerase chain reaction (PCR), or realize to detect cloned DNA fragment with common structure feature with the antibody screening expression library.For example referring to people such as Innis, 1990, PCR:A Guide to Methods andApplication, Academic Press, New York.Can also use other nucleic acid amplification program, such as ligase chain reaction (LCR) (LCR), connect activated transcription (LAT) and based on the amplification (NASBA) of nucleotide sequence.

Obtaining described nucleotide sequence can be by the standard cloning process that uses in the genetically engineered, and this nucleotide sequence is relocated (relocate) to other position that this sequence will be replicated from its natural place.The segmental cutting of expectation that cloning process can comprise the nucleotide sequence that comprises this polypeptide of encoding with separate, the insertion of this fragment in carrier molecule, and recombinant vectors mixing in host cell, the multiple copied of this nucleotide sequence or clone will be replicated in host cell.This nucleotide sequence can be genome, cDNA, RNA, semi-synthetic, synthetic source or its arbitrary combination.

Particularly, described polynucleotide comprise and preferably are made up of such nucleotide sequence: this nucleotide sequence be selected from A _DNAThe nucleotide sequence in the zone of the encoding mature polypeptide of the sequence of group has at least 50% identity.Particularly, described nucleotide sequence be selected from A _DNAThe nucleotide sequence in the zone of the encoding mature polypeptide of the sequence of group has at least 65% identity, more specifically be 70% identity, more specifically be 80% identity, more specifically being 90% identity, more specifically is 95% identity, more specifically is 96% identity, more specifically be 97% identity, more specifically being 98% identity, more specifically is 99% identity, or is specially 100% identity most.Particularly, described nucleotide sequence comprises and is selected from A _DNAThe nucleotide sequence in the zone of the encoding mature polypeptide of the sequence of group.In a more preferred embodiment, described nucleotide sequence is by being selected from A _DNAThe nucleotide sequence in the zone of the encoding mature polypeptide of the sequence of group is formed.

Particularly, described polynucleotide comprise and preferably are made up of such nucleotide sequence: this nucleotide sequence coded zytase that is selected from, serine easterase, peroxidase, the GH61A polypeptide, the GH61B polypeptide, the GH61C polypeptide, the GH61D polypeptide, beta-glucosidase enzyme, the maturing enzyme of inscribe arabinase and peptic peptidase, and this nucleotide sequence separates with the code book contriver and with the secreted zytase of Botryosphaeria rhodina bacterial strain of CBS preserving number 274.96 preservations, serine easterase, peroxidase, the GH61A polypeptide, the GH61B polypeptide, the GH61C polypeptide, the GH61D polypeptide, beta-glucosidase enzyme, the nucleotide sequence of the maturing enzyme of inscribe arabinase and peptic peptidase, has at least 50% identity, be specially at least 65% identity, more specifically be 70% identity, more specifically be 80% identity, more specifically be 90% identity, more specifically be 95% identity, more specifically be 96% identity, more specifically be 97% identity, more specifically be 98% identity, more specifically be 99% identity, or be specially 100% identity most.

In a specific embodiment, described polynucleotide comprise and preferably are made up of such nucleotide sequence: this nucleotide sequence coded zytase that is selected from, serine easterase, peroxidase, the GH61A polypeptide, the GH61B polypeptide, the GH61C polypeptide, the GH61D polypeptide, beta-glucosidase enzyme, the maturing enzyme of inscribe arabinase and peptic peptidase, and this nucleotide sequence has at least 50% identity with the maturing enzyme nucleotide sequence that coding is selected from D polypeptide group, be specially at least 65% identity, more specifically be 70% identity, more specifically be 80% identity, more specifically be 90% identity, more specifically be 95% identity, more specifically be 96% identity, more specifically be 97% identity, more specifically be 98% identity, more specifically be 99% identity, or be specially 100% identity most.

In a specific embodiment, described polynucleotide comprise and preferably are made up of such nucleotide sequence: this nucleotide sequence coded maturing enzyme that is selected from zytase, serine easterase, peroxidase, GH61A polypeptide, GH61B polypeptide, GH61C polypeptide, GH61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase, and this nucleotide sequence be selected from E _DNAThe nucleotide sequence of group sequence has at least 50% identity, be specially at least 65% identity, more specifically being 70% identity, more specifically is 80% identity, more specifically is 90% identity, more specifically be 95% identity, more specifically being 96% identity, more specifically is 97% identity, more specifically is 98% identity, more specifically be 99% identity, or be specially 100% identity most.

SEQ ID NO：1

Polynucleotide encoding GH10 zytase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 927 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:1 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：3

Polynucleotide encoding GH11 zytase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 58 to 663 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:3 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：5

Polynucleotide encoding serine easterase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 1110 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:5 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：7

Polynucleotide encoding lipase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 1347 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:7 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：9

Polynucleotide encoding peroxidase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 1 to 555 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:9 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：11

Polynucleotide encoding GH61A polypeptide of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 49 to 702 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:11 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：13

Polynucleotide encoding GH61B polypeptide of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 40 to 786 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:13 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：15

Polynucleotide encoding GH61C polypeptide of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 819 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:15 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：17

Polynucleotide encoding GH61D polypeptide of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 61 to 675 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:17 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：19

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 1 to 729 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:19 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：21

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 1299 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:21 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：23

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 49 to 1179 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:23 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：25

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 70 to 846 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:25 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：27

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 58 to 801 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:27 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：29

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 157 to 603 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:29 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：31

The ripe functional polypeptide of polynucleotide encoding of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 660 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:31 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：33

Polynucleotide encoding beta-glucosidase enzyme of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 46 to 1854 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:33 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：35

Polynucleotide encoding inscribe arabinase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 64 to 966 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:35 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：37

Polynucleotide encoding inscribe arabinase of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 55 to 1368 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:37 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SFQ ID NO：39

Polynucleotide encoding stomach en-proteolytic enzyme of the present invention (pepsin protease) in a specific embodiment, and comprise or be made up of such nucleotide sequence: 61 to 1248 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:39 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

SEQ ID NO：41

Polynucleotide encoding stomach en-proteolytic enzyme of the present invention in a specific embodiment, and comprise or be made up of such nucleotide sequence: 64 to 849 the nucleotide sequence of described nucleotide sequence and SEQ ID NO:41 has at least 70% identity, more specifically be at least 80% identity, more specifically be at least 90% identity, more specifically be at least 95% identity, more specifically be at least 96% identity, more specifically be at least 97% identity, more specifically be at least 98% identity, more specifically be at least 99% identity, or be specially 100% identity most.

Comprise than being selected from B for synthetic _PolypeptideThe aminoacid sequence of the mature polypeptide that group is comprised has the polypeptide of the aminoacid sequence of at least one displacement, disappearance and/or insertion, and the modification of the nucleotide sequence of the polypeptide of the present invention of encoding may be essential.

It will be readily apparent to one skilled in the art that to make these modify the function that keeps enzyme, that is, can outside the critical area of enzyme function, carry out these modifications.Therefore vital amino-acid residue is not preferably modified concerning function, for example replaced.Vital amino-acid residue can be identified by program known in the art concerning function, such as site-directed mutagenesis or alanine scanning mutagenesis (alanine scanning mutagenesis) (for example referring to Cunningham and Wells, 1989, Science 244:1081-1085).Substrate-enzyme interacting site can determine that wherein three-dimensional structure can be by measuring such as technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (for example referring to people such as de Vos, 1992, Science 255:306-312 by three-dimensional structural analysis; People such as Smith, 1992, Journal of Molecular Biology 224:899-904; People such as Wlodaver, 1992, FEBS Letters 309:59-64).

In addition, can be by introducing the nucleotide sequence that nucleotide subsitution changes coding enzyme of the present invention, such displacement can not make the other aminoacid sequence of this nucleotide sequence coded generation, but is used for expressing the codon use habit of the host living beings of enzyme corresponding to intention.

The sudden change that is another Nucleotide with a nucleotide subsitution imports nucleotide sequence, can realize by utilizing any method known in the art to carry out site-directed mutagenesis.Useful especially is to utilize to have target and insert segmental superhelix double-stranded DNA carrier and two methods that contain the synthetic primer of required sudden change.Every is extended in the temperature cycle process by the Pfu archaeal dna polymerase with the relative chain complementary Oligonucleolide primers of carrier respectively.After being integrated into primer, generate the mutant plasmid that comprises the stagger arrangement breach.After temperature cycle, use methylating and the specific DpnI of hemimethylation DNA handles product with digestion parental DNA template, and select to comprise the synthetic DNA of sudden change.Other method known in the art also can be used.About the generality of nucleotide subsitution describe referring to, for example, Ford etc., 1991, Protein Expression and Purification 2:95-107.

The invention still further relates to and comprise, preferably the polynucleotide of being made up of such nucleotide sequence: described nucleotide sequence coded polypeptide of the present invention and at the height stringent condition under the preferred high degree stringent condition, and is selected from following polynucleotide probes hybridization:

The (ii) complementary strand of the cDNA that nucleotide sequence comprised, described nucleotide sequence is selected from A _DNAThe zone of the encoding mature polypeptide of group sequence;

(iii) (i) or fragment (ii), its coding has B _PolypeptideThe excretory mature polypeptide of the function of the corresponding mature polypeptide that is comprised in the group.

(J.Sambrook, E.F.Fritsch and T.Maniatus, 1989, Molecular Cloning, ALaboratory Manual, second edition, Cold Spring Harbor, New York).

Be understandable that, about the details of nucleotide sequence hybridization and details be entitled as " polypeptide of the present invention " part herein in the content of the hybridization aspect discussed identical or close.

The invention still further relates to the storage media of the information that is applicable to nucleotide sequence electronics, that comprise amino acid sequence of polypeptide of the present invention or polynucleotide of the present invention.Described storage media may suitably be disk or CD, and described electronics can be a computing equipment, described information specifically can digital store on storage media.

Nucleic acid construct

The invention still further relates to the nucleic acid construct that comprises the polynucleotide of the present invention that are operably connected with one or more regulating and controlling sequences, described regulating and controlling sequence instructs the expression of encoding sequence under the condition compatible with regulating and controlling sequence in suitable host cell.

The separation polynucleotide that can utilize several different methods operation code book invention polypeptide are to provide the condition of polypeptide expression.According to the difference of expression vector, may wish or must before polynucleotide sequence is inserted carrier, operate on it.The technology of utilizing recombinant DNA method to modify polynucleotide sequence is well-known in the art.

Regulating and controlling sequence can be suitable promoter sequence, is promptly discerned the nucleotide sequence of expressing described Nucleotide by host cell.Promoter sequence comprises the transcription regulating nucleotide sequence of regulating expression of polypeptides.Promotor can be any nucleotide sequence that shows transcriptional activity in selected host cell, comprises sudden change, brachymemma and promotor heterozygosis, and can obtain from the gene of polypeptide in coding and host cell homology or allogenic extracellular or the cell.

Be used to instruct nucleic acid construct of the present invention to transcribe, the example of the suitable promotor of especially in bacterial host cell, transcribing, be from intestinal bacteria lac operon, streptomyces coelicolor (Streptomycescoelicolor) agarase gene (dagA), subtilis type froctosan saccharase gene (sacB), bacillus licheniformis alpha-amylase gene (amyL), bacstearothermophilus (Bacillusstearothermophilus) produces maltogenic amylase (maltogenic amylase) gene (amyM), bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis (Bacillus licheniformis) penicillinase gene (penP), subtilis xylA and xylB gene, with procaryotic β-Nei Xiananmei gene (people such as Villa-Kamaroff, 1978, Proceedings of the National Academyof Sciences USA 75:3727-3731) promotor that obtains in, and tac promotor (people such as DeBoer, 1983, Proceedings of the National Academy of Sciences USA 80:21-25).Also have " Useful proteins from recombinant bacteria " Scientific American, 1980, people such as 242:74-94 and Sambrook, 1989, the same middle other promotor of describing.

Be used for instructing the example of the suitable promotor that nucleic acid construct of the present invention transcribes to have from aspergillus oryzae (Aspergillus oryzae) TAKA amylase at filamentous fungal host cell, Rhizomucor miehei aspartate protease, the neutral α-Dian Fenmei of aspergillus niger (Aspergillus niger), α-Dian Fenmei is stablized in aspergillus niger acid, aspergillus niger or Aspergillus awamori (Aspergillus awamori) glucoamylase (glaA), Rhizomucor miehei lipase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triosephosphate isomerase, Aspergillus nidulans (Aspergillus nidulans) acetamidase and sharp sickle spore (Fusarium oxysporum) trypsin-like proteolytic enzyme (WO 96/00787), and NA2-tpi promotor (from the hybrid promoter of neutral α-Dian Fenmei of aspergillus niger and aspergillus oryzae phosphotriose isomerase gene); And sudden change, promotor brachymemma and heterozygosis.

In yeast host, useful promotor has and is obtained from yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae galactokinase (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP) and yeast saccharomyces cerevisiae 3-phoshoglyceric acid (phosphoglycerate) kinase gene.Also have people such as Romanos, 1992, other the useful promotor that is used for yeast host cell has been described among the Yeast 8:423-488.

Regulating and controlling sequence also can be suitable Transcription Termination subsequence, promptly discerns the sequence that stops transcribing by host cell.The terminator sequence is operably connected to 3 ' end of the nucleotide sequence of coded polypeptide.Any terminator that works in selected host cell all can be used for the present invention.

For the preferred terminator of filamentous fungal host cell is to obtain from the gene of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans anthranilic acid (anthranilate) synthase, aspergillus niger alpha-glucosidase and sharp sickle spore trypsin-like proteolytic enzyme.

Obtain from yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate, brewing yeast cell pigment C (CYC1) and yeast saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase gene for the preferred terminator of yeast host cell.Also have people such as Romanos, 1992, the same middle other useful terminator that is used for yeast host cell of describing.

Regulating and controlling sequence can also be suitable leader sequence, promptly among the mRNA host cell is translated important non-translational region.Leader sequence is operably connected to 5 ' end of the nucleotide sequence of coded polypeptide.Any leader sequence that works in selected host cell all can be used for the present invention.

Obtain from aspergillus oryzae TAKA amylase and Aspergillus nidulans phosphotriose isomerase gene for the preferred leader sequence of filamentous fungal host cell.

Obtain from yeast saccharomyces cerevisiae Hydratase, phosphoenolpyruvate (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, yeast saccharomyces cerevisiae α-factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP) gene for the preferred leader sequence of yeast host cell.

Regulating and controlling sequence can also be the polyadenylation sequence, promptly is operably connected to the sequence of nucleotide sequence 3 ' end, and when being transcribed, is discerned by host cell as the signal that poly-adenosine residue is added on the mRNA that transcribes out.Any polyadenylation sequence that works in selected host cell all can be used for the present invention.

For the preferred polyadenylation sequence of filamentous fungal host cell is to obtain from the gene of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans o-amino benzoyl acid synthase, sharp sickle spore trypsin-like proteolytic enzyme and aspergillus niger alpha-glucosidase.

People such as Guo and Sherman, 1995, the polyadenylation sequence useful to yeast host cell described among the Molecular Cellular Biology 15:5983-5990.

Regulating and controlling sequence can also be a signal peptide coding region, and its coding is connected in the N-terminal of polypeptide, and guides encoded polypeptides to enter the aminoacid sequence of emiocytosis approach.5 of the encoding sequence of nucleotide sequence ' end can contain signal peptide coding region inherently, it the translation reading frame in the coding secrete polypeptide natural connection of coding section.Perhaps, 5 of encoding sequence ' can to contain encoding sequence be external signal peptide coding region to end.If encoding sequence does not contain signal peptide coding region natively, then may need external signal peptide coding region.Perhaps, external signal peptide coding region can be replaced the natural signals peptide-coding region simply so that strengthen the secretion of polypeptide.Yet any signal peptide coding region that instructs polypeptide expressed to enter selected secretory host cell approach all can be used for the present invention.

The signal peptide coding region that has the prsA gene of the neutral protein enzyme (nprT, nprS, nprM) of β-Nei Xiananmei, bacstearothermophilus of subtilisin, the Bacillus licheniformis of α-Dian Fenmei, the Bacillus licheniformis of product maltogenic amylase from genus bacillus NCIB 11837, bacstearothermophilus and subtilis to obtain for the effective signal peptide coding region of bacterial host cell.Also have Simonen and Palva, 1993, other signal peptide of describing among the Microbiological Reviews 57:109-137.

The signal peptide coding region that obtains from the gene of aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, Rhizomucor miehei aspartate protease, Humicola insolens cellulase and Humicola lanuginosa lipase is arranged for the effective signal peptide coding region of filamentous fungal host cell.

For the useful signal peptide of yeast host cell is to obtain from the gene of yeast saccharomyces cerevisiae α-factor and yeast saccharomyces cerevisiae saccharase.People such as Romanos, 1992, other useful signal peptide coding region of having described in the same.

Regulating and controlling sequence can also be propetide (propeptide) coding region, and its coding is positioned at the aminoterminal aminoacid sequence of polypeptide.The polypeptide of gained can be described as proenzyme (proenzyme) or propolypeptide (propolypeptide).Propolypeptide generally be do not have active, by catalysis or autocatalysis cutting with propetide after the propolypeptide excision, can change ripe activated polypeptide into.Preceding peptide-coding region can obtain from the gene of bacillus subtilis alkali proteinase (aprE), subtilis neutral protease (nprT), yeast saccharomyces cerevisiae α-factor, Rhizomucormiehei aspartate protease and Myceliophthora thermophila laccase (WO 95/33836).

When signal peptide and propetide district all were present in the N-terminal of polypeptide, the propetide district was positioned near the aminoterminal position of polypeptide, and the signal peptide district is positioned at the N-terminal position near the propetide district.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, can use TAKA α-Dian Fenmei promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor as regulating sequence.

Other example of regulating sequence has those adjusting sequences that gene is increased.In eukaryotic system, these are included in the dihydrofolate reductase gene that increases when methotrexate exists, and the metallothionein gene of amplification in the presence of heavy metal.In these situations, the nucleotide sequence of coded polypeptide will be operably connected with the adjusting sequence.

Recombinant expression vector

The invention still further relates to the recombinant expression vector that comprises nucleic acid construct of the present invention.The above-mentioned various nucleic acid of stating can be connected together with regulating and controlling sequence producing recombinant expression vector, this carrier can comprise that one or more restriction sites easily make the nucleotide sequence that can insert or replace coded polypeptide in these sites.Perhaps, nucleotide sequence of the present invention can be expressed by nucleotide sequence or the nucleic acid construct that contains sequence are inserted suitable expression.During construction of expression vector, encoding sequence placed carrier so that encoding sequence is operably connected with suitable expression regulation.

Recombinant expression vector can be can accept the recombinant DNA operation easily and can cause any carrier (for example plasmid or virus) that nucleotide sequence is expressed.The selection of carrier is depended on carrier usually and is introduced consistency between the host cell of this carrier.Carrier can be a plasmid linear or closed hoop.

Carrier can be an autonomously replicationg vector, and promptly the form with the outer entity of karyomit(e) exists, and it duplicates the carrier that is independent of THE REPLICATION OF CHROMOSOME, for example plasmid, extra-chromosomal element, minichromosome or artificial chromosome.

Carrier can comprise any means that are used to guarantee self-replacation.Perhaps, carrier can be such carrier: it is incorporated in the genome and with the karyomit(e) that it is integrated into and duplicates after importing host cell.In addition, single carrier or plasmid be can use, or two or more carriers or the plasmid of all DNA that remains to be introduced the host cell gene group, perhaps transposon contained together.

Carrier of the present invention preferably comprises one or more selective markers that allows easily to select transformant.Selective marker is such genoid, and its product helps to produce biocide or virus resistance, heavy metal resistance, auxotroph becomes prototroph (prototrophy to auxotrophs) or the like.

The example of bacterium selective marker has the dal gene from subtilis or Bacillus licheniformis, perhaps gives the mark of antibiotics resistance such as penbritin, kantlex, paraxin or tetracyclin resistance.What be suitable for yeast host cell is marked with ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3.The selective marker of using in thread host cell includes but not limited to: amdS (acetamidase), argB (ornithine transcarbamylase), bar (phosphinothricin acetyltransferase), hygB (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5 '-phosphate decarboxylase), sC (sulfate adenylyl transferase (sulfate adenyltransferase)) and trpC (o-amino benzoyl acid synthase) and Equivalent thereof.

What be preferred for Aspergillus (Asperigillus) cell is the amdS of Aspergillus nidulans or aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus).

Carrier of the present invention preferably comprises and allows vector integration in the host cell gene group or allow carrier not rely on the element of genome self-replicating in cell.

For being incorporated into the host cell gene group, the polynucleotide sequence of the responsible coded polypeptide of carrier or any other carrier element by homology or non-homogeneous recombination and integration in genome.Perhaps, carrier can comprise additional nucleotide sequence, instructs by homologous recombination to be integrated in the host cell gene group in the karyomit(e) exact position.These additional nucleotide sequences can be incorporated in the host cell gene group exact position on karyomit(e) carrier.In order to improve the possibility of integrating in the exact position, integrated element should preferably comprise enough numbers and corresponding target sequence height homologous nucleic acid, such as 100-1,500 base pairs, preferred 400-1,500 base pairs and 800-1 most preferably, 500 base pairs, thereby the probability of raising homologous recombination.Integrated element can be with the host cell gene group in any sequence of target sequence homologous.In addition, integrated element can be non-coding or coding nucleotide sequence.On the other hand, carrier can be by non-homogeneous recombination and integration in the genome of host cell.

For self-replicating, carrier also can comprise the replication orgin that can make carrier self-replicating in described host cell.The example of bacterium replication orgin has the replication orgin of plasmid pBR322, pUC19, pACYC177 and pACYC184 that permission duplicates in intestinal bacteria, and allows to make the replication orgin of pUB110, the pE194, pTA1060 and the pAM β 1 that duplicate in genus bacillus.The example that is used for the replication orgin of yeast host cell has the combination of 2 μ m replication orgin, ARS1, ARS4, ARS1 and CEN3, reaches the combination of ARS4 and CEN6.

Replication orgin can have makes its effect in host cell become the sudden change (see, for example, Ehrlich, 1978, Proceedings of the National.Academy of Sciences USA75:1433) of responsive to temperature type.

Nucleotide sequence more than the coding polypeptide of the present invention of a copy can be inserted in the host cell to strengthen the expression of this gene product.The increase of nucleotide sequence copy numbers can be by following realization: another copy of nucleotide sequence is incorporated in the host cell gene group at least, perhaps nucleotide sequence is included the selected marker that can increase, by culturing cell in the presence of suitable selective agent, thereby can filter out the cell that the selected marker of containing the amplification copy is also just contained the more multiple copied of described nucleotide sequence.

Being used to connect said elements is (for example referring to people such as Sambrook, 1989, the same) well-known to those skilled in the art with the method that makes up recombinant expression vector of the present invention.

Recombinant host cell

The invention still further relates to the recombinant host cell that comprises nucleic acid construct of the present invention, the recombinant production that is used for described polypeptide that they can be favourable.As previously mentioned, the carrier that will comprise nucleotide sequence of the present invention is introduced host cell, so that carrier is held as chromosomal intasome or as the outer carrier of the karyomit(e) of self-replicating.

Host cell can be a unicellular microorganism, prokaryotic organism for example, or non-unicellular microorganism, for example eukaryote.

Useful unicellular microorganism has bacterial cell, such as gram positive bacterium, include but not limited to bacillus cell, for example Alkaliphilic bacillus (Bacillus alkaphilus), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus brevis (Bacillus brevis), Bacillus circulans (Bacillus circulans), Bacillus clausii, Bacillus coagulans (Bacillus coagulans), bacillus lautus (Bacillus lautus), bacillus lentus (Bacillus lentus), Bacillus licheniformis, bacillus megaterium (Bacillus megaterium), bacstearothermophilus, subtilis, and bacillus thuringiensis (Bacillus thuringiensis); Or streptomyces (Streptomyces) cell, for example shallow Streptomyces glaucoviolaceus (Streptomyces lividans) and mouse ash streptomycete (Streptomycesmurinus), perhaps gram negative bacterium is such as intestinal bacteria and pseudomonas kind (Pseudomonassp.).In a specific embodiment, bacterial host cell is bacillus lentus, Bacillus licheniformis, bacstearothermophilus or bacillus subtilis cell.Another preferred aspect, bacillus cell is (alkalophilic) genus bacillus of having a liking for alkali.

Carrier is imported bacterial host cell can be by protoplast transformation for example (referring to for example Chang and Cohen, 1979, Molecular General Genetics 168:111-115), use experience attitude cell is (referring to for example Young and Spizizen, 1961, Journal of Bacteriology 81:823-829; Or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56:209-221), electroporation is (referring to for example Shigekawa and Dower, 1988, Biotechniques 6:742-751) or engage (referring to for example Koehler and Thorne, 1987, Journal of Bacteriology169:5771-5278) realize.

Host cell can be an eukaryotic cell, such as Mammals, insect, plant or fungal cell.

One preferred aspect, host cell is the fungal cell." fungi " comprises Ascomycota (Ascomycota) when being used for this paper, Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota), and Zygomycota (Zygomycota) is (as people such as Hawksworth, at Ainsworth and Bisby ' sDictionary of The Fungi, the 8th edition, 1995, CAB International, University Press, Cambridge, defined among the UK), and oomycetes door (Oomycota) (as people such as Hawksworth, 1995, quoted in the same the 171st page) and all mitospore fungies (people such as Hawksworth, 1995, the same).One preferred aspect, fungal host cells is a yeast cell." yeast " comprises ascosporogenous yeast (Endomycetale Endomycetales), product sporidium yeast and belongs to the yeast (gemma guiding principle Blastomycetes) of imperfect fungi (Fungi Imperfecti) when being used for this paper.Because the zymic classification also can change from now on, for the present invention, yeast should be as at Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M. and Davenport, R.R. compile Soc.App.Bacteriol.Symposium SeriesNo.9,1980) in defined.

One preferred aspect, yeast host cell is that mycocandida, Hansenula (Hansenula), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), saccharomyces (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or Yarrowia belong to cell.

One most preferred aspect, yeast host cell is Ka Ersibai sugar yeast (Saccharomycescarlsbergensis), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharification sugar yeast (Saccharomyces diastaticus), Saccharomyces douglasii, Saccharomyceskluyveri, Saccharomyces norbensis or avette sugar yeast (Saccharomyces oviformis) cell.In another most preferred scheme, yeast host cell is Kluyveromyces lactis (Kluyveromyces lactis) cell.In another most preferred scheme, yeast host cell is a Yarrowia lipolytica cell.

In another more preferred aspect, fungal host cells is a filamentous fungal cells." filamentous fungus " comprises the subclass of all thread forms of Mycophyta (Eumycota) and oomycetes door (Oomycota) (as Hawksworth etc., 1995, document is the same defined).Filamentous fungus is characterised in that the mycelia body wall of being made up of chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans and other complex polysaccharide usually.Nourishing and growing relies on mycelia to prolong, and carbon katabolism is obligate aerobic.On the contrary, nourish and grow such as the zymic of yeast saccharomyces cerevisiae and to be undertaken, and carbon katabolism can ferment by unicellular thalloid budding.

One in addition preferred aspect, filamentous fungal host cell is that Acremonium genus, Aspergillus, fusarium (Fusarium), Humicola (Humicola), Mucor (Mucor), myceliophthora (Myceliophthora), the mould genus of arteries and veins spore (Neurospora), Penicillium (Penicillium), Thielavia (Thielavia), Tolypocladium belong to or the cell of Trichoderma (Trichoderma).

One most preferred aspect, filamentous fungal host cell is Aspergillus awamori, smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.In another most preferred scheme, filamentous fungal host cell is a bar spore shape sickle spore (Fusarium bactridioides), Fusarium cerealis, Fusarium crookwellense, machete sickle spore (Fusarium culmorum), F.graminearum schw (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), fusarium oxysporum (Fusarium oxysporum), racemosus sickle spore (Fusariumreticulatum), rose-colored sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusariumsambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusariumsporotrichioides), sulphur look sickle spore (Fusarium sulphureum), Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum cell.In a kind of the most preferred embodiment, the filamentous fungus parental cell is Fusarium venenatum (Nirenberg sp.nov.) cell.In another kind of the most preferred embodiment, filamentous fungal host cell is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, coarse arteries and veins spore mould (Neurospora crassa), penicillium purpurogenum, Thielavia terrestris, Trichodermaharzianum, healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichoderma reesei or viride cell.

The fungal cell can transform by relating to protoplastis formation, protoplast transformation and cell walls regenerated process in a manner known way.People such as EP 238 023 and Yelton, 1984, the process that suitable Aspergillus and Trichoderma host cell transform has been described among the Proceedingsof the National Academy of Sciences USA 81:1470-1474.People such as Malardier, 1989, the method for suitable conversion fusarium species has been described among Gene 78:147-159 and the WO 96/00787.Yeast can utilize Becker and Guarente at Abelson, J.N. and Simon, the Guide to Yeast Genetics andMolecular Biology that M.I. compiles, Methods in Enzymology, Volume.194, pp 182-187, Academic Press company, New York; People such as Ito, 1983, Journal of Bacteriology 153:163; And people such as Hinnen, 1978, the program described in the Proceedings of the National Academy of SciencesUSA 75:1920 transforms.

Production method

The invention still further relates to the method for producing enzyme of the present invention, comprising: the biological strain of (a) cultivating the nucleotide sequence of the enzyme that comprises the code book invention is that wherein said strain is to express and to secrete this enzyme; And (b) reclaim described enzyme.In a specific embodiment, described strain system is a wild-type strain system, Botryospaeria rhodina CBS 274.96 for example, and described in another embodiment strain system is aforesaid recombinant host cell.

In production method of the present invention, utilize method well-known in the art culturing cell in being suitable for producing the substratum of described enzyme.For example; can be in laboratory or industrial fermentation jar; at suitable substratum and can making under described expression of polypeptides and/or the isolating condition, carry out cell cultures by shake-flask culture, small-scale or large scale fermentation (comprise continuously, in batches, feed supplement-in batches or solid state fermentation).Cultivate and use program known in the art in the suitable nutrient medium that contains carbon and nitrogenous source and inorganic salt, to carry out.The suitable culture base can obtain from commercial supplier, perhaps can prepare according to the prescription of having announced the catalogue of American type culture collection (for example referring to).If enzyme is secreted in the substratum, can directly from substratum, reclaim enzyme so.If enzyme is not secreted, can from cell lysate, reclaim so.

The enzyme polypeptide of gained can reclaim by methods known in the art.For example, can pass through conventional procedure, include but not limited to centrifugal, filtration, extraction, spraying drying, evaporation or precipitation, from substratum, reclaim described enzyme.

Polypeptide of the present invention can be by multiple program purifying known in the art, include but not limited to that chromatography (for example ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis (for example preparation property isoelectrofocusing), difference dissolving (for example ammonium sulfate precipitation), SDS-PAGE or extraction are (for example referring to Protein Purification, J.-C.Janson and Lars Ryden compile, VCH Publishers, New York, 1989.

Transgenic plant

The invention still further relates to transgenic plant, plant part or vegetable cell, their be encoded nucleotide sequences of enzyme of the present invention transform, thereby express described enzyme.Described in one embodiment plant can be as the host who produces described enzyme with callable amount.Can reclaim enzyme from described plant or plant part.Perhaps, the plant or the plant part itself that contain this recombinase can be used for improving food or quality of the fodder, for example, improve nutritive value, palatability and rheological property, or destroy antinutritional factor (antinutritional factor).Particularly, express the plant of described enzyme or parent material that plant part can be used as improvement and be used to produce fuel alcohol or bio-ethanol (bio-ethanol).

Described transgenic plant can be dicots (dicotyledonss) or monocotyledonous (monocotyledons).Monocotyledonous example is careless class/Gramineae (grasses), English grass (meadowgrass) (bluegrass (blue grass), annual bluegrass belong to (Poa)) for example, forage grass (forage grass), festuca (festuca) for example, lolium (lolium); Cold ground type herbage (temperate grass), for example Agrostis (Agrostis); And cereal (cereals), as wheat, oat, rye, barley, rice, Chinese sorghum and corn (maize) (corn (corn)).

The example of dicotyledons has: tobacco; Beans (legumes), for example lupine (lupins); Potato; Beet; Pea; Kidney bean (bean) and soybean, and cress (Brassicaceae), for example Cauliflower, Semen Brassicae campestris (rape seed) and sibship model animals Arabidopis thaliana (Arabidopsis thaliana) closely with it.

The example of plant part has stem, callus, leaf, root, fruit, seed and stem tuber.Specific plant tissue, for example chloroplast(id), apoplast, plastosome, vacuole, peroxysome and tenuigenin all are considered to plant part.In addition, any vegetable cell no matter what it organize from, all is considered to plant part.

The offspring of these plants, plant part and vegetable cell also is included in the scope of the present invention.

The transgenic plant or the vegetable cell of described expression enzyme of the present invention can make up according to methods known in the art.Briefly, described plant or vegetable cell make up like this: the expression construct of one or more codings enzyme of the present invention is integrated into the genome of plant host, and makes modified plant or vegetable cell breeding the becoming transgenic plant or the vegetable cell of gained.

Easily, described expression construct is the nucleic acid construct that comprises nucleotide sequence, described nucleotide sequence coded enzyme of the present invention, and be operably connected to the required suitable regulating and controlling sequence of this nucleotide sequence of expression in selected plant or plant part.In addition, but this expression construct can also comprise the selective marker that can be used for identifying the host cell of having integrated expression construct; And this construct imported the needed dna sequence dna of described plant (latter is depended on the DNA introduction method of use).

Select to regulate sequence, when, where, how for example promotor and terminator sequence, and optional signal or transit sequence according to for example wanting to express this enzyme determine.For example, the expression of gene of the enzyme of the present invention of encoding can be composing type or induction type, perhaps can be developmental character, stage or tissue-specific, and gene product can be by target in concrete tissue or plant part for example seed or leaf.The description of regulating sequence for example there are Tague etc., 1988, Plant Physiology86:506.

For the constructive expression, can use the 35S-CaMV promotor (Franck etc., 1980.Cell 21:285-294).Organ specific promotor can be, for example, from storage property storage tissue (storagesink tissues) for example stem tuber of seed, potato and promotor (Edwards and the Coruzzi of fruit, 1990, Ann.Rev.Genet.24:275-303), perhaps from for example merismatic promotor of metabolic storage tissue (metabolicsink tissues) (Ito etc., 1994, Plant Mol.Biol.24:863-878); Or the promotor of seed-specific, for example from the gluten of rice, prolamine, sphaeroprotein or albumin promoter (Wu etc., 1998, Plant and Cell Physiology 39:885-889), from the legumin B4 of broad bean (Vicia faba) and the broad bean promotor (Conrad etc. of the seed protein gene of the unknown, 1998, Journal of Plant Physiology 152:708-711), from the proteic promotor (Chen etc. of seed oil body (seed oil body), 1998, Plant and Cell Physiology 39:935-941), storage protein napA promotor from colea (Brassica napus), or the promotor of any other seed-specific known in the art, for example WO 91/14772 is described.In addition, this promotor can also be the specific promotor of leaf, for example the rbcs promotor of rice or tomato (Kyozuka etc., 1993, Plant Physiology 102:991-1000); Chlorella virus VITAMIN B4 methyl transferase gene promotor (Mitra and Higgins, 1994, Plant Molecular Biology 26:85-93), or from the aldP gene promoter (people such as Kagaya of rice, 1995, Molecular andGeneral Genetics 248:668-674); Or be the promotor potato pin2 promotor (Xu etc., 1993, Plant Molecular Biology 22:573-588) for example of wound-induced.

Also can use promotor to strengthen the more high expression level that element obtains enzyme in plant.For example, promotor enhancing element can be the intron between the nucleotide sequence of the promotor and the enzyme of the present invention of encoding.Xu etc. for example, first intron that 1993 (the same) disclose rice Actin muscle 1 gene strengthens the purposes of expressing.

But any other part of selectable marker gene and expression construct can be selected those from this area available.

According to routine techniques known in the art this nucleic acid construct is integrated into Plant Genome, described technology comprises that the conversion of Agrobacterium (Agrobacterium) mediation, virus-mediated conversion, microinjection, particle bombardment, biological projectile transform (biolistic tranformation) and electroporation (Gasser etc., 1990, Science 244:1293; Potrykus, 1990, Bio/Technology 8:535; Shimamoto etc., 1989, Nature 338:274).

At present, the transgenosis of agrobacterium tumefaciens (Agrobacterim tumefaciens) mediation is that the preferred method that produces the transgenosis dicotyledons (is seen Hooykas and Schilperoort, 1992, the summary of PlantMolecular Biology 19:15-38).But this method also can be used for transforming monocots, although general preferred other method for transformation of monocotyledons.At present, producing the monocotyledonous preferred method of transgenosis is particle (the minimum gold of the quilt that DNA wraps that is used to transform or tungsten particle) bombardment embryo callus (embroynic calli) or developmental embryo (Christou, 1992, Plant Journal 2:275-281; Shimamoto, 1994, Current Opinion Biotechnology 5:158-162; Vasil etc., 1992, Bio/Technology 10:667-674).The method of another optional transforming monocots is based on protoplast transformation, as Omirulleh etc., and 1993, Plant Molecular Biology 21:415-428 is described.

After the conversion, select to have integrated the transformant of expression construct, and make it be regenerated as whole plant according to side well known in the art.

The invention still further relates to the method that produces enzyme of the present invention, it comprises that (a) helping producing under the condition of described enzyme, cultivates the transgenic plant or the vegetable cell of the nucleotide sequence that contains the enzyme of the present invention of encoding; (b) reclaim this enzyme.

Comprise the composition of enzyme polypeptide and their preparation method

The invention provides the composition and the such method for compositions of preparation that comprise polypeptide of the present invention and vehicle, this method comprises mixes polypeptide of the present invention and vehicle.In a specific embodiment, polypeptide of the present invention is a said composition, for example main (polypeptide) composition in the single-component composition.Here, vehicle is interpreted as being used to prepare any complementary reagent or the compound of described composition, comprises solvent, carrier, stablizer etc.

Said composition can also comprise one or more other enzyme, for example aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, at, Maltose 4-glucosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, haloperoxidase (haloperoxidase), saccharase, laccase, lipase, mannosidase, oxydase, pectin decomposing enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic ferment, rnase, trans-glutaminases, or zytase.

Described composition can and can be the form of liquid or solid composition according to the methods known in the art preparation.For example, enzyme composition can be with the known method preparation of polypeptide and/or medicine preparation technical field, for example is formulated as dressing or not coated granules or microparticle.Therefore polypeptide of the present invention can be with particle, preferred non-pulverizing (non-dusting) particle, and the liquid of liquid, particularly stabilization, the form of slurries or protected polypeptide provides.For certain purposes, can preferably polypeptide be fixed on the solid state substrate.

The polypeptide that will comprise in the composition can be according to the methods known in the art stabilization, thereby for example by adding antioxidant or reductive agent with the polypeptide in the oxidation stable composition of restriction polypeptide, maybe can PVP, PVA, PEG or other are known stablizes it to the stable useful suitable polymers of polypeptide in solid or liquid composition by for example adding.

In other embodiments, composition of the present invention is a detergent compositions, said composition is also comprises surfactant except polypeptide of the present invention, and, randomly, be selected from for example zeolite, SYNTHETIC OPTICAL WHITNER percarbonate, bleach boosters (bleach enhancers) compound of TAED or NOBS, suds suppressor (suds suppressors), perfume compound or the like for example for example of synergistic agent (builder).

Composition of the present invention in another embodiment is a feed composition, and it also comprises cereal (cereal) or cereal (grain) product except polypeptide of the present invention.

Composition of the present invention in another embodiment be comprise polypeptide of the present invention food compositions for example bread powder (baker ' s flour) composition, brewage product, fruit juice, oil or lard product.

Composition of the present invention in another embodiment is a pulp composition, and it also contains paper pulp except polypeptide of the present invention.

Composition of the present invention in another embodiment is thing (biocidal) composition of killing livestock, and it also contains oxydo-reductase promotor except polypeptide of the present invention.

Enzyme polypeptide and the purposes that comprises their composition

In aspect other, the invention provides polypeptide of the present invention or polynucleotide, or the composition that comprises described polypeptide or polynucleotide is in the multiple application process that particularly (technology) process is for example carried out in industry or the family, and below the purposes of the purpose that is used for Business Studies.Therefore such process contained in this paper, and it is included in (technology) industry, research or the family expenses process and uses polypeptide of the present invention or polynucleotide of the present invention.

Polypeptide of the present invention in one embodiment or composition are used to clean the cellulosic fabric.

Use polypeptide of the present invention or preparation of compositions food or fodder additives in another embodiment.

Use wooden (lignolosic) material of polypeptide of the present invention or compositions-treated and paper pulp in another embodiment.

Disclosing of stain remover

Polypeptide of the present invention can add in stain remover (detergent) composition and therefore become its component.

Detergent compositions of the present invention is passable, for example, be formulated as hand washing or machine washing of clothes detergent compositions, it comprises and is applicable to that pre-treatment stains the fabric softening compositions (rinse added fabric softener composition) that the laundry additive composition of fabric and rinsing add; Perhaps can be formulated as the detergent compositions that is used for the operation of general family expenses hard surface cleaning, or be formulated as and be used for hand washing or the operation of machine dishwashing.

One specific aspect in, the invention provides the stain remover additive that comprises polypeptide of the present invention.This stain remover additive and detergent compositions can comprise for example for example laccase and/or peroxidase of proteolytic enzyme, lipase, at, amylase, carbohydrase, cellulase, polygalacturonase, mannase, arabinase (arabinase), Galactanase, zytase, oxydase of one or more other enzyme.

Generally speaking, the character of selected enzyme should be compatible with selected stain remover (for example optimal pH, with consistency of other enzymes or non-enzyme component or the like), and this enzyme should exist with significant quantity.

Proteolytic enzyme: suitable proteolytic enzyme comprises animal, plant or those microbe-derived proteolytic enzyme.Microbe-derived is preferred.Also comprise mutant chemically modified or that protein engineering is transformed.This protein can be serine protease or metalloprotease, is preferably alkaline microbial protease or trypsin-like (trypsin-like) proteolytic enzyme.The example of Sumizyme MP has subtilisin, particularly from those of genus bacillus, for example subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (as described in WO 89/06279).The trypsin-like examples of proteases has trypsin for example pig or Niu Laiyuan) and sickle spore (Fusarium) proteolytic enzyme, it has description in WO 89/06270 and WO 94/25583.

Useful examples of proteases has on the variant described in WO 92/19729, WO 98/20115, WO 98/20116 and the WO 98/34946, the particularly specific position described in those documents the metathetical variant is arranged.

Preferred commercially available proteolytic enzyme comprises Alcalase , Savinase , Primase , Duralase , Esperase  and Kannase  (Novozymes A/S), Maxatase , Maxacal , Maxapem , Properase , Purafect , Purafect OxP , FN2  and FN3  (Genencor International Inc.).

Lipase: suitable lipase comprises those lipase of bacterium or originated from fungus.Also comprise mutant chemically modified or that protein engineering is transformed.The example of useful lipase comprises from Humicola (Humicola, with the Thermomyces synonym) lipase, for example EP 258 068 and EP305 216 described lipase from H.lanuginosa (T.lanuginosus), or the described lipase of WO96/13580 from H.insolens, pseudomonas (Pseudomonas) lipase, for example from Pseudomonas alcaligenes (P.alcaligenes) or pseudomonas pseudoalcaligenes (P.pseudoalcaligenes) (EP 218 272), pseudomonas cepacia (P.cepacia) (EP 331 376), (GB 1 for Situ thatch pseudomonas (P.stutzeri), 372,034), Pseudomonas fluorescens (P.fluorescens), the lipase of pseudomonas bacterial classification SD705 strain (WO 95/06720 and WO 96/27002) and P.wisconsinensis (WO 96/12012); Genus bacillus lipase, for example from subtilis (people such as Dartois, (1993), Biochemica et Biophysica Acta, 1131,253-360), the lipase of bacstearothermophilus (JP 64/744992) or bacillus pumilus (B.pumilus) (WO 91/16422).

Other example has WO 92/05249, and WO 94/01541, and EP 407 225, and EP 260 105, WO95/35381, WO 96/00292, and WO 95/30744, and WO 94/25578, WO 95/14783, the lipase Variant described in the WO95/22615, WO 97/04079 and WO 97/07202.

Preferred commercially available lipase comprises Lipolase ^TM, Lipolase Ultra ^TMAnd Lipex ^TM(Novozymes AJS).

Amylase: suitable amylase (α and/or β) comprises those amylase of bacterium or originated from fungus.Also comprise mutant chemically modified or that protein engineering is transformed.Amylase comprises, for example, derives from genus bacillus, the α-Dian Fenmei of for example a kind of special lichem bacillus strain (at GB 1,296,839 in detailed description is arranged).

Useful diastatic example has WO 94/02597, and WO 94/18314, on the variant of describing among WO 96/23873 and the WO 97/43424, the particularly specific position described in those documents the metathetical variant is arranged.

Preferred commercially available amylase comprises Duramyl ^TM, Termamyl ^TM, Fungamyl ^TMAnd BAN ^TM(Novozymes A/S), Rapidase ^TMAnd Purastar ^TM(from Genencor International Inc.).

Cellulase: suitable cellulase comprises those cellulases of bacterium or originated from fungus.Also comprise mutant chemically modified or that protein engineering is transformed.Suitable cellulase comprises the cellulase that belongs to from bacillus, Rhodopseudomonas, Humicola, fusarium, Thielavia and Acremonium, for example at US 4,435,307, US 5,648, and 263, US 5,691,178, US 5,776,757 and WO 89/09259 in fungal cellulase that describe, that produce by Humicola insolens, Myceliophthora thermophila and sharp sickle spore.

Specially suitable cellulase is alkalescence or the neutral cellulase with the benefit of protecting look (color care).The example of such cellulase has EP 0 495 257, and EP 0 531 372, and WO 96/11262, the cellulase of describing among WO 96/29397 and the WO 98/08940.Other examples have cellulase variants, and for example WO 94/07998, and EP 0 531 315, and US 5,457,046, and US 5,686,593, US5, and 763,254, WO 95/24471, those that describe among WO 98/12307 and the PCT/DK98/00299.

Commercially available cellulase comprises Celluzyme  and Carezyme  (Novozymes), Clazinase  and Puradax HA  (Genencor International Inc.), and KAC-500 (B)  (Kao Corporation).

Peroxidase/oxydase: suitable peroxidase/oxydase comprises those peroxidase/oxydase of plant, bacterium or originated from fungus.Also comprise mutant chemically modified or that protein engineering is transformed.The example of useful peroxidase comprises the peroxidase from Coprinus (Coprinus), for example from Coprinus cinereus (C.cinereus), and variant, as WO 93/24618, described those the peroxidase of WO 95/10602 and WO 98/15257.

Commercially available peroxidase comprises Guardzyme  (Novozymes A/S).

The independent additive that can contain one or more enzymes by adding, or add the composite additive that comprises all enzymes, detergency enzymes (detergent enzyme (s)) is included in the detergent compositions.Stain remover additive of the present invention, promptly independent additive or composite additive can be configured to for example particle, liquid, slurries or the like.The formulation of preferred stain remover additive is a particle, the particularly liquid of non-pulverizing particle, liquid, particularly stabilization, or slurries.

The non-pulverizing particle can, for example,, 991 and 4,661,452 disclosed such preparations, randomly, can also wrap quilt with methods known in the art as US 4,106.The example of wax shape (waxy) capsulating material have mean molal quantity be 1000-20000 poly-(oxyethane) product (polyoxyethylene glycol, PEG); Ethoxylated nonylphenol with 16-50 ethylene oxide unit(s); Ethoxylized fatty alcohol, wherein alcohol contains 12-20 carbon atom, and 15-80 ethylene oxide unit(s) wherein arranged; Fatty Alcohol(C12-C14 and C12-C18); Lipid acid; And the monoglyceride of lipid acid, triglyceride and triglyceride level.GB 1483591 provides the example that is suitable for the film forming capsulating material used by fluidized-bed.The liquid enzymes prepared product can, for example,,, come stabilization as propylene glycol, sugar or sugar alcohol, lactic acid or boric acid by adding polyvalent alcohol according to the method for having established.Can prepare protected enzyme according to EP 238,216 disclosed methods.

Detergent compositions of the present invention can be any form easily, for example bar, sheet, powder, particle, paste or liquid.Liquid detergents can be a water-based, contains usually up to 70% water and the organic solvent of 0-30%, and perhaps can be non-aqueous.

Described detergent compositions comprises one or more tensio-active agents, and it is semi-polar that tensio-active agent can be that non-ionic type comprises, and/or anionic, and/or cationic, and/or amphoteric ion type.Tensio-active agent typically exists with the level of 0.1-60 weight %.

When being included in wherein, described stain remover contains about 1% to about 40% anion surfactant for example Alkyl Benzene Sulphonic Acid's alkyl ester, alpha-alefinically sulphonate, alkyl sodium sulfate ester (fatty alcohol sulfate), alcohol ethoxysulfate (ethoxysulfate), secondary sulfonated alkane (alkanesulfonate), alpha-sulfo fatty acid methyl ester, alkyl or alkenyl succsinic acid or soap usually.

When being included in wherein, described stain remover contains have an appointment 0.2% to about 40% the nonionogenic tenside such as the N-acyl group N-alkyl derivative of fatty alcohol ethoxylate, nonyl phenol ethoxylate, alkyl polyglycoside, alkyl dimethyl amine oxide, ethoxylated fatty acid monoethanolamine, lipid acid monoethanolamine, polyhydroxy alkyl fatty amide (polyhydroxy alkyl fatty acid amide) or glycosamine (" glucosamine " (" glucamides ")) usually.

Described stain remover can comprise that the washing synergistic agent (detergent builder) of 0-65% or complexing agent (complexing agent) are as zeolite, diphosphate, triphosphate, phosphonate (phosphonate), carbonate, Citrate trianion, nitrilotriacetic acid(NTA), ethylenediamine tetraacetic acid (EDTA), diethylene triaminepentaacetic acid(DTPA), alkyl or alkenyl succsinic acid, soluble silicate or stratified (layered) silicate (for example from Hoechst SKS-6)

Described stain remover can comprise one or more polymkeric substance.For example carboxymethyl cellulose, poly-(V-Pyrol RC), poly-(ethylene glycol), poly-(vinyl alcohol), poly-(vinylpyridine-N-oxide compound), poly-(ethene imidazoles), polycarboxylate such as polyacrylic ester, toxilic acid/acrylic copolymer and lauryl methacrylate(LMA)/acrylic copolymer.

Described stain remover can comprise bleaching system, and described system comprises H ₂O ₂The source is perborate or percarbonate for example, and it can make up as tetra acetyl ethylene diamine or nonanoyl oxygen benzene sulfonate (nonanoyloxybenzenesulfonate) with product peracid bleach activator (peracid-forming bleach activator).Perhaps, bleaching system can comprise for example peroxy acid of acid amides, imide or sulfone type.

The enzyme of detergent compositions of the present invention can come stabilization with the stablizer of routine, for example polyvalent alcohol such as propylene glycol or glycerol, sugar or sugar alcohol, lactic acid, boric acid or boric acid derivatives, for example, the aromatic boric acid ester, or phenylo boric acid derivative such as 4-formyl phenylo boric acid, and said composition can be prepared as described in WO92/19709 and WO 92/19708.

Detergent solution also can comprise the detergent component that other are conventional, and for example fabric conditioner (conditioner) comprises clay, short infusion, suds suppressor, inhibitor, the dirt suspension agent, anti-dirt redeposition agent, dyestuff, sterilant, white dyes, hydrotropic agent, tarnish inhibitor, or spices.

In this consideration, in described detergent compositions, any enzyme, enzyme particularly of the present invention, can be to be equivalent to every liter of washings of 0.01-100mg zymoprotein, preferred every liter of washings of 0.05-5mg zymoprotein, the most preferably amount of every liter of washings of 0.1-1mg zymoprotein adding.

Enzyme of the present invention can also be incorporated in the WO 97/07202 disclosed detergent compositions, incorporates WO 97/07202 into this paper as a reference at this.

The microorganism of preservation

According to " microorganism that is used for patented procedure of international recognition preserves budapest treaty ", following microorganism is deposited in fungi strain preservation center (Centraalbureau voor Schimmelcultures), Fungal and Yeast Collection, Uppsala-laan 8,3584 CT Utrecht, P.O.Box 85167,3508 AD Utrecht, Holland:

Title: Botryosphaeria rhodina

Alias: cotton look two spores (Diplodia gossypina) (SBL 274) (Berkeley﹠amp; M.A.Curtis) von Arx, von 1970, " The genera offungi sporulating in pure culture ": 143

Classification: Dothideaceae, Dothideales, Dothidemycetes, Ascomycota (Ascomycota)

Preserving number: CBS 274.96

Preservation date: on March 12nd, 1996

Embodiment

Embodiment 1 identifies Botryosphaeria rhodina CBS 274.96 excretory functional polypeptides

The enzyme fingerprinting of nutrient solution

By culture broth being measured, obtained the enzymic activity distribution plan with the plurality of enzymes measuring method.96 hole microtitration (MT) plates of preparation band substrate also are kept at 10 ℃ up to use.Two kinds of different pH versions have been prepared: pH3 and pH7.Substrate below using: 0.05%AZCL (Mazurine dyeing and crosslinked substrate, Megazyme)-and amylose starch, arabinan, beta-glucan (barley), casein, collagen, curdlan, dextran, Polygalactan (potato), polygalactomannan (angle beans) (carob), He-Mierocrystalline cellulose, amylopectin (pullulan), xylan (oat) and xyloglucan (the AZCL-casein can not be used in pH3, so does not add the AZCL-casein in these plates).

The preparation of pH3 substrate:

Every kind of AZCL substrate of 0.1g is dissolved among the 0.2M succsinic acid pH3+10 microlitre Triton X-100 (0.01%) of 100ml, obtains the final concentration of 0.1%AZCL.

The preparation of pH7 substrate:

The aseptic H20 that every kind of AZCL of 0.1g is dissolved in 50ml adds among the 10 microlitre Triton X-100 (0.01%).In each 50ml AZCL substrate, add 50ml 0.4M MOPS pH7, obtain final volume 100ml, and final concentration 0.2M damping fluid, 0.1%AZCL.

Also comprised the mensuration of laccase and lipase activity, substrate is prepared as follows:

The preparation of laccase substrate:

Preparation is dissolved in 0.2M phosphoric acid salt/borate buffer solution, the 0.08mg/ml Chicago SkyBlue 35ml of pH9.

The preparation of lipase substrate:

By to mix 2%PVA solution at 3: 1 and soybean oil prepares polyvinyl alcohol (PVA)/soybean oil emulsion.Use the ULTRA-TURRAX mixing tank with oily emulsification, and emulsion and the 500ml of 12ml comprised 10mM CaCl ₂, the 0.2M sodium acetate buffer of pH5.5, and the crystal violet solution of 5ml 0.2% mixes.

Use US Sterilin 96 hole MT plates and Multidrop S20 dress plate device (stacker), TitertekInstruments, Inc., Alabama.The every kind of AZCL-substrate of 200 microlitres and the laccase substrate branch of lipase substrate and 150 microlitres are installed in the MT hole, and 30-50 μ l culture broth is added in every part of substrate, 26 ℃ are incubated overnight.Following measurement result is marked: 0: non-activity; 1: weak activity; 2: strong active.

Form as a result: the fingerprinting of cotton look two spore culture broth

Substrate	Enzymic activity	pH3	pH7
Substrate	Enzymic activity	pH3	pH7	The ACZL-amylose starch	α-Dian Fenmei	0 ^a	1
ACZL-arabinan (removing branch)	Inscribe-1,5-α-L-arabinanase	0	2	The ACZL-amylose starch	α-Dian Fenmei	0 ^a	1
ACZL-arabinan (removing branch)	Inscribe-1,5-α-L-arabinanase	0	2	ACZL-beta-glucan (barley)	Beta-glucanase, lichenase and cellulase	2	1
The ACZL-casein	Proteolytic enzyme	Nt ^b	2	ACZL-beta-glucan (barley)	Beta-glucanase, lichenase and cellulase	2	1
The ACZL-casein	Proteolytic enzyme	Nt ^b	2	ACZL-collagen	Proteolytic enzyme	0	1
The ACZL-curdlan	Inscribe-1,3-callose enzyme	1	0	ACZL-collagen	Proteolytic enzyme	0	1
The ACZL-curdlan	Inscribe-1,3-callose enzyme	1	0	The ACZL-dextran	Inscribe-1,6-α-D-dextranase (dextranase)	0	0
ACZL-Polygalactan (potato)	Inscribe-1,4-β-D-Galactanase	0	2	The ACZL-dextran	Inscribe-1,6-α-D-dextranase (dextranase)	0	0
ACZL-Polygalactan (potato)	Inscribe-1,4-β-D-Galactanase	0	2	ACZL-polygalactomannan (angle beans)	Inscribe-1,4-β-D-mannase	2	2
The ACZL-HE-Mierocrystalline cellulose	Inscribe-cellulase	2	2	ACZL-polygalactomannan (angle beans)	Inscribe-1,4-β-D-mannase	2	2
The ACZL-HE-Mierocrystalline cellulose	Inscribe-cellulase	2	2	The ACZL-amylopectin	Limit dextrinase (Starch debranching enzyme)	0	0
ACZL-xylan (Oat Spelts)	Inscribe-1,4-β-D-zytase	2	2	The ACZL-amylopectin	Limit dextrinase (Starch debranching enzyme)	0	0
ACZL-xylan (Oat Spelts)	Inscribe-1,4-β-D-zytase	2	2	The ACZL-xyloglucan	Endo cellulase	0	2
Chicago Sky Blue	Laccase	0	0	The ACZL-xyloglucan	Endo cellulase	0	2
Chicago Sky Blue	Laccase	0	0	The PVA/ soybean oil	Lipase	0	0

^aResult's scoring of determination of activity: 0=non-activity; The weak reaction of 1=; 2=reacts by force

^bNt=does not test

The A.cDNA library construction

With the cDNA of the Protocols in Molecular Biology of standard people 1995 " Current protocols inmolecular biology " Publ.:John Wiley and sons such as () Ausuble preparation from Botryosphaeriarhodina CBS 274.96.

The fermentation of the biomass of using during the cDNA library produces be from 28 ℃ of following incubations 7 days the PDA plate of inoculation begin.Inoculation several mycelium-PDA agar plug (plugs) in the bottle that shakes of Mex1 substratum is being arranged, wherein the Mex1 substratum contains (every liter): the 20g soybean, 15g wheat bran, 10g avicel cellulose (cellulose Avicel), 5g Star Dri 5 01,3g bactopeptone (bactopeptone), 0.2g polyoxypropylene (pluronic) PE6100 and 1g sweet oil.Vibrating at 26 ℃ of following 150rpm, these shake bottle.Filter the collection mycelium by Miracloth after 7 days, and mycelium is chilled in the liquid nitrogen, preserve up to use down at-80 ℃.

RNA separates: prepare total RNA from freezing, powdered Botryospaeria rhodina mycelium, method is to extract by guanidine thiocyanate, pass through the ultracentrifugation (Chirgwin of lower floor (cushion) of 5.7M CsCl then, J.M., Przbyla, A.E., Macdonlad, RJ. with Ruttwer W.J., Isolation ofbiologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry 18,5294-5299,1979).With oligomerization (dT)-Mierocrystalline cellulose affinity chromatography (Aviv, H. and Leder, P., Purification of biologically active globin messenger RNA bychromatography on oligothymidylic acid-cellulose, Proc.Natl.Acad.Sci.USA69 (6), 1408-1412,1972) separate the RNA that is rich in poly A.

The structure in cDNA library: according to Gubler U and Hoffman, B.J., A simple and veryefficient method for generating cDNA libraries, Gene 25 (2-3), 263-269, (1983); Sambrook, J., Fritsch, E.F. and Maniantis, T.Molecular cloning:A laboratoryManual, second edition, 1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, people's (1994) such as New York and Kofod general method uses poly A-Not1 primer (Promega, the U.S.) synthetic double chain cDNA.After synthesizing, handle cDNA, with the flat endization of T4 archaeal dna polymerase, then with excessive 50 times EcoRI joint (Invitrogen, the U.S.) connection of mole number with the mung bean rnase.According to the guidance of manufacturers, with restriction enzyme NotI (New England Biolabs, the U.S.) cutting cDNA, then with agarose gel electrophoresis with the cDNA size classification.To downcut and with GFX DNA separating kit (AP Biotech) purifying from gel corresponding to 700bp and bigger cDNA.Then by ligation with the cDNA directed cloning for preparing in the pMHas5 of EcoRI-NotI cutting.After will connecting mixture and import DH10B cell (Invitrogen) by electroporation, be taped against and contain on the LB agar that 50mg/ rises kantlex.30,000 transformant altogether that connect product from original cDNA-pMHas5 carrier prepare cDNA plasmid pond (pool).According to the plasmid DNA lock out operation rules (Qiagen Inc.GMBH) of Qiagen, select the pond of the bacterium colony that substratum reclaims directly preparation plasmid DNA from solid LB kantlex.

The carrier that is used to clone is pMhas5, and it is on the books in patent WO 03/044049, has following feature:

Characteristic portion is described

CDS 365-1156 kalamycin resistance

CDS 2232-2387 beta-galactosidase enzymes α peptide

-10 signal 2189-2192 SD sequences

Promotor 2101-2189 Lac promotor

The KanP1 primer of diversity feature 626-650 BACE system

The noticeable feature of this plasmid is near the EcoRI-NotI restriction site in SD zone of Lac promotor.It makes the cDNA of band EcoRI-NotI joint to be cloned in the carrier, and makes the construct of gained can be transcribed actively and translate in escherichia coli host.

B. the structure of transposon and preparation

Described as WO 01/77315 A1, the transposon assist signal is caught (Transposon AssistedSignal Trapping, TAST) ultimate principle is that genes all in the selected genome is merged mutually by the gene of transposon tagging with the β-Nei Xiananmei of coding no signal.Like this, when cultivating the host cell clone comprise by transposon tagging and the genomic gene of the gene fusion of the β-Nei Xiananmei of coding no signal in the substratum that is containing penbritin, have only and express and those clones of secretion β-Nei Xiananmei can survive.But, only having at the gene with the β-Nei Xiananmei gene fusion can be by the complete promotor of host's strain system identification and ribosome bind site (promptly, in the true life process, produced the gene of polypeptide) by cell expressing, and β-Nei Xiananmei is translated like this, under the condition that makes the synthetic polypeptide be passed cytoplasmic membrane by transhipment and correctly fold, β-Nei Xiananmei just can be secreted.Therefore, when the gene that will merge was inserted into the host cell of selection, the clone of those amicillin resistances just contained the gene of encoding function secrete polypeptide.

Even do not need to express whole gene when usually, using the TAST method.When adding transposon tagging to gene, the N-terminal of these genes part is as expressing fusion protein, just show these genes contain complete transcribe, translation and secretion sequence.Therefore, the N-terminal part that it has been generally acknowledged that these genes is enough to guarantee whole expression of gene and secretion as Expression of Fusion Protein.

Therefore can draw a conclusion: the gene that obtains by the TAST method excretory functional polypeptide of encoding really.

The structure that contains the SigA4 transposon of β-Nei Xiananmei reporter gene:

According to the guidance of WO 01/77315 A1, use standard molecular biological technique to make up the transposon that contains no signal β-Nei Xiananmei gene.At first, use has (proofreading) polysaccharase (Pfu Turbo, Stratagene, the U.S.) of proofreading activity from pUC19 carrier pcr amplification no signal β-Nei Xiananmei gene.The PCR fragment of gained contains NotI and EcoRI restriction site so that the clone.Plasmid pEntranceposon (the Cam that contains Entranceposon and antibiotics resistance mark CAT (chlorampenicol resistant of in transposon, encoding) ^r) be from Finnzymes, (the Espoo Finland) that OY obtains.Digest this plasmid with restriction enzyme NotI and EcoRI, the fragment with the β-Nei Xiananmei that contains no signal after the gel-purified is connected.To connect in the DH10B cell that product is transformed into electric transformed competence colibacillus (electro-competent), identify the escherichia coli cloning of the plasmid that contains the β-Nei Xiananmei that has described no signal and called after SigA2 by restriction analysis.

Be the preparation transposon, made up less SigA2 derivative, it lacks the bla gene of coding β-Nei Xiananmei: use the initial sum termination of the bla gene that is attached to SigA2, and outside two Oligonucleolide primers SigA2NotU-P 5 '-TCG CGA TCC GTT TTC GCA TTTATC GTG AAA CGC T-3 ' (SEQ ID NO:43) and the SigA2NotD-P 5 '-CCG CAAACG CTG GTG AAA GTA AAA GAT GCT GAA-3 ' (SEQ ID NO:44) of direction comes pcr amplification not have the SigA2 of bla gene.The amplified production of about 3.6kb that this PCR reaction produces is transformed in the suitable coli strain through after reconnecting (relegate).From can be at LB paraxin but can not the transformant that the LB penbritin is grown, separate the plasmid of 3.6kb.This plasmid has kept all two BglII sites and has lacked active blg gene, is called as pSig4.

60 microlitre concentration are that the pSigA4 plasmid DNA prepared product of 0.3 μ g/ μ l is with BglII digestion and separate on sepharose.The SigA2 transposon DNA band of 2kb is eluted, and according to supplier's guidance, with " GFX ^TMPCR, DNA and gel strips zone purification test kit " (PCR, DNA andGel Band Purification Kit) (the Amersham Pharmacia Biotech Inc. U.S.) purifying, with 200 microlitre EB buffer solution elution.Zhi Bei SigA2 can be used for transposon assist signal seizure (TAST sees below) like this.

C. transposon tagging

Have the bla gene of 5 ' brachymemma from the transposon of pSigA4 preparation, this genes encoding has been removed the β-Nei Xiananmei of secretion signal.β-Nei Xiananmei only just can be given the intestinal bacteria amicillin resistance when being secreted into pericentral siphon, and the cytoplasmic expression of β-Nei Xiananmei can not be given amicillin resistance.If there is not signal sequence, β-Nei Xiananmei will can not be transported in the pericentral siphon, thereby the clone just can not grow containing on the substratum of penbritin yet.The β-Nei Xiananmei gene of no signal is included in the transposon by this way, makes to have the successive open reading frame between the border of transposon and the β-Nei Xiananmei coding region.Like this, reformed transposon can cause the fusion with the common reading frame (in-frame) of target gene when swivel base is in coding excretory proteinic gene.So just cause the generation that is secreted into colibacillus periplasm and gives the warm gene product of amicillin resistance.And if transposon is incorporated in the coding non-secretion proteic gene, even read frame altogether, corresponding host can not become amicillin resistance yet.

The transposon assist signal of D.Botryosphaeria rhodina is caught

Can in WO 01/77315, find about the complete description that the transposon assist signal is caught.30,000 transformant altogether that connect product from initial cDNA-pMHas5 carrier have made up cDNA plasmid pond.According to the plasmid DNA lock out operation rules (Qiagen Inc.) of Qiagen, select the pond of the bacterium colony that substratum reclaims directly preparation plasmid DNA from solid LB kantlex.(Finnizyme Finland), handles the plasmid pond with transposon SigA2 and MuA transposase according to the guidance of transposase manufacturers.

In order to add transposon tagging for Botryosphaeria rhodina CBS 274.96 cDNA libraries, the SigA2 transposon 4 or 8 microlitres that will contain the DNA of 2.6 micrograms of having an appointment, Botryosphaeria rhodina CBS 274.96 cDNA libraries 1 microlitre with the DNA concentration of plasmid pond DNA, FinnzymesMuA transposase 2 microlitres (0.22 microgram/microlitre), with the 5x damping fluid (from Finnzymes OY, Espoo, Finland) 5 microlitres mix in the cumulative volume of 50 microlitres, and 30 ℃ of incubations 3.5 hours, then at 75 ℃ of heat inactivation 10min.Add 5 microlitre 3M sodium acetate pH5 and 110 microlitres, 96% ethanol, and make the DNA precipitation at the centrifugal 30min of 20000rpm.Washing precipitation is also dry, resuspended in 10 microlitre TE damping fluids then.

At Biorad gene pulse equipment (50 μ F, 20mAmp, 1.8kV) in, 1.5 the plasmid pond that is added with transposon tagging of microlitre imports the super competence of DH10B (ultra-competent) cell of 20 microlitres by electroporation, (Gibco-BRL) carries out according to the standard operating procedure that provides with this cell.Cell incubation (28 ℃ 2 hours, 250rpm), are layered on then and select on the substratum in the SOC substratum under vibration with electroporation.Used 3 kinds of nutrient agars:

The LB+50mg/ml kantlex,

LB+ kantlex+15mg/ml paraxin and/or

LB+ kantlex+paraxin+12.5mg/ml penbritin.

By the electroporation product being diluted and being layered on LB+ kantlex+paraxin substratum, determined that every part of electroporation thing approximately exists 72,000 bacterium colony that contains the cDNA library plasmid of band SigA2 transposon, and under three reselection procedure (LB, kantlex, paraxin, penbritin), 69 bacterium colonies have approximately been reclaimed.Further carry out the experiment of electroporation and bed board, up under three reselection procedure, from experiment, reclaiming 445 bacterium colonies altogether.According to Qiagen Qiaturbo96 working specification (the Qiagen Inc. U.S.) these bacterium colonies are carried out plasmid and extract (miniprep) in a small amount.According to disclosed method among the embodiment of International Patent Application WO 01/77315 (the 28th page), plasmid is checked order with transposon forward and reverse primer (primer A and B).

Primer A:AGCGT TTGCG GCCGC GATCC (SEQ ID NO:45)

Primer B:TTATT CGGTC GAAAA GGATC C (SEQ ID NO:46)

E. sequence assembling and note

Obtain the dna sequence dna of reactant with AB3700 kapillary sequenator.Repair these sequences and read the result with the carrier of removing each plasmid and transposon sequence and A and B primer.Obtain the sequence of 225 assemblings thus, use PhredPhrap program (Brent Ewing, LaDeana Hillier, Michael C.Wendl and Phil Green; Base-calling of automated sequencer traces using phred I.Accuracy assessment; Genome Research; 8:175-185; 1998; Brent Ewing and PhilGreen; Base-calling of automated se-quencer traces using phred II.Errorprobabilities; Genome Research 8:186-194; 1998) they are divided into 148 contigs (contigs).Use BLASTX program 2.0a19MP-WashU[1998-7-14 then] and [making up Linux-x86 18:51:44 30-Jul-1998] (Gish, Warren 1994-1997-is unexposed; Gish, Warren and David J.States; Identification of protein coding regions by databasesimilarity search; Nat.Genet.3:266-72; 1993), with all 148 contigs with can from the public DNA of standard and protein sequence database (TrEMBL, SWALL, PDB, EnsemblPep, GeneSeqP) sequence that obtains is relatively.

The sequence major part of gained is the functioning gene of the complete functional polypeptide of coding, and it obtains from the amicillin resistance clone as mentioned above, as the basis of manual analysis.

For the amicillin resistance of confirming described bacterium colony is the result that the beta-lactam enzymic activity increases, tested the beta-lactam enzymic activity among the signal capture clone that the arrival site of transposon (landing site) is different on 10 cDNA.Working specification according to Invitrogen Life Technologies is transformed into plasmid DNA in the One Shot Top 10 chemoreception attitude intestinal bacteria again, and transformation mixture is coated on the LB agar of band kantlex (50 μ g/ml) and paraxin (10 μ g/ml).28 ℃ after following 2 days, with the bacterial colony photographic reprinting bed board to the LB of LB kantlex, paraxin and 15 (10 μ g/ml) penbritin.28 ℃ after following 3 days, the bacterium colony (true growers) of really growth is inoculated in the 10ml LB substratum that contains kantlex (50 μ g/ml) and paraxin (10 μ g/ml), 37 ℃, 275rpm is incubated overnight.Be diluted in fresh LB Kan/CAM substratum by 1: 100 overnight culture and cultivate OD600=0.5.Centrifugal collecting cell and once with 0.9%NaCl washing.Precipitation is suspended in the supersound process damping fluid (pH 8.0 for 100mM Tris-HCl, 2mM EDTA), regulates cell and count to optical density(OD) OD600=0.5, with the amplitude supersound process of Soniprep 150 (MSE) with 1.5 μ m.15, the centrifugal 10min of 000rpm is used for the beta-lactam enzymatic determination with supernatant with sample.In the plastics cuvette, supernatant and 50 μ l nitrocefin are added lustre to, and (1mg/ml is in 50%DMSO for the beta-lactam enzyme substrates; 0.05M PO ₄In the damping fluid) and 0.1M PO ₄Damping fluid is mixed into 1ml, uses 3300pro spectrophotometer measurement Abs then ₄₈₂The result is as follows:

Table I X: have different Shine Dalgamo (SD) sequences and ATG translation initiation codon and between distance and transposon clone's beta-lactam enzymic activity of arriving the site

The clone	The arrival site of the last transposon of cDNA (landing site) (bp)	Distance (bp) between SD sequence and the ATG initiator codon	Beta-lactam enzymic activity (to catching clone (trappant) ZY063807 normalization method)
The clone				ZY063832	806	102	5-5
ZY063832	650	102	11.5	ZY063832	806	102	5-5
ZY063832	650	102	11.5	ZY063836	991	35	35.5
ZY063836	991	35	4.0	ZY063836	991	35	35.5
ZY063836	991	35	4.0	ZY063807	851	256	1.0
ZY063827	568	8	202.0	ZY063807	851	256	1.0
ZY063827	568	8	202.0	ZY063816	476	126	16.0
ZY063816	634	126	3.0	ZY063816	476	126	16.0
ZY063816	634	126	3.0	ZY063171	469	9	106.5
ZY063171	684	9	52.0	ZY063171	469	9	106.5

Last table has illustrated 3 main points:

1) all can detect the beta-lactam enzymic activity among all 10 clones.What should emphasize is that the intestinal bacteria transformant that contains plasmid accordingly rises penbritin to 50mg/ and selects to have resistance.These true common demonstrations, all 10 clones produce the hybrid protein of being made up of the part of the cDNA of the band transposon tagging that is fused to the β-Nei Xiananmei gene, wherein to provide the mode with the active peptide of β-Nei Xiananmei to merge.

2) because these 10 clones' cDNA is checked order fully, the in-position of SigA2 transposon in each clone obtained confirmation.These 10 clones contain the SigA2 transposon, and it is in correct direction and reads in the frame, to impel natural be encoded proteic N-terminal and the coded β-Nei Xiananmei generation heterozygosis fusion of transposon.

3) in eucaryon cDNA, the length of the upstream of untranslated (5 ' UTR) leader sequence can change between hundreds of base pairs at 1bp.In order for example optimally to translate cDNA in the Shine-Dalgarno zone from intestinal bacteria translation element, the optimal distance of 4 to 11 base pairs is optimum before the ATG initiator codon.As seen from the above table, the 5 ' UTR more much longer than optimum value still allows some cDNA heterozygote-beta-lactam enzyme fusion proteins of expression, because observed the beta-lactam enzymic activity in the transformed into escherichia coli from sample.

The nucleotide sequence of the present invention of gained is the complete functional polypeptide of functioning gene coding, not only for above-mentioned reasons, and because they obtain from the amicillin resistance clone.Here the clone of Huo Deing is an amicillin resistance, because after adding transposon tagging, the β-Nei Xiananmei gene fusion of these genes and no signal, the β-Nei Xiananmei gene of no signal has only when when having the gene fusion of the complete promotor that can be identified and ribosome bind site in host's strain, could be expressed, translation, transhipment pass cytoplasmic membrane and correctly folding.

Therefore, can draw a conclusion, gene of the present invention is the active excretory polypeptide of coding really.Because 16 Gene Sequence Analysis show the common reading frame that has obtained with the β-Nei Xiananmei gene of no signal and merge.In addition, by measuring whole nucleotide sequence, proved conclusively open reading frame complete of these genes.

Embodiment 2 determines enzymic activity by homology

By with the gene of known function or polypeptide relatively, can predicted gene or the function of the polypeptide that is encoded.Analyzed A _DNAGroup and B _PolypeptideThe group sequence with from the similarity between the sequence of public and internal database, with definite A _DNAGroup and B _PolypeptideOrganize the functional of sequence.Sequence is relatively used program BLASTX2.0a19MP-WashU[1998-7-14] carry out.By with A _DNAGroup and B _PolypeptideGroup sequence function known sequences immediate with it carried out careful artificial sequence comparison, for the function of predicting these genes and the polypeptide that is encoded provides possibility.Even be lower than 40%, thereby may be difficult to make under the situation of reliable prediction in all amino acid whose identity, by carefully analyze and the important area of interpretation catalytic site and/or peptide sequence in amino-acid residue, prediction A _DNAGroup and B _PolypeptideThe function of group sequence also is possible.If the amino acid of the catalytic site of known array also is present in the polypeptide of the present invention, have enough all amino acid whose identity simultaneously, just can conclude that this polypeptide and described known array from Botryosphaeriarhodina CBS 274.96 has same function.

Embodiment 3 preparation B _PolypeptideThe group polypeptide

For from filamentous fungus for example the cDNA of Botryosphaeria rhodina CBS 274.96 prepare polypeptide, it is feasible expressing this cDNA in yeast or other filamentous fungus.As the example of non exhaustive property, a kind of good selection is to express in aspergillus oryzae.Provided the cDNA (SEQ ID No:3) that how in aspergillus oryzae, to express the coding zytase below.

Use expression plasmid pDaU71.This plasmid contains (1) Aspergillus nidulans amdS gene, as the selective marker in the aspergillus; (2) yeast URA3 gene, it is cut off by ampicillin resistance gene, is used for selecting intestinal bacteria; (3) overlapping with the aspergillus niger NA2 promotor (neutral starch enzyme) in 3 extra amyR-sites+Aspergillus nidulans TPI promotor 5 ' untranslated part is used for heterogenous expression; (4) aspergillus niger AMG terminator.As the template of relevant portion in amplification pond, Botryosphaeria rhodina cDNA library, the primer below in the PCR reaction, using:

Primer #166:CGCGGATCCACCATGGTCTCCTTCAAGTCGATTC (SEQID NO:47)

Primer #167:CCGCTCGAGTTACTGCACGGTAATCGTAGC (SEQ ID NO:47)

Use following conditions:

According to the indication of manufacturers, use Extensor Hi Fidelity Reddy Load archaeal dna polymerase PCR mixed solution (ABGene, Britain).

CDNA plasmid pond (1 nanogram/microlitre): 5 microlitres

Primer #166 1 microlitre

Primer #167 1 microlitre

PCR master's mixed solution (master mix) 12.5 microlitres

Deionized water 7.5 microlitres

Cumulative volume 25 microlitres

Reactant is changed in the MJ Research DNA cloning instrument that is preheating to 94 ℃, carries out following circulation then:

94 ℃ 2 minutes

25 round-robin then:

94 ℃ 30 seconds

53 ℃ 30 seconds

72 ℃ 1 minute

Then

72 ℃ 10 minutes

Product with 1% agarose gel analysis, 5 microlitres is also determined the amount of the PCR product of gained to confirm correct size.Indication (AP Pharma) 20 last microlitre mixtures of GFX purifying according to manufacturers.In the digested overnight reaction system of 30 microlitre standards, carry out the BamHI-XhoI restriction digestion of standard with 20 microlitres in the 40 microlitre purified products.And then with the product of GFX purifying restriction digestion, again it is carried out the ligation of standard with pDau71 through BamHI-XhoI restriction digestion and purifying.To connect product and be transformed into (intestinal bacteria DH10B or TOP10 (can obtain from Invitrogen) can be used as cloning host the structure of this expression vector) in the DH10B Bacillus coli cells, and on the LB ampicillin medium bed board.Select 10 transformant to carry out the plasmid DNA purifying, and it is checked order to determine to insert the fragments sequence integrity.Select the clone pPFJO47 of a no PCR mistake to be used for further research.

As structure aspergillus oryzae BECh2 strain as described in the WO 00/39322 (BECh2 derives from aspergillus oryzae JaL228, and this bacterial strain is as being fundamental construction with the bacterial strain aspergillus oryzae IFP4177 of preservation as described in the WO 98/12300).Transform and culture condition according to people such as Christiansen, 1988, Biotechnology 6,1419-1422 reaches as described in the 63rd page of WO 01/12794-A and carries out.Carry out taking turns again separate after, be used for 10ml YP glucose or YP maltose in the spore inoculating Nunc of transformant pipe, and culture cultivated 3 days down at 30 ℃.

To carry out sds gel electrophoresis from 10 microlitre supernatant samples of above-mentioned 10ml culture.With SYPRO Orange Protein Gel Stain (Molecular Probes) to gel-colored.Several aspergillus transformant have significant band on sds gel.By carrying out the xylanase activity that AZCL-wheat araboxylan is further analyzed these positive findingses for 6.0 times at pH.At 0.2M sodium phosphate salt (Na-phosphate) damping fluid, among the pH 6.0+0.01%Triton-X 100 substrate promptly is prepared as the suspension of 0.2%w/v from the AZCL-araboxylan (Megazyme) of wheat.Substrate with 900 microlitres in the hot mixed instrument of Eppendorf (thermomixer) is preheating to 37 ℃.In substrate, add 100 microlitres from the thick nutrient solution supernatant of recombinant host bacterial strain Bech2 or different sample and under top speed at 37 ℃ of incubation 15min.Then reaction mixture was placed on ice 2 minutes, with 20, the centrifugal 1min of 000xG.The supernatant of 2 * 200 microlitres is transferred to microtiter plate and measure at OD590.The increase of measuring absorbancy is as activity.

Embodiment 4 measures xylanase activity

Active mensuration is used the nutrient solution or the cell lysate of host's strain of the synthetic justacrine zytase in the suitable damping fluid.Such sample spot of suitable volumes to agar plate, is contained insoluble chromogenic substrate AZCL-Birch xylan (Megazyme on the agar plate ^TM) and suitable damping fluid, its pH is for example 4.5-7.5.In suitable temperature, for example under 37 ℃, the time that dull and stereotyped incubation is suitable, for example one day.The haloing (halo) of the blueness around activity is visible as a little.

Embodiment 5 measures peroxidase activity

Peroxidase can use as people such as Ishida: 1987 described 2,4-chlorophenesic acid method (Ishida, A., N.Futamura and T.Matsusaka.1987.Detection of peroxidaseacitvity and its localisation in the forespore envelopes of Bacillus cereus.J.Gen.Appl.Microbiol.33:27-32.) measure with spectrophotometry.As indicator, can use the 1.0mM 2 in the 100mM potassium phosphate buffer (pH 7.0), the mixture of the 4-aminoantipyrene (aminoantipyrine) of 4-chlorophenesic acid and 82mM, suitable substrate are the 50mM hydrogen peroxide (Sigma) in the 100mM potassium phosphate buffer (pH 7.0).

The nutrient solution supernatant that 200 microlitres are diluted suitably adds 1ml plastics cuvette.Add 200 microlitre indicator mixture.Add 200 microlitre hydrogen peroxide substrates and start reaction.Measure the variation of absorbancy at the 510nm place with the spectrophotometer of standard.

The cellulose degradation promoter action that embodiment 6 measures cellulose degrading enzyme or enzyme mixture

The synergy (synergistic action) of some excretory protein plain degraded of display fibers in the presence of cellulose degrading enzyme or its mixture.These excretory protein itself can have or not have hydrolytic enzyme activities.At number of patent application US11/046,124 and the PCT application PCT/US2005/003525 that announced on July 30th, 1 in can find the example of such secretory protein and how detect their cellulose degradation promoter action, particularly use each of embodiment 24 and 25-28, be introduced into for reference at this.

A kind of method of measuring this promoter action is as follows: will synthesize the justacrine cellulase and promote the nutrient solution of host's strain of property polypeptide or cell lysate to stir cell (Millipore with the Amicon that holds back to the PM10 film of 10kDa is housed, Billerica, MA) concentrate after, with Econo-Pac 10DG post (BioRadLaboratories, Hercules, CA) desalination.With BCA (bicinchoninic acid, people such as P.K.Smith 1985, Anal.Biochem.150:76) the protein determination test kit (Pierce, Rockford, IL) use BSA as the standard test protein concentration after, these polypeptide liquid storages are kept at-20 ℃.These polypeptide are not further purified, and liquid storage are added in the reaction mixture according to the total protein that records.

Use dilute sulphuric acid pre-treatment maize straw at the state-run renewable energy source of USDOE laboratory (U.S.Department of EnergyNational Renewable Energy Laboratory (NREL)).The sulfuric acid of following conditions: 1.4wt% is used in pre-treatment, following 8 minutes of 165 ℃ and 107psi.According to NREL, the water insoluble solid in the pretreated maize straw (PCS) contains 56.5% Mierocrystalline cellulose, 4.6% hemicellulose and 28.4% xylogen.Mierocrystalline cellulose and hemicellulose are to use NREL standard analyzer (NREL Standard Analytical Procedure) #002, carry out the two-stage sulphuric acid hydrolysis after, utilize high-performance liquid chromatogram determination to carry out glycan analysis and measure.Xylogen is to use NREL standard analyzer #003, with what measure by measurement weight after sulphuric acid hydrolysis Mierocrystalline cellulose and the hemicellulose fraction.Before enzymically hydrolyse, on glass filter, use the deionized water of large volume " ish " described PCS; Obtain the dry weight of water " ish " PCS excessively.By in coffee mill (coffee-grinder), pulverizing, then at Millipore filter (6P Express Membrane, the Stericup of 22 μ m, Millipore, Bedford MA) goes up with deionized water " ish ", and the PCS that crosses from water " ish " prepares the PCS that pulverizes.

The hydrolysis of PCS is that (Pierce, Rockford IL) carry out, and used total reaction volume is 1.0ml with 1.1ml Immunoware tubule.In this working specification, the hydrolysis of PCS (10mg/ml is in 50mM sodium acetate pH 5.0 damping fluids), be in the presence of 3% aspergillus oryzae beta-glucosidase enzyme (recombinant expressed in aspergillus oryzae) of cellulose protein application of sample amount according to WO 02/095014, use the polypeptide of the present invention to be measured or Celluclast  1.5L sample (the Novozymes A/S of different protein application of sample amounts (being expressed as the every gram of the enzyme PCS of mg), Bagsvaerd, Denmark) carry out.The screening of the PCS hydrolysis ability of polypeptide of the present invention is at 50 ℃ of (Isotemp 10S water-bath or TS Autoflow CO ₂The interlayer incubator) carries out under.Usually, reaction is by duplicate samples such as carry out and get in quadruplicate in hydrolytic process.Stop the PCS hydrolysis reaction by every part of hydrolyzate and the 180 μ l 0.11M NaOH (termination reagent) that mix 20 μ l equal portions.Every part of sample is done suitable serial dilution, and utilize the following para hydroxybenzene formyl hydrazine that is applicable to 96 hole microtest plate specifications (PHBAH, Sigma, St.Louis, MO) assay method mensuration reducing sugar content.Briefly, the sample with the suitable dilution of 90 μ l equal portions places 96 hole conical bottom microtest plates.In each hole, add 1.5% (w/v) PHBAH60 μ l among the 2%NaOH.Plate is not added a cover heating 10 minutes at 95 ℃.Allow plate cool to room temperature (RT), add 50 μ l distilled water to each hole then.Shift 100 μ l equal portions to flat 96 orifice plates from each hole, and (Molecular Devices, Sunnyvale CA) measure A with SpectraMax Microplate Reader _410nmAbsorbancy.(with 0.4% sodium hydroxide dilution, 0.1-0.0125mg/ml) the production standard curve is with the A with gained with the glucose standard substance _410nmValue is converted to glucose equivalent.Calculate the PCS cellulose conversion percentage of each reaction with the equivalent of gained.

Cellulose conversion be reducing sugar degree (transformation efficiency, %) calculate with following equation:

Transformation efficiency (%)=RS _(mg/ml)* 100*162/ (Mierocrystalline cellulose _(mg/ml)* 180)=RS _(mg/ml)* 100/ (Mierocrystalline cellulose _(mg/ml)* 1.111)

In the formula, RS is the concentration of reduced sugar in the solution of measuring with glucose equivalent (mg/ml), and the factor 1.111 has reflected that cellulose conversion is that the weight of glucose increases.

In order to screen the polypeptide of the present invention that can promote Celluclast  1.5L performance, carry out the PCS hydrolysis reaction (working specification of 1.0ml, every liter of 10g PCS, 50 ℃, 3% the aspergillus oryzae beta-glucosidase enzyme that adds total application of sample amount), wherein with the Celluclast  1.5L of 2.5mg enzyme application of sample amount and each sample of 2.5mg polypeptide application of sample amount (total protein of each reaction 5mg enzyme application of sample amount).Measured by 10mg enzyme application of sample amount, the Celluclast  1.5L control reaction that 5mg enzyme application of sample amount and 2.5mg enzyme application of sample amount are formed, and the PCS cellulose conversion rate that writes down them is used for comparison.

Embodiment 7 measures lipase activity

Activity measurement uses the nutrient solution or the cell lysate of host's strain of the synthetic justacrine lipase in the suitable damping fluid.

Lipase measurement (PNV mensuration): be added in each hole of 96 hole microtest plates with the dilution buffer liquid of pipettor with 20 microlitres.The sample (supernatant) that in this dilution buffer liquid, adds 5 microlitres.When beginning test adds the substrate of 200 microlitres in each hole, and plate is installed to ELISA reads on the plate device (can read the programmable spectrophotometer of 96 orifice plates).Measured the absorbancy of a 405nm, measured 10 minutes in per 30 seconds.With the time to the abs405 slope of a curve as any activity unit.

Dilution buffer liquid: 25ml 2M Tris/HCl pH 7.5,0.50ml 2M CaCl ₂, 2.5ml 15%Brij 35, water is adjusted to 500ml.

Substrate stock solution: valeric acid p-nitrophenyl ester (p-Nitrophenylvalerate) SIGMA N 4377 (the density 1.11g/ml) of 0.1295g (117 microlitre) are dissolved in the 10ml methyl alcohol.In freezing plant, preserve.

Substrate: 100 microlitre substrate stock solutions are mixed with 10ml dilution buffer liquid.

Embodiment 8 measures proteolytic enzyme and peptidase activity

The nutrient solution or the cell lysate of the synthetic justacrine peptase in pH damping fluid and/or host's strain of proteolytic enzyme with selected peptidase activity the best, its described activity can be measured like this: on agar plate, wherein this agar plate contains insoluble chromogenic substrate AZCL-casein (Megazyme with suitable sample volume (for example 20 microlitres) point sample ^TM) or AZCL-collagen (Megazyme ^TM) or Azocoll (Sigma-Aldrich), for example level of 0.1%w/w.Be suitable under the temperature that peptase works, for example under 37 ℃, the time that dull and stereotyped incubation is suitable, for example 1 day.Blue haloing around activity is visible as a little.Can replace AZCL-casein and AZCL-collagen (Megazyme with cold collagen or cold casein ^TM).By point sample on the cold collagen or cold casein of agar plate, form clearly zone when having peptase and/or proteolytic enzyme to exist.

Embodiment 9 measures inscribe pectinose enzymic activity

The nutrient solution or the cell lysate of host's strain of the synthetic justacrine arabinase in pH damping fluid with selected peptidase activity the best, its described activity can be measured like this: with suitable sample volume (for example 20 microlitres) point sample on agar plate, wherein this agar plate contains insoluble chromogenic substrate AZCL-arabinan, for example 0.1%w/w level.Be suitable under the temperature that arabinase works, for example under 37 ℃, the time that dull and stereotyped incubation is suitable, for example 1 day.Blue haloing around activity is visible as a little.

This mensuration can be carried out under different pH.Under acid pH, can pass through 0.1g AZCL-arabinan (the painted crosslinked substrate of Mazurine, Megazyme, Ireland) being dissolved in 100ml0.2M succsinic acid pH3+10 microlitre Triton X-100 (0.01%) obtains 0.1%AZCL-arabinan final concentration, prepares the AZCL-arabinan.Under neutral pH, can add among the 10 microlitre Triton X-100 (0.01%) and prepare the AZCL-arabinan by 0.1g AZCL-arabinan (the painted crosslinked substrate of Mazurine, Megazyme, Ireland) is dissolved in the 50ml sterilized water.In this 50ml AZCL substrate, add 50ml 0.4M MOPS pH 7 then and obtain the final volume of 100ml, and the 0.2M damping fluid, the final concentration of 0.1%AZCL.

Embodiment 10 measures beta-glucosidase activity

Many beta-glucosidase enzymes may be to 4-nitrophenyl-β-D-glucopyranoside or at least some activity of cellobiose, although these may not be their natural substrates.Also can find activity with highstrung methyl umbrella shape base (methyl-umbiliferyl) β-D-glucoside.Generally speaking can use any (1,4)-β-and (1,3)-β-few glucoside (oligoglucosides) is as substrate, measure (The Sigma Diagnostic Glucose (Trinder) Assay of system by Trinder, Sigma, St.Louis MO) measures the glucose that discharges, and assesses beta-glucosidase activity.

A kind of method of measuring beta-glucosidase activity is to prepare the nutrient solution of host's strain of synthesizing the justacrine arabinase or the preparation of cell lysate, makes described preparation contain about 6.9 * 10 ^-6The total protein of mg/ml, 100mM Trisodium Citrate pH 5.0, p-nitrophenyl-β of 0.01%Tween-20 and 4mM-D-glucopyranoside.At 50 ℃ of incubation said preparations, and got sample aliquot at 0.5,1,2,3,3.75 and 24 hour.In each sample aliquot, add 1M yellow soda ash pH 10.0, determine the anionic concentration of p-nitrophenyl by the absorbancy of 405nm then.

The method of another kind of beta-glucosidase activity is: by at first desalination (BioRad Econo-Pac10DG post), concentrate (Centricon Plus-20 then, Biomax-5,5kD holds back) to the concentration (BCA measures system) of 0.92mg/ml, prepare the nutrient solution of host's strain of synthesizing the justacrine arabinase or the preparation of cell lysate.Then said preparation is added 10mM cellobiose among the 0.01%Tween-20 at 65 ℃ of following incubations with 0.037 and 0.0092 μ g/ml total protein and 100mM Trisodium Citrate pH 5.0.0.5,1, got sample aliquot in 2,3,4,6 and 19 hours.Sample aliquot is boiled 6 minutes with termination reaction, and (Sigma Chemical Co., St.Louis MO) measure glucose concn with the glucose external standard to use Trinder to measure system then.

Embodiment 11 measures esterase activity

The nutrient solution or the cell lysate of host's strain of the synthetic justacrine esterase in the suitable damping fluid used in determination of activity.When selecting to be used to measure the active substrate of serine easterase, should preferentially be chosen in esterase and do not formed the micellar substrate under the concentration when saturated, to obtain the optimal conversion of substrate by substrate.

A kind of method of testing esterase activity is under the measurement standard condition, for example 30 ℃, pH 7.0 times, and the alkali consumption of this enzymic hydrolysis triactin, wherein the concentration of triactin is lower than the CMC of triactin, and alkali consumption is expressed as the function of time.The esterase hydrolyzed triactin can discharge acetate, and this just needs to add alkali, and to keep pH constant be 7.0 (constant pH methods), therefore keeps pH and in the amount of the 7.0 needed alkali form of sodium hydroxide (usually with) be exactly measuring of the triactin ester bond that is hydrolyzed.

The mode of another kind of test esterase activity is to measure esterase hydrolyzed PNP acetic ester (acetic acid p-nitrophenyl acetate) to discharge colored PNP.Be added in each hole of 96 hole microtiter plates with the dilution buffer liquid of pipettor 20 microlitres.5 microlitre samples (nutrient solution supernatant or filtering cell lysate) are added in the dilution buffer liquid.When measuring beginning, in each hole, add the substrate of 200 microlitres and plate is installed to ELISA and read on the plate device (can read the programmable spectrophotometer of 96 orifice plates).Measured the absorbancy of a 405nm, measured 10 minutes in per 30 seconds.With the time to the abs405 slope of a curve as any activity unit.

Substrate stock solution: the acetic acid p-nitrophenyl acetate of appropriate amount is dissolved in the 10ml methyl alcohol.In freezing plant, preserve.

Sequence table

＜110〉Novozymes Company (Novozymes A/S)

＜120〉polypeptide of BOTRYOSPHAERIA RHODINA

<130>10543.000-dk

<160>48

<170>PatentIn version 3.2

<210>1

<211>930

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(927)

<220>

<221>sig_peptide

<222>(1)..(54)

<220>

<221>mat_peptide

<222>(55)..(927)

<220>

<221>misc_feature

<222>(55)..(162)

＜223〉domain C BM1

<400>1

atg cat cag aat tcc gcc ttg ttg ctg ctg gca gcc atc cca gcg acg 48

Met His Gln Asn Ser Ala Leu Leu Leu Leu Ala Ala Ile Pro Ala Thr

-15 -10 -5

tat gcc gcc gtc cct gcc tgg ggt cag tgc ggc ggt tcg ggc tat agt 96

Tyr Ala Ala Val Pro Ala Trp Gly Gln Cys Gly Gly Ser Gly Tyr Ser

-1 1 5 10

ggc gaa acc act tgt gta tct ggt tat acc tgc gtg act gta aac caa 144

Gly Glu Thr Thr Cys Val Ser Gly Tyr Thr Cys Val Thr Val Asn Gln

15 20 25 30

tgg tac tcc caa tgc cag caa gga tcc gca ggt ccc acc acc acg ctc 192

Trp Tyr Ser Gln Cys Gln Gln Gly Ser Ala Gly Pro Thr Thr Thr Leu

35 40 45

gcc aca gtc aca acc acg ggc agc ggc acc acg ccg agc tcg acc tct 240

Ala Thr Val Thr Thr Thr Gly Ser Gly Thr Thr Pro Ser Ser Thr Ser

50 55 60

ggc agc atc gat gcc aag ttc aag gcc aag gga aag aag tac ttt ggc 288

Gly Ser Ile Asp Ala Lys Phe Lys Ala Lys Gly Lys Lys Tyr Phe Gly

65 70 75

gtg gcg acg gac cag ggc cga ctc acg agc ggg cag aac gcg gcc atc 336

Val Ala Thr Asp Gln Gly Arg Leu Thr Ser Gly Gln Asn Ala Ala Ile

80 85 90

atc aaa gcc gac ttt ggc cag gtc acg ccg gag aac agc atg aag tgg 384

Ile Lys Ala Asp Phe Gly Gln Val Thr Pro Glu Asn Ser Met Lys Trp

95 100 105 110

gac gcc acc gag cct tca cgc aac acg ttc acc ttc acg acg gcc gac 432

Asp Ala Thr Glu Pro Ser Arg Asn Thr Phe Thr Phe Thr Thr Ala Asp

115 120 125

tac ctg gtt gat tgg gcg acg acc aac gac aag ctg atc cgt ggc cac 480

Tyr Leu Val Asp Trp Ala Thr Thr Asn Asp Lys Leu Ile Arg Gly His

130 135 140

acg acc gtc tgg cac tcg cag ctg ccc acc tgg gtc tca agc atc acc 528

Thr Thr Val Trp His Ser Gln Leu Pro Thr Trp Val Ser Ser Ile Thr

145 150 155

gat aag gcc act ttg acg acc gtc atg cag aac cac atc gcc acc gaa 576

Asp Lys Ala Thr Leu Thr Thr Val Met Gln Asn His Ile Ala Thr Glu

160 165 170

atg ggt cgc tgg aag ggc aag atc tac gct tgg gat gtc gtc aac gag 624

Met Gly Arg Trp Lys Gly Lys Ile Tyr Ala Trp Asp Val Val Asn Glu

175 180 185 190

atc ttc aac gag gac ggc tca ttc agg tcc tcg gtc ttc tac aac gtc 672

Ile Phe Asn Glu Asp Gly Ser Phe Arg Ser Ser Val Phe Tyr Asn Val

195 200 205

ctc ggc gag gac ttt gtc cgc ctc gcc ttc gag gct gcg cgc gcc gcc 720

Leu Gly Glu Asp Phe Val Arg Leu Ala Phe Glu Ala Ala Arg Ala Ala

210 215 220

gac ccc aac gcc aag ctg tac atc aac gac tac aac ctc gac tcc gcc 768

Asp Pro Asn Ala Lys Leu Tyr Ile Asn Asp Tyr Asn Leu Asp Ser Ala

225 230 235

acc tac gcc aaa acc acc ggc ctg gac gtc acc aac tgc gtc ggc atc 816

Thr Tyr Ala Lys Thr Thr Gly Leu Asp Val Thr Asn Cys Val Gly Ile

240 245 250

acc gtt tgg ggc ctg cgc gac ccg gat agc tgg agg gcg agc agc acg 864

Thr Val Trp Gly Leu Arg Asp Pro Asp Ser Trp Arg Ala Ser Ser Thr

255 260 265 270

ccg ttg ctg ttt gat gcc gac ttc cag ccg aag gcc gcg tat acc gcc 912

Pro Leu Leu Phe Asp Ala Asp Phe Gln Pro Lys Ala Ala Tyr Thr Ala

275 280 285

att ttg aac agt ttg tag 930

Ile Leu Asn Ser Leu

290

<210>2

<211>309

<212>PRT

<213>Botryosphaeria rhodina

<400>2

Met His Gln Asn Ser Ala Leu Leu Leu Leu Ala Ala Ile Pro Ala Thr

-15 -10 -5

Tyr Ala Ala Val Pro Ala Trp Gly Gln Cys Gly Gly Ser Gly Tyr Ser

-1 1 5 10

Gly Glu Thr Thr Cys Val Ser Gly Tyr Thr Cys Val Thr Val Asn Gln

15 20 25 30

Trp Tyr Ser Gln Cys Gln Gln Gly Ser Ala Gly Pro Thr Thr Thr Leu

35 40 45

Ala Thr Val Thr Thr Thr Gly Ser Gly Thr Thr Pro Ser Ser Thr Ser

50 55 60

Gly Ser Ile Asp Ala Lys Phe Lys Ala Lys Gly Lys Lys Tyr Phe Gly

65 70 75

Val Ala Thr Asp Gln Gly Arg Leu Thr Ser Gly Gln Asn Ala Ala Ile

80 85 90

Ile Lys Ala Asp Phe Gly Gln Val Thr Pro Glu Asn Ser Met Lys Trp

95 100 105 110

Asp Ala Thr Glu Pro Ser Arg Asn Thr Phe Thr Phe Thr Thr Ala Asp

115 120 125

Tyr Leu Val Asp Trp Ala Thr Thr Asn Asp Lys Leu Ile Arg Gly His

130 135 140

Thr Thr Val Trp His Ser Gln Leu Pro Thr Trp Val Ser Ser Ile Thr

145 150 155

Asp Lys Ala Thr Leu Thr Thr Val Met Gln Asn His Ile Ala Thr Glu

160 165 170

Met Gly Arg Trp Lys Gly Lys Ile Tyr Ala Trp Asp Val Val Asn Glu

175 180 185 190

Ile Phe Asn Glu Asp Gly Ser Phe Arg Ser Ser Val Phe Tyr Asn Val

195 200 205

Leu Gly Glu Asp Phe Val Arg Leu Ala Phe Glu Ala Ala Arg Ala Ala

210 215 220

Asp Pro Asn Ala Lys Leu Tyr Ile Asn Asp Tyr Asn Leu Asp Ser Ala

225 230 235

Thr Tyr Ala Lys Thr Thr Gly Leu Asp Val Thr Asn Cys Val Gly Ile

240 245 250

Thr Val Trp Gly Leu Arg Asp Pro Asp Ser Trp Arg Ala Ser Ser Thr

255 260 265 270

Pro Leu Leu Phe Asp Ala Asp Phe Gln Pro Lys Ala Ala Tyr Thr Ala

275 280 285

Ile Leu Asn Ser Leu

290

<210>3

<211>663

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(663)

<220>

<221>sig_peptide

<222>(1)..(57)

<220>

<221>mat_peptide

<222>(58)..(663)

<400>3

atg gtc tcc ttc aag tcg att ctt ctc act ctc acc gcc gct gcc agc 48

Met Val Ser Phe Lys Ser Ile Leu Leu Thr Leu Thr Ala Ala Ala Ser

-15 -10 -5

gtc ttc tcc gcc ccg acc cct gag gcg ggc gag ctg atc gcg agg cag 96

Val Phe Ser Ala Pro Thr Pro Glu Ala Gly Glu Leu Ile Ala Arg Gln

-1 1 5 10

aac acg cca agc ggc acc ggc acg cac aac ggc tac ttc tat tcc ttc 144

Asn Thr Pro Ser Gly Thr Gly Thr His Asn Gly Tyr Phe Tyr Ser Phe

15 20 25

tgg acc gac ggt gct ggc cag gtg acc tac acc aac ggc gct ggt ggt 192

Trp Thr Asp Gly Ala Gly Gln Val Thr Tyr Thr Asn Gly Ala Gly Gly

30 35 40 45

teg tac agc gtg acg tgg tcc ggc aac gcc ggc aac tgg gtt ggc ggc 240

Ser Tyr Ser Val Thr Trp Ser Gly Asn Ala Gly Asn Trp Val Gly Gly

50 55 60

aag gga tgg cag acg ggc agc gcc agg acg atc aac tac tcg ggc acc 288

Lys Gly Trp Gln Thr Gly Ser Ala Arg Thr Ile Asn Tyr Ser Gly Thr

65 70 75

tac aac ccc aac ggc aac tcg tac ctc gcc gtg tac ggc tgg tcg cgc 336

Tyr Asn Pro Asn Gly Asn Ser Tyr Leu Ala Val Tyr Gly Trp Ser Arg

80 85 90

aac ccg ctg gtg gag tac tac atc gtc gag tcg tac ggc acg tac aac 384

Asn Pro Leu Val Glu Tyr Tyr Ile Val Glu Ser Tyr Gly Thr Tyr Asn

95 100 105

ccg ggc tcg ggc ggc acc aag aag ggc acg gtc acg tcg gac ggc ggc 432

Pro Gly Ser Gly Gly Thr Lys Lys Gly Thr Val Thr Ser Asp Gly Gly

110 115 120 125

acc tac gac atc tac gtg agc acc cgc acc aac gcg ccc agc atc gac 480

Thr Tyr Asp Ile Tyr Val Ser Thr Arg Thr Asn Ala Pro Ser Ile Asp

130 135 140

ggc acc cag acc ttc cag cag tac tgg tcc gtg cgc cag tcc aag cgc 528

Gly Thr Gln Thr Phe Gln Gln Tyr Trp Ser Val Arg Gln Ser Lys Arg

145 150 155

gtc ggc ggc acc gtg acg acc aag aac cac ttc gat gcc tgg gcc gcc 576

Val Gly Gly Thr Val Thr Thr Lys Asn His Phe Asp Ala Trp Ala Ala

160 165 170

gtt ggc ctt aac ctg ggc act ttc gac tac cag atc gtc gct acc gag 624

Val Gly Leu Asn Leu Gly Thr Phe Asp Tyr Gln Ile Val Ala Thr Glu

175 180 185

ggc tac cag agc agc ggg tcg gct acg att acc gtg cag 663

Gly Tyr Gln Ser Ser Gly Ser Ala Thr Ile Thr Val Gln

190 195 200

<210>4

<211>221

<212>PRT

<213>Botryosphaeria rhodina

<400>4

Met Val Ser Phe Lys Ser Ile Leu Leu Thr Leu Thr Ala Ala Ala Ser

-15 -10 -5

Val Phe Ser Ala Pro Thr Pro Glu Ala Gly Glu Leu Ile Ala Arg Gln

-1 1 5 10

Asn Thr Pro Ser Gly Thr Gly Thr His Asn Gly Tyr Phe Tyr Ser Phe

15 20 25

Trp Thr Asp Gly Ala Gly Gln Val Thr Tyr Thr Asn Gly Ala Gly Gly

30 35 40 45

Ser Tyr Ser Val Thr Trp Ser Gly Asn Ala Gly Asn Trp Val Gly Gly

50 55 60

Lys Gly Trp Gln Thr Gly Ser Ala Arg Thr Ile Asn Tyr Ser Gly Thr

65 70 75

Tyr Asn Pro Asn Gly Asn Ser Tyr Leu Ala Val Tyr Gly Trp Ser Arg

80 85 90

Asn Pro Leu Val Glu Tyr Tyr Ile Val Glu Ser Tyr Gly Thr Tyr Asn

95 100 105

Pro Gly Ser Gly Gly Thr Lys Lys Gly Thr Val Thr Ser Asp Gly Gly

110 115 120 125

Thr Tyr Asp Ile Tyr Val Ser Thr Arg Thr Asn Ala Pro Ser Ile Asp

130 135 140

Gly Thr Gln Thr Phe Gln Gln Tyr Trp Ser Val Arg Gln Ser Lys Arg

145 150 155

Val Gly Gly Thr Val Thr Thr Lys Asn His Phe Asp Ala Trp Ala Ala

160 165 170

Val Gly Leu Asn Leu Gly Thr Phe Asp Tyr Gln Ile Val Ala Thr Glu

175 180 185

Gly Tyr Gln Ser Ser Gly Ser Ala Thr Ile Thr Val Gln

190 195 200

<210>5

<211>1113

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1110)

<220>

<221>misc_feature

<222>(1)..(1110)

＜223〉propetide

<220>

<221>transit_peptide

<222>(1)..(54)

<220>

<221>mat_peptide

<222>(55)..(1110)

<400>5

atg gtc gct atc aac tac ctc gca acc ctg gcc ctg gcg gcc tca gca 48

Met Val Ala Ile Asn Tyr Leu Ala Thr Leu Ala Leu Ala Ala Ser Ala

-15 -10 -5

agc gcc atc ccc atg gac tcc cgc ctg gaa gcg cgc caa agc ttc tcc 96

Ser Ala Ile Pro Met Asp Ser Arg Leu Glu Ala Arg Gln Ser Phe Ser

-1 1 5 10

atc ccc ggc atc ggc gga cag acc gcc aac gac gtg cag tcc ggt acc 144

Ile Pro Gly Ile Gly Gly Gln Thr Ala Asn Asp Val Gln Ser Gly Thr

15 20 25 30

tgc aag gac gtg acg tac atc ttc gcg cgg ggc acg acg gag cag ggc 192

Cys Lys Asp Val Thr Tyr Ile Phe Ala Arg Gly Thr Thr Glu Gln Gly

35 40 45

aac atg ggc agc acg gtc ggg ccg gcg ctg aag acg aag ctg gag gcg 240

Asn Met Gly Ser Thr Val Gly Pro Ala Leu Lys Thr Lys Leu Glu Ala

50 55 60

gcc atc ggc gcc gac aag ctc gcg acg cag ggc gtc aac tac ccg gcc 288

Ala Ile Gly Ala Asp Lys Leu Ala Thr Gln Gly Val Asn Tyr Pro Ala

65 70 75

gac gtg gcg ggc acc gtc gtc ggc agc atg tca ccc ggc cag gcc gag 336

Asp Val Ala Gly Thr Val Val Gly Ser Met Ser Pro Gly Gln Ala Glu

80 85 90

ggc agc aag aac tgc gcg cag ctg gtc aaa cag gct ttg tcc aac tgc 384

Gly Ser Lys Asn Cys Ala Gln Leu Val Lys Gln Ala Leu Ser Asn Cys

95 100 105 110

ccg cag acc aag atc gtg ctg gcc ggc tac tcg cag ggc gcg cag cag 432

Pro Gln Thr Lys Ile Val Leu Ala Gly Tyr Ser Gln Gly Ala Gln Gln

115 120 125

gtc cac ggc tgc ctc atc gat ttg agc gcc gat gag gcg cag aag gtc 480

Val His Gly Cys Leu Ile Asp Leu Ser Ala Asp Glu Ala Gln Lys Val

130 135 140

gcg gcc gcc gtc acc ttc ggc gac ccc ctg cgg gcg cag cag ttc aag 528

Ala Ala Ala Val Thr Phe Gly Asp Pro Leu Arg Ala Gln Gln Phe Lys

145 150 155

aac atc gac cag tcg cgc acc aag atc ttc tgc gcc acc ggc gac ctc 576

Asn Ile Asp Cln Ser Arg Thr Lys Ile Phe Cys Ala Thr Gly Asp Leu

160 165 170

gtc tgc acc aac cag ttc atc atc acg gcc gcc cac ctc tcc tat gcc 624

Val Cys Thr Asn Gln Phe Ile Ile Thr Ala Ala His Leu Ser Tyr Ala

175 180 185 190

tcc gag tcc acc ggc ccg gcc gcc gag ttc atc cag cag cag ctg ggc 672

Ser Glu Ser Thr Gly Pro Ala Ala Glu Phe Ile Gln Gln Gln Leu Gly

195 200 205

act ctc gac tcc tct tct tcc tcg tcc aac agc tcg tcg tcg acg acg 720

Thr Leu Asp Ser Ser Ser Ser Ser Ser Asn Ser Ser Ser Ser Thr Thr

210 215 220

acg gcg tca act tcc gct gac agc agc gcc acc agt acc ggc tcg tcc 768

Thr Ala Ser Thr Ser Ala Asp Ser Ser Ala Thr Ser Thr Gly Ser Ser

225 230 235

gac agc agc gtt gcc tcg tct ggc cta ggc tcc ggg ctt ctc ggt ggc 816

Asp Ser Ser Val Ala Ser Ser Gly Leu Gly Ser Gly Leu Leu Gly Gly

240 245 250

ggc ttg agt ggc ttg acc ggt ggc ggt tcc agc ggt ggt tcg agt ctg 864

Gly Leu Ser Gly Leu Thr Gly Gly Gly Ser Ser Gly Gly Ser Ser Leu

255 260 265 270

ctc agc ggc ttg agc ggt etg agt gga agt gat tcc agc agc agt ggc 912

Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser Asp Ser Ser Ser Ser Gly

275 280 285

ggt tcg agc ctc ctg agt gga ttg agc gga ttg agc ggg agc agc ggt 960

Gly Ser Ser Leu Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser Ser Gly

290 295 300

tcc agc gac agc ggt tcg agc atg ctt ggc ggg ctc agc ggt ctc agt 1008

Ser Ser Asp Ser Gly Ser Ser Met Leu Gly Gly Leu Ser Gly Leu Ser

305 310 315

ggg ctt agc ggg ctg gga gga tcg tcg agc ggc gga tcg ggc ctc atg 1056

Gly Leu Ser Gly Leu Gly Gly Ser Ser Ser Gly Gly Ser Gly Leu Met

320 325 330

agc ggt ttg agc ggt ctg agt ggc ctg agc ggc ctt ggg ggc tcg aag 1104

Ser Gly Leu Ser Gly Leu Ser Gly Leu Ser Gly Leu Gly Gly Ser Lys

335 340 345 350

aag aac tga 1113

Lys Asn

<210>6

<211>370

<212>PRT

<213>Botryosphaeria rhodina

<400>6

Met Val Ala Ile Asn Tyr Leu Ala Thr Leu Ala Leu Ala Ala Ser Ala

-15 -10 -5

Ser Ala Ile Pro Met Asp Ser Arg Leu Glu Ala Arg Gln Ser Phe Ser

-1 1 5 10

Ile Pro Gly Ile Gly Gly Gln Thr Ala Asn Asp Val Gln Ser Gly Thr

15 20 25 30

Cys Lys Asp Val Thr Tyr Ile Phe Ala Arg Gly Thr Thr Glu Gln Gly

35 40 45

Asn Met Gly Ser Thr Val Gly Pro Ala Leu Lys Thr Lys Leu Glu Ala

50 55 60

Ala Ile Gly Ala Asp Lys Leu Ala Thr Gln Gly Val Asn Tyr Pro Ala

65 70 75

Asp Val Ala Gly Thr Val Val Gly Ser Met Ser Pro Gly Gln Ala Glu

80 85 90

Gly Ser Lys Asn Cys Ala Gln Leu Val Lys Gln Ala Leu Ser Asn Cys

95 100 105 110

Pro Gln Thr Lys Ile Val Leu Ala Gly Tyr Ser Gln Gly Ala Gln Gln

115 120 125

Val His Gly Cys Leu Ile Asp Leu Ser Ala Asp Glu Ala Gln Lys Val

130 135 140

Ala Ala Ala Val Thr Phe Gly Asp Pro Leu Arg Ala Gln Gln Phe Lys

145 150 155

Asn Ile Asp Gln Ser Arg Thr Lys Ile Phe Cys Ala Thr Gly Asp Leu

160 165 170

Val Cys Thr Asn Gln Phe Ile Ile Thr Ala Ala His Leu Ser Tyr Ala

175 180 185 190

Ser Glu Ser Thr Gly Pro Ala Ala Glu Phe Ile Gln Gln Gln Leu Gly

195 200 205

Thr Leu Asp Ser Ser Ser Ser Ser Ser Asn Ser Ser Ser Ser Thr Thr

210 215 220

Thr Ala Ser Thr Ser Ala Asp Ser Ser Ala Thr Ser Thr Gly Ser Ser

225 230 235

Asp Ser Ser Val Ala Ser Ser Gly Leu Gly Ser Gly Leu Leu Gly Gly

240 245 250

Gly Leu Ser Gly Leu Thr Gly Gly Gly Ser Ser Gly Gly Ser Ser Leu

255 260 265 270

Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser Asp Ser Ser Ser Ser Gly

275 280 285

Gly Ser Ser Leu Leu Ser Gly Leu Ser Gly Leu Ser Gly Ser Ser Gly

290 295 300

Ser Ser Asp Ser Gly Ser Ser Met Leu Gly Gly Leu Ser Gly Leu Ser

305 310 315

Gly Leu Ser Gly Leu Gly Gly Ser Ser Ser Gly Gly Ser Gly Leu Met

320 325 330

Ser Gly Leu Ser Gly Leu Ser Gly Leu Ser Gly Leu Gly Gly Ser Lys

335 340 345 350

Lys Asn

<210>7

<211>1350

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1347)

<220>

<221>misc_feature

<222>(1)..(1347)

＜223〉propetide

<220>

<221>transit_peptide

<222>(1)..(54)

<220>

<221>mat_peptide

<222>(55)..(1347)

<400>7

atg cat ttg tcc agt gtt tgt ctc gtc ctc agt ggg ctt ctc ctt acc 48

Met His Leu Ser Ser Val Cys Leu Val Leu Ser Gly Leu Leu Leu Thr

-15 -10 -5

aac gct gcc cca gcc cct gtc cct gaa aat ggg ctc gag aag agg cag 96

Asn Ala Ala Pro Ala Pro Val Pro Glu Asn Gly Leu Glu Lys Arg Gln

-1 1 5 10

tcc ctg agc agc gtc ctg agc gcc ctc agt ggc ctg acc gaa cct acg 144

Ser Leu Ser Ser Val Leu Ser Ala Leu Ser Gly Leu Thr Glu Pro Thr

15 20 25 30

gcc atc ttg tct cag ctc gag gcg gtt gaa gcg aca tcg acg ccc acc 192

Ala Ile Leu Ser Gln Leu Glu Ala Val Glu Ala Thr Ser Thr Pro Thr

35 40 45

agc gtc gag cag gcg cag gag cag ctc gag gcc atc tac ggg acg aca 240

Ser Val Glu Gln Ala Gln Glu Gln Leu Glu Ala Ile Tyr Gly Thr Thr

50 55 60

cca acc aac atc ttc gag aac atc gcg cag caa atc gcc gac gga ctg 288

Pro Thr Asn Ile Phe Glu Asn Ile Ala Gln Gln Ile Ala Asp Gly Leu

65 70 75

tcg acg ctg acc atc gtc caa gcc ctc ggc ttc tcc ccc agc ggc gag 336

Ser Thr Leu Thr Ile Val Gln Ala Leu Gly Phe Ser Pro Ser Gly Glu

80 85 90

aac tcg gaa acc aac agc aac acg cgc gaa ccg tcg acg acc atc tac 384

Asn Ser Glu Thr Asn Ser Asn Thr Arg Glu Pro Ser Thr Thr Ile Tyr

95 100 105 110

ccc aag aag tcg tcc tcg gat gcc ccc tat tcc atc act gag gaa gag 432

Pro Lys Lys Ser Ser Ser Asp Ala Pro Tyr Ser Ile Thr Glu Glu Glu

115 120 125

ctc cgc caa gcc atc tac atc ccc tcc gac ttc acg tac ggc gac aag 480

Leu Arg Gln Ala Ile Tyr Ile Pro Ser Asp Phe Thr Tyr Gly Asp Lys

130 135 140

ccg ccg gtc atc ttc gtg ccg ggc acg ggc tcg tac ggc ggc atc agc 528

Pro Pro Val Ile Phe Val Pro Gly Thr Gly Ser Tyr Gly Gly Ile Ser

145 150 155

ttc gga tcg aac ctg cgc aag ctg ctg acg ggc gtg tcg tac gcg gac 576

Phe Gly Ser Asn Leu Arg Lys Leu Leu Thr Gly Val Ser Tyr Ala Asp

160 165 170

ccg gtc tgg ctc aac gtg ccg gac gcg ctg ctg cgc gac gcg cag acg 624

Pro Val Trp Leu Asn Val Pro Asp Ala Leu Leu Arg Asp Ala Gln Thr

175 180 185 190

aac ggc gag ttc gtg gcg tac gcc atc aac tac atc tcg ggc ata tcc 672

Asn Gly Glu Phe Val Ala Tyr Ala Ile Asn Tyr Ile Ser Gly Ile Ser

195 200 205

ggc gac gcc aac gtg tcg gtc gtc tcg tgg tcg cag ggc ggg ctg gac 720

Gly Asp Ala Asn Val Ser Val Val Ser Trp Ser Gln Gly Gly Leu Asp

210 215 220

acg cag tgg gct ttt act tat tgg ccg tcg acg cgc gcc ctg gtc tct 768

Thr Gln Trp Ala Phe Thr Tyr Trp Pro Ser Thr Arg Ala Leu Val Ser

225 230 235

gac ttc gtg ccc gtc agc ccg gac ttc cac ggc acc gtc ctg gcc aac 816

Asp Phe Val Pro Val Ser Pro Asp Phe His Gly Thr Val Leu Ala Asn

240 245 250

gtc atc tgc ctc aac ccg ggc gcc ggc ggt gtt ggg ttg ggc ccc tgc 864

Val Ile Cys Leu Asn Pro Gly Ala Gly Gly Val Gly Leu Gly Pro Cys

255 260 265 270

gcg ccg gcg gtg ctg cag cag gag tac aac agc aac ttc gtc acg gcc 912

Ala Pro Ala Val Leu Gln Gln Glu Tyr Asn Ser Asn Phe Val Thr Ala

275 280 285

ctg cgc gcg gcg ggc ggt gcg gac gct tac gtg ccg acg acg tct gtt 960

Leu Arg Ala Ala Gly Gly Ala Asp Ala Tyr Val Pro Thr Thr Ser Val

290 295 300

ttc tct ggc ttc ctc gat gag att gtc cag ccg cag tcc ggc acc ggc 1008

Phe Ser Gly Phe Leu Asp Glu Ile Val Gln Pro Gln Ser Gly Thr Gly

305 310 315

gcg tcc gcg tac atc aat gat gct agg ggt gtg ggc acg acc aat gct 1056

Ala Ser Ala Tyr Ile Asn Asp Ala Arg Gly Val Gly Thr Thr Asn Ala

320 325 330

gag gtg cag gtc gtg tgc aag ggc aag ggt ccc gct ggc ggt ttt tac 1104

Glu Val Gln Val Val Cys Lys Gly Lys Gly Pro Ala Gly Gly Phe Tyr

335 340 345 350

acg cac gag agc ttg ctg gtc aac ccg ctg acc tat gct ctc ctc gtc 1152

Thr His Glu Ser Leu Leu Val Asn Pro Leu Thr Tyr Ala Leu Leu Val

355 360 365

gat gcc ttg acc cat gat ggc ccg ggt agt gtg gac agg ctg gat ctg 1200

Asp Ala Leu Thr His Asp Gly Pro Gly Ser Val Asp Arg Leu Asp Leu

370 375 380

gat acc gtg tgc tcg acc gtc gtg gcg ccc ggc ctg ggg ctg gat gcg 1248

Asp Thr Val Cys Ser Thr Val Val Ala Pro Gly Leu Gly Leu Asp Ala

385 390 395

ttg ttg gag att gag ggc gtg aat gtt ctg gcc gct gtc aat ctg ttg 1296

Leu Leu Glu Ile Glu Gly Val Asn Val Leu Ala Ala Val Asn Leu Leu

400 405 410

acc tac tcg gac agg agg ttg gcc gag ccg gcg ctg atg tct tat gcg 1344

Thr Tyr Ser Asp Arg Arg Leu Ala Glu Pro Ala Leu Met Ser Tyr Ala

415 420 425 430

gct taa 1350

Ala

<210>8

<211>449

<212>PRT

<213>Botryosphaeria rhodina

<400>8

Met His Leu Ser Ser Val Cys Leu Val Leu Ser Gly Leu Leu Leu Thr

-15 -10 -5

Asn Ala Ala Pro Ala Pro Val Pro Glu Asn Gly Leu Glu Lys Arg Gln

-1 1 5 10

Ser Leu Ser Ser Val Leu Ser Ala Leu Ser Gly Leu Thr Glu Pro Thr

15 20 25 30

Ala Ile Leu Ser Gln Leu Glu Ala Val Glu Ala Thr Ser Thr Pro Thr

35 40 45

Ser Val Glu Gln Ala Gln Glu Gln Leu Glu Ala Ile Tyr Gly Thr Thr

50 55 60

Pro Thr Asn Ile Phe Glu Asn Ile Ala Gln Gln Ile Ala Asp Gly Leu

65 70 75

Ser Thr Leu Thr Ile Val Gln Ala Leu Gly Phe Ser Pro Ser Gly Glu

80 85 90

Asn Ser Glu Thr Asn Ser Asn Thr Arg Glu Pro Ser Thr Thr Ile Tyr

95 100 105 110

Pro Lys Lys Ser Ser Ser Asp Ala Pro Tyr Ser Ile Thr Glu Glu Glu

115 120 125

Leu Arg Gln Ala Ile Tyr Ile Pro Ser Asp Phe Thr Tyr Gly Asp Lys

130 135 140

Pro Pro Val Ile Phe Val Pro Gly Thr Gly Ser Tyr Gly Gly Ile Ser

145 150 155

Phe Gly Ser Asn Leu Arg Lys Leu Leu Thr Gly Val Ser Tyr Ala Asp

160 165 170

Pro Val Trp Leu Asn Val Pro Asp Ala Leu Leu Arg Asp Ala Gln Thr

175 180 185 190

Asn Gly Glu Phe Val Ala Tyr Ala Ile Asn Tyr Ile Ser Gly Ile Ser

195 200 205

Gly Asp Ala Asn Val Ser Val Val Ser Trp Ser Gln Gly Gly Leu Asp

210 215 220

Thr Gln Trp Ala Phe Thr Tyr Trp Pro Ser Thr Arg Ala Leu Val Ser

225 230 235

Asp Phe Val Pro Val Ser Pro Asp Phe His Gly Thr Val Leu Ala Asn

240 245 250

Val Ile Cys Leu Asn Pro Gly Ala Gly Gly Val Gly Leu Gly Pro Cys

255 260 265 270

Ala Pro Ala Val Leu Gln Gln Glu Tyr Asn Ser Asn Phe Val Thr Ala

275 280 285

Leu Arg Ala Ala Gly Gly Ala Asp Ala Tyr Val Pro Thr Thr Ser Val

290 295 300

Phe Ser Gly Phe Leu Asp Glu Ile Val Gln Pro Gln Ser Gly Thr Gly

305 310 315

Ala Ser Ala Tyr Ile Asn Asp Ala Arg Gly Val Gly Thr Thr Asn Ala

320 325 330

Glu Val Gln Val Val Cys Lys Gly Lys Gly Pro Ala Gly Gly Phe Tyr

335 340 345 350

Thr His Glu Ser Leu Leu Val Asn Pro Leu Thr Tyr Ala Leu Leu Val

355 360 365

Asp Ala Leu Thr His Asp Gly Pro Gly Ser Val Asp Arg Leu Asp Leu

370 375 380

Asp Thr Val Cys Ser Thr Val Val Ala Pro Gly Leu Gly Leu Asp Ala

385 390 395

Leu Leu Glu Ile Glu Gly Val Asn Val Leu Ala Ala Val Asn Leu Leu

400 405 410

Thr Tyr Ser Asp Arg Arg Leu Ala Glu Pro Ala Leu Met Ser Tyr Ala

415 420 425 430

Ala

<210>9

<211>555

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(555)

<400>9

atg cgc ttc gcc acc gcc gcc acc gcc ctc gcc ctc acc ggc ttc tgc 48

Met Arg Phe Ala Thr Ala Ala Thr Ala Leu Ala Leu Thr Gly Phe Cys

1 5 10 15

agc gcc gcc gtc ctg ccg cgc gcc acc gag cac aag gtc tac gtc gac 96

Ser Ala Ala Val Leu Pro Arg Ala Thr Glu His Lys Val Tyr Val Asp

20 25 30

act tcc aag tgc gcc gac aac ggc cgc acc ctg ccg cag atc tac ggc 144

Thr Ser Lys Cys Ala Asp Asn Gly Arg Thr Leu Pro Gln Ile Tyr Gly

35 40 45

atc tcc aac tcg acc tcg cag gac ttc acc gac ccg cag cgc ttc gac 192

Ile Ser Asn Ser Thr Ser Gln Asp Phe Thr Asp Pro Gln Arg Phe Asp

50 55 60

ggg ccc acc ttc acc ttc acc gtg ccc gcc tac tac cag ggc cac ctc 240

Gly Pro Thr Phe Thr Phe Thr Val Pro Ala Tyr Tyr Gln Gly His Leu

65 70 75 80

tgg ctg tac aac agc gac gac cag gcc gcc tcg agc ggt gac aac acc 288

Trp Leu Tyr Asn Ser Asp Asp Gln Ala Ala Ser Ser Gly Asp Asn Thr

85 90 95

ccc ctg aac gtc cag ggc gtc gac ttc tac ttc tac gac cag ccc acc 336

Pro Leu Asn Val Gln Gly Val Asp Phe Tyr Phe Tyr Asp Gln Pro Thr

100 105 110

gac gtc gag cgc aac cag gcc acc gtg ccc gct gag ggc gac gcc aac 384

Asp Val Glu Arg Asn Gln Ala Thr Val Pro Ala Glu Gly Asp Ala Asn

115 120 125

cag gac ggc cag gtg tac agc gtt ccc gac ccc atc act gcc gtc cgc 432

Gln Asp Gly Gln Val Tyr Ser Val Pro Asp Pro Ile Thr Ala Val Arg

130 135 140

ttc gcc agc acc cct agc agc acc ttc atc gag ggc aag agc ggc ggg 480

Phe Ala Ser Thr Pro Ser Ser Thr Phe Ile Glu Gly Lys Ser Gly Gly

145 150 155 160

cac tct gta cag cac cca gga ggg cga cgc tct gta cgt cta cta ctg 528

His Ser Val Gln His Pro Gly Gly Arg Arg Ser Val Arg Leu Leu Leu

165 170 175

cga gga gtg gcc cgt cca gaa cta gag 555

Arg Gly Val Ala Arg Pro Glu Leu Glu

180 185

<210>10

<211>185

<212>PRT

<213>Botryosphaeria rhodina

<400>10

Met Arg Phe Ala Thr Ala Ala Thr Ala Leu Ala Leu Thr Gly Phe Cys

1 5 10 15

Ser Ala Ala Val Leu Pro Arg Ala Thr Glu His Lys Val Tyr Val Asp

20 25 30

Thr Ser Lys Cys Ala Asp Asn Gly Arg Thr Leu Pro Gln Ile Tyr Gly

35 40 45

Ile Ser Asn Ser Thr Ser Gln Asp Phe Thr Asp Pro Gln Arg Phe Asp

50 55 60

Gly Pro Thr Phe Thr Phe Thr Val Pro Ala Tyr Tyr Gln Gly His Leu

65 70 75 80

Trp Leu Tyr Asn Ser Asp Asp Gln Ala Ala Ser Ser Gly Asp Asn Thr

85 90 95

Pro Leu Asn Val Gln Gly Val Asp Phe Tyr Phe Tyr Asp Gln Pro Thr

100 105 110

Asp Val Glu Arg Asn Gln Ala Thr Val Pro Ala Glu Gly Asp Ala Asn

115 120 125

Gln Asp Gly Gln Val Tyr Ser Val Pro Asp Pro Ile Thr Ala Val Arg

130 135 140

Phe Ala Ser Thr Pro Ser Ser Thr Phe Ile Glu Gly Lys Ser Gly Gly

145 150 155 160

His Ser Val Gln His Pro Gly Gly Arg Arg Ser Val Arg Leu Leu Leu

165 170 175

Arg Gly Val Ala Arg Pro Glu Leu Glu

180 185

<210>11

<211>702

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(7 02)

<220>

<221>trahsit_peptide

<222>(1)..(48)

<220>

<221>misc_feature

<222>(1)..(702)

＜223〉propetide

<220>

<221>mat_peptide

<222>(49)..(702)

<400>11

atg aag ggt ctc ttc gct att ctt gcc acg gct tcg gtc gtc tct gcc 48

Met Lys Gly Leu Phe Ala Ile Leu Ala Thr Ala Ser Val Val Ser Ala

-15 -10 -5 -1

cac gcc acc tgg cag gag ctc tgg gtt ggt act gag gac aag gag gga 96

His Ala Thr Trp Gln Glu Leu Trp Val Gly Thr Glu Asp Lys Glu Gly

1 5 10 15

act tgc atc cgc ctt cct cag agc aac agc ccc gtc acc gat gtc acc 144

Thr Cys Ile Arg Leu Pro Gln Ser Asn Ser Pro Val Thr Asp Val Thr

20 25 30

tcc aac gac atc cgc tgc aac gcc agc ccc agc gct gcc tcg acc act 192

Ser Asn Asp Ile Arg Cys Asn Ala Ser Pro Ser Ala Ala Ser Thr Thr

35 40 45

tgc tcc gtt gcc gcc ggc ggt tca ctg acg gtt gag atg cac cag cag 240

Cys Ser Val Ala Ala Gly Gly Ser Leu Thr Val Glu Met His Gln Gln

50 55 60

ccc aac gac cgc agc tgc gac aac gag gcc atc ggt ggc aac cac ttc 288

Pro Asn Asp Arg Ser Cys Asp Asn Glu Ala Ile Gly Gly Asn His Phe

65 70 75 80

ggc cca gtc atg atc tac atg tcc aag gtc gac gac gcc gcc act gcc 336

Gly Pro Val Met Ile Tyr Met Ser Lys Val Asp Asp Ala Ala Thr Ala

85 90 95

gat ggc tct ggc gac tgg ttc aag gtc gct cag gac acc tac aac ggc 384

Asp Gly Ser Gly Asp Trp Phe Lys Val Ala Gln Asp Thr Tyr Asn Gly

100 105 110

act gag gct agc tgg ggt acc gag atc ctc aac gcc aac tgc ggc aag 432

Thr Glu Ala Ser Trp Gly Thr Glu Ile Leu Asn Ala Asn Cys Gly Lys

115 120 125

cgc gcc ttc acc gtc ccc aag tct ctc ccg tcg ggc gac tac ctc gtc 480

Arg Ala Phe Thr Val Pro Lys Ser Leu Pro Ser Gly Asp Tyr Leu Val

130 135 140

cgc gcc gag gcg ctg gcc ctg cac agc gca ggt agc gag ggc ggt gct 528

Arg Ala Glu Ala Leu Ala Leu His Ser Ala Gly Ser Glu Gly Gly Ala

145 150 155 160

cag ttc tac atg agc tgc tac cag gtc acc gtc acc ggc ggc ggc agc 576

Gln Phe Tyr Met Ser Cys Tyr Gln Val Thr Val Thr Gly Gly Gly Ser

165 170 175

gcc acc ccg tcc ccg acc gtc aag ttc cct ggc gcc tac agc gcc gac 624

Ala Thr Pro Ser Pro Thr Val Lys Phe Pro Gly Ala Tyr Ser Ala Asp

180 185 190

gat gct ggt atc ctc atc aac atc tac cag acc ccg ctg acg tac gag 672

Asp Ala Gly Ile Leu Ile Asn Ile Tyr Gln Thr Pro Leu Thr Tyr Glu

195 200 205

gcc cct ggc ccg gct gtc tgg agc ggt aac 702

Ala Pro Gly Pro Ala Val Trp Ser Gly Asn

210 215

<210>12

<211>234

<212>PRT

<213>Botryosphaeria rhodina

<400>12

Met Lys Gly Leu Phe Ala Ile Leu Ala Thr Ala Ser Val Val Ser Ala

-15 -10 -5 -1

His Ala Thr Trp Gln Glu Leu Trp Val Gly Thr Glu Asp Lys Glu Gly

1 5 10 15

Thr Cys Ile Arg Leu Pro Gln Ser Asn Ser Pro Val Thr Asp Val Thr

20 25 30

Ser Asn Asp Ile Arg Cys Asn Ala Ser Pro Ser Ala Ala Ser Thr Thr

35 40 45

Cys Ser Val Ala Ala Gly Gly Ser Leu Thr Val Glu Met His Gln Gln

50 55 60

Pro Asn Asp Arg Ser Cys Asp Asn Glu Ala Ile Gly Gly Asn His Phe

65 70 75 80

Gly Pro Val Met Ile Tyr Met Ser Lys Val Asp Asp Ala Ala Thr Ala

85 90 95

Asp Gly Ser Gly Asp Trp Phe Lys Val Ala Gln Asp Thr Tyr Asn Gly

100 105 110

Thr Glu Ala Ser Trp Gly Thr Glu Ile Leu Asn Ala Asn Cys Gly Lys

115 120 125

Arg Ala Phe Thr Val Pro Lys Ser Leu Pro Ser Gly Asp Tyr Leu Val

130 135 140

Arg Ala Glu Ala Leu Ala Leu His Ser Ala Gly Ser Glu Gly Gly Ala

145 150 155 160

Gln Phe Tyr Met Ser Cys Tyr Gln Val Thr Val Thr Gly Gly Gly Ser

165 170 175

Ala Thr Pro Ser Pro Thr Val Lys Phe Pro Gly Ala Tyr Ser Ala Asp

180 185 190

Asp Ala Gly Ile Leu Ile Asn Ile Tyr Gln Thr Pro Leu Thr Tyr Glu

195 200 205

Ala Pro Gly Pro Ala Val Trp Ser Gly Asn

210 215

<210>13

<211>786

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(786)

<220>

<221>transit_peptide

<222>(1)..(39)

<220>

<221>misc_feature

<222>(1)..(786)

＜223〉propetide

<220>

<221>mat_peptide

<222>(40)..(786)

<400>13

atg ttc ttc tcc caa aag ctc atc gcg gcc gtc gcc gcc ctc ccc gac 48

Met Phe Phe Ser Gln Lys Leu Ile Ala Ala Val Ala Ala Leu Pro Asp

-10 -5 -1 1

cat gac ttc ggc cca cta ctt ctg tcc gca act cat cgt caa cgg cga 96

His Asp Phe Gly Pro Leu Leu Leu Ser Ala Thr His Arg Gln Arg Arg

5 10 15

acc tcc gag caa tgg gaa tac gtc cgc gaa acc tct cag ggc tac gag 144

Thr Ser Glu Gln Trp Glu Tyr Val Arg Glu Thr Ser Gln Gly Tyr Glu

20 25 30 35

ccg caa tac act ccg gac atc ctc acc tcc aac gac ctg cgc tgc aac 192

Pro Gln Tyr Thr Pro Asp Ile Leu Thr Ser Asn Asp Leu Arg Cys Asn

40 45 50

acg gac agc ctc gcc gcc gct gcc aac acc aag gtc gcg tcc gtc gcg 240

Thr Asp Ser Leu Ala Ala Ala Ala Asn Thr Lys Val Ala Ser Val Ala

55 60 65

gcc ggc gac acc gtc tcc ttc gtc acc gac tac ggc gcc aag gtg cag 288

Ala Gly Asp Thr Val Ser Phe Val Thr Asp Tyr Gly Ala Lys Val Gln

70 75 80

cac ccg ggc ccg ctg acg ttc tgg atg tcg cag gcg ccg ggc ggg gat 336

His Pro Gly Pro Leu Thr Phe Trp Met Ser Gln Ala Pro Gly Gly Asp

85 90 95

gta acc aca tac gat ggc tca ggc gat tgg ttc aag atc ggc gtc gtg 384

Val Thr Thr Tyr Asp Gly Ser Gly Asp Trp Phe Lys Ile Gly Val Val

100 105 110 115

ggc tac gac acg ccg ttc gac tcg acg gga acg aac tgg cgc gcc tac 432

Gly Tyr Asp Thr Pro Phe Asp Ser Thr Gly Thr Asn Trp Arg Ala Tyr

120 125 130

gat gag ggc acg ttc aac gtg tcc atc ccg aca acg gtg ccg aat ggc 480

Asp Glu Gly Thr Phe Asn Val Ser Ile Pro Thr Thr Val Pro Asn Gly

135 140 145

caa tac ttg ctg cgc atc gag cat atc ggc ctg cac cgc ccg tcg acg 528

Gln Tyr Leu Leu Arg Ile Glu His Ile Gly Leu His Arg Pro Ser Thr

150 155 160

cgc gag atg ttc ttc aac tgc gcg cag gtt gag gtg acg ggg tcg tcc 576

Arg Glu Met Phe Phe Asn Cys Ala Gln Val Glu Val Thr Gly Ser Ser

165 170 175

gcc aca gcg gtg ccg agt gag acg gcg aag att cct gcg gga tct ata 624

Ala Thr Ala Val Pro Ser Glu Thr Ala Lys Ile Pro Ala Gly Ser Ile

180 185 190 195

gtg aga gcg atg agt ggg tgt cca agt gga gca tgt ata gta gcc cga 672

Val Arg Ala Met Ser Gly Cys Pro Ser Gly Ala Cys Ile Val Ala Arg

200 205 210

gca gct tcc cgt act ctg gcc cag cta ctg ttg atg gtg gtg ttt ttg 720

Ala Ala Ser Arg Thr Leu Ala Gln Leu Leu Leu Met Val Val Phe Leu

215 220 225

att ctc agg gct ctg att ctg ctt aaa tgg gcg gga ttt tcc ctt tcc 768

Ile Leu Arg Ala Leu Ile Leu Leu Lys Trp Ala Gly Phe Ser Leu Ser

230 235 240

ata tgt tct att gtt gta 786

Ile Cys Ser Ile Val Val

245

<210>14

<211>262

<212>PRT

<213>Botryosphaeria rhodina

<400>14

Met Phe Phe Ser Gln Lys Leu Ile Ala Ala Val Ala Ala Leu Pro Asp

-10 -5 -1 1

His Asp Phe Gly Pro Leu Leu Leu Ser Ala Thr His Arg Gln Arg Arg

5 10 15

Thr Ser Glu Gln Trp Glu Tyr Val Arg Glu Thr Ser Gln Gly Tyr Glu

20 25 30 35

Pro Gln Tyr Thr Pro Asp Ile Leu Thr Ser Asn Asp Leu Arg Cys Asn

40 45 50

Thr Asp Ser Leu Ala Ala Ala Ala Asn Thr Lys Val Ala Ser Val Ala

55 60 65

Ala Gly Asp Thr Val Ser Phe Val Thr Asp Tyr Gly Ala Lys Val Gln

70 75 80

His Pro Gly Pro Leu Thr Phe Trp Met Ser Gln Ala Pro Gly Gly Asp

85 90 95

Val Thr Thr Tyr Asp Gly Ser Gly Asp Trp Phe Lys Ile Gly Val Val

100 105 110 115

Gly Tyr Asp Thr Pro Phe Asp Ser Thr Gly Thr Asn Trp Arg Ala Tyr

120 125 130

Asp Glu Gly Thr Phe Asn Val Ser Ile Pro Thr Thr Val Pro Asn Gly

135 140 145

Gln Tyr Leu Leu Arg Ile Glu His Ile Gly Leu His Arg Pro Ser Thr

150 155 160

Arg Glu Met Phe Phe Asn Cys Ala Gln Val Glu Val Thr Gly Ser Ser

165 170 175

Ala Thr Ala Val Pro Ser Glu Thr Ala Lys Ile Pro Ala Gly Ser Ile

180 185 190 195

Val Arg Ala Met Ser Gly Cys Pro Ser Gly Ala Cys Ile Val Ala Arg

200 205 210

Ala Ala Ser Arg Thr Leu Ala Gln Leu Leu Leu Met Val Val Phe Leu

215 220 225

Ile Leu Arg Ala Leu Ile Leu Leu Lys Trp Ala Gly Phe Ser Leu Ser

230 235 240

Ile Cys Ser Ile Val Val

245

<210>15

<211>819

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(819)

<220>

<221>transit_peptide

<222>(1)..(54)

<220>

<221>misc_feature

<222>(1)..(819)

＜223〉propetide

<220>

<221>mat_peptide

<222>(55)..(819)

<400>15

atg tct ttc aag tct ctt gct gtt att gcc gct ggt gcg gcc acc gcc 48

Met Ser Phe Lys Ser Leu Ala Val Ile Ala Ala Gly Ala Ala Thr Ala

-15 -10 -5

aac gcc cac ggt gtc atc ctg gac atc gtg tct ggc ggc aag acc tac 96

Asn Ala His Gly Val Ile Leu Asp Ile Val Ser Gly Gly Lys Thr Tyr

-1 1 5 10

ggt ggc tgg gac gcc agc tac gtc tac tac aac ccc gtc ccc gag gtt 144

Gly Gly Trp Asp Ala Ser Tyr Val Tyr Tyr Asn Pro Val Pro Glu Val

15 20 25 30

gct gcc tgg cag tct ggt ggc ttc ggc cac ggc ccc atc gtc ggc acc 192

Ala Ala Trp Gln Ser Gly Gly Phe Gly His Gly Pro Ile Val Gly Thr

35 40 45

cag tac tcg acc gct tcc atc aac tgc cac gac gac gct att gcc gct 240

Gln Tyr Ser Thr Ala Ser Ile Asn Cys His Asp Asp Ala Ile Ala Ala

50 55 60

ccc atc tac atg gag gcc gcc gcc ggt gac gag atc gcc atc tcc tgg 288

Pro Ile Tyr Met Glu Ala Ala Ala Gly Asp Glu Ile Ala Ile Ser Trp

65 70 75

ggt acc cct ggc aac ccc ccc agc gcc tgg ccc acg agc cac cac ggc 336

Gly Thr Pro Gly Asn Pro Pro Ser Ala Trp Pro Thr Ser His His Gly

80 85 90

ccc atc att acc tac atg gct cct tgc ggt ggt gct gat gct act ggc 384

Pro Ile Ile Thr Tyr Met Ala Pro Cys Gly Gly Ala Asp Ala Thr Gly

95 100 105 110

gac tgc acc tcc ctg aac gtc acc gac ctc gct tgg acc aag gtc tac 432

Asp Cys Thr Ser Leu Asn Val Thr Asp Leu Ala Trp Thr Lys Val Tyr

115 120 125

cag aag ggt ctc atc acc ggc ggt gat gtt gac agc cag gtc tgg gcc 480

Gln Lys Gly Leu Ile Thr Gly Gly Asp Val Asp Ser Gln Val Trp Ala

130 135 140

acc gac gag ctc atc tcg aac aac aag acc atg gtc acc atc ccc tcc 528

Thr Asp Glu Leu Ile Ser Asn Asn Lys Thr Met Val Thr Ile Pro Ser

145 150 155

tcg ctc gcc ccg ggc aac tac gtc ctc cgc aac gag atc atc gcc ctt 576

Ser Leu Ala Pro Gly Asn Tyr Val Leu Arg Asn Glu Ile Ile Ala Leu

160 165 170

cac gcc ggc ggt gag gtc aac ggc ccc cag aac tac ccc cag tgc tac 624

His Ala Gly Gly Glu Val Asn Gly Pro Gln Asn Tyr Pro Gln Cys Tyr

175 180 185 190

aac gtc aag atc acc ggc tct ggc tcc gga aag ctt acc gac ggc gtc 672

Asn Val Lys Ile Thr Gly Ser Gly Ser Gly Lys Leu Thr Asp Gly Val

195 200 205

aag ggc acc gag ctc tac acc ccc gag gac acc gtc ttc aac atc tac 720

Lys Gly Thr Glu Leu Tyr Thr Pro Glu Asp Thr Val Phe Asn Ile Tyr

210 215 220

gcc aac att gac agc tac ccc ttc ccc ggc ccc gag ctc tgg agc ggc 768

Ala Asn Ile Asp Ser Tyr Pro Phe Pro Gly Pro Glu Leu Trp Ser Gly

225 230 235

gct tcc tct acc tcc aac gcc acc aag cgc tct ttc cgt acc ttc aag 816

Ala Ser Ser Thr Ser Asn Ala Thr Lys Arg Ser Phe Arg Thr Phe Lys

240 245 250

gca 819

Ala

255

<210>16

<211>273

<212>PRT

<213>Botryosphaeria rhodina

<400>16

Met Ser Phe Lys Ser Leu Ala Val Ile Ala Ala Gly Ala Ala Thr Ala

-15 -10 -5

Asn Ala His Gly Val Ile Leu Asp Ile Val Ser Gly Gly Lys Thr Tyr

-1 1 5 10

Gly Gly Trp Asp Ala Ser Tyr Val Tyr Tyr Asn Pro Val Pro Glu Val

15 20 25 30

Ala Ala Trp Gln Ser Gly Gly Phe Gly His Gly Pro Ile Val Gly Thr

35 40 45

Gln Tyr Ser Thr Ala Ser Ile Asn Cys His Asp Asp Ala Ile Ala Ala

50 55 60

Pro Ile Tyr Met Glu Ala Ala Ala Gly Asp Glu Ile Ala Ile Ser Trp

65 70 75

Gly Thr Pro Gly Asn Pro Pro Ser Ala Trp Pro Thr Ser His His Gly

80 85 90

Pro Ile Ile Thr Tyr Met Ala Pro Cys Gly Gly Ala Asp Ala Thr Gly

95 100 105 110

Asp Cys Thr Ser Leu Asn Val Thr Asp Leu Ala Trp Thr Lys Val Tyr

115 120 125

Gln Lys Gly Leu Ile Thr Gly Gly Asp Val Asp Ser Gln Val Trp Ala

130 135 140

Thr Asp Glu Leu Ile Ser Asn Asn Lys Thr Met Val Thr Ile Pro Ser

145 150 155

Ser Leu Ala Pro Gly Asn Tyr Val Leu Arg Asn Glu Ile Ile Ala Leu

160 165 170

His Ala Gly Gly Glu Val Asn Gly Pro Gln Asn Tyr Pro Gln Cys Tyr

175 180 185 190

Asn Val Lys Ile Thr Gly Ser Gly Ser Gly Lys Leu Thr Asp Gly Val

195 200 205

Lys Gly Thr Glu Leu Tyr Thr Pro Glu Asp Thr Val Phe Asn Ile Tyr

210 215 220

Ala Asn Ile Asp Ser Tyr Pro Phe Pro Gly Pro Glu Leu Trp Ser Gly

225 230 235

Ala Ser Ser Thr Ser Asn Ala Thr Lys Arg Ser Phe Arg Thr Phe Lys

240 245 250

Ala

255

<210>17

<211>675

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(675)

<220>

<221>sig_peptide

<222>(1)..(60)

<220>

<221>misc_feature

<222>(1)..(675)

＜223〉propetide

<220>

<221>mat_peptide

<222>(61)..(675)

<400>17

atg aag act ttc act act ttc gca ttc gct gcc tct gtg ctg gca cag 48

Met Lys Thr Phe Thr Thr Phe Ala Phe Ala Ala Ser Val Leu Ala Gln

-20 -15 -10 -5

gct gtc aac gga cac tac atc ttc caa tac ctc act gcc aac ggc gtg 96

Ala Val Asn Gly His Tyr Ile Phe Gln Tyr Leu Thr Ala Asn Gly Val

-1 1 5 10

aag ggt ggt atc tat cag aac att agg gag aac acg aac aac aac tcg 144

Lys Gly Gly Ile Tyr Gln Asn Ile Arg Glu Asn Thr Asn Asn Asn Ser

15 20 25

ccc gtg act gat ctc gag tcc aac gac ctc cgc tgc aat gtt ggt ggt 192

Pro Val Thr Asp Leu Glu Ser Asn Asp Leu Arg Cys Asn Val Gly Gly

30 35 40

gag gat ggc agc aag act agc acg gtc tcc gtc gct gct ggc agc acc 240

Glu Asp Gly Ser Lys Thr Ser Thr Val Ser Val Ala Ala Gly Ser Thr

45 50 55 60

gtc gct ttc act gcc gac atc gcc gtg tac cac cag ggc ccc gtc tct 288

Val Ala Phe Thr Ala Asp Ile Ala Val Tyr His Gln Gly Pro Val Ser

65 70 75

ttc tac atg aca aag gtc gac gac gcg gcg gcg gcg gac ggc agc acg 336

Phe Tyr Met Thr Lys Val Asp Asp Ala Ala Ala Ala Asp Gly Ser Thr

80 85 90

ccg tgg ttt aag atc aag gac atc gga ccc act ttc tcc aac ggc cag 384

Pro Trp Phe Lys Ile Lys Asp Ile Gly Pro Thr Phe Ser Asn Gly Gln

95 100 105

gcg act tgg gac ctc gag acg acg tac aac gtg acc atc ccc aac tgc 432

Ala Thr Trp Asp Leu Glu Thr Thr Tyr Asn Val Thr Ile Pro Asn Cys

110 115 120

ctt ccc gcc ggc gag tac ctg ctg cgc atc cag cag ctt ggc atc cac 480

Leu Pro Ala Gly Glu Tyr Leu Leu Arg Ile Gln Gln Leu Gly Ile His

125 130 135 140

aac ccg tgg ccg gcc ggc atc ccg caa ttc tac atc tcg tgc gcc cag 528

Asn Pro Trp Pro Ala Gly Ile Pro Gln Phe Tyr Ile Ser Cys Ala Gln

145 150 155

gtc aag gtc acg ggc agc ggc tcg ggc tcg ccc agc ccg act gtt tcc 576

Val Lys Val Thr Gly Ser Gly Ser Gly Ser Pro Ser Pro Thr Val Ser

160 165 170

atc ccc ggc gcg ttc aag gag acg gac ccc ggc tat acc gtc aac att 624

Ile Pro Gly Ala Phe Lys Glu Thr Asp Pro Gly Tyr Thr Val Asn Ile

175 180 185

tac aac gac ttc acc aac tat act gtc ccc ggc ccg gag gtg tgg acg 672

Tyr Asn Asp Phe Thr Asn Tyr Thr Val Pro Gly Pro Glu Val Trp Thr

190 195 200

tgc 675

Cys

205

<210>18

<211>225

<212>PRT

<213>Botryosphaeria rhodina

<400>18

Met Lys Thr Phe Thr Thr Phe Ala Phe Ala Ala Ser Val Leu Ala Gln

-20 -15 -10 -5

Ala Val Asn Gly His Tyr Ile Phe Gln Tyr Leu Thr Ala Asn Gly Val

-1 1 5 10

Lys Gly Gly Ile Tyr Gln Asn Ile Arg Glu Asn Thr Asn Asn Asn Ser

15 20 25

Pro Val Thr Asp Leu Glu Ser Asn Asp Leu Arg Cys Asn Val Gly Gly

30 35 40

Glu Asp Gly Ser Lys Thr Ser Thr Val Ser Val Ala Ala Gly Ser Thr

45 50 55 60

Val Ala Phe Thr Ala Asp Ile Ala Val Tyr His Gln Gly Pro Val Ser

65 70 75

Phe Tyr Met Thr Lys Val Asp Asp Ala Ala Ala Ala Asp Gly Ser Thr

80 85 90

Pro Trp Phe Lys Ile Lys Asp Ile Gly Pro Thr Phe Ser Asn Gly Gln

95 100 105

Ala Thr Trp Asp Leu Glu Thr Thr Tyr Asn Val Thr Ile Pro Asn Cys

110 115 120

Leu Pro Ala Gly Glu Tyr Leu Leu Arg Ile Gln Gln Leu Gly Ile His

125 130 135 140

Asn Pro Trp Pro Ala Gly Ile Pro Gln Phe Tyr Ile Ser Cys Ala Gln

145 150 155

Val Lys Val Thr Gly Ser Gly Ser Gly Ser Pro Ser Pro Thr Val Ser

160 165 170

Ile Pro Gly Ala Phe Lys Glu Thr Asp Pro Gly Tyr Thr Val Asn Ile

175 180 185

Tyr Asn Asp Phe Thr Asn Tyr Thr Val Pro Gly Pro Glu Val Trp Thr

190 195 200

Cys

205

<210>19

<211>729

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(729)

<400>19

atg gag tcg gcg tcc aag acg ctg aag cgc gtg acg ctt gag ctg ggt 48

Met Glu Ser Ala Ser Lys Thr Leu Lys Arg Val Thr Leu Glu Leu Gly

1 5 10 15

ggc aag gac ccg gcc atc gtg tgc tcg gac gtc gac atc gcg gcg acg 96

Gly Lys Asp Pro Ala Ile Val Cys Ser Asp Val Asp Ile Ala Ala Thr

20 25 30

gcc ccc aag gtt gcc acc ctg gcc ttc ctc aac tcg ggt cag atc tgc 144

Ala Pro Lys Val Ala Thr Leu Ala Phe Leu Asn Ser Gly Gln Ile Cys

35 40 45

ctg gcc atc aag cgt atc tac gtt cac gag aag atc tac gac gag ttc 192

Leu Ala Ile Lys Arg Ile Tyr Val His Glu Lys Ile Tyr Asp Glu Phe

50 55 60

ctc aag gcg tgc gtc gag cac acc aag acg ctc gtg ctc ggc aac ggc 240

Leu Lys Ala Cys Val Glu His Thr Lys Thr Leu Val Leu Gly Asn Gly

65 70 75 80

acc gag ccc aac acc ttc ctc ggc ccc gtg cag aac gcc atg cag tac 288

Thr Glu Pro Asn Thr Phe Leu Gly Pro Val Gln Asn Ala Met Gln Tyr

85 90 95

gag cgc gtc aag ggc ttc ttc cag gac gtg cac gag cac aag atg aag 336

Glu Arg Val Lys Gly Phe Phe Gln Asp Val His Glu His Lys Met Lys

100 105 110

gtg gcc gtc ggc ggc gtc aac gac aag acg ggc ggc tac tac atc acc 384

Val Ala Val Gly Gly Val Asn Asp Lys Thr Gly Gly Tyr Tyr Ile Thr

115 120 125

ccg acc atc atc gac aac ccg gcc gag acg agc aag atc gtg acc gag 432

Pro Thr Ile Ile Asp Asn Pro Ala Glu Thr Ser Lys Ile Val Thr Glu

130 135 140

gag ccc ttc ggc ccc atc gtg ccg ctg ctc aag tgg agc gac gag agc 480

Glu Pro Phe Gly Pro Ile Val Pro Leu Leu Lys Trp Ser Asp Glu Ser

145 150 155 160

gag gtc gtc cac cgc gcc aac gac acc aag atg ggt ctc ggc gcc tcc 528

Glu Val Val His Arg Ala Asn Asp Thr Lys Met Gly Leu Gly Ala Ser

165 170 175

gtg tgg agc aac gac ctc gcc cag gcc gag cgc atc gcc cgc cag ctc 576

Val Trp Ser Asn Asp Leu Ala Gln Ala Glu Arg Ile Ala Arg Gln Leu

180 185 190

gac gcc ggc agc gtc tgg atc aac act cac ctc gag ctc gac ccc aac 624

Asp Ala Gly Ser Val Trp Ile Asn Thr His Leu Glu Leu Asp Pro Asn

195 200 205

gct ccc ttc ggc ggc cac aag gag agc ggt gtt ggc tac gag tgg ggt 672

Ala Pro Phe Gly Gly His Lys Glu Ser Gly Val Gly Tyr Glu Trp Gly

210 215 220

ctt ggt ggc atg aag gcc tac tgc aac gtc cag acc ctg ttc ttg aag 720

Leu Gly Gly Met Lys Ala Tyr Cys Asn Val Gln Thr Leu Phe Leu Lys

225 230 235 240

aag aag gtc 729

Lys Lys Val

<210>20

<211>243

<212>PRT

<213>Botryosphaeria rhodina

<400>20

Met Glu Ser Ala Ser Lys Thr Leu Lys Arg Val Thr Leu Glu Leu Gly

1 5 10 15

Gly Lys Asp Pro Ala Ile Val Cys Ser Asp Val Asp Ile Ala Ala Thr

20 25 30

Ala Pro Lys Val Ala Thr Leu Ala Phe Leu Asn Ser Gly Gln Ile Cys

35 40 45

Leu Ala Ile Lys Arg Ile Tyr Val His Glu Lys Ile Tyr Asp Glu Phe

50 55 60

Leu Lys Ala Cys Val Glu His Thr Lys Thr Leu Val Leu Gly Asn Gly

65 70 75 80

Thr Glu Pro Asn Thr Phe Leu Gly Pro Val Gln Asn Ala Met Gln Tyr

85 90 95

Glu Arg Val Lys Gly Phe Phe Gln Asp Val His Glu His Lys Met Lys

100 105 110

Val Ala Val Gly Gly Val Asn Asp Lys Thr Gly Gly Tyr Tyr Ile Thr

115 120 125

Pro Thr Ile Ile Asp Asn Pro Ala Glu Thr Ser Lys Ile Val Thr Glu

130 135 140

Glu Pro Phe Gly Pro Ile Val Pro Leu Leu Lys Trp Ser Asp Glu Ser

145 150 155 160

Glu Val Val His Arg Ala Asn Asp Thr Lys Met Gly Leu Gly Ala Ser

165 170 175

Val Trp Ser Asn Asp Leu Ala Gln Ala Glu Arg Ile Ala Arg Gln Leu

180 185 190

Asp Ala Gly Ser Val Trp Ile Asn Thr His Leu Glu Leu Asp Pro Asn

195 200 205

Ala Pro Phe Gly Gly His Lys Glu Ser Gly Val Gly Tyr Glu Trp Gly

210 215 220

Leu Gly Gly Met Lys Ala Tyr Cys Asn Val Gln Thr Leu Phe Leu Lys

225 230 235 240

Lys Lys Val

<210>21

<211>1300

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1299)

<220>

<221>sig_peptide

<222>(1)..(54)

<220>

<221>mat_peptide

<222>(55)..(1299)

<220>

<221>misc_feature

<222>(55)..(456)

＜223〉unknown territory

<220>

<221>misc_feature

<222>(460)..(579)

＜223〉chitin (chitin) is in conjunction with the territory

<220>

<221>misc_feature

<222>(580)..(1299)

＜223〉be rich in the structural domain of Threonine-Serine

<400>21

atg aag ttg gcg gcg tcg ctt ttg ctt gtc gca gcc gcg ctt gcg ggg 48

Met Lys Leu Ala Ala Ser Leu Leu Leu Val Ala Ala Ala Leu Ala Gly

-15 -10 -5

gcc ttt gac aac cgc caa tcg cat gca agg gcc ccc gtt ccg cga gac 96

Ala Phe Asp Asn Arg Gln Ser His Ala Arg Ala Pro Val Pro Arg Asp

-1 1 5 10

gcc ttc gac aat gct tgc gag acc gtc tac atc acg agt tat gtc tgc 144

Ala Phe Asp Asn Ala Cys Glu Thr Val Tyr Ile Thr Ser Tyr Val Cys

15 20 25 30

acc acc ttc gtc gtc cct tcg ctt agc tac acc agc cat gag ttt agc 192

Thr Thr Phe Val Val Pro Ser Leu Ser Tyr Thr Ser His Glu Phe Ser

35 40 45

tgc acc act cac ttg acc aac acc acg cgt atc aca tct tcc gga tcc 240

Cys Thr Thr His Leu Thr Asn Thr Thr Arg Ile Thr Ser Ser Gly Ser

50 55 60

acg acc gca gaa act tta act tca ggt cac acg agc tca gag agc cgc 288

Thr Thr Ala Glu Thr Leu Thr Ser Gly His Thr Ser Ser Glu Ser Arg

65 70 75

gct att agc ccg aca caa aac tca tcc agc gtt tac ccg agc gac agc 336

Ala Ile Ser Pro Thr Gln Asn Ser Ser Ser Val Tyr Pro Ser Asp Ser

80 85 90

cct tca cgt tct gtg tct tca tcc aca ctg tcg cag tct tcc aga acc 384

Pro Ser Arg Ser Val Ser Ser Ser Thr Leu Ser Gln Ser Ser Arg Thr

95 100 105 110

gaa aca agc aat aga gac acg agc aat acg tct cac agc gac agc cct 432

Glu Thr Ser Asn Arg Asp Thr Ser Asn Thr Ser His Ser Asp Ser Pro

115 120 125

act ccc ggc ccc agc gag gag ccc tgt tgc ggc ccg caa ggc ggt aac 480

Thr Pro Gly Pro Ser Glu Glu Pro Cys Cys Gly Pro Gln Gly Gly Asn

130 135 140

cgt cgt tgt ccc cat gga aca tgc tgt tcc aaa aat gga cac tgt ggt 528

Arg Arg Cys Pro His Gly Thr Cys Cys Ser Lys Asn Gly His Cys Gly

145 150 155

tcg ggg cca gat ttc tgt ggt gat ggg tgc caa tct tcg tgg gga aac 576

Ser Gly Pro Asp Phe Cys Gly Asp Gly Cys Gln Ser Ser Trp Gly Asn

160 165 170

tgt acc aac gac aac agc gat gag ata tct ccc tcg agc agt ccc tca 624

Cys Thr Asn Asp Asn Ser Asp Glu Ile Ser Pro Ser Ser Ser Pro Ser

175 180 185 190

aac tac tcg gcg cca gct gca tgg gct cga gtg aaa aga gat gag ttt 672

Asn Tyr Ser Ala Pro Ala Ala Trp Ala Arg Val Lys Arg Asp Glu Phe

195 200 205

gac gca ggt gca ttt gaa ctc ttg aca agt ctc aag tac atc gtt gaa 720

Asp Ala Gly Ala Phe Glu Leu Leu Thr Ser Leu Lys Tyr Ile Val Glu

210 215 220

ggc acc atg gtg aga acc agc act tgc act tac act cac tgg cac acc 768

Gly Thr Met Val Arg Thr Ser Thr Cys Thr Tyr Thr His Trp His Thr

225 230 235

atc tcg act aca tca aag cga acg agt acc atc acc gtc tac att tcg 816

Ile Ser Thr Thr Ser Lys Arg Thr Ser Thr Ile Thr Val Tyr Ile Ser

240 245 250

acg tgt cta tca tca aat cca cca gtc acc agc agc agc aca cag tcc 864

Thr Cys Leu Ser Ser Asn Pro Pro Val Thr Ser Ser Ser Thr Gln Ser

255 260 265 270

atc tcc tct ctc atc aca tct cct acg ttg gtg tca act tcg agt gtc 912

Ile Ser Ser Leu Ile Thr Ser Pro Thr Leu Val Ser Thr Ser Ser Val

275 280 285

att acg aca tcc agc aca tcc caa tac tca agc agt acc tca tgc acc 960

Ile Thr Thr Ser Ser Thr Ser Gln Tyr Ser Ser Ser Thr Ser Cys Thr

290 295 300

tat aca aaa agt tca aac act aca ata ccg tgg tca cca ccc aca agc 1008

Tyr Thr Lys Ser Ser Asn Thr Thr Ile Pro Trp Ser Pro Pro Thr Ser

305 310 315

atg tcg ata acc agc tct tca tgc act cgc tca tcg gac tgg aca acc 1056

Met Ser Ile Thr Ser Ser Ser Cys Thr Arg Ser Ser Asp Trp Thr Thr

320 325 330

cca aag ccg cca ccc tcg acc tca aca acc ata caa acg aca caa acc 1104

Pro Lys Pro Pro Pro Ser Thr Ser Thr Thr Ile Gln Thr Thr Gln Thr

335 340 345 350

ccg gat act ata acg aaa tcg aat act ccc act acg acc aag acc aca 1152

Pro Asp Thr Ile Thr Lys Ser Asn Thr Pro Thr Thr Thr Lys Thr Thr

355 360 365

act aag atc tcg att tca att tcc act cca tgg aat act aca tgt acc 1200

Thr Lys Ile Ser Ile Ser Ile Ser Thr Pro Trp Asn Thr Thr Cys Thr

370 375 380

tca tca acg aac agc acc aca tcc aca ccc caa acc aca cat aca gcg 1248

Ser Ser Thr Asn Ser Thr Thr Ser Thr Pro Gln Thr Thr His Thr Ala

385 390 395

aca gaa cca ccc act tcc agc atc ata gca ata tca agc tcc tct aac 1296

Thr Glu Pro Pro Thr Ser Ser Ile Ile Ala Ile Ser Ser Ser Ser Asn

400 405 410

ccg c 1300

Pro

415

<210>22

<211>433

<212>PRT

<213>Botryosphaeria rhodina

<400>22

Met Lys Leu Ala Ala Ser Leu Leu Leu Val Ala Ala Ala Leu Ala Gly

-15 -10 -5

Ala Phe Asp Asn Arg Gln Ser His Ala Arg Ala Pro Val Pro Arg Asp

-1 1 5 10

Ala Phe Asp Asn Ala Cys Glu Thr Val Tyr Ile Thr Ser Tyr Val Cys

15 20 25 30

Thr Thr Phe Val Val Pro Ser Leu Ser Tyr Thr Ser His Glu Phe Ser

35 40 45

Cys Thr Thr His Leu Thr Asn Thr Thr Arg Ile Thr Ser Ser Gly Ser

50 55 60

Thr Thr Ala Glu Thr Leu Thr Ser Gly His Thr Ser Ser Glu Ser Arg

65 70 75

Ala Ile Ser Pro Thr Gln Asn Ser Ser Ser Val Tyr Pro Ser Asp Ser

80 85 90

Pro Ser Arg Ser Val Ser Ser Ser Thr Leu Ser Gln Ser Ser Arg Thr

95 100 105 110

Glu Thr Ser Asn Arg Asp Thr Ser Asn Thr Ser His Ser Asp Ser Pro

115 120 125

Thr Pro Gly Pro Ser Glu Glu Pro Cys Cys Gly Pro Gln Gly Gly Asn

130 135 140

Arg Arg Cys Pro His Gly Thr Cys Cys Ser Lys Asn Gly His Cys Gly

145 150 155

Ser Gly Pro Asp Phe Cys Gly Asp Gly Cys Gln Ser Ser Trp Gly Asn

160 165 170

Cys Thr Asn Asp Asn Ser Asp Glu Ile Ser Pro Ser Ser Ser Pro Ser

175 180 185 190

Asn Tyr Ser Ala Pro Ala Ala Trp Ala Arg Val Lys Arg Asp Glu Phe

195 200 205

Asp Ala Gly Ala Phe Glu Leu Leu Thr Ser Leu Lys Tyr Ile Val Glu

210 215 220

Gly Thr Met Val Arg Thr Ser Thr Cys Thr Tyr Thr His Trp His Thr

225 230 235

Ile Ser Thr Thr Ser Lys Arg Thr Ser Thr Ile Thr Val Tyr Ile Ser

240 245 250

Thr Cys Leu Ser Ser Asn Pro Pro Val Thr Ser Ser Ser Thr Gln Ser

255 260 265 270

Ile Ser Ser Leu Ile Thr Ser Pro Thr Leu Val Ser Thr Ser Ser Val

275 280 285

Ile Thr Thr Ser Ser Thr Ser Gln Tyr Ser Ser Ser Thr Ser Cys Thr

290 295 300

Tyr Thr Lys Ser Ser Asn Thr Thr Ile Pro Trp Ser Pro Pro Thr Ser

305 310 315

Met Ser Ile Thr Ser Ser Ser Cys Thr Arg Ser Ser Asp Trp Thr Thr

320 325 330

Pro Lys Pro Pro Pro Ser Thr Ser Thr Thr Ile Gln Thr Thr Gln Thr

335 340 345 350

Pro Asp Thr Ile Thr Lys Ser Asn Thr Pro Thr Thr Thr Lys Thr Thr

355 360 365

Thr Lys Ile Ser Ile Ser Ile Ser Thr Pro Trp Asn Thr Thr Cys Thr

370 375 380

Ser Ser Thr Asn Ser Thr Thr Ser Thr Pro Gln Thr Thr His Thr Ala

385 390 395

Thr Glu Pro Pro Thr Ser Ser Ile Ile Ala Ile Ser Ser Ser Ser Asn

400 405 410

Pro

415

<210>23

<211>1179

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1179)

<220>

<221>sig_peptide

<222>(1)..(48)

<220>

<221>mat_peptide

<222>(49)..(1179)

<400>23

atg ctt aag cac atc acc ctt gcg gca ttg gcc tcg atg gcc ttt gcc 48

Met Leu Lys His Ile Thr Leu Ala Ala Leu Ala Ser Met Ala Phe Ala

-15 -10 -5 -1

cag aca caa gac ctc aat gcc aca ctc agc ggc att ccc gag ctg tcc 96

Gln Thr Gln Asp Leu Asn Ala Thr Leu Ser Gly Ile Pro Glu Leu Ser

1 5 10 15

aat cta acg tca tac tac atc tcg ctc cct gac tcc ctg agc gcg ttg 144

Asn Leu Thr Ser Tyr Tyr Ile Ser Leu Pro Asp Ser Leu Ser Ala Leu

20 25 30

tcg gct gcc agg aac atc acc atc ctg gcg cct agt aac aat gcc ttc 192

Ser Ala Ala Arg Asn Ile Thr Ile Leu Ala Pro Ser Asn Asn Ala Phe

35 40 45

gag cag ctg ttg agc agc ccc ctc ggc gcg gcg ctg acc aac gac ccg 240

Glu Gln Leu Leu Ser Ser Pro Leu Gly Ala Ala Leu Thr Asn Asp Pro

50 55 60

gat ctc gtc caa gcc atg ctt acc tac cac gtg ctc aac ggc agc tac 288

Asp Leu Val Gln Ala Met Leu Thr Tyr His Val Leu Asn Gly Ser Tyr

65 70 75 80

agc tcg agc cag atc act gag gac agt caa ttc atc ccc act ctc ctg 336

Ser Ser Ser Gln Ile Thr Glu Asp Ser Gln Phe Ile Pro Thr Leu Leu

85 90 95

acc gac cct agg tat acc aat gtt acc ggc ggt cag cgg gtt gag gtg 384

Thr Asp Pro Arg Tyr Thr Asn Val Thr Gly Gly Gln Arg Val Glu Val

100 105 110

gag aaa gag gat ggt aac gac gtc ttt tac tcg ggg ctg cgg cag aat 432

Glu Lys Glu Asp Gly Asn Asp Val Phe Tyr Ser Gly Leu Arg Gln Asn

115 120 125

ctg act ttg gga cga agt gac atc aac ttc acc ggc ggt tac atc cac 480

Leu Thr Leu Gly Arg Ser Asp Ile Asn Phe Thr Gly Gly Tyr Ile His

130 135 140

atc att gac acc gtc ctc acg ctg cca cca aac gtc agc tcg acg gcc 528

Ile Ile Asp Thr Val Leu Thr Leu Pro Pro Asn Val Ser Ser Thr Ala

145 150 155 160

gtg gcc acg aac ctg acg gcg ctc gtc ggg gcg ctg acc aac gcc agc 576

Val Ala Thr Asn Leu Thr Ala Leu Val Gly Ala Leu Thr Asn Ala Ser

165 170 175

ctg gtc ggg gcg gtc gac acg acg ccg gac gtg acc atc ttc gcg ccg 624

Leu Val Gly Ala Val Asp Thr Thr Pro Asp Val Thr Ile Phe Ala Pro

180 185 190

gcc aac gac gca ttc gct gcc atc ggc tca gtg ctc gac ggc acg tca 672

Ala Asn Asp Ala Phe Ala Ala Ile Gly Ser Val Leu Asp Gly Thr Ser

195 200 205

tcg gac gac ctg tcg aac ctg ctc agc tac cac gtc gtc aac ggc acc 720

Ser Asp Asp Leu Ser Asn Leu Leu Ser Tyr His Val Val Asn Gly Thr

210 215 220

gtc gcg tac tcg tcg gac ctc cag ggc aac cag acg gtc acg gcg ctc 768

Val Ala Tyr Ser Ser Asp Leu Gln Gly Asn Gln Thr Val Thr Ala Leu

225 230 235 240

aac ggc ggc gac ctg acg atc cgc gtg ctg gac gac ggc gac gtc ttc 816

Asn Gly Gly Asp Leu Thr Ile Arg Val Leu Asp Asp Gly Asp Val Phe

245 250 255

gtc aac ggc gcg cgc gtg atc att ccg gac atc ctg gtg gcg aac ggt 864

Val Asn Gly Ala Arg Val Ile Ile Pro Asp Ile Leu Val Ala Asn Gly

260 265 270

gtg gtg cat gtc atc gac aac gtc ctc aac ccc tcc aat tcc acg tcc 912

Val Val His Val Ile Asp Asn Val Leu Asn Pro Ser Asn Ser Thr Ser

275 280 285

ggc ccc agc gac gag aac gac gac agc gga gac gtc cag tac acc ggc 960

Gly Pro Ser Asp Glu Asn Asp Asp Ser Gly Asp Val Gln Tyr Thr Gly

290 295 300

gcc acg tcc gcg acc aac gtg ccc ttc act tcc ggc gtg gcc acg gca 1008

Ala Thr Ser Ala Thr Asn Val Pro Phe Thr Ser Gly Val Ala Thr Ala

305 310 315 320

acg gcg acc gtc ggc gtc acc ggc acc ggc ggt ggt ggt ggt gcg acg 1056

Thr Ala Thr Val Gly Val Thr Gly Thr Gly Gly Gly Gly Gly Ala Thr

325 330 335

ggc acg gcg acg ggc act ggt ggt gcc gcg agc gcg agc gcc tcg ggt 1104

Gly Thr Ala Thr Gly Thr Gly Gly Ala Ala Ser Ala Ser Ala Ser Gly

340 345 350

gct gcc gct ggt gtt ggg ctg agt ggt ggg ttg atg ggt gtg gcc ctc 1152

Ala Ala Ala Gly Val Gly Leu Ser Gly Gly Leu Met Gly Val Ala Leu

355 360 365

gcg ttg ggt gca gtc ctg tcg ccg ttg 1179

Ala Leu Gly Ala Val Leu Ser Pro Leu

370 375

<210>24

<211>393

<212>PRT

<213>Botryosphaeria rhodina

<400>24

Met Leu Lys His Ile Thr Leu Ala Ala Leu Ala Ser Met Ala Phe Ala

-15 -10 -5 -1

Gln Thr Gln Asp Leu Asn Ala Thr Leu Ser Gly Ile Pro Glu Leu Ser

1 5 10 15

Asn Leu Thr Ser Tyr Tyr Ile Ser Leu Pro Asp Ser Leu Ser Ala Leu

20 25 30

Ser Ala Ala Arg Asn Ile Thr Ile Leu Ala Pro Ser Asn Asn Ala Phe

35 40 45

Glu Gln Leu Leu Ser Ser Pro Leu Gly Ala Ala Leu Thr Asn Asp Pro

50 55 60

Asp Leu Val Gln Ala Met Leu Thr Tyr His Val Leu Asn Gly Ser Tyr

65 70 75 80

Ser Ser Ser Gln Ile Thr Glu Asp Ser Gln Phe Ile Pro Thr Leu Leu

85 90 95

Thr Asp Pro Arg Tyr Thr Asn Val Thr Gly Gly Gln Arg Val Glu Val

100 105 110

Glu Lys Glu Asp Gly Asn Asp Val Phe Tyr Ser Gly Leu Arg Gln Asn

115 120 125

Leu Thr Leu Gly Arg Ser Asp Ile Asn Phe Thr Gly Gly Tyr Ile His

130 135 140

Ile Ile Asp Thr Val Leu Thr Leu Pro Pro Asn Val Ser Ser Thr Ala

145 150 155 160

Val Ala Thr Asn Leu Thr Ala Leu Val Gly Ala Leu Thr Asn Ala Ser

165 170 175

Leu Val Gly Ala Val Asp Thr Thr Pro Asp Val Thr Ile Phe Ala Pro

180 185 190

Ala Asn Asp Ala Phe Ala Ala Ile Gly Ser Val Leu Asp Gly Thr Ser

195 200 205

Ser Asp Asp Leu Ser Asn Leu Leu Ser Tyr His Val Val Asn Gly Thr

210 215 220

Val Ala Tyr Ser Ser Asp Leu Gln Gly Asn Gln Thr Val Thr Ala Leu

225 230 235 240

Asn Gly Gly Asp Leu Thr Ile Arg Val Leu Asp Asp Gly Asp Val Phe

245 250 255

Val Asn Gly Ala Arg Val Ile Ile Pro Asp Ile Leu Val Ala Asn Gly

260 265 270

Val Val His Val Ile Asp Asn Val Leu Asn Pro Ser Asn Ser Thr Ser

275 280 285

Gly Pro Ser Asp Glu Asn Asp Asp Ser Gly Asp Val Gln Tyr Thr Gly

290 295 300

Ala Thr Ser Ala Thr Asn Val Pro Phe Thr Ser Gly Val Ala Thr Ala

305 310 315 320

Thr Ala Thr Val Gly Val Thr Gly Thr Gly Gly Gly Gly Gly Ala Thr

325 330 335

Gly Thr Ala Thr Gly Thr Gly Gly Ala Ala Ser Ala Ser Ala Ser Gly

340 345 350

Ala Ala Ala Gly Val Gly Leu Ser Gly Gly Leu Met Gly Val Ala Leu

355 360 365

Ala Leu Gly Ala Val Leu Ser Pro Leu

370 375

<210>25

<211>846

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(846)

<220>

<221>sig_peptide

<222>(1)..(69)

<220>

<221>mat_peptide

<222>(70)..(846)

<400>25

atg cgt ttc aca aag acc act cct ctc ctc ctt atc gcc acc acc ttt 48

Met Arg Phe Thr Lys Thr Thr Pro Leu Leu Leu Ile Ala Thr Thr Phe

-20 -15 -10

tcc ctc acc tac gcc gcc gct ctc ccg cct gat gac caa cga ctc cct 96

Ser Leu Thr Tyr Ala Ala Ala Leu Pro Pro Asp Asp Gln Arg Leu Pro

-5 -1 1 5

cag cct gtg act gac aac aag gac gcc gcc cca ttc aac ttt aac acc 144

Gln Pro Val Thr Asp Asn Lys Asp Ala Ala Pro Phe Asn Phe Asn Thr

10 15 20 25

gac ggc aac ggc aaa ttc tat tac aat ggg ggc ggc gac gat gac aat 192

Asp Gly Asn Gly Lys Phe Tyr Tyr Asn Gly Gly Gly Asp Asp Asp Asn

30 35 40

gac gac gac gac gac gat gat gat gac gat gac gac cag ttc gag gcc 240

Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Gln Phe Glu Ala

45 50 55

cca gac tgc gac gac gca gaa gat gtg ttg gag gga gag tgc ggc aat 288

Pro Asp Cys Asp Asp Ala Glu Asp Val Leu Glu Gly Glu Cys Gly Asn

60 65 70

ctc ctc aac ggt gaa ggc cgt ccc gtg ctg gag ggt gac ggc agt gta 336

Leu Leu Asn Gly Glu Gly Arg Pro yal Leu Glu Gly Asp Gly Ser Val

75 80 85

gcg cag aag ggg gct ccg ccg cgc aag gag cgc atc aag gtg cgc agg 384

Ala Gln Lys Gly Ala Pro Pro Arg Lys Glu Arg Ile Lys Val Arg Arg

90 95 100 105

agc ctg aag ctt cat cgt ctt cgt cgt cgc aat gcc atc aag gac gat 432

Ser Leu Lys Leu His Arg Leu Arg Arg Arg Asn Ala Ile Lys Asp Asp

110 115 120

gat cat gat cac gac gac aaa gac gac cac gac cat gac cat gat gac 480

Asp His Asp His Asp Asp Lys Asp Asp His Asp His Asp His Asp Asp

125 130 135

gac acg ccg gcg gag aag gct cgc gag aag gag gaa gac cgt ctc gaa 528

Asp Thr Pro Ala Glu Lys Ala Arg Glu Lys Glu Glu Asp Arg Leu Glu

140 145 150

gac ctg cgg gat gcc gag gag gag gct ttg gag aag ttg aag aag ggc 576

Asp Leu Arg Asp Ala Glu Glu Glu Ala Leu Glu Lys Leu Lys Lys Gly

155 160 165

ccg aat cat cgc cgc gat gaa gac gac tcc cca gcg gag cgg gct cgt 624

Pro Asn His Arg Arg Asp Glu Asp Asp Ser Pro Ala Glu Arg Ala Arg

170 175 180 185

gag aag gaa gag gac aag aag gaa gat ttg cgg gat gcg gag gag gac 672

Glu Lys Glu Glu Asp Lys Lys Glu Asp Leu Arg Asp Ala Glu Glu Asp

190 195 200

cgc ttg gag cgt gag cgc aag aag cag ggt aag ggg cat cca cac gac 720

Arg Leu Glu Arg Glu Arg Lys Lys Gln Gly Lys Gly His Pro His Asp

205 210 215

gat gac gac gac gat gat gat act cct gag gag aaa gcc cgc gaa cgc 768

Asp Asp Asp Asp Asp Asp Asp Thr Pro Glu Glu Lys Ala Arg Glu Arg

220 225 230

gaa gaa gat cgg ctc gag gac ctg cgt gat gcg gag gac ccg tta gtg 816

Glu Glu Asp Arg Leu Glu Asp Leu Arg Asp Ala Glu Asp Pro Leu Val

235 240 245

cga atg caa agg cgg cgc caa cca tct tgc 846

Arg Met Gln Arg Arg Arg Gln Pro Ser Cys

250 255

<210>26

<211>282

<212>PRT

<213>Botryosphaeria rhodina

<400>26

Met Arg Phe Thr Lys Thr Thr Pro Leu Leu Leu Ile Ala Thr Thr Phe

-20 -15 -10

Ser Leu Thr Tyr Ala Ala Ala Leu Pro Pro Asp Asp Gln Arg Leu Pro

-5 -1 1 5

Gln Pro Val Thr Asp Asn Lys Asp Ala Ala Pro Phe Asn Phe Asn Thr

10 15 20 25

Asp Gly Asn Gly Lys Phe Tyr Tyr Asn Gly Gly Gly Asp Asp Asp Asn

30 35 40

Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Asp Gln Phe Glu Ala

45 50 55

Pro Asp Cys Asp Asp Ala Glu Asp Val Leu Glu Gly Glu Cys Gly Asn

60 65 70

Leu Leu Asn Gly Glu Gly Arg Pro Val Leu Glu Gly Asp Gly Ser Val

75 80 85

Ala Gln Lys Gly Ala Pro Pro Arg Lys Glu Arg Ile Lys Val Arg Arg

90 95 100 105

Ser Leu Lys Leu His Arg Leu Arg Arg Arg Asn Ala Ile Lys Asp Asp

110 115 120

Asp His Asp His Asp Asp Lys Asp Asp His Asp His Asp His Asp Asp

125 130 135

Asp Thr Pro Ala Glu Lys Ala Arg Glu Lys Glu Glu Asp Arg Leu Glu

140 145 150

Asp Leu Arg Asp Ala Glu Glu Glu Ala Leu Glu Lys Leu Lys Lys Gly

155 160 165

Pro Asn His Arg Arg Asp Glu Asp Asp Ser Pro Ala Glu Arg Ala Arg

170 175 180 185

Glu Lys Glu Glu Asp Lys Lys Glu Asp Leu Arg Asp Ala Glu Glu Asp

190 195 200

Arg Leu Glu Arg Glu Arg Lys Lys Gln Gly Lys Gly His Pro His Asp

205 210 215

Asp Asp Asp Asp Asp Asp Asp Thr Pro Glu Glu Lys Ala Arg Glu Arg

220 225 230

Glu Glu Asp Arg Leu Glu Asp Leu Arg Asp Ala Glu Asp Pro Leu Val

235 240 245

Arg Met Gln Arg Arg Arg Gln Pro Ser Cys

250 255

<210>27

<211>801

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(801)

<220>

<221>sig_peptide

<222>(1)..(57)

<220>

<221>misc_feature

<222>(1)..(801)

＜223〉propetide

<220>

<221>mat_peptide

<222>(58)..(801)

<220>

<221>misc_feature

<222>(729)..(798)

＜223〉transmembrane peptides

<400>27

atg cgc ttc ttc tcc acc atc gtc ggc gct gcc gcc ctc att tcg agc 48

Met Arg Phe Phe Ser Thr Ile Val Gly Ala Ala Ala Leu Ile Ser Ser

-15 -10 -5

gtc gtt gct cag gac ctc ggc atc acc aag gct ccc tcc tct gtc cag 96

Val Val Ala Gln Asp Leu Gly Ile Thr Lys Ala Pro Ser Ser Val Gln

-1 1 5 10

gcc ggc caa acc tac acc att gag tac act gcg ccg gct ggc gcc gct 144

Ala Gly Gln Thr Tyr Thr Ile Glu Tyr Thr Ala Pro Ala Gly Ala Ala

15 20 25

gtg tct ctc atc ctg cgc aag ggt gac ccc aac aac ctg gac act ctc 192

Val Ser Leu Ile Leu Arg Lys Gly Asp Pro Asn Asn Leu Asp Thr Leu

30 35 40 45

act acc ctg acc tcc aat gcc gaa ggc ggt tct tac gag tgg act gtg 240

Thr Thr Leu Thr Ser Asn Ala Glu Gly Gly Ser Tyr Glu Trp Thr Val

50 55 60

gcc agc agc cta gag agc gac gac gac tac gcc atc gag att aag cag 288

Ala Ser Ser Leu Glu Ser Asp Asp Asp Tyr Ala Ile Glu Ile Lys Gln

65 70 75

ggc gac gac aac aac tac ttc ggc ccc ttc agc ctc acc ggt ggt tcc 336

Gly Asp Asp Asn Asn Tyr Phe Gly Pro Phe Ser Leu Thr Gly Gly Ser

80 85 90

gcc tcg gcc tct tcg gca tct tcc agc tcc tct gct tct gct tct gcc 384

Ala Ser Ala Ser Ser Ala Ser Ser Ser Ser Ser Ala Ser Ala Ser Ala

95 100 105

tct tct tcg gcc tct gcc tct gcc tct gcg tcc gcg tct gct tcg gcc 432

Ser Ser Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala

110 115 120 125

tct gcc tcg gct tct ggc tcc gcc agc tcg acc gag agc tcc acc atc 480

Ser Ala Ser Ala Ser Gly Ser Ala Ser Ser Thr Glu Ser Ser Thr Ile

130 135 140

act gcc agc gcc tcg ctc tcc tcg gct gcc tcc tcg ctg tcc tcg ctg 528

Thr Ala Ser Ala Ser Leu Ser Ser Ala Ala Ser Ser Leu Ser Ser Leu

145 150 155

atc tcg gcc gcc aac tcg acc ctg gcc tcc atc acc agc tcg aac gcg 576

Ile Ser Ala Ala Asn Ser Thr Leu Ala Ser Ile Thr Ser Ser Asn Ala

160 165 170

act gcc acc agc agc aag ccg tcc aac ggc act atc agc agc acc ctg 624

Thr Ala Thr Ser Ser Lys Pro Ser Asn Gly Thr Ile Ser Ser Thr Leu

175 180 185

cac agc tcg act gcc acc tcc acc tcg tcg tcg tcg tct gag ggc tcg 672

His Ser Ser Thr Ala Thr Ser Thr Ser Ser Ser Ser Ser Glu Gly Ser

190 195 200 205

agc tcc tcc ggc gcg tcc gag act gcc agc tcg act ggc ggc gcc cct 720

Ser Ser Ser Gly Ala Ser Glu Thr Ala Ser Ser Thr Gly Gly Ala Pro

210 215 220

acc tcc ggt gcc gcc atg ccc agc atg gtc agc ccc atc gcg ctc gtc 768

Thr Ser Gly Ala Ala Met Pro Ser Met Val Ser Pro Ile Ala Leu Val

225 230 235

ctc ggc gcc gtt gct gcc atg atc ttc ctc aac 801

Leu Gly Ala Val Ala Ala Met Ile Phe Leu Asn

240 245

<210>28

<211>267

<212>PRT

<213>Botryosphaeria rhodina

<400>28

Met Arg Phe Phe Ser Thr Ile Val Gly Ala Ala Ala Leu Ile Ser Ser

-15 -10 -5

Val Val Ala Gln Asp Leu Gly Ile Thr Lys Ala Pro Ser Ser Val Gln

-1 1 5 10

Ala Gly Gln Thr Tyr Thr Ile Glu Tyr Thr Ala Pro Ala Gly Ala Ala

15 20 25

Val Ser Leu Ile Leu Arg Lys Gly Asp Pro Asn Asn Leu Asp Thr Leu

30 35 40 45

Thr Thr Leu Thr Ser Asn Ala Glu Gly Gly Ser Tyr Glu Trp Thr Val

50 55 60

Ala Ser Ser Leu Glu Ser Asp Asp Asp Tyr Ala Ile Glu Ile Lys Gln

65 70 75

Gly Asp Asp Asn Asn Tyr Phe Gly Pro Phe Ser Leu Thr Gly Gly Ser

80 85 90

Ala Ser Ala Ser Ser Ala Ser Ser Ser Ser Ser Ala Ser Ala Ser Ala

95 100 105

Ser Ser Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala Ser Ala

110 115 120 125

Ser Ala Ser Ala Ser Gly Ser Ala Ser Ser Thr Glu Ser Ser Thr Ile

130 135 140

Thr Ala Ser Ala Ser Leu Ser Ser Ala Ala Ser Ser Leu Ser Ser Leu

145 150 155

Ile Ser Ala Ala Asn Ser Thr Leu Ala Ser Ile Thr Ser Ser Asn Ala

160 165 170

Thr Ala Thr Ser Ser Lys Pro Ser Asn Gly Thr Ile Ser Ser Thr Leu

115 180 185

His Ser Ser Thr Ala Thr Ser Thr Ser Ser Ser Ser Ser Glu Gly Ser

190 195 200 205

Ser Ser Ser Gly Ala Ser Glu Thr Ala Ser Ser Thr Gly Gly Ala Pro

210 215 220

Thr Ser Gly Ala Ala Met Pro Ser Met Val Ser Pro Ile Ala Leu Val

225 230 235

Leu Gly Ala Val Ala Ala Met Ile Phe Leu Asn

240 245

<210>29

<211>1065

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>misc_feature

<222>(1)..(1065)

<223>cDNA

<220>

<221>CDS

<222>(109)..(603)

<220>

<221>transit_peptide

<222>(109)..(156)

<220>

<221>misc_feature

<222>(109)..(603)

＜223〉propetide

<220>

<221>mat_peptide

<222>(157)..(603)

<400>29

ggcacgaggc accataatca ctatcagaac ccaaaccagt cgtttctgat atcaaaccct 60

catctaaacc tcatctcaaa ccaaccgaaa aggaccaata aaaccaac atg atg caa 117

Met Met Gln

-15

ttc ctc act gtc gcc gcc ctc ttc acc acc gcc gcc ttc gcc tct ccc 165

Phe Leu Thr Val Ala Ala Leu Phe Thr Thr Ala Ala Phe Ala Ser Pro

-10 -5 -1 1

atc gca cag gct ccc aac acc cca cct gcc ggc act ccc gtc tac act 213

Ile Ala Gln Ala Pro Asn Thr Pro Pro Ala Gly Thr Pro Val Tyr Thr

5 10 15

ccg gcc agc acc ccg atc tac tac ccc ctc aac act ccg gtc aac acg 261

Pro Ala Ser Thr Pro Ile Tyr Tyr Pro Leu Asn Thr Pro Val Asn Thr

20 25 30 35

cca gtc gcc act ccc ggc agc ggc agc ggc ccc ggc ttc atc ggc ggc 309

Pro Val Ala Thr Pro Gly Ser Gly Ser Gly Pro Gly Phe Ile Gly Gly

40 45 50

ggc tac aac agc ctc ccc gtc tgc ggc ccg cac gcc tac gac ccg cgc 357

Gly Tyr Asn Ser Leu Pro Val Cys Gly Pro His Ala Tyr Asp Pro Arg

55 60 65

gcc ttc cac tgc tac gac agc agc gtc ggc tac ggc ggc cag acg tac 405

Ala Phe His Cys Tyr Asp Ser Ser Val Gly Tyr Gly Gly Gln Thr Tyr

70 75 80

acc aac atc ctg tgc ccg ctg cag aac ggc gag ccg ctg gcc gcc tgc 453

Thr Asn Ile Leu Cys Pro Leu Gln Asn Gly Glu Pro Leu Ala Ala Cys

85 90 95

ggc ccg agc tgc tac gac ccg gag atc ttc acc tgc ggc gcc gac ggc 501

Gly Pro Ser Cys Tyr Asp Pro Glu Ile Phe Thr Cys Gly Ala Asp Gly

100 105 110 115

atc ctg tct gtc gcc ggc cag tac gcc acc ccc gcc gcc gct acc ccg 549

Ile Leu Ser Val Ala Gly Gln Tyr Ala Thr Pro Ala Ala Ala Thr Pro

120 125 130

atg act ccg gcc ggc gtc ttc cct ccg gcc ggc gcg acg ccg acg ggg 597

Met Thr Pro Ala Gly Val Phe Pro Pro Ala Gly Ala Thr Pro Thr Gly

135 140 145

ggc ctc taagcgggat cgtccggaat gacgatcagc tcaagcatgt gtgagcgaga 653

Gly Leu

gagacagagc atagctactg cgtattaaaa gctgtgaaga ggtgacacgg caatgcacgt 713

tcgtcttggg catttctttt ggggtttcat ggcgtaggat gctgggcgct tcttgggtgg 773

tcttatgagc atttaacgtt ccttctacgc ttagagtggc tgcaacgttg atgaatgagg 833

ggggtgatgg tcgatcagtt gaccgttccg tgtgaaccgt gtcaaacacg tcacacgtcg 893

ccatgagtcg accacgtcgt tgatgtgcaa aagaacatcg aggatgcaac aaggaaatga 953

ttaatggaca tcatgtttta agtacataaa gggagatcat gggtagacta aacgaaaagc 1013

cccctctaat gttaatattt ctcatcttaa aaaaaaaaga ttcatttgtc tc 1065

<210>30

<211>165

<212>PRT

<213>Botryosphaeria rhodina

<400>30

Met Met Gln Phe Leu Thr Val Ala Ala Leu Phe Thr Thr Ala Ala Phe

-15 -10 -5 -1

Ala Ser Pro Ile Ala Gln Ala Pro Asn Thr Pro Pro Ala Gly Thr Pro

1 5 10 15

Val Tyr Thr Pro Ala Ser Thr Pro Ile Tyr Tyr Pro Leu Asn Thr Pro

20 25 30

Val Asn Thr Pro Val Ala Thr Pro Gly Ser Gly Ser Gly Pro Gly Phe

35 40 45

Ile Gly Gly Gly Tyr Asn Ser Leu Pro Val Cys Gly Pro His Ala Tyr

50 55 60

Asp Pro Arg Ala Phe His Cys Tyr Asp Ser Ser Val Gly Tyr Gly Gly

65 70 75 80

Gln Thr Tyr Thr Asn Ile Leu Cys Pro Leu Gln Asn Gly Glu Pro Leu

85 90 95

Ala Ala Cys Gly Pro Ser Cys Tyr Asp Pro Glu Ile Phe Thr Cys Gly

100 105 110

Ala Asp Gly Ile Leu Ser Val Ala Gly Gln Tyr Ala Thr Pro Ala Ala

115 120 125

Ala Thr Pro Met Thr Pro Ala Gly Val Phe Pro Pro Ala Gly Ala Thr

130 135 140

Pro Thr Gly Gly Leu

145

<210>31

<211>660

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(660)

<220>

<221>transit_peptide

<222>(1)..(54)

<220>

<221>misc_feature

<222>(1)..(660)

＜223〉propetide

<220>

<221>mat_peptide

<222>(55)..(660)

<400>31

atg aag act ttc gca ttc gcc acc gtg gct gcg ctc agc gct gtt gct 48

Met Lys Thr Phe Ala Phe Ala Thr Val Ala Ala Leu Ser Ala Val Ala

-15 -10 -5

acc gcc caa gac ttg ggg ctg ttg ctc tca tcc tgc gcc tcc gat caa 96

Thr Ala Gln Asp Leu Gly Leu Leu Leu Ser Ser Cys Ala Ser Asp Gln

-1 1 5 10

ttt cag gaa ctt gga ttg acc gga gtc gac ggt gat ccg tgc aag agc 144

Phe Gln Glu Leu Gly Leu Thr Gly Val Asp Gly Asp Pro Cys Lys Ser

15 20 25 30

gat gcg ggc aaa tct tcg tac tat gag tgc tcc tgc acc aag ggt cag 192

Asp Ala Gly Lys Ser Ser Tyr Tyr Glu Cys Ser Cys Thr Lys Gly Gln

35 40 45

gag ttt gtc gtc gat tac ctc tgc aaa aac cct gga tcc tgc agc ccc 240

Glu Phe Val Val Asp Tyr Leu Cys Lys Asn Pro Gly Ser Cys Ser Pro

50 55 60

agc gac atc cct ggc ttg acg gat act ctc gtc agc ttc tgc aaa tcg 288

Ser Asp Ile Pro Gly Leu Thr Asp Thr Leu Val Ser Phe Cys Lys Ser

65 70 75

gtc ggt gtc acc gtc aca gct ccc tcg aac ccg tgc ggt ctc tcc ggc 336

Val Gly Val Thr Val Thr Ala Pro Ser Asn Pro Cys Gly Leu Ser Gly

80 85 90

ggt agt agc tct tct gct cct gcg tcc tct gcc aca tcc gct ccc gcc 384

Gly Ser Ser Ser Ser Ala Pro Ala Ser Ser Ala Thr Ser Ala Pro Ala

95 100 105 110

acg tcc gcc cct agt tct tca cct gca tcg tcg cca gcc tcc tcg gcg 432

Thr Ser Ala Pro Ser Ser Ser Pro Ala Ser Ser Pro Ala Ser Ser Ala

115 120 125

gct tcc tcc gca gcg agc tct gcc ccg agc tat gcc ccc agc tcc gct 480

Ala Ser Ser Ala Ala Ser Ser Ala Pro Ser Tyr Ala Pro Ser Ser Ala

130 135 140

gca tca tct cct ccg gcc aca act ccc gcc ggt aca ccc act acc ccg 528

Ala Ser Ser Pro Pro Ala Thr Thr Pro Ala Gly Thr Pro Thr Thr Pro

145 150 155

gct gga acc cct tat ggt act cca gtc ggc acc ccg gcc agc act ccg 576

Ala Gly Thr Pro Tyr Gly Thr Pro Val Gly Thr Pro Ala Ser Thr Pro

160 165 170

gct gcc tac act ggt gca gct gca gtt aaa aac gtg gct ggt ggt ctc 624

Ala Ala Tyr Thr Gly Ala Ala Ala Val Lys Asn Val Ala Gly Gly Leu

175 180 185 190

gtc ggt gtg gct ggt ttt gct ggc ctc ttc ttc ctc 660

Val Gly Val Ala Gly Phe Ala Gly Leu Phe Phe Leu

195 200

<210>32

<211>220

<212>PRT

<213>Botryosphaeria rhodina

<400>32

Met Lys Thr Phe Ala Phe Ala Thr Val Ala Ala Leu Ser Ala Val Ala

-15 -10 -5

Thr Ala Gln Asp Leu Gly Leu Leu Leu Ser Ser Cys Ala Ser Asp Gln

-1 1 5 10

Phe Gln Glu Leu Gly Leu Thr Gly Val Asp Gly Asp Pro Cys Lys Ser

15 20 25 30

Asp Ala Gly Lys Ser Ser Tyr Tyr Glu Cys Ser Cys Thr Lys Gly Gln

35 40 45

Glu Phe Val Val Asp Tyr Leu Cys Lys Asn Pro Gly Ser Cys Ser Pro

50 55 60

Ser Asp Ile Pro Gly Leu Thr Asp Thr Leu Val Ser Phe Cys Lys Ser

65 70 75

Val Gly Val Thr Val Thr Ala Pro Ser Asn Pro Cys Gly Leu Ser Gly

80 85 90

Gly Ser Ser Ser Ser Ala Pro Ala Ser Ser Ala Thr Ser Ala Pro Ala

95 100 105 110

Thr Ser Ala Pro Ser Ser Ser Pro Ala Ser Ser Pro Ala Ser Ser Ala

115 120 125

Ala Ser Ser Ala Ala Ser Ser Ala Pro Ser Tyr Ala Pro Ser Ser Ala

130 135 140

Ala Ser Ser Pro Pro Ala Thr Thr Pro Ala Gly Thr Pro Thr Thr Pro

145 150 155

Ala Gly Thr Pro Tyr Gly Thr Pro Val Gly Thr Pro Ala Ser Thr Pro

160 165 170

Ala Ala Tyr Thr Gly Ala Ala Ala Val Lys Asn Val Ala Gly Gly Leu

175 180 185 190

Val Gly Val Ala Gly Phe Ala Gly Leu Phe Phe Leu

195 200

<210>33

<211>1854

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1854)

<220>

<221>sig_peptide

<222>(1)..(45)

<220>

<221>mat_peptide

<222>(46)..(1854)

<400>33

atg tct ttg ctt ttg ctg ctc agc agc ggc gct att gcg ctc gca caa 48

Met Ser Leu Leu Leu Leu Leu Ser Ser Gly Ala Ile Ala Leu Ala Gln

-15 -10 -5 -1 1

cag gtc tat gtg tct gct gat gga cct gct caa tgc acc gca agc cag 96

Gln Val Tyr Val Ser Ala Asp Gly Pro Ala Gln Cys Thr Ala Ser Gln

5 10 15

act tat tct gcg act tac gct tct ccg acc tat gcc ttc agc aac ttt 144

Thr Tyr Ser Ala Thr Tyr Ala Ser Pro Thr Tyr Ala Phe Ser Asn Phe

20 25 30

tcg ttc acg caa acg gag acg gtc cgg act gct acc tca gtc aag tct 192

Ser Phe Thr Gln Thr Glu Thr Val Arg Thr Ala Thr Ser Val Lys Ser

35 40 45

gcg cca gtc aca act tac gcc ccg cca tac gca tcc ctc agc cac ctg 240

Ala Pro Val Thr Thr Tyr Ala Pro Pro Tyr Ala Ser Leu Ser His Leu

50 55 60 65

gtt cca gat ctg agc aca acg aca tgg gga aac tgg gat ccc aat gcc 288

Val Pro Asp Leu Ser Thr Thr Thr Trp Gly Asn Trp Asp Pro Asn Ala

70 75 80

acg gca act gcc acc gat acc gcc gac ccc tac gga cag gct gcg tgg 336

Thr Ala Thr Ala Thr Asp Thr Ala Asp Pro Tyr Gly Gln Ala Ala Trp

85 90 95

tct gct ttg tgg gaa cat gcc agt ctc gcc aac ttt acc ttc agg ggt 384

Ser Ala Leu Trp Glu His Ala Ser Leu Ala Asn Phe Thr Phe Arg Gly

100 105 110

ctt tac tca aca acc gtc tcc cca act ccg gtg cct act agt gaa ctt 432

Leu Tyr Ser Thr Thr Val Ser Pro Thr Pro Val Pro Thr Ser Glu Leu

115 120 125

gtt ctg ccg cct cca gaa tat ttc act ccc cag gac tgc tct tac ttc 480

Val Leu Pro Pro Pro Glu Tyr Phe Thr Pro Gln Asp Cys Ser Tyr Phe

130 135 140 145

cca gac gac ttc atg ttc gga gtt gca ggc tct gct tcc cag atc gaa 528

Pro Asp Asp Phe Met Phe Gly Val Ala Gly Ser Ala Ser Gln Ile Glu

150 155 160

ggg gcc atc gca gac gaa ggg aga aca ccc tct ctc atg gaa att ttg 576

Gly Ala Ile Ala Asp Glu Gly Arg Thr Pro Ser Leu Met Glu Ile Leu

165 170 175

atc tct cct tcg acc gga aaa ccc acc aac tac gtc aca aac gag aac 624

Ile Ser Pro Ser Thr Gly Lys Pro Thr Asn Tyr Val Thr Asn Glu Asn

180 185 190

tac tac ctg tac aag cag gat atc gag cgt ctg gct gct atg gga gtc 672

Tyr Tyr Leu Tyr Lys Gln Asp Ile Glu Arg Leu Ala Ala Met Gly Val

195 200 205

aag tac tat tct ttt act att ccg tgg tct cga atc ttg cca ttc gtg 720

Lys Tyr Tyr Ser Phe Thr Ile Pro Trp Ser Arg Ile Leu Pro Phe Val

210 215 220 225

ctt gaa ggc acc ccc ctc aac cag caa ggc ctG gac cac tac gac gat 768

Leu Glu Gly Thr Pro Leu Asn Gln Gln Gly Leu Asp His Tyr Asp Asp

230 235 240

ctc att aat ttt gtc ctt gag aag gga atg cag ccg act gtc acc ctg 816

Leu Ile Asn Phe Val Leu Glu Lys Gly Met Gln Pro Thr Val Thr Leu

245 250 255

atc cac ttc gac acg cct ctg cag ttc tac gga aac aac tta agc act 864

Ile His Phe Asp Thr Pro Leu Gln Phe Tyr Gly Asn Asn Leu Ser Thr

260 265 270

gct gcg gac cct cct ctt att ggt tac acc aac gga gct tat cag aat 912

Ala Ala Asp Pro Pro Leu Ile Gly Tyr Thr Asn Gly Ala Tyr Gln Asn

275 280 285

gag acg ttc gag gat gct ttc gtg aac tat ggc aag atc gtc atg act 960

Glu Thr Phe Glu Asp Ala Phe Val Asn Tyr Gly Lys Ile Val Met Thr

290 295 300 305

cac ttt gct gac cgt gtt cct gtc tgg ttc act ttc aat gaa ccc tta 1008

His Phe Ala Asp Arg Val Pro Val Trp Phe Thr Phe Asn Glu Pro Leu

310 315 320

ctc tat tgt gac aat ggc aag agt gta aac acg gtt gtc aaa gcc cat 1056

Leu Tyr Cys Asp Asn Gly Lys Ser Val Asn Thr Val Val Lys Ala His

325 330 335

gcc aga ctc tat cat ttc tat cac gag gag atc aac ggc acc ggc aag 1104

Ala Arg Leu Tyr His Phe Tyr His Glu Glu Ile Asn Gly Thr Gly Lys

340 345 350

gtt gga atc aag ttc aac gac aac ttt ggt gta cca cgc gac cct cag 1152

Val Gly Ile Lys Phe Asn Asp Asn Phe Gly Val Pro Arg Asp Pro Gln

355 360 365

gat tcc tcg gat gtg gac gcc gcg aac cat ttc aac gag ttt caa ctg 1200

Asp Ser Ser Asp Val Asp Ala Ala Asn His Phe Asn Glu Phe Gln Leu

370 375 380 385

gca aca ttt gcc aac cct atc ttc ctc ggg aag gat tac cct gag gcc 1248

Ala Thr Phe Ala Asn Pro Ile Phe Leu Gly Lys Asp Tyr Pro Glu Ala

390 395 400

ttc aag atg aca gtc ccc gat tat gtg ccg ctc tca cag gag gat ttg 1296

Phe Lys Met Thr Val Pro Asp Tyr Val Pro Leu Ser Gln Glu Asp Leu

405 410 415

gaa tac atc ggt ggt aca tca gac ttc ctc ggc atc gat ccc tac act 1344

Glu Tyr Ile Gly Gly Thr Ser Asp Phe Leu Gly Ile Asp Pro Tyr Thr

420 425 430

gcg aca gtc gta agc ccg ccg cct gat gga att gcg gtt tgc gca gcc 1392

Ala Thr Val Val Ser Pro Pro Pro Asp Gly Ile Ala Val Cys Ala Ala

435 440 445

aac aca tcc gac ccc ctc ttc ccc tac tgc gtc gag caa tca acc ttg 1440

Asn Thr Ser Asp Pro Leu Phe Pro Tyr Cys Val Glu Gln Ser Thr Leu

450 455 460 465

aca agc acc ggc tgg aac atc ggt tac cgt tcg cag acc tac gtc tac 1488

Thr Ser Thr Gly Trp Asn Ile Gly Tyr Arg Ser Gln Thr Tyr Val Tyr

470 475 480

atc acg ccc aag tac ctg cgc acc tac ctg tcc tat ctg tgg aac acc 1536

Ile Thr Pro Lys Tyr Leu Arg Thr Tyr Leu Ser Tyr Leu Trp Asn Thr

485 490 495

ttc cag cac cct gtc atg atc act gag ttt ggc tac cct gtg ttc ggc 1584

Phe Gln His Pro Val Met Ile Thr Glu Phe Gly Tyr Pro Val Phe Gly

500 505 510

gag gcg gac aag gaa gat ctc tcg gac cag ttg tac gac ctt cct cgc 1632

Glu Ala Asp Lys Glu Asp Leu Ser Asp Gln Leu Tyr Asp Leu Pro Arg

515 520 525

agc tac tac tac ctc tct ttc atg agt gag gtg ctc aag gca atc tgg 1680

Ser Tyr Tyr Tyr Leu Ser Phe Met Ser Glu Val Leu Lys Ala Ile Trp

530 535 540 545

gag gac aac gtc cac gtc ctt ggg gcg ttc gcg tgg agc ttt gcc gat 1728

Glu Asp Asn Val His Val Leu Gly Ala Phe Ala Trp Ser Phe Ala Asp

550 555 560

aac tgg gaa ttc ggt gac tac gcg caa caa ttt ggc att cag gtc gtc 1776

Asn Trp Glu Phe Gly Asp Tyr Ala Gln Gln Phe Gly Ile Gln Val Val

565 570 575

aac cgt acg acg caa gag agg tat tat aag aag agt ttc ttc gat ctg 1824

Asn Arg Thr Thr Gln Glu Arg Tyr Tyr Lys Lys Ser Phe Phe Asp Leu

580 585 590

gtg gac ttc gtg gcg gcg agg aca aag tct 1854

Val Asp Phe Val Ala Ala Arg Thr Lys Ser

595 600

<210>34

<211>618

<212>PRT

<213>Botryosphaeria rhodina

<400>34

Met Ser Leu Leu Leu Leu Leu Ser Ser Gly Ala Ile Ala Leu Ala Gln

-15 -10 -5 -1 1

Gln Val Tyr Val Ser Ala Asp Gly Pro Ala Gln Cys Thr Ala Ser Gln

5 10 15

Thr Tyr Ser Ala Thr Tyr Ala Ser Pro Thr Tyr Ala Phe Ser Asn Phe

20 25 30

Ser Phe Thr Gln Thr Glu Thr Val Arg Thr Ala Thr Ser Val Lys Ser

35 40 45

Ala Pro Val Thr Thr Tyr Ala Pro Pro Tyr Ala Ser Leu Ser His Leu

50 55 60 65

Val Pro Asp Leu Ser Thr Thr Thr Trp Gly Asn Trp Asp Pro Asn Ala

70 75 80

Thr Ala Thr Ala Thr Asp Thr Ala Asp Pro Tyr Gly Gln Ala Ala Trp

85 90 95

Ser Ala Leu Trp Glu His Ala Ser Leu Ala Asn Phe Thr Phe Arg Gly

100 105 110

Leu Tyr Ser Thr Thr Val Ser Pro Thr Pro Val Pro Thr Ser Glu Leu

115 120 125

Val Leu Pro Pro Pro Glu Tyr Phe Thr Pro Gln Asp Cys Ser Tyr Phe

130 135 140 145

Pro Asp Asp Phe Met Phe Gly Val Ala Gly Ser Ala Ser Gln Ile Glu

150 155 160

Gly Ala Ile Ala Asp Glu Gly Arg Thr Pro Ser Leu Met Glu Ile Leu

165 170 175

Ile Ser Pro Ser Thr Gly Lys Pro Thr Asn Tyr Val Thr Asn Glu Asn

180 185 190

Tyr Tyr Leu Tyr Lys Gln Asp Ile Glu Arg Leu Ala Ala Met Gly Val

195 200 205

Lys Tyr Tyr Ser Phe Thr Ile Pro Trp Ser Arg Ile Leu Pro Phe Val

210 215 220 225

Leu Glu Gly Thr Pro Leu Asn Gln Gln Gly Leu Asp His Tyr Asp Asp

230 235 240

Leu Ile Asn Phe Val Leu Glu Lys Gly Met Gln Pro Thr Val Thr Leu

245 250 255

Ile His Phe Asp Thr Pro Leu Gln Phe Tyr Gly Asn Asn Leu Ser Thr

260 265 270

Ala Ala Asp Pro Pro Leu Ile Gly Tyr Thr Asn Gly Ala Tyr Gln Asn

275 280 285

Glu Thr Phe Glu Asp Ala Phe Val Asn Tyr Gly Lys Ile Val Met Thr

290 295 300 305

His Phe Ala Asp Arg Val Pro Val Trp Phe Thr Phe Asn Glu Pro Leu

310 315 320

Leu Tyr Cys Asp Asn Gly Lys Ser Val Asn Thr Val Val Lys Ala His

325 330 335

Ala Arg Leu Tyr His Phe Tyr His Glu Glu Ile Asn Gly Thr Gly Lys

340 345 350

Val Gly Ile Lys Phe Asn Asp Asn Phe Gly Val Pro Arg Asp Pro Gln

355 360 365

Asp Ser Ser Asp Val Asp Ala Ala Asn His Phe Asn Glu Phe Gln Leu

370 375 380 385

Ala Thr Phe Ala Asn Pro Ile Phe Leu Gly Lys Asp Tyr Pro Glu Ala

390 395 400

Phe Lys Met Thr Val Pro Asp Tyr Val Pro Leu Ser Gln Glu Asp Leu

405 410 415

Glu Tyr Ile Gly Gly Thr Ser Asp Phe Leu Gly Ile Asp Pro Tyr Thr

420 425 430

Ala Thr Val Val Ser Pro Pro Pro Asp Gly Ile Ala Val Cys Ala Ala

435 440 445

Asn Thr Ser Asp Pro Leu Phe Pro Tyr Cys Val Glu Gln Ser Thr Leu

450 455 460 465

Thr Ser Thr Gly Trp Asn Ile Gly Tyr Arg Ser Gln Thr Tyr Val Tyr

470 475 480

Ile Thr Pro Lys Tyr Leu Arg Thr Tyr Leu Ser Tyr Leu Trp Asn Thr

485 490 495

Phe Gln His Pro Val Met Ile Thr Glu Phe Gly Tyr Pro Val Phe Gly

500 505 510

Glu Ala Asp Lys Glu Asp Leu Ser Asp Gln Leu Tyr Asp Leu Pro Arg

515 520 525

Ser Tyr Tyr Tyr Leu Ser Phe Met Ser Glu Val Leu Lys Ala Ile Trp

530 535 540 545

Glu Asp Asn Val His Val Leu Gly Ala Phe Ala Trp Ser Phe Ala Asp

550 555 560

Asn Trp Glu Phe Gly Asp Tyr Ala Gln Gln Phe Gly Ile Gln Val Val

565 570 575

Asn Arg Thr Thr Gln Glu Arg Tyr Tyr Lys Lys Ser Phe Phe Asp Leu

580 585 590

Val Asp Phe Val Ala Ala Arg Thr Lys Ser

595 600

<210>35

<211>966

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(966)

<220>

<221>sig_peptide

<222>(1)..(63)

<220>

<221>mat_peptide

<222>(64)..(966)

<400>35

atg ttg aat ctg aag atc ctc gcg acc tcg ttc ctc cct ctc ctc ccg 48

Met Leu Asn Leu Lys Ile Leu Ala Thr Ser Phe Leu Pro Leu Leu Pro

-20 -15 -10

acc ctg gtg agc gga tat gcc aat ccc ggg gcc tgc tca ggg act tgc 96

Thr Leu Val Ser Gly Tyr Ala Asn Pro Gly Ala Cys Ser Gly Thr Cys

-5 -1 1 5 10

gtg aac acg cac gac ccc tcg atc att cgc cgc tcc gat ggc aca tac 144

Val Asn Thr His Asp Pro Ser Ile Ile Arg Arg Ser Asp Gly Thr Tyr

15 20 25

ttc cgc ttc tcg acg ggc ggc aag atc gcc atc cac act gcg cca gac 192

Phe Arg Phe Ser Thr Gly Gly Lys Ile Ala Ile His Thr Ala Pro Asp

30 35 40

atc acg gga cca tgg act tac aag gga gct gct ctg ccc gac ggc tcg 240

Ile Thr Gly Pro Trp Thr Tyr Lys Gly Ala Ala Leu Pro Asp Gly Ser

45 50 55

agc att gac ctc gct ggc aaa gac gac ctc tgg gca ccc agc gtc cac 288

Ser Ile Asp Leu Ala Gly Lys Asp Asp Leu Trp Ala Pro Ser Val His

60 65 70 75

cag atc gga agc ctg tac tac ctt tac tac tcg gtg agc acg ttt ggg 336

Gln Ile Gly Ser Leu Tyr Tyr Leu Tyr Tyr Ser Val Ser Thr Phe Gly

80 85 90

tcg cag aac tcg gca att gga ctg gcg cgg tcg tcg acg atg gac gtg 384

Ser Gln Asn Ser Ala Ile Gly Leu Ala Arg Ser Ser Thr Met Asp Val

95 100 105

ggc agc tgg acg gac gtg gga agc acg ggc atc aag tcg gac tcg tcg 432

Gly Ser Trp Thr Asp Val Gly Ser Thr Gly Ile Lys Ser Asp Ser Ser

110 115 120

aag ccg tac aac gcg att gat ccg gcg ctg atc aac gcc gac ggc acg 480

Lys Pro Tyr Asn Ala Ile Asp Pro Ala Leu Ile Asn Ala Asp Gly Thr

125 130 135

tac ctc ctc act ttc ggg tcg ttc tgg aag gac ctg tac cag gtg ccg 528

Tyr Leu Leu Thr Phe Gly Ser Phe Trp Lys Asp Leu Tyr Gln Val Pro

140 145 150 155

atg aag acc acg ccg acg gct gca agc ggg tcg gcg tac caa gtg gcg 576

Met Lys Thr Thr Pro Thr Ala Ala Ser Gly Ser Ala Tyr Gln Val Ala

160 165 170

tac gac ccg gtc agc acg gcg gaa gag ggc ccg ttc atc ttc aag tac 624

Tyr Asp Pro Val Ser Thr Ala Glu Glu Gly Pro Phe Ile Phe Lys Tyr

175 180 185

ggc agc tac tac tac ctc ttc tac tcc aag ggc aag tgc tgc ggc tac 672

Gly Ser Tyr Tyr Tyr Leu Phe Tyr Ser Lys Gly Lys Cys Cys Gly Tyr

190 195 200

gac agc tcc agg ccg gcg gcg gga gag gag tac aag atc atg gtc tgc 720

Asp Ser Ser Arg Pro Ala Ala Gly Glu Glu Tyr Lys Ile Met Val Cys

205 210 215

cgg tcg tcc aag gcc acg ggc gga ttt gtc gac aag agc gga aca tcg 768

Arg Ser Ser Lys Ala Thr Gly Gly Phe Val Asp Lys Ser Gly Thr Ser

220 225 230 235

tgc acc aac gga ggc ggg aca gtc gtt ttg gaa tcg cac ggc aac gtt 816

Cys Thr Asn Gly Gly Gly Thr Val Val Leu Glu Ser His Gly Asn Val

240 245 250

tac gga ccc gga ggc caa gga gtc tac gac gat ccc aca tac ggg ccg 864

Tyr Gly Pro Gly Gly Gln Gly Val Tyr Asp Asp Pro Thr Tyr Gly Pro

255 260 265

att ctc tac tat cac tac gtc gtc acg acc atc gga tac gcc gac ggc 912

Ile Leu Tyr Tyr His Tyr Val Val Thr Thr Ile Gly Tyr Ala Asp Gly

270 275 280

cag aag cag ttc ggg tgg aac aag atc aat ttc tcc agc ggt tgg ccg 960

Gln Lys Gln Phe Gly Trp Asn Lys Ile Asn Phe Ser Ser Gly Trp Pro

285 290 295

gtc gtg 966

Val Val

300

<210>36

<211>322

<212>PRT

<213>Botryosphaeria rhodina

<400>36

Met Leu Asn Leu Lys Ile Leu Ala Thr Ser Phe Leu Pro Leu Leu Pro

-20 -15 -10

Thr Leu yal Ser Gly Tyr Ala Asn Pro Gly Ala Cys Ser Gly Thr Cys

-5 -1 1 5 10

Val Asn Thr His Asp Pro Ser Ile Ile Arg Arg Ser Asp Gly Thr Tyr

15 20 25

Phe Arg Phe Ser Thr Gly Gly Lys Ile Ala Ile His Thr Ala Pro Asp

30 35 40

Ile Thr Gly Pro Trp Thr Tyr Lys Gly Ala Ala Leu Pro Asp Gly Ser

45 50 55

Ser Ile Asp Leu Ala Gly Lys Asp Asp Leu Trp Ala Pro Ser Val His

60 65 70 75

Gln Ile Gly Ser Leu Tyr Tyr Leu Tyr Tyr Ser Val Ser Thr Phe Gly

80 85 90

Ser Gln Asn Ser Ala Ile Gly Leu Ala Arg Ser Ser Thr Met Asp Val

95 100 105

Gly Ser Trp Thr Asp Val Gly Ser Thr Gly Ile Lys Ser Asp Ser Ser

110 115 120

Lys Pro Tyr Asn Ala Ile Asp Pro Ala Leu Ile Asn Ala Asp Gly Thr

125 130 135

Tyr Leu Leu Thr Phe Gly Ser Phe Trp Lys Asp Leu Tyr Gln Val Pro

140 145 150 155

Met Lys Thr Thr Pro Thr Ala Ala Ser Gly Ser Ala Tyr Gln Val Ala

160 165 170

Tyr Asp Pro Val Ser Thr Ala Glu Glu Gly Pro Phe Ile Phe Lys Tyr

175 180 185

Gly Ser Tyr Tyr Tyr Leu Phe Tyr Ser Lys Gly Lys Cys Cys Gly Tyr

190 195 200

Asp Ser Ser Arg Pro Ala Ala Gly Glu Glu Tyr Lys Ile Met Val Cys

205 210 215

Arg Ser Ser Lys Ala Thr Gly Gly Phe Val Asp Lys Ser Gly Thr Ser

220 225 230 235

Cys Thr Asn Gly Gly Gly Thr Val Val Leu Glu Ser His Gly Asn Val

240 245 250

Tyr Gly Pro Gly Gly Gln Gly Val Tyr Asp Asp Pro Thr Tyr Gly Pro

255 260 265

Ile Leu Tyr Tyr His Tyr Val Val Thr Thr Ile Gly Tyr Ala Asp Gly

270 275 280

Gln Lys Gln Phe Gly Trp Asn Lys Ile Asn Phe Ser Ser Gly Trp Pro

285 290 295

Val Val

300

<210>37

<211>1368

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1368)

<220>

<221>sig_peptide

<222>(1)..(54)

<220>

<221>mat_peptide

<222>(55)..(1368)

<400>37

atg cat ttc cct tcc att tgg agc ctc gcg ctc ctt tca tca tca gcc 48

Met His Phe Pro Ser Ile Trp Ser Leu Ala Leu Leu Ser Ser Ser Ala

-15 -10 -5

ctc gcg tcg ctg cag atc gtc ccg ggc gcc aca tgg act gcc acc aac 96

Leu Ala Ser Leu Gln Ile Val Pro Gly Ala Thr Trp Thr Ala Thr Asn

-1 1 5 10

acc gga cag cac ctt cag gcc cat ggt acc ggc atc atc aag gtt ggc 144

Thr Gly Gln His Leu Gln Ala His Gly Thr Gly Ile Ile Lys Val Gly

15 20 25 30

gac acg tac tac atg atc ggc gag gac aag acg aac ggc acc agt ttc 192

Asp Thr Tyr Tyr Met Ile Gly Glu Asp Lys Thr Asn Gly Thr Ser Phe

35 40 45

cag aac gtc aac tgc tac tcg tcc acg aac ctc gtc gaa tgg aag tac 240

Gln Asn Val Asn Cys Tyr Ser Ser Thr Asn Leu Val Glu Trp Lys Tyr

50 55 60

gaa ggc gcc ctg ctc tcc cag acg gcc tcg ggc gat ctc ggt ccc agc 288

Glu Gly Ala Leu Leu Ser Gln Thr Ala Ser Gly Asp Leu Gly Pro Ser

65 70 75

cgc gtg gtt gag cgt ccc aag gtc atc tac aac gac cag acc agc aag 336

Arg Val Val Glu Arg Pro Lys Val Ile Tyr Asn Asp Gln Thr Ser Lys

80 85 90

tac gtg ctc tgg atg cac atc gac tcg tcc gac tac aag gac gcc aag 384

Tyr Val Leu Trp Met His Ile Asp Ser Ser Asp Tyr Lys Asp Ala Lys

95 100 105 110

aca ggc gtc gcc tcc ggc gat agc gtt tgc ggc tcc tac gag tac cac 432

Thr Gly Val Ala Ser Gly Asp Ser Val Cys Gly Ser Tyr Glu Tyr His

115 120 125

ggc agc ttc cgg ccg ttg ggc ttc cag agc agg gat atg ggc ctg ttc 480

Gly Ser Phe Arg Pro Leu Gly Phe Gln Ser Arg Asp Met Gly Leu Phe

130 135 140

aag gac gat gat ggc aag gcg tac ttg atg acc gaa gac cgt gaa aac 528

Lys Asp Asp Asp Gly Lys Ala Tyr Leu Met Thr Glu Asp Arg Glu Asn

145 150 155

ggc ctc cgc atc aac gcc ttg acc gac gac tac ctg aac gtc acc ggc 576

Gly Leu Arg Ile Asn Ala Leu Thr Asp Asp Tyr Leu Asn Val Thr Gly

160 165 170

gac tcc tct gtc tac cgc ttc gac gag aag tac gaa tcc ccc gcc atg 624

Asp Ser Ser Val Tyr Arg Phe Asp Glu Lys Tyr Glu Ser Pro Ala Met

175 180 185 190

gtc aag gtt gac ggg acc tac tac ctc ttc gcc tcc cag ctt acc ggc 672

Val Lys Val Asp Gly Thr Tyr Tyr Leu Phe Ala Ser Gln Leu Thr Gly

195 200 205

tgg aac ccc aac gac aac tac tac gtc aca gcc tcc tcc ctc tcc ggc 720

Trp Asn Pro Asn Asp Asn Tyr Tyr Val Thr Ala Ser Ser Leu Ser Gly

210 215 220

ccc tgg acc tcc tgg aag acc ttc gcc gac gtc ggc tcc aac acc tac 768

Pro Trp Thr Ser Trp Lys Thr Phe Ala Asp Val Gly Ser Asn Thr Tyr

225 230 235

tcc tcg caa acc tcc ttc atc ctc ccc atc acc ggc agc tcc ggc acg 816

Ser Ser Gln Thr Ser Phe Ile Leu Pro Ile Thr Gly Ser Ser Gly Thr

240 245 250

acg tac atg tac cta ggc gac cgc tgg atc agc tcc gcc ctc ttc cgc 864

Thr Tyr Met Tyr Leu Gly Asp Arg Trp Ile Ser Ser Ala Leu Phe Arg

255 260 265 270

agc acc tac atc tgg ctg ccg ctc acg atc gac tcc gcc gca aag acc 912

Ser Thr Tyr Ile Trp Leu Pro Leu Thr Ile Asp Ser Ala Ala Lys Thr

275 280 285

gca tcc atg aag aac gcc gtc aac tgg gtc ccc gac gtc gcc gcc ggc 960

Ala Ser Met Lys Asn Ala Val Asn Trp Val Pro Asp Val Ala Ala Gly

290 295 300

acc tgg gcc gct ggc ccc agc gag acg cag ccg gag ggc gaa gac gcg 1008

Thr Trp Ala Ala Gly Pro Ser Glu Thr Gln Pro Glu Gly Glu Asp Ala

305 310 315

acg ctc agc ggc ggc gcg agg acg gtg acc tgc agt ggg tgc agc ggc 1056

Thr Leu Ser Gly Gly Ala Arg Thr Val Thr Cys Ser Gly Cys Ser Gly

320 325 330

ggg gag ggg gcc ggg tat ctc ggt ggg acg gac tcg ggc gtc gtg acg 1104

Gly Glu Gly Ala Gly Tyr Leu Gly Gly Thr Asp Ser Gly Val Val Thr

335 340 345 350

ttt gcg ggg gtg acg agc gat gcg gcg acg aag tcg tcg gtt cgg gtc 1152

Phe Ala Gly Val Thr Ser Asp Ala Ala Thr Lys Ser Ser Val Arg Val

355 360 365

aag tat cag aat ttg gat agc acc gcg cgg tat gcg gat gtg agc gtt 1200

Lys Tyr Gln Asn Leu Asp Ser Thr Ala Arg Tyr Ala Asp Val Ser Val

370 375 380

aat ggc ggc gcg aag cag agg atc gcg ttt ttg ccg acg gcg aac ggg 1248

Asn Gly Gly Ala Lys Gln Arg Ile Ala Phe Leu Pro Thr Ala Asn Gly

385 390 395

acg cct ggg agt agc gtt gtg aat ctg gat ttg aag gcg ggc agt gcg 1296

Thr Pro Gly Ser Ser Val Val Asn Leu Asp Leu Lys Ala Gly Ser Ala

400 405 410

aat gag gtg gtt att gag ggc gcg aat ggt ggg tgg gga cct gat gtg 1344

Asn Glu Val Val Ile Glu Gly Ala Asn Gly Gly Trp Gly Pro Asp Val

415 420 425 430

gat cgg att atg gtg ccg cgg tcg 1368

Asp Arg Ile Met Val Pro Arg Ser

435

<210>38

<211>456

<212>PRT

<213>Botryosphaeria rhodina

<400>38

Met His Phe Pro Ser Ile Trp Ser Leu Ala Leu Leu Ser Ser Ser Ala

-15 -10 -5

Leu Ala Ser Leu Gln Ile Val Pro Gly Ala Thr Trp Thr Ala Thr Asn

-1 1 5 10

Thr Gly Gln His Leu Gln Ala His Gly Thr Gly Ile Ile Lys Val Gly

15 20 25 30

Asp Thr Tyr Tyr Met Ile Gly Glu Asp Lys Thr Asn Gly Thr Ser Phe

35 40 45

Gln Asn Val Asn Cys Tyr Ser Ser Thr Asn Leu Val Glu Trp Lys Tyr

50 55 60

Glu Gly Ala Leu Leu Ser Gln Thr Ala Ser Gly Asp Leu Gly Pro Ser

65 70 75

Arg Val Val Glu Arg Pro Lys Val Ile Tyr Asn Asp Gln Thr Ser Lys

80 85 90

Tyr Val Leu Trp Met His Ile Asp Ser Ser Asp Tyr Lys Asp Ala Lys

95 100 105 110

Thr Gly Val Ala Ser Gly Asp Ser Val Cys Gly Ser Tyr Glu Tyr His

115 120 125

Gly Ser Phe Arg Pro Leu Gly Phe Gln Ser Arg Asp Met Gly Leu Phe

130 135 140

Lys Asp Asp Asp Gly Lys Ala Tyr Leu Met Thr Glu Asp Arg Glu Asn

145 150 155

Gly Leu Arg Ile Asn Ala Leu Thr Asp Asp Tyr Leu Asn Val Thr Gly

160 165 170

Asp Ser Ser Val Tyr Arg Phe Asp Glu Lys Tyr Glu Ser Pro Ala Met

175 180 185 190

Val Lys Val Asp Gly Thr Tyr Tyr Leu Phe Ala Ser Gln Leu Thr Gly

195 200 205

Trp Asn Pro Asn Asp Asn Tyr Tyr Val Thr Ala Ser Ser Leu Ser Gly

210 215 220

Pro Trp Thr Ser Trp Lys Thr Phe Ala Asp Val Gly Ser Asn Thr Tyr

225 230 235

Ser Ser Gln Thr Ser Phe Ile Leu Pro Ile Thr Gly Ser Ser Gly Thr

240 245 250

Thr Tyr Met Tyr Leu Gly Asp Arg Trp Ile Ser Ser Ala Leu Phe Arg

255 260 265 270

Ser Thr Tyr Ile Trp Leu Pro Leu Thr Ile Asp Ser Ala Ala Lys Thr

275 280 285

Ala Ser Met Lys Asn Ala Val Asn Trp Val Pro Asp Val Ala Ala Gly

290 295 300

Thr Trp Ala Ala Gly Pro Ser Glu Thr Gln Pro Glu Gly Glu Asp Ala

305 310 315

Thr Leu Ser Gly Gly Ala Arg Thr Val Thr Cys Ser Gly Cys Ser Gly

320 325 330

Gly Glu Gly Ala Gly Tyr Leu Gly Gly Thr Asp Ser Gly Val Val Thr

335 340 345 350

Phe Ala Gly Val Thr Ser Asp Ala Ala Thr Lys Ser Ser Val Arg Val

355 360 365

Lys Tyr Gln Asn Leu Asp Ser Thr Ala Arg Tyr Ala Asp Val Ser Val

370 375 380

Asn Gly Gly Ala Lys Gln Arg Ile Ala Phe Leu Pro Thr Ala Asn Gly

385 390 395

Thr Pro Gly Ser Ser Val Val Asn Leu Asp Leu Lys Ala Gly Ser Ala

400 405 410

Asn Glu Val Val Ile Glu Gly Ala Asn Gly Gly Trp Gly Pro Asp Val

415 420 425 430

Asp Arg Ile Met Val Pro Arg Ser

435

<210>39

<211>1248

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(1248)

<220>

<221>sig_peptide

<222>(1)..(60)

<220>

<221>mat_peptide

<222>(61)..(1248)

<400>39

atg gca acg cgt gca ctc tct acg ttc gtt ttg gcc aac ttt ctg ggc 48

Met Ala Thr Arg Ala Leu Ser Thr Phe Val Leu Ala Asn Phe Leu Gly

-20 -15 -10 -5

tca tgc ctc tct tta gct gtt cca gtc gtg cgc caa agc ggc aaa gtt 96

Ser Cys Leu Ser Leu Ala Val Pro Val Val Arg Gln Ser Gly Lys Val

-1 1 5 10

ggc gtc ctt gat gtt tcc atc cca ccc aac agg aac gat gac caa tac 144

Gly Val Leu Asp Val Ser Ile Pro Pro Asn Arg Asn Asp Asp Gln Tyr

15 20 25

tac acg gtt gat ctc gat ttc gat ggc caa act gtt ccg gtt ctt ctc 192

Tyr Thr Val Asp Leu Asp Phe Asp Gly Gln Thr Val Pro Val Leu Leu

30 35 40

gat act ggc tct gga gat ctc ttc gtt ggg tca aac caa tgc agc acg 240

Asp Thr Gly Ser Gly Asp Leu Phe Val Gly Ser Asn Gln Cys Ser Thr

45 50 55 60

act gat cca gac agt gga tgc tac aac agc cca ttt tac caa atc acc 288

Thr Asp Pro Asp Ser Gly Cys Tyr Asn Ser Pro Phe Tyr Gln Ile Thr

65 70 75

aat gaa acc gtc atc gtt gcg aac gag acg ttc ggc act gtt gtg gga 336

Asn Glu Thr Val Ile Val Ala Asn Glu Thr Phe Gly Thr Val Val Gly

80 85 90

gtt gcc ggc gtg aat gga aat cag tcc atc atg ccc gtt gat ttt gga 384

Val Ala Gly Val Asn Gly Asn Gln Ser Ile Met Pro Val Asp Phe Gly

95 100 105

ggc gtt acc att cca gat ctc gcc act ccc ctt ctt tat tat gcg ggc 432

Gly Val Thr Ile Pro Asp Leu Ala Thr Pro Leu Leu Tyr Tyr Ala Gly

110 115 120

aag ggc gag ttc cag aat ggg tct ttt gga ggc att ctt ggt gtc tct 480

Lys Gly Glu Phe Gln Asn Gly Ser Phe Gly Gly Ile Leu Gly Val Ser

125 130 135 140

ccg cgc aac gtt tct cgc aac tat tac ttc ttc gag cgg ctt cct cca 528

Pro Arg Asn Val Ser Arg Asn Tyr Tyr Phe Phe Glu Arg Leu Pro Pro

145 150 155

atc gat gcc atg atc aca gaa ggt ctg ttg gag aag ccc gtc ttc tcg 576

Ile Asp Ala Met Ile Thr Glu Gly Leu Leu Glu Lys Pro Val Phe Ser

160 165 170

ctg acc ctg ccg aga ctg gga gat cct gat tcc ata tcc gga aaa ttg 624

Leu Thr Leu Pro Arg Leu Gly Asp Pro Asp Ser Ile Ser Gly Lys Leu

175 180 185

aca ctt ggc gcc atc gag gac gct ccg atc atc gga gac atc tcc tac 672

Thr Leu Gly Ala Ile Glu Asp Ala Pro Ile Ile Gly Asp Ile Ser Tyr

190 195 200

aac gaa atc atc gac gca ccc aac tac ggc tac gag gat gcc cgt ctc 720

Asn Glu Ile Ile Asp Ala Pro Asn Tyr Gly Tyr Glu Asp Ala Arg Leu

205 210 215 220

gcc ccg atg tcc tgg acc tcc cag ctg gag ggc gtg cgc atg aac gga 768

Ala Pro Met Ser Trp Thr Ser Gln Leu Glu Gly Val Arg Met Asn Gly

225 230 235

gtt gag atc aac atg acg cag agc tca atc gac gcg caa ggc cgc tac 816

Val Glu Ile Asn Met Thr Gln Ser Ser Ile Asp Ala Gln Gly Arg Tyr

240 245 250

ctc tcc ctc ttc gac tcg ggc gcc caa acc atc ctc ctc cgc tac caa 864

Leu Ser Leu Phe Asp Ser Gly Ala Gln Thr Ile Leu Leu Arg Tyr Gln

255 260 265

gaa ttc acc gcc gtc gcc gcg ctc ttc aag ggc aag acg att gtg cag 912

Glu Phe Thr Ala Val Ala Ala Leu Phe Lys Gly Lys Thr Ile Val Gln

270 275 280

gac ggc tac gcc gtc tac ttc gac tgc gcc gag ccg cag ctg ctc gag 960

Asp Gly Tyr Ala Val Tyr Phe Asp Cys Ala Glu Pro Gln Leu Leu Glu

285 290 295 300

ctg aac tac cac ggc cgc tgg ttc gcc gtc gac ccg ctc gac ttg ata 1008

Leu Asn Tyr His Gly Arg Trp Phe Ala Val Asp Pro Leu Asp Leu Ile

305 310 315

atc ccc agc gac cat ggt gtg gtc aac ggg acg gtg atg tgc aag tcc 1056

Ile Pro Ser Asp His Gly Val Val Asn Gly Thr Val Met Cys Lys Ser

320 325 330

gcg ctg ggc acg tgg agc agg acg ttt gcg gac tcg att atc ggt gtg 1104

Ala Leu Gly Thr Trp Ser Arg Thr Phe Ala Asp Ser Ile Ile Gly Val

335 340 345

ccg ttt atg cgg aat acg ctg agt gtg ttt gat tac gtg acg gag gat 1152

Pro Phe Met Arg Asn Thr Leu Ser Val Phe Asp Tyr Val Thr Glu Asp

350 355 360

ttg tac agt gtg cag ccg cgc gtg ggg ttg ggg agc ttg acg gat ggc 1200

Leu Tyr Ser Val Gln Pro Arg Val Gly Leu Gly Ser Leu Thr Asp Gly

365 370 375 380

gcg gcg gcg atg gag agg tat gcg ggg ttg tat cag aat agg ttg ttg 1248

Ala Ala Ala Met Glu Arg Tyr Ala Gly Leu Tyr Gln Asn Arg Leu Leu

385 390 395

<210>40

<211>416

<212>PRT

<213>Botryosphaeria rhodina

<400>40

Met Ala Thr Arg Ala Leu Ser Thr Phe Val Leu Ala Asn Phe Leu Gly

-20 -15 -10 -5

Ser Cys Leu Ser Leu Ala Val Pro Val Val Arg Gln Ser Gly Lys Val

-1 1 5 10

Gly Val Leu Asp Val Ser Ile Pro Pro Asn Arg Asn Asp Asp Gln Tyr

15 20 25

Tyr Thr Val Asp Leu Asp Phe Asp Gly Gln Thr Val Pro Val Leu Leu

30 35 40

Asp Thr Gly Ser Gly Asp Leu Phe Val Gly Ser Asn Gln Cys Ser Thr

45 50 55 60

Thr Asp Pro Asp Ser Gly Cys Tyr Asn Ser Pro Phe Tyr Gln Ile Thr

65 70 75

Asn Glu Thr Val Ile Val Ala Asn Glu Thr Phe Gly Thr Val Val Gly

80 85 90

Val Ala Gly Val Asn Gly Asn Gln Ser Ile Met Pro Val Asp Phe Gly

95 100 105

Gly Val Thr Ile Pro Asp Leu Ala Thr Pro Leu Leu Tyr Tyr Ala Gly

110 115 120

Lys Gly Clu Phe Gln Asn Gly Ser Phe Gly Gly Ile Leu Gly Val Ser

125 130 135 140

Pro Arg Asn Val Ser Arg Asn Tyr Tyr Phe Phe Glu Arg Leu Pro Pro

145 150 155

Ile Asp Ala Met Ile Thr Glu Gly Leu Leu Glu Lys Pro Val Phe Ser

160 165 170

Leu Thr Leu Pro Arg Leu Gly Asp Pro Asp Ser Ile Ser Gly Lys Leu

175 180 185

Thr Leu Gly Ala Ile Glu Asp Ala Pro Ile Ile Gly Asp Ile Ser Tyr

190 195 200

Asn Glu Ile Ile Asp Ala Pro Asn Tyr Gly Tyr Glu Asp Ala Arg Leu

205 210 215 220

Ala Pro Met Ser Trp Thr Ser Gln Leu Glu Gly Val Arg Met Asn Gly

225 230 235

Val Glu Ile Asn Met Thr Gln Ser Ser Ile Asp Ala Gln Gly Arg Tyr

240 245 250

Leu Ser Leu Phe Asp Ser Gly Ala Gln Thr Ile Leu Leu Arg Tyr Gln

255 260 265

Glu Phe Thr Ala Val Ala Ala Leu Phe Lys Gly Lys Thr Ile Val Gln

270 275 280

Asp Gly Tyr Ala Val Tyr Phe Asp Cys Ala Glu Pro Gln Leu Leu Glu

285 290 295 300

Leu Asn Tyr His Gly Arg Trp Phe Ala Val Asp Pro Leu Asp Leu Ile

305 310 315

Ile Pro Ser Asp His Gly Val Val Asn Gly Thr Val Met Cys Lys Ser

320 325 330

Ala Leu Gly Thr Trp Ser Arg Thr Phe Ala Asp Ser Ile Ile Gly Val

335 340 345

Pro Phe Met Arg Asn Thr Leu Ser Val Phe Asp Tyr Val Thr Glu Asp

350 355 360

Leu Tyr Ser Val Gln Pro Arg Val Gly Leu Gly Ser Leu Thr Asp Gly

365 370 375 380

Ala Ala Ala Met Glu Arg Tyr Ala Gly Leu Tyr Gln Asn Arg Leu Leu

385 390 395

<210>41

<211>849

<212>DNA

<213>Botryosphaeria rhodina

<220>

<221>CDS

<222>(1)..(849)

<220>

<221>sig_peptide

<222>(1)..(63)

<220>

<221>mat_peptide

<222>(64)..(849)

<400>41

atg ctt ccg aaa atc gct ctt cag ggt ggc ctc gtg gct ctg ctg gtg 48

Met Leu Pro Lys Ile Ala Leu Gln Gly Gly Leu Val Ala Leu Leu Val

-20 -15 -10

caa aca gcc gca gcc caa gta cga tgc gcc act ccc gat ccc cca aaa 96

Gln Thr Ala Ala Ala Gln Val Arg Cys Ala Thr Pro Asp Pro Pro Lys

-5 -1 1 5 10

gag ctg ctg gag cat gca gcg gag atg aaa gcg caa gaa aag gcg atg 144

Glu Leu Leu Glu His Ala Ala Glu Met Lys Ala Gln Glu Lys Ala Met

15 20 25

aaa gat gct gga att cag caa gcc cgg gcc cct atc aca atc aat gct 192

Lys Asp Ala Gly Ile Gln Gln Ala Arg Ala Pro Ile Thr Ile Asn Ala

30 35 40

tgg ttc cac gtc atc gct gcc tct gac acc gtt gag gat gcc aac ttg 240

Trp Phe His Val Ile Ala Ala Ser Asp Thr Val Glu Asp Ala Asn Leu

45 50 55

act gat gaa atg ctt caa aac caa ctt gag gtg ctc aat tcc aac tac 288

Thr Asp Glu Met Leu Gln Asn Gln Leu Glu Val Leu Asn Ser Asn Tyr

60 65 70 75

gct ccg cac gac atc cag ttc aat ctc tcg ggc aca acc agg act gtc 336

Ala Pro His Asp Ile Gln Phe Asn Leu Ser Gly Thr Thr Arg Thr Val

80 85 90

aac agc agt tgg tct gac aac acc gat acg ctt gtc atg aag aca caa 384

Asn Ser Ser Trp Ser Asp Asn Thr Asp Thr Leu Val Met Lys Thr Gln

95 100 105

ctc cgg aag ggc gat tat gct act ctc aac ttg tat ttc cag agg aaa 432

Leu Arg Lys Gly Asp Tyr Ala Thr Leu Asn Leu Tyr Phe Gln Arg Lys

110 115 120

ctc ccg ggt gac tca tca ggt tac tgc acc ttc cct gga atc gtt gaa 480

Leu Pro Gly Asp Ser Ser Gly Tyr Cys Thr Phe Pro Gly Ile Val Glu

125 130 135

gag ggg acg cta gac ttc ttc aac gac ggc tgc gtg att gac gcc cag 528

Glu Gly Thr Leu Asp Phe Phe Asn Asp Gly Cys Val Ile Asp Ala Gln

140 145 150 155

acc gtg cct gga ggc agc aaa gtc ccg tac aac gag ggg aaa aca gcc 576

Thr Val Pro Gly Gly Ser Lys Val Pro Tyr Asn Glu Gly Lys Thr Ala

160 165 170

acc cat gag gtc ggc cac tgg ttc ggt ctc tac cac aca ttt caa ggc 624

Thr His Glu Val Gly His Trp Phe Gly Leu Tyr His Thr Phe Gln Gly

175 180 185

ggc tgc aac ggc ggc gac ggt att gac gac acg cca gct caa gca agc 672

Gly Cys Asn Gly Gly Asp Gly Ile Asp Asp Thr Pro Ala Gln Ala Ser

190 195 200

tac agc gag ggt tgt ccc gtt ggt agg gac tcg tgt ccg gat ttg cct 720

Tyr Ser Glu Gly Cys Pro Val Gly Arg Asp Ser Cys Pro Asp Leu Pro

205 210 215

gga ttg gac ccg att cac aac tac atg gac tat tca gat gac gct tgc 768

Gly Leu Asp Pro Ile His Asn Tyr Met Asp Tyr Ser Asp Asp Ala Cys

220 225 230 235

tac gaa gaa ttt act cct gat caa gat gct cgc atg cgg tcc aac tgg 816

Tyr Glu Glu Phe Thr Pro Asp Gln Asp Ala Arg Met Arg Ser Asn Trp

240 245 250

gac tac tat cgc gcg gcc gcg cag ggc agt gag 849

Asp Tyr Tyr Arg Ala Ala Ala Gln Gly Ser Glu

255 260

<210>42

<211>283

<212>PRT

<213>Botryosphaeria rhodina

<400>42

Met Leu Pro Lys Ile Ala Leu Gln Gly Gly Leu Val Ala Leu Leu Val

-20 -15 -10

Gln Thr Ala Ala Ala Gln Val Arg Cys Ala Thr Pro Asp Pro Pro Lys

-5 -1 1 5 10

Glu Leu Leu Glu His Ala Ala Glu Met Lys Ala Gln Glu Lys Ala Met

15 20 25

Lys Asp Ala Gly Ile Gln Gln Ala Arg Ala Pro Ile Thr Ile Asn Ala

30 35 40

Trp Phe His Val Ile Ala Ala Ser Asp Thr Val Glu Asp Ala Asn Leu

45 50 55

Thr Asp Glu Met Leu Gln Asn Gln Leu Glu Val Leu Asn Ser Asn Tyr

60 65 70 75

Ala Pro His Asp Ile Gln Phe Asn Leu Ser Gly Thr Thr Arg Thr Val

80 85 90

Asn Ser Ser Trp Ser Asp Asn Thr Asp Thr Leu Val Met Lys Thr Gln

95 100 105

Leu Arg Lys Gly Asp Tyr Ala Thr Leu Asn Leu Tyr Phe Gln Arg Lys

110 115 120

Leu Pro Gly Asp Ser Ser Gly Tyr Cys Thr Phe Pro Gly Ile Val Glu

125 130 135

Glu Gly Thr Leu Asp Phe Phe Asn Asp Gly Cys Val Ile Asp Ala Gln

140 145 150 155

Thr Val Pro Gly Gly Ser Lys Val Pro Tyr Asn Glu Gly Lys Thr Ala

160 165 170

Thr His Glu Val Gly His Trp Phe Gly Leu Tyr His Thr Phe Gln Gly

175 180 185

Gly Cys Asn Gly Gly Asp Gly Ile Asp Asp Thr Pro Ala Gln Ala Ser

190 195 200

Tyr Ser Glu Gly Cys Pro Val Gly Arg Asp Ser Cys Pro Asp Leu Pro

205 210 215

Gly Leu Asp Pro Ile His Asn Tyr Met Asp Tyr Ser Asp Asp Ala Cys

220 225 230 235

Tyr Glu Glu Phe Thr Pro Asp Gln Asp Ala Arg Met Arg Ser Asn Trp

240 245 250

Asp Tyr Tyr Arg Ala Ala Ala Gln Gly Ser Glu

255 260

<210>43

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer SigA2NotU-P

<400>43

tcgcgatccg ttttcgcatt tatcgtgaaa cgct 34

<210>44

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer SigA2NotD-P

<400>44

ccgcaaacgc tggtgaaagt aaaagatgct gaa 33

<210>45

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer A

<400>45

agcgtttgcg gccgcgatcc 20

<210>46

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer B

<400>46

ttattcggtc gaaaaggatc c 21

<210>47

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer #166

<400>47

cgcggatcca ccatggtctc cttcaagtcg attc 34

<210>48

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer #167

<400>48

ccgctcgagt tactgcacgg taatcgtagc 30

Claims

1. be selected from down the isolated polypeptide of group:

(a) comprise the polypeptide of aminoacid sequence, described aminoacid sequence with by SEQ ID NO:2, SEQID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ IDNO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, the sequence of the mature polypeptide that is comprised in the group that SEQ ID NO:40 and SEQID NO:42 constitute has at least 90% identity

(b) by the nucleotide sequence encoded polypeptide, this nucleotides sequence is listed under the height stringent condition and is selected from down the hybridization of group polynucleotide probes:

(i) complementary strand of nucleotide sequence, described nucleotide sequence are selected from SEQ ID NO:1, SEQ IDNO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ IDNO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, the zone of the encoding mature polypeptide of SEQ ID NO:39 and SEQ IDNO:41

The (ii) complementary strand of the cDNA sequence that is comprised in the nucleotide sequence, described nucleotide sequence is selected from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ IDNO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, the zone of the encoding mature polypeptide of SEQ ID NO:39 and SEQ ID NO:41

Wherein said polypeptide has the NO:2 by SEQ ID, SEQ ID NO:4, SEQ ID NO:6, SEQID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ IDNO:36, SEQ ID NO:38, the function of the corresponding mature polypeptide that is comprised in the group that SEQ ID NO:40 and SEQ ID NO:42 constitute.

2. be selected from down the isolating enzyme of group:

(a) comprise the enzyme of aminoacid sequence, described aminoacid sequence has at least 90% identity with the aminoacid sequence that is selected from the maturing enzyme of the secreted zytase of the Botryosphaeria rhodina bacterial strain of CBS preservation accession number 274.96 preservations, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase.

(i) complementary strand of nucleotide sequence, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preservation accession number, and encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase

The (ii) complementary strand of the contained cDNA sequence of nucleotide sequence, described nucleotide sequence is contained in the Botryosphaeria rhodina bacterial strain with 274.96 preservations of CBS preservation accession number, and the encoding mature enzyme, this maturing enzyme is selected from the secreted zytase of this bacterial strain, serine easterase, peroxidase, GH 61A polypeptide, GH 61B polypeptide, GH 61C polypeptide, GH 61D polypeptide, beta-glucosidase enzyme, inscribe arabinase and peptic peptidase;

3. claim 1 or 2 polypeptide, it is selected from:

(a) comprise the polypeptide of aminoacid sequence, described aminoacid sequence be selected from following sequence and have at least 90% identity:

The amino acid/11-291 of SEQ ID NO:2; The 1-202 of SEQ ID NO:4; The amino acid/11-352 of SEQ ID NO:6; The amino acid/11-431 of SEQ ID NO:8; The amino acid/11-185 of SEQ ID NO:10; The amino acid/11-218 of SEQ ID NO:12; The amino acid/11-249 of SEQ ID NO:14; The 1-255 of SEQ IDNO:16; The amino acid/11-205 of SEQ ID NO:18; The amino acid/11-243 of SEQ ID NO:20; The amino acid/11-415 of SEQ ID NO:22; The amino acid/11-377 of SEQ ID NO:24; The amino acid/11 of SEQID NO:26-259; The amino acid/11-248 of SEQ ID NO:28; The amino acid/11-149 of SEQ ID NO:30; The amino acid/11-202 of SEQ ID NO:32; The amino acid/11-603 of SEQ ID NO:34; The amino acid/11-301 of SEQ ID NO:36; The amino acid/11-438 of SEQ ID NO:38; The amino acid/11 of SEQID NO:40-396; Amino acid/11-262 with SEQ ID NO:42;

(b) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed in the height stringent condition down and be selected from following multi-nucleotide hybrid:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is selected from the Nucleotide 55-927 of SEQ ID NO:1, the Nucleotide 58-663 of SEQ ID NO:3, the Nucleotide 55-1110 of SEQ ID NO:5, the Nucleotide 55-1347 of SEQ ID NO:7, the Nucleotide 1-555 of SEQ ID NO:9, the Nucleotide 49-702 of SEQ IDNO:11, the Nucleotide 40-786 of SEQ ID NO:13, the Nucleotide 55-819 of SEQ ID NO:15, the Nucleotide 61-675 of SEQ ID NO:17, the Nucleotide 1-729 of SEQ ID NO:19, the Nucleotide 55-1299 of SEQ ID NO:21, the Nucleotide 49-1179 of SEQ ID NO:23, the Nucleotide 70-846 of SEQ ID NO:25, the Nucleotide 58-810 of SEQ ID NO:27, the Nucleotide 55-660 of SEQ IDNO:31, the Nucleotide 46-1854 of SEQ ID NO:33, the Nucleotide 64-966 of SEQ ID NO:35, the Nucleotide 55-1368 of SEQ ID NO:37, the Nucleotide 64-849 of the Nucleotide 61-1248 of SEQ ID NO:39 and SEQ ID NO:41;

The (ii) complementary strand of the cDNA sequence that is comprised in the nucleotide sequence, described nucleotide sequence is selected from: the Nucleotide 55-927 of SEQ ID NO:1, the Nucleotide 58-663 of SEQ ID NO:3, the Nucleotide 55-1110 of SEQ IDNO:5, the Nucleotide 55-1347 of SEQ ID NO:7, the Nucleotide 1-555 of SEQ ID NO:9, the Nucleotide 49-702 of SEQ ID NO:11, the Nucleotide 40-786 of SEQ ID NO:13, the Nucleotide 55-819 of SEQ ID NO:15, the Nucleotide 61-675 of SEQ ID NO:17, the Nucleotide 1-729 of SEQ ID NO:19, the Nucleotide 55-1299 of SEQ ID NO:21, the Nucleotide 49-1179 of SEQ IDNO:23, the Nucleotide 70-846 of SEQ ID NO:25, the Nucleotide 58-810 of SEQ ID NO:27, the Nucleotide 55-660 of SEQ ID NO:31, the Nucleotide 46-1854 of SEQ ID NO:33, the Nucleotide 64-966 of SEQ ID NO:35, the Nucleotide 55-1368 of SEQ ID NO:37, the Nucleotide 64-849 of the Nucleotide 61-1248 of SEQ ID NO:39 and SEQ ID NO:41.

4. the polypeptide of claim 3, wherein said polypeptide is an enzyme, described enzyme is selected from the polypeptide with such aminoacid sequence: described aminoacid sequence be selected from following aminoacid sequence and have at least 95% identity: the amino acid/11-291 of SEQ ID NO:2; The 1-202 of SEQ ID NO:4; The amino acid/11 of SEQ IDNO:6-352; The amino acid/11-431 of SEQ ID NO:8; The amino acid/11-185 of SEQ ID NO:10; The amino acid/11-218 of SEQ ID NO:12; The amino acid/11-249 of SEQ ID NO:14; The 1-255 of SEQ ID NO:16; The amino acid/11-205 of SEQ ID NO:18; The amino acid/11-243 of SEQ ID NO:20; The amino acid/11-415 of SEQ ID NO:22; The amino acid/11-377 of SEQ ID NO:24; The amino acid/11-259 of SEQ ID NO:26; The amino acid/11-248 of SEQ ID NO:28; The amino acid/11 of SEQ IDNO:30-149; The amino acid/11-202 of SEQ ID NO:32; The amino acid/11-603 of SEQ ID NO:34; The amino acid/11-301 of SEQ ID NO:36; The amino acid/11-438 of SEQ ID NO:38; The amino acid/11-396 of SEQ ID NO:40; Amino acid/11-262 with SEQ ID NO:42.

5. the polypeptide of claim 4, wherein this polypeptide is an enzyme, and described enzyme is selected from by such nucleotide sequence encoded polypeptide, and described nucleotides sequence is listed under the high stringent condition and is selected from following multi-nucleotide hybrid:

(i) complementary strand of nucleotide sequence, described nucleotide sequence is selected from: the Nucleotide 55-927 of SEQ ID NO:1, the Nucleotide 58-663 of SEQ ID NO:3, the Nucleotide 55-1110 of SEQ ID NO:5, the Nucleotide 55-1347 of SEQ ID NO:7, the Nucleotide 1-555 of SEQ ID NO:9, the Nucleotide 49-702 of SEQ IDNO:11, the Nucleotide 40-786 of SEQ ID NO:13, the Nucleotide 55-819 of SEQ ID NO:15, the Nucleotide 61-675 of SEQ ID NO:17, the Nucleotide 1-729 of SEQ ID NO:19, the Nucleotide 55-1299 of SEQ ID NO:21, the Nucleotide 49-1179 of SEQ ID NO:23, the Nucleotide 70-846 of SEQ ID NO:25, the Nucleotide 58-810 of SEQ ID NO:27, the Nucleotide 55-660 of SEQ IDNO:31, the Nucleotide 46-1854 of SEQ ID NO:33, the Nucleotide 64-966 of SEQ ID NO:35, the Nucleotide 55-1368 of SEQ ID NO:37, the Nucleotide 64-849 of the Nucleotide 61-1248 of SEQ ID NO:39 and SEQ ID NO:41; With

6. the polypeptide of claim 3, wherein said polynucleotide encoding is by being selected from the polypeptide that following polypeptide is formed: the amino acid/11-291 of SEQ ID NO:2; The 1-202 of SEQ ID NO:4; The amino acid/11 of SEQ IDNO:6-352; The amino acid/11-431 of SEQ ID NO:8; The amino acid/11-185 of SEQ ID NO:10; The amino acid/11-218 of SEQ ID NO:12; The amino acid/11-249 of SEQ ID NO:14; The 1-255 of SEQ ID NO:16; The amino acid/11-205 of SEQ ID NO:18; The amino acid/11-243 of SEQ ID NO:20; The amino acid/11-415 of SEQ ID NO:22; The amino acid/11-377 of SEQ ID NO:24; The amino acid/11-259 of SEQ ID NO:26; The amino acid/11-248 of SEQ ID NO:28; The amino acid/11 of SEQ IDNO:30-149; The amino acid/11-202 of SEQ ID NO:32; The amino acid/11-603 of SEQ ID NO:34; The amino acid/11-301 of SEQ ID NO:36; The amino acid/11-438 of SEQ ID NO:38; The amino acid/11-396 of SEQ ID NO:40; Amino acid/11-262 with SEQ ID NO:42.

7. the polypeptide of claim 3, wherein said polypeptide is the GH10 zytase, described GH10 zytase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH10 zytase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS274.96 preservation.

8. the polypeptide of claim 3, wherein this polypeptide is the GH10 zytase of the amino acid/11-291 that comprises SEQ ID NO:2.

9. the polypeptide of claim 3, wherein the GH10 zytase formed by the amino acid/11-291 of SEQ ID NO:2 of this polypeptide.

10. the polypeptide of claim 3, wherein said polypeptide is the GH11 zytase, described GH11 zytase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH11 zytase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS274.96 preservation.

11. the polypeptide of claim 3, wherein this polypeptide is the GH11 zytase of the amino acid/11-202 that comprises SEQ ID NO:4.

12. the polypeptide of claim 3, wherein the GH11 zytase formed by the amino acid/11-202 of SEQ ID NO:4 of this polypeptide.

13. the polypeptide of claim 3, wherein this polypeptide is a serine easterase, described serine easterase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the serine easterase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

14. the polypeptide of claim 3, wherein this polypeptide is the serine easterase of the amino acid/11-352 that comprises SEQ ID NO:6.

15. the polypeptide of claim 3, the wherein serine easterase formed by the amino acid/11-352 of SEQ ID NO:6 of this polypeptide.

16. the polypeptide of claim 3, wherein this polypeptide is a lipase, described lipase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the serine easterase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

17. the polypeptide of claim 3, wherein this polypeptide is the lipase of the amino acid/11-431 that comprises SEQ ID NO:8.

18. the polypeptide of claim 3, the wherein lipase formed by the amino acid/11-431 of SEQ ID NO:8 of this polypeptide.

19. the polypeptide of claim 3, wherein this polypeptide is a peroxidase, and described peroxidase comprises and the aminoacid sequence that can have 90% identity from the peroxidase that obtains with the Botryosphaeria rhodina of preservation accession number CBS 274.96 preservations at least.

20. the polypeptide of claim 3, wherein this polypeptide is the peroxidase of the amino acid/11-185 that comprises SEQ ID NO:10.

21. the polypeptide of claim 3, the wherein peroxidase formed by the amino acid/11-185 of SEQ ID NO:10 of this polypeptide.

22. the polypeptide of claim 3, wherein this polypeptide is a GH 61A polypeptide, described GH 61A polypeptide comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH 61A polypeptide that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

23. the polypeptide of claim 3, wherein this polypeptide is the GH 61A polypeptide of the amino acid/11-218 that comprises SEQ ID NO:12.

24. the polypeptide of claim 3, wherein the GH 61A polypeptide formed by the amino acid/11-218 of SEQ ID NO:12 of this polypeptide.

25. the polypeptide of claim 3, wherein this polypeptide is a GH 61B polypeptide, described GH 61B polypeptide comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH 61B polypeptide that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

26. the polypeptide of claim 3, wherein this polypeptide is the GH 61B polypeptide of the amino acid/11-249 that comprises SEQ ID NO:14.

27. the polypeptide of claim 3, wherein the GH 61B polypeptide formed by the amino acid/11-249 of SEQ ID NO:14 of this polypeptide.

28. the polypeptide of claim 3, wherein this polypeptide is a GH 61C polypeptide, described GH 61C polypeptide comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH 61C polypeptide that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

29. the polypeptide of claim 3, wherein this polypeptide is the GH 61C polypeptide of the amino acid/11-255 that comprises SEQ ID NO:16.

30. the polypeptide of claim 3, wherein the GH 61C polypeptide formed by the amino acid/11-255 of SEQ ID NO:16 of this polypeptide.

31. the polypeptide of claim 3, wherein this polypeptide is a GH 61D polypeptide, described GH 61D polypeptide comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the GH 61D polypeptide that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

32. the polypeptide of claim 3, wherein this polypeptide is the GH 61D polypeptide of the amino acid/11-205 that comprises SEQ ID NO:18.

33. the polypeptide of claim 3, wherein the GH 61D polypeptide formed by the amino acid/11-205 of SEQ ID NO:18 of this polypeptide.

34. the polypeptide of claim 3, wherein this polypeptide is a beta-glucosidase enzyme, described beta-glucosidase enzyme comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the beta-glucosidase enzyme that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

35. the polypeptide of claim 3, wherein this polypeptide is the beta-glucosidase enzyme of the amino acid/11-603 that comprises SEQ ID NO:34.

36. the polypeptide of claim 3, the wherein beta-glucosidase enzyme formed by the amino acid/11-603 of SEQ ID NO:34 of this polypeptide.

37. the polypeptide of claim 3, wherein this polypeptide is the inscribe arabinase, described inscribe arabinase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the inscribe arabinase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

38. the polypeptide of claim 3, wherein this polypeptide is the inscribe arabinase of the amino acid/11-301 that comprises SEQ ID NO:36.

39. the polypeptide of claim 3, wherein the inscribe arabinase formed by the amino acid/11-301 of SEQ ID NO:36 of this polypeptide.

40. the polypeptide of claim 3, wherein this polypeptide is the inscribe arabinase, described inscribe arabinase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the inscribe arabinase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

41. the polypeptide of claim 3, wherein this polypeptide is the inscribe arabinase of the amino acid/11-438 that comprises SEQ ID NO:38.

42. the polypeptide of claim 3, wherein the inscribe arabinase formed by the amino acid/11-438 of SEQ ID NO:38 of this polypeptide.

43. the polypeptide of claim 3, wherein this polypeptide is a peptic peptidase, and described peptic peptidase comprises and the aminoacid sequence that can have 90% identity from the peptic peptidase that obtains with the Botryosphaeria rhodina of preservation accession number CBS 274.96 preservations at least.

44. the polypeptide of claim 3, wherein this polypeptide is the peptic peptidase of the amino acid/11-396 that comprises SEQ ID NO:40.

45. the polypeptide of claim 3, the wherein peptic peptidase formed by the amino acid/11-396 of SEQ ID NO:40 of this polypeptide.

46. the polypeptide of claim 3, wherein this polypeptide is a peptic peptidase, described peptic peptidase comprises aminoacid sequence, and described aminoacid sequence has at least 90% identity with the peptic peptidase that can obtain from the Botryosphaeria rhodina with preservation accession number CBS 274.96 preservations.

47. the polypeptide of claim 3, wherein this polypeptide is the peptic peptidase of the amino acid/11-262 that comprises SEQ ID NO:42.

48. the polypeptide of claim 3, the wherein peptic peptidase formed by the amino acid/11-262 of SEQ ID NO:42 of this polypeptide.

49. polynucleotide, it comprises the nucleotide sequence of defined polypeptide in the coding claim 3.

50. nucleic acid construct, it comprises the nucleotide sequence of definition in the claim 49, and this nucleotide sequence is operably connected with the regulating and controlling sequence that one or more instruct described polypeptide to produce in host cell.

51. recombinant expression vector, it comprises the nucleic acid construct of claim 50.

52. recombinant host cell, it comprises the nucleic acid construct of claim 50.

53. the method for the polypeptide of production claim 3, it comprises:

A. cultivate bacterial strain to produce described polypeptide, the wild-type form of wherein said bacterial strain can produce this polypeptide; And

B. reclaim this polypeptide.

54. the method for the polypeptide of production claim 3, it comprises:

A. helping to produce under the condition of described polypeptide, cultivating the recombinant host cell of definition in the claim 52; And

B. reclaim this polypeptide.

55. composition, it comprises the polypeptide and the vehicle of claim 3.

56. the method for compositions of preparation claim 55, it comprises the polypeptide of claim 1 and mixed with excipients.

57. the storage media that is suitable for using in electronics, described electronics comprises the information of the amino acid sequence of polypeptide of claim 3.

58. the storage media that is suitable for using in electronics, described electronics comprise the information of nucleotide sequence of the polynucleotide of claim 49.