CN101052396A

CN101052396A - Cancer treatments

Info

Publication number: CN101052396A
Application number: CN 200580037980
Authority: CN
Inventors: 希瑟·海伦妮·宾德尔; 加里·T·埃利奥特; 洛伦佐·M·莱奥尼; 克里斯蒂娜·卡洛尔·尼迈尔; 普拉提克·S·穆尔塔尼
Original assignee: Cephalon LLC
Current assignee: Cephalon LLC
Priority date: 2004-11-05
Filing date: 2005-11-04
Publication date: 2007-10-10

Abstract

Methods and compositions for treating cancers characterized by death-resistant cancer cells are described. In general, such methods involve administration of a therapeutically effective amount of a compound that induces mitotic catastrophe in the some, and preferably most or all, of the cancerous cells. Methods for assessing the efficacy of such treatments are also provided.

Description

Treatment of cancer

Technical field

The present invention relates generally to treatment of cancer, particularly relates to the cancer of the inductive apoptosis of antiradiation drug.

Background technology

1. foreword

The application requires the interests and the priority of following each U.S. Provisional Patent Application: serial number 60/625,193, and submit in November, 2004, is entitled as " treatment of cancer "; With 60/660,266, submit in March, 2005, is entitled as " treatment of cancer ".These apply for that each comfortable this merges as a reference in full with it, comprises accompanying drawing, form and claim.

Below description comprise and can be used for understanding information of the present invention.Be not to admit that any described information is prior art or correlation technique for the present invention, perhaps any clear and definite or implicit announcement of quoting is a prior art.

2. background

In the U.S., cancer is second dead main cause now, and the U.S. has 8,000,000 people of surpassing to be diagnosed as cancer.Nineteen ninety-five, cancer accounts for 23.3% of all death of the U.S..Referring to U.S. Department of Health and Human Service, the Health United States1996-97 and the Injury Chartbook 117 (1997) at national health statistics center (U.S.Dept.of Health and HumanServices, National Center for Health Statistics).

Cancer is not understood in the molecules level as yet fully.The known change that cellular exposure is caused the DNA of deactivation " inhibition " gene or activation " oncogene " in carcinogen such as some virus, some chemical substance or radiant energy.Suppressor gene is a growth regulatory gene, and it is in case sudden change just can not be controlled the cell growth again.Originally oncogene be normal gene (being called proto-oncogene), becomes transformed gene by sudden change or change expression content.The product of transformed gene causes the improper growth of cell.Surpass 20 different normal cell genes and can become oncogene by gene alteration.Transformant is different with normal cell aspect a lot, comprises the composition of cellular morphology, cell-cell-cell interaction, film, structure, protein excretion, gene expression and the mortality rate of cytoskeleton (cell transformed can indeterminate growth).

Tumor, or tumor are cell growth abnormity, that do not regulated and amorphous propagation, are commonly referred to cancer.If the character that tumor has destructive growth, soaks into and shift is exactly pernicious or cancer.Infiltration is meant tumor by permeating or destroy the local diffusion of surrounding tissue, and destructiveness is passed the basal layer that limits organizational boundary usually, therefore usually enters systemic circulatory system.Transfer is often referred to tumor cell by serous cavity, subarachnoid space or other lacuna, moves in the mode of direct diffusion.By transfer process, tumor cell migration generates tumor to other position of health at the position that occurs the position away from it at first.

One of now main Therapeutic Method with three types of cancer or therapeutic alliance: perform the operation radiation and chemotherapy.Perform the operation to relate to and sweep off pathological tissues.Though operation is effective sometimes for the tumor (for example breast, colon and skin) that removing is positioned at some position, it can not be used for the treatment of the tumor that is positioned at other position, as vertebra, can not treat the tumor disease such as the leukemia that are dispersed in.Radiotherapy relates to living tissue is exposed in the cell death or destructive ionizing radiation that can cause exposing.The side effect of radiotherapy may be acute and of short duration, but some may be irreversible.Chemotherapy relates to destroys cellular replication or cellular metabolism.The most frequently used in the treatment of breast, lung and carcinoma of testis.

Ill effect with systemic chemotherapy treatment tumor disease is that the patient who accepts treatment of cancer fears most.In these ill effects, pernicious the most common with vomiting.Other adverse side effect comprises that accepting high dose chemotherapy and bone marrow rescues cytopenia among the patient of treatment (bone marrow rescue) or radiotherapy, infection, cachexia, mucositis; Alopecia (alopecia); Skin complication such as pruritus, urticaria and angioedema; Neural complication; Pulmonary and cardiac complication; And reproduction and endocrine complication.The side effect that chemotherapy causes has a strong impact on patient's quality of life, and may influence the compliance of patient to treatment strongly.Therefore, need improved Therapeutic Method.

3. definition

" alkylating agent " refers to chemical modification DNA and destroys the chemotherapy compound of its function.Some alkylating agents cause forming between the nucleotide of same chain of double chain DNA molecule or complementary strand crosslinked, but other causes the base-pair mismatch between the DNA chain.The example of alkylating agent comprises bendamustine (bendamustine), busulfan (busulfan), carboplatin (carboplatin), carmustine (carmustine), cisplatin (cisplatin), chlorambucil (chlorambucil), cyclophosphamide (cyclophosphamide), dacarbazine (dacarbazine), hexamethylmelamine (hexamethylmelamine), ifosfamide (ifosphamide), lomustine (lomustine), chlormethine (mechlorethamine), melphalan (melphalan), mitotane (mitotane), mitomycin (mytomycin), pipobroman (pipobroman), procarbazine (procarbazine), streptozotocin (streptozocin), thio-tepa (thiotepa) and triethylene melamine (triethylenemelamine).

" antimetabolite " refers to the synthetic chemotherapeutic of interfere with biomolecules, and described biomolecule comprises the synthetic person that needs the synthetic DNA that must (as nucleotide and nucleoside) of DNA.The example of antimetabolite comprises capecitabine (capecitabine), chlorine deoxyadenosine (chlorodeoxyadenosine), cytosine arabinoside (cytarabine) (and activity form, ara-CMP), cytosine arabinoside (cytosinearabinoside), dacabazine, floxuridine (floxuridine), NSC-118218 (fludarabine), 5-fluorouracil (5-fluorouracil), gemcitabine (gemcitabine), hydroxyurea (hydroxyurea), Ismipur (6-mercaptopurine), methotrexate (methotrexate), pentostatin (pentostatin), trimetrexate (trimetrexate) and 6-thioguanine (6-thioguanine).

" resisting mitosis " refers to disturb mitotic chemotherapeutic, normally forms by destroying microtubule.The resisting mitosis examples for compounds comprises nvelbine (navelbine), paclitaxel (paclitaxel), docetaxel (taxotere), vinblastine (vinblastine), vincristine (vincristine), vindesine (vindesine) and vinorelbine (vinorelbine).

Within the scope of the present invention, the chemical drugs that is to destroy malignant cell and tissue of " chemotherapeutic " feeling the pulse with the finger-tip.Chemotherapeutic comprises micromolecule, nucleic acid (as antisense molecule, ribozyme, siRNA molecule etc.) and protein (as antibody, antibody fragment, cytokine, enzyme and peptide hormone), when in order to prevent or treat cancer or other malignant tumor when being administered to the patient, it has Graft Versus Tumor.Chemotherapeutic is often based on the mechanism of action classification, as alkylating agent, anti-metabolism and antimitotic agent.

Term " therapeutic alliance " refers to that therapeutic scheme relates to and uses two kinds of different therapies at least, to reach the therapeutic effect that needs.For example, therapeutic alliance can comprise uses the different composition of two or more chemisms, as the chemotherapeutics and the marrow protectant of fast-acting.Perhaps, therapeutic alliance can comprise uses one or more chemotherapeutics and gives radiotherapy and/or operation or other means, improves patient's quality of life or treatment cancer.Under the situation of using the different composition of two or more chemisms, should understand active component and can be used as the part of same compositions or use as different components.When using as the compositions of separating, the compositions that comprises the different activities composition can be by identical or different approach, adopt identical various dose scheme, and while or do not use simultaneously is all according to the needs of particular case and according to attending doctor's decision.Equally, when one or more chemotherapeutic and for example radiotherapy and/or operation associating, medicine can give before or after operation or radiotherapy.

" intercalator " refers to self to insert the chemotherapeutics between adjacent base pair in the double chain DNA molecule, its destroy dna structure and disturb dna replication dna, genetic transcription and/or DNA conjugated protein with the combining of DNA.

" monotherapy " refers to that therapeutic scheme is based on giving a kind of treatment compounds effective, no matter be that single agent is used or repeatedly used in a period of time.

Under the business-like background of medicine, term " promotion " etc. refers to cause prescription, supply, purchase and/or the application of chemical compound, compositions or therapeutic scheme directly or indirectly by the activity of discovery, research, exploitation and/or business-like manufacturer, the distributor of the concrete medical compounds, compositions or the therapeutic scheme that participate in being paid close attention to or other entity carried out or initiated any and all informational, persuasion property and science.Such activity can be directly towards supply with sell in the chain anyone, include but not limited to medical professional (as doctor and nurse), pharmacists, health care management person, insurance company or government representative and patient's (comprising potential patient).In other words, the primary and foremost purpose that promotes is sale or use and/or the interest that stimulates certain drug chemical compound, compositions or therapeutic scheme, and any activity of therefore serving for this purpose has constituted " promotion " of certain drug chemical compound, compositions or therapeutic scheme.

Article according to compositions, method, machine or the manufacturing of " can patent " of the present invention are meant that when studying this theme has satisfied all legal condition about patentability.For example, about novelty, unobviousness etc., if studies show that afterwards, one or more claim have comprised that one or more will destroy the embodiment of novelty, unobviousness etc., and the claim that then is defined on the embodiment that is restricted to " can patent " is clearly got rid of the embodiment that can not obtain patent.Same appended claim also will be interpreted as the wideest zone of reasonableness being provided and keeping its effectiveness.In addition, submit to or time of license to time that the effectiveness of one or more claims is queried from the application, if one or more legal condition about patentability is revised, change if perhaps estimate the standard whether specified conditions about patentability satisfy, this claim should explain in the following manner that (1) keeps its effectiveness and (2) that the wideest reasonable dismissal is provided in this case.

Term " the acceptable salt of medicine " refers to keep the salt of the biopotency and the characteristic of The compounds of this invention, and it is not that biology or others are undesirable.Under a lot of situations, chemical compound of the present invention can form acid and/or alkali salt under the condition that has amino and/or carboxyl or group similarly.The acceptable acid salt of medicine can prepare from inorganic and organic acid, and the acceptable base addition salts of medicine can be from inorganic and organic base preparation.Summary about the acceptable salt of medicine is seen Berge, et al. ((1977) J.Pharm.Sd, vol.66,1)." the acceptable nontoxic salts of medicine " refers to nontoxic medicine acceptable inorganic or organic acid or nontoxic salts inorganic or that organic base forms.For example, salt comprises from deutero-salt such as mineral acid example hydrochloric acid, hydrobromic acid, sulphuric acid, sulphonyl amino acid, phosphoric acid, nitric acid, and from organic acid such as acetic acid, propanoic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pounce on acid (pamoicacid), maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, fumaric acid, methanesulfonic acid and toluenesulfonic acid etc.Salt also comprises from inorganic base, as the salt of ammonia, oxyethylamine and hydrazine.The organic base that is suitable for comprises methylamine, ethamine, propylamine, dimethylamine, diethylamine, trimethylamine, triethylamine, ethylenediamine, oxyethylamine, morpholine, piperazine and guanidine.

" a plurality of " refer to above one.

Term " Rituximab (rituximab) the is difficult to treat " meaning is used rituximab treatment before being, but decision according to doctor or treatment expert, because the disease that the Rituximab therapy that single medicament or therapeutic alliance are used is difficult to treat (be defined as in 6 months of whole rituximab treatment and do not react or PD), be not suitable for further treatment, and/or rituximab treatment before had untoward reaction, make further treatment can not get guaranteeing.

Before looking like and be, term " anti-CD 20 is difficult to treat " uses pharmaceutical treatment with the CD20 AI, but decision according to doctor or treatment expert, because the disease that is difficult to treat of the anti-CD20 agent that single medicament or therapeutic alliance are used (be defined as in 6 months of whole anti-CD20 treatments and do not react or PD), be not suitable for further treatment, and/or rituximab treatment before had untoward reaction, make further treatment can not get guaranteeing.

" the S phase " of cell cycle refers to the period of Chromosomal duplication.

Term " kind " is used for this paper under different condition, as the concrete kind of chemotherapeutic.In each condition, term refers to that this class chemistry of indication is distinguished unconspicuous molecule monoid under these specified conditions.

" object " or " patient " is meant need be by the animal of the effective treatment for the treatment of of molecule of the present invention.Treatable animal is according to the present invention includes vertebrates, and mammal such as cattle, dog, horse, cat, sheep, pig and primates (comprising people and non-human primates) animal is particularly preferred example.

When " treatment effective dose " referred to be administered in the object of this treatment of needs, active component was enough to produce the amount of therapeutical effect.Under the condition of treatment of cancer, " treatment effective dose " is in the one or more parameters relevant with cancerous cell survival or metabolism, generation has the amount of the change of objective measurement, comprise the increase of the one or more gene expressions relevant or minimizing, tumor load reduction, cancerous cell cracking with particular cancers, in biological specimen (as the aliquot of biopsy and body fluid such as whole blood, blood plasma, serum, urine etc.) detect one or more cancer cell death labellings, to inducing of inducing cell programmed death or other cell death approach etc.Certainly, the treatment effective dose according to the body weight of concrete object and the disease that will treat, object and age, degree of being in a bad way, selected specific compound, will according to application program, time of application, method of application etc. change, all these can be determined at an easy rate by those of ordinary skill in the art.Will be appreciated that under the situation of therapeutic alliance the treatment effective dose that constitutes the active component that the treatment effective dose of given activity composition can constitute when using with monotherapy (being that therapeutic scheme only adopts a kind of entity chemical drugs as active component) is different.

Term " treatment " meaning is any processing to disease or disease, comprises prevention or protects exempt to take a disease disease or disease (promptly causing clinical symptoms no longer to develop); Suppress disease or disease (promptly stoping or suppress the development of clinical symptoms); And/or palliate a disease or disease (promptly causing clinical symptoms to disappear).The final incident of inducing will be appreciated that not to be always to distinguish " prevention " and " inhibition " disease or disease, because can be the unknown or potential.Therefore, term " prevention " is interpreted as having constituted a class " treatment ", not only comprises " prevention " but also comprise " inhibition ".Term " protection " thereby comprise " prevention ".

Summary of the invention

An object of the present invention is, by being applied in the chemical compound (as bendamustine) that causes mitosis catastrophe (catastrophe) in the cancerous cell, use separately or combine, provide the method that can patent for treatment is characterised in that the anti-dead cancer of cancerous cell with other chemical compound and/or treatment.In preferred embodiments, these methods comprise determining whether the patient suffers from the cancer that is characterised in that the anti-death of cancerous cell, if, to the bendamustine of patient's administering therapeutic effective dose.Another purpose of invention relates to during the using of treatment of cancer or one or more periods afterwards, detects in patient's biological specimen of gathering on the basis of cancer cell death labelling, estimates the effectiveness of treatment of cancer.

Therefore, one aspect of the present invention relates to the method that patents for the treatment of the cancer patient, described cancer patient's cancer is characterised in that cancerous cell is anti-dead, be cancerous cell antagonism apoptosis or other program cell death approach, and cell shows multi-drug resistance (MDR), this is to be applied one or more alkylating agents, and it is inductive to use or combine with anti-CD20 such as Rituximab institute separately.These methods comprise to chemical compound patient's administering therapeutic effective dose, cause mitosis catastrophe in anti-dead cancerous cell.Such cell comprises the cell that resists drug-induced apoptosis.The example of described cell comprises the cell of p53 defective, normally comprises the results of mutation that disappearance or this gene delection are arranged in the gene of the p53 that encodes.The representational example of such cancer comprises Fei Hejiejinshi (Hodgkin ' s) lymphoma (" NHL ") and chronic lymphocytic leukemia (" CLL ").Inducing the particularly preferred chemical compound of mitosis catastrophe is the alkylating agent bendamustine.Therefore, related fields relate to and comprise and identify that the particular cancers cell is anti-dead cancerous cell, be used in afterwards induce mitosis catastrophe in the described cell chemical compound separately or with the Therapeutic Method of other chemotherapeutic, adjuvant, operation and/or radiotherapy combined treatment.In addition, can monitor the effectiveness of described therapeutic scheme, estimate the treatment of specific monotherapy or conjoint therapy and can reach required effect.

Another aspect of the present invention relates to some relevant method that patents for the treatment of cancer, particularly is characterised in that the anti-dead cancer of cancerous cell.These methods comprise when at least a portion cell that comprises cancer and are in cell cycle S during the phase, give the chemical compound of patient's administering therapeutic effective dose.In some embodiments, use to the patient that to order about the result that cancerous cell enters the chemical compound of S phase be that at least a portion of patient's cancerous cell is driven the into S phase.Bendamustine is the particularly preferred chemical compound that cancerous cell enters the S phase that orders about.Because bendamustine is applicable to cell driven in the S phase, other preferred embodiment comprise use subsequently one or more other have more the chemotherapeutics of activity (bringing into play bigger therapeutical effect, for example cytotoxicity) during the phase in cell cycle S when cell.In described method, use subsequently one or more other chemotherapeutic preferably occur in bendamustine use the back at least about 10 minutes, preferably at least about about 60 minutes of 30-or longer, though preferably using described other medicine occurs in bendamustine and uses within about 72 hours of the back preferred about 48 hours or shorter.In these preferred embodiments of a part, other chemotherapeutic is used in about 30 minutes to about 36 hours after using bendamustine, preferably in about 30 minutes to 24 hours after using bendamustine, under some situation, after using bendamustine about 30 minutes to 6 in about 12 hours.Relevant method comprises the toxicity that minimizing is relevant with treatment of cancer.Such method comprises the bendamustine of using the treatment effective dose of a plurality of dosage to the cancer patient.First dose just is enough to cause unwanted toxicity.In such incident, but the delay control secondary is used (or subsequent dose), goes down until unwanted toxicity.In some cases, bendamustine also can change at the application dosage of different time.

Therefore another aspect of the present invention relates on the basis of using alkylating agent (as bendamustine), estimates the method that patents of the effectiveness of cancer therapies, and this method can be monotherapy or conjoint therapy during whole therapeutic process or afterwards.When using when estimating after comprising the therapeutic scheme of using alkylating agent (as bendamustine), preferred earlier through time enough, make alkylating agent can bring into play its due or need therapeutical effect.In such method, from from detect patient's the biological sample cancer cell death labelling relevant with curative effect (that is, produce by dying or dead cancerous cell or the molecule (for example protein, Hydrocarbon, lipid, nucleic acid or other molecule) that discharges and as lose cell viability, can not breed, old and feeble isophenous) determine whether used treatment effective.。Preferred cell death marker comprises that the level of adenylate kinase 3 enzyme activity level, PARP cleaved products and cell viability reduce.According to labelling, such detection can be qualitative, sxemiquantitative or quantitative.The existence of the labelling that detects or level show that pool treats and whether have or once effective.

Another aspect of the present invention, invention relate to and to suffering from one or more alkylating agents and anti-CD20 agent (for example Rituximab) are had resistance or the patient of the cancer that is difficult to treat uses on the basis of bendamustine, to treatment for cancer.It is the cancer of feature that preferred these methods are used to resist with the anti-death of cancerous cell.Related aspect of the present invention relates to the method for processing transactions in described treatment for cancer, comprise the cancer that promotes bendamustine to be used to handle the cancer that is difficult to treat or be characterised in that the anti-death of cancerous cell, particularly use the cancer of the therapeutic alliance refractory of one or more alkylating agents and anti-CD20 agent such as Rituximab.Also have an aspect whether to relate to patient's cancer to bendamustine treatment sensitivity.Will be appreciated that and to adopt any evaluation that is applicable to bendamustine sensitivity.In the certain preferred embodiments of these methods, the cancerous tissue cell sample of gathering from the patient partly or entirely in that virose chemical compound does not exist, makes and is exposed to bendamustine under the growth conditions of cancer cell multiplication to cancerous cell.Carry out sensitivity assessment based on analysis result then.For example, and compare, propagation lowers and shows cell, and promptly patient's cancer be basic treatment sensitivity to bendamustine.Otherwise not effect (or improving propagation) demonstration lacks sensitivity.

The another one aspect of invention relates to the application of bendamustine in the medicine of preparation treatment cancer, described cancer is to be characterised in that the anti-dead cancer of cancerous cell or to treat intractable cancer, particularly uses the cancer of the therapeutic alliance refractory of one or more alkylating agents and anti-CD20 agent such as Rituximab.Preferred described medicine comprises the bendamustine for the treatment of effective dose.

The accompanying drawing summary

Present patent application comprises at least one colored drawing.The duplicate that has the present patent application of color drawings provides in request and after paying necessary fee.

Fig. 1 has two test group, A and B, and each shows gene expression profiles.These two test group are presented among the non_hodgkin lymphoma cell line SU-DHL-1, with the gene expression that contains Affymetrix gene chip (U133A) mensuration that surpasses 12,000 knowns.Bendamustine is at IC ₅₀(25 μ M; Band 1) and IC ₉₀(35 μ M; Band 2) test down.Chlorambucil (5 μ M; Band 3) and cyclophosphamide metabolite phosphamide chlormethine (50 μ M; Band 4) at IC ₉₀Following test.Expose back 8h separating mRNA.Bunch figure (clustergram) representative that A. shows and contrast (diluent, DMSO) relatively, preceding 100 modulateds water saving the highest flat gene.The gene that red representative is raised, the gene of blue representative downward modulation.B. this bunch figure shows simultaneously by whole three kinds of tested drug-induced genes.

Fig. 2 has three block diagrams, 2A, 2B and 2C.According to the narration of the part of method hereinafter, in the SU-DHL-1 of bendamustine, phosphamide chlormethine and the chlorambucil of the being exposed to toxic concentration of etc.ing, carry out the Q-PCR analysis.With to the analysis of the 18s RNA level standardization to input cDNA (input cDNA), the transcriptional level in the sample that is untreated is set at 1.Fig. 2 A shows that two kinds of representative p53-rely on the relative rna level of gene p21 and NOXA.Fig. 2 B shows four kinds of gene polo-class kinases (PLK-I), aurora kinases A and the B of participation M phase cell cycle chechpoint and the rna level of cell periodic protein B 1.Fig. 2 C demonstration relates to the gene EXO1 of DNA repair mechanism and the rna level of Fen1.The multiple of the contrast that post representative is handled with respect to DMSO-change average+/-SE.

Fig. 3 has shown several immunoblottings, has proved in NHL cell (SU-DHL-1), and bendamustine (50 μ M) compares with cyclophosphamide (50 μ M) and chlorambucil (4 μ M), and the apoptosis effect improves.In order to produce these immunoblottings, prepare product of cell lysis after 20 hours in exposure as described in method part hereinafter.Film is detected as point sample contrast with beta-actin, and be presented at the protein below of being regulated.The rectangular figure of left upper end represents the expression of Ser15-phosphorylation p53, detects with the phosphorus specific antibody.The side figure on the middle left side shows the expression of total p53 and p21.Lower left figure represents the expression of Bax.Right-hand figure shows total length PARP (the top) and with the PARP caspase fracture fragment of the antibody of the special caspase broken site of identification.

Fig. 4 is made up of two figure, and A and B represent the functional analysis of selected DNA repair mechanism.It is bendamustine rather than cyclophosphamide that Fig. 4 A shows, repairs (BER) by the base excision and causes the DNA damage reparation.Repairase Ape-1, a kind of no purine restriction endonuclease, in the BER approach, in the cytotoxic activity of bendamustine and cyclophosphamide metabolite phosphamide chlormethine (PM), bringing into play crucial effects, with Ape-1 inhibitor methoxamine (MX) its effect is estimated.Observe moving to left of curve with bendamustine and MX, show that the DNA damage of bendamustine generation is repaired by BER.Fig. 4 B shows that inhibition MGMT repairing activity does not influence the cytotoxicity of bendamustine.Repairase MGMT (O ⁶-methyl guanine-dnmt rna) effect in the bendamustine cytotoxic activity is with MGMT inhibitor O ⁶-benzyl guanine (O ⁶-BG) estimate.Add O ⁶-benzyl guanine does not significantly change the IC of bendamustine ₅₀, so bendamustine can not be induced O ⁶-alkyl guanine DNA addition product.Otherwise, O ⁶-benzyl guanine obviously makes cell to other chlormethine such as carmustine and phosphamide chlormethine (PM) sensitization.

Fig. 5 illustrates bendamustine and effectively enters tumor cell, cause long-time and large-scale DNA damage, it has caused the startup of at least three signal pathways: 1) may activate " classics " p53-dependency stress pathways as NOXA and Bax by the BCL-2 family member of short apoptosis, cause the strong activation of inherent apoptosis; 2) activate the DNA repair mechanism, as base excision fix tool, it can not activate by other alkylating agent that is used in usually among NHL or the CLL patient; With 3) suppress several mitosis outposts of the tax office, as kinases PLK-I and Aurora A and B.Though do not wish to be limited in the concrete theory, according to estimates, the inducing DNA damage simultaneously and the inhibition mitosis outpost of the tax office have stoped the tumor cell just effectively DNA plerosis damage before the experience mitosis that is exposed to bendamustine.Thereby cell enters mitosis with impaired DNA, and the cell that perhaps can not proceed " routine " p53-dependent cell programmed death will the death by mitosis catastrophe.This alternate programmed cell death approach is together with the strong activation of traditional apoptosis, according to believing that external where bendamustine be and in the tumor patient that chemical drugs is difficult to treat, and kills the reason of drug resistance cancerous cell very effectively.

Fig. 6 is a rectangular histogram, has shown several " eluting " experimental sessions that embodiment 3 hereinafter describes, the result that the adenylate kinase that carries out is analyzed.In these experiments, the SU-DHL-1 cell was handled 30,60 or 90 minutes with 50 μ M bendamustines, 20 μ M phosphamide chlormethine or 2 μ M chlorambucils.After regularly medicine was cultivated, cell cleaned in 1XPBS, and " eluting " specific chemotherapeutics adds fresh culture medium then.Cultured cell is 48 hours afterwards, carries out the analysis of adenylate kinase during this period of time later in cell conditioned medium liquid.The zero minutes that on behalf of medicine (or not having medicine), the pink post cultivate.Green post representative was cultivated 30 minutes, and orange post representative was cultivated 60 minutes, and the representative of purple post was cultivated 120 minutes.The result has drawn three kinds of medicines and " no medicine " contrasts the active level of adenylate kinase in the supernatant of comparing.The top of standard deviation each pillar on figure shows.

Fig. 7 with and Fig. 6 similar be rectangular histogram, shown several " eluting " experimental sessions that embodiment 3 hereinafter describes, the result that the adenylate kinase that carries out is analyzed.Difference between the result who describes between Fig. 6 and 7 is that the data that Fig. 6 shows relate to after the various medicines of culture medium " eluting ", cell culture 48 hours, and the data of Fig. 7 related to after " eluting " certain drug cell culture 72 hours.

Those skilled in the art will be appreciated that following explanation specifically narrated some preferred embodiment of the present invention, thereby just representational, are not the actual rangees of describing invention.Before being described in detail the present invention, should be appreciated that the present invention is not limited to described concrete molecule, system and method, these can change.It is also understood that terminology used here is not intended to limit the present invention's scope defined by the appended claims just in order to describe specific embodiments.

The specific embodiment

The present invention is based on unexpected discovery, and promptly the alkylating agent bendamustine has been given play to very fast cytotoxicity to multiple cancerous cell type, comprises the cancerous cell of traditional chemotherapy regimen refractory.Have been found that also following stationery body is described, compare that bendamustine is brought into play its toxic action by the binding mode of uniqueness with other anticarcinogen.

Bendamustine, two (2-chloroethyl) amino of 4-{5-[]-1-methyl-2-benzimidazolyl }, be a kind of nitrogen mustards chemotherapeutics.Bendamustine mainly shows alkylation activity, and promptly it is the DNA damage agent.When being applied to people (passing through intravenous injection usually), the bendamustine serum half-life is short, about 2 hours.Therefore, it is removed rapidly from the patient body system.Beat all is to have been found that by behind the cellular uptake bendamustine is brought into play its persistent cytotoxicity rapidly.In fact, such as the following examples 3 report, most of toxic action of chemical compound will be exposed under the medicament performance after about at least 30 minutes at cancerous cell.

Current typical bendamustine therapeutic scheme comprises and separately gives intravenous injection three times that each time contains the bendamustine of equivalent.Usually the first time infusion give infusion for the second time one day after, three weeks were infusions for the third time behind first time infusion afterwards.Adopt this scheme to be because bendamustine xicity related comprises bone marrow depression.Obtained the character of bendamustine serum half-life weak point and its snap action, then can reduce the xicity related of medicine by delay control secondary and subsequent applications.In fact, because in the report relevant with bendamustine treatment non_hodgkin lymphoma, accidental also may be lethal tumor dissolving on a large scale, so can increase the interval that medicine is repeatedly used, reduces the dissolved incidence rate of tumor.Except reducing deleterious toxicity, in particular treatment, strengthen the bendamustine administration interval and also can strengthen treatment window (window), promptly at this moment between in the section medicine bring into play its required treatment benefit.

Carry out the traditional method processing of compositions for use of the present invention according to the pharmaceutical formulation technology, generation is applied to the medical pharmacy (being medicine or therapeutic combination) of object, described object comprises human and other mammal, promptly is respectively " medicine " and " veterinary " medication.Referring to, for example latest edition Remington ' s Pharmaceutical Sciences (Mack Publishing Co., Easton, PA).Usually, chemical compound such as bendamustine and pharmaceutically acceptable carrier are combined into compositions.Said composition also can comprise following one or more: antiseptic; Solubilizing agent; Stabilizing agent; Wetting agent; Emulsifying agent; Sweeting agent; Coloring agent; Aromatic; Salt; Buffer agent; Coating agent; And antioxidant.

Carry out the used medicine of the present invention and can be prepared into free acid or alkali, preferred and suitable then chemical compound combination produces the acceptable salt of medicine.The statement of " the acceptable salt of medicine " refers to nontoxic, medicine acceptable inorganic or organic acid or nontoxic salts inorganic or that organic base forms.For example, described salt comprises from deutero-salt such as mineral acid example hydrochloric acid, hydrobromic acid, sulphuric acid, sulphonyl amino acid, phosphoric acid, nitric acid, and from organic acid such as acetic acid, propanoic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pounce on the salt of preparations such as acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, fumaric acid, methanesulfonic acid and toluenesulfonic acid.Salt also comprises from inorganic base, as the salt of ammonia, oxyethylamine and hydrazine.The organic base that is suitable for comprises methylamine, ethamine, propylamine, dimethylamine, diethylamine, trimethylamine, triethylamine, ethylenediamine, oxyethylamine, morpholine, piperazine and guanidine.

Under any circumstance, pharmaceutical composition is preferably made the form of the dosage unit that contains required curative of specified rate (as bendamustine) and carrier (being the acceptable excipient of physiology).Any such molecule is to the formation of the treatment effective dose of human or other mammal (or other animal), to depend on various factors, comprising the particular compound of the medical conditions of the type of disease or disease, age, body weight, sex, object, degree of being in a bad way, route of administration, employing.Therefore, dosage can alter a great deal, but can conventionally determine with standard method.In any case, " effective dose " of chemotherapeutic is to cause the Cytotoxic amount of wanting.For reaching the effect of wanting, the requirement of described treatment molecule will depend on numerous consideration items, comprise the ability of the cancer response molecule of specific molecular itself, the disease that will treat or disease, object, route of administration etc.For reaching the effect of wanting, the accurate amount of this required molecule depends on medical practitioner's judgement, and to each independent to as if specific.But suitable dose can be from every kg body weight approximate number nanogram every day (ng) active component to approximate number milligram (mg).

The preparation of therapeutic combination is well known in the art.Usually, such compositions is made injection, or is liquid solution or for suspension, still, also can make and is fit to the solid form that is dissolved in or floats on a liquid before the injection.Preparation also can be emulsified.The active treatment composition often can accept with physiology and with the compatible mixed with excipients of active component.The excipient that is suitable for is for example water for injection, saline, glucose, glycerol, ethanol etc. and combination thereof.In addition, if desired, compositions can contain the auxiliary agent of effectiveness of a small amount of raising active component such as moistening or emulsifying agent, antipyretic, stabilizing agent, thickening agent, suspending agent, anesthetis, antiseptic, antioxidant, antibacterial, analgesic, pH buffer agent etc.Described composition can provide additional treatment benefit, or acts on any potential side effect that prevention drug administration compositions may cause.

Compositions of the present invention to be containing the dosage unit preparations of conventional carrier, auxiliary agent and medium, can be Orally administered, the spray parenteral is used by sucking, use in (intranodally), the sheath in the rectal administration, knot and use or local application.Under therapeutic combination is situation for human administration, the drug application acceptable carrier.Term " medicine acceptable carrier " and " physiology acceptable carrier " are when referring to be applied to object, physiology can tolerate and not produce usually the molecular entity and the compositions of undesired allergy or similar improper reaction, described improper reaction such as stomach upset, dizziness etc.

For Orally administered, compositions can be any suitable form, comprising for example capsule, tablet, lozenge, pastille, powder, suspension agent or liquid.Liquid can be used as and has the compositions injection that suitable carrier comprises saline, glucose or water and use.Term " parenteral " comprises in subcutaneous, intravenous, intramuscular, breastbone or intraperitoneal approach infusion (comprise and continuing or the interruption infusion) and injection.The suppository of rectal administration can be by being solid with active component and suitable non-stimulated excipient relaxing the bowels with purgatives of warm nature as usual but preparing for the cocoa butter of liquid and/or Polyethylene Glycol mix under the physiological temp.

Compositions also can be prepared into solid form (comprising granule, powder or suppository).Compositions can and/or can contain traditional auxiliary agent such as antiseptic, stabilizing agent, wetting agent, emulsifying agent, buffer agent etc. through the operation of traditional medicine as sterilization.Orally administered solid dosage forms can comprise capsule, tablet, pill, powder and granule.In described solid dosage forms, reactive compound can mix with at least a inert excipient such as sucrose, lactose or starch.Described dosage form also can comprise the added substance except inert diluent, as lubricant magnesium stearate for example.Under the situation of capsule, tablet and pill, dosage form also can comprise buffer agent.Tablet and pill also can be prepared in addition and have casing.Orally administered liquid dosage form also can comprise the acceptable emulsion of medicine, solution, suspension, syrup and elixir, and it contains inert diluent such as the water that is generally used for this area.Described compositions also can comprise auxiliary agent, as wetting agent, sweeting agent, flavoring agent and aromatic.

Ejection preparation such as aseptic injection are moisture or contain oil suspension, can be according to known method with suitable dispersant or wetting agent and suspending agent preparation.Ejection preparation also can be aseptic injectable solution or the suspension in acceptable nontoxic diluent of parenteral or solvent.Can with Applicable media and solvent be water for injection, Rimger solution and isoosmotic sodium chloride solution etc.In addition, aseptic fixedly oil can be used as solvent or suspension media.For this reason, can comprise synthetic monoglyceride or diglyceride with the fixedly oil of any gentleness.In addition, found fatty acid such as the oleic acid purposes in the preparation injection.

As local application, the suitable local dose of compositions can be used one to four every day, preferred two or three times.During the using of this dosage also can have nonuser between two parties day.The suitable compositions of local application often comprises the active component of 0.001%-10%w/w, and for example the 1-2 weight % of preparation although it can comprise nearly 10%w/w, preferably is no more than 5%w/w, more preferably the 0.1%-1% of preparation.The preparation that is suitable for local application comprises and is suitable for transdermal liquid or semi-liquid preparation (as liniment, lotion, unguentum, cream or paste) that drop is fit to eyes, ear or nose are used.

Using the illustrative methods (as making it reach sterilization or aseptic condition) of compositions of the present invention, is obvious for the technical staff.Some method that is fit to this purpose proposes among the 7th Ed. (1985) at the The of Goodman and Gilman Pharmacological Basis of Therapeutics.Can be interrupted using of patient; Or use with speed progressively, that continue, constant or control.

The typical treatment effective dose of bendamustine treatment non_hodgkin lymphoma can about 60-120mg/m ², single agent in continuous two days is used, or between dosage a few days at interval.Can approximately per three to around be the cycle repetition.In order to treat chronic lymphocytic leukemia (CLL), can give bendamustine about 80-100mg/m at the 1st and 2 day ²Can after about 4 weeks, repeat this cycle.In order to treat Hokdkin disease (II-IV phase), in " DBVBe scheme ", can give bendamustine and accompany and used daunorubicin 25mg/m on the the 1st and 15 day ², used bleomycin 10mg/m on the the 1st and 15 day ², used vincristine 1.4mg/m on the the 1st and 15 day ², and 1-5 days bendamustine 50mg/m ², approximately every is to repeat in the cycle all around.For breast carcinoma, can give bendamustine (120mg/m at the 1st and 8 day ²) the 1st and 8 day methotrexate 40mg/m of associating ², and the 1st and 8 day 5-fluorouracil 600mg/m ², approximately every is to repeat in the cycle all around.As the second line treatment of breast carcinoma, bendamustine can give about 100-150mg/m at the 1st and 2 day ², approximately every is to repeat in the cycle all around.

Method of the present invention comprises monotherapy and therapeutic alliance.Under the situation of therapeutic alliance, the present invention has envisioned and has used two or more chemotherapeutics.Various chemotherapeutics are known in the art.Some have been licensed for one or more cancer indications of treatment in these chemical compounds.Other are before different phase clinical and in the clinical development.The chemotherapeutics example that is fit to implementation therapeutic alliance of the present invention comprises alkylating agent busulfan, carboplatin, carmustine, cisplatin, chlorambucil, cyclophosphamide, dacarbazine, hexamethylmelamine, ifosfamide, lomustine, chlormethine, melphalan, mitotane, mitomycin, pipobroman, procarbazine, streptozotocin, thio-tepa and triethylene melamine.The antimetabolite class that preferred and bendamustine share comprise capecitabine, chlorine deoxyadenosine, cytosine arabinoside (and activity form, ara-CMP), cytosine arabinoside, dacabazine, floxuridine, NSC-118218,5-fluorouracil, gemcitabine, hydroxyurea, Ismipur, methotrexate, pentostatin, trimetrexate and 6-thioguanine.Antimitotic chemical compound preferred and that bendamustine share comprises nvelbine, paclitaxel, docetaxel, vinblastine, vincristine, vindesine and vinorelbine.

The chemotherapeutics of other class comprises topoisomerase I inhibitor (as camptothecine (camptothecin), irinotecan (irinotecan), topotecan (topotecan) etc.); Topoisomerase II inhibitor such as daunorubicin (daunorubicin), amycin (doxorubicin), etoposide (etoposide), idarubicin (idarubicin), mitoxantrone (mitoxantrone) and teniposide (teniposide); Angiogenesis inhibitor (as reaching heparin (dalteparin), suramin (suramin) etc.); Antibody comprises that alemtuzumab (alemtuzumab), bevacizumab (bevacizumab), bud salol fourth (bexarotene), epratuzumab, gemtuzumab Ozogamicin Mylotarg CDP 771 (gemtuzumab ozogamicin), emol monoclonal antibody (ibritumomab tiuxetan), imatinib mesylate (imatinib mesylate), thunder are for bent thiophene (raltitrexed), revlimid, Rituximab, Herceptin (trastuzumab); Tyrosine kinase inhibitor; Intercalating agent; And hormone, as Anastrozole (anastrozole), estrogen, estrogen antagonist (as fulvestrant (fulvestrant) and tamoxifen (tamoxifen)), exemestane (exemestane), flutamide (flutamide), goserelin (goserelin), leuprorelin (leuprolide), nilutamide (nilutamide), levimasole, letrozole (letrozole), prednisone (prednisone) and toremifene (toremifene).Other chemotherapeutics comprises protein such as angiostatin, asparaginase, deniluekin diftitox, blood vessel endothelium chalone, imiquimod (imiquimod), interferon, interleukin 11 and Pegaspargase (pegaspargase).Also have other chemotherapeutics to comprise molecule, as 9-cis-retinoic acid (alitretinoin), hexamethylmelamine (altretamine), amifostine (amifostine), SN-11841 (amsacrine), arsenic trioxide, bleomycin (bleomycin), capecitabine (capecitabine), the carboxylic acid amides triazole, celecoxib (celecoxib), dactinomycin (dactinomycin), epirubicin (epirubicin), geldanmycin, 17-allyl amino-17-de-methoxy geldanamycin (17 AAG), irinotecan, the 2-methoxyestradiol, mithramycin (mithramycin), ametycin (mytomycin C), oxaliplatin (oxaliplatin), shark amine (squalamine), temozolomide (temozolamide), Thalidomide (thalidomide), tretinoin triapine and valrubicin.Those skilled in the art should know from experience, and these and other chemotherapeutics known now or exploitation afterwards can share with bendamustine, treats various tumors, comprises cancer.

Embodiment

Provide the following example to be used to illustrate some aspect of the present invention, and help those skilled in the art to implement the present invention.These embodiment must not think to have limited by any way scope of invention.

Embodiment 1

The molecules analysis of bendamustine mechanism of action

A. foreword

Bendamustine (Treanda ^TM, Salmedix, Inc.CA; Ribomustin ^TM(Ribosepharm GmbH, Munich Germany)) be a kind of antitumor agent, resisted the activity of various human tumors before clinical with clinical proof, as non_hodgkin lymphoma (NHL), chronic lymphocytic leukemia, solid tumor, breast carcinoma and small cell lung cancer, and multiple myeloma, comprise the intractable tumor of traditional DNA damage agent.Bendamustine, two (2-chloroethyl) amino of 4-{5-[]-1-methyl-2-benzimidazolyl the hydrochloric acid butanoic acid, initial synthetic be to have low toxicity and have alkylation concurrently and the medicament of antimetabolite character in order to produce.It has three substructure elements: 2-chloroethyl aminoalkyl group; The benzimidazole ring; With the butanoic acid side chain.2-chloroethyl aminoalkyl group and other nitrogen mustards, shared as cyclophosphamide, chlorambucil and melphalan.Though the butanoic acid side chain is also arranged in the chlorambucil, benzimidazole central rings system is the exclusive characteristics of bendamustine.Its unique anti-tumor activity characteristics may give the credit to this stage construction structure, and itself and the difference of traditional alkylating agent are come.

The DNA alkylating agent is extremely useful in the chemotherapy material.These medicines have unforeseeable mechanism of action, induce the ability of sequencing necrosis as in these chemical compounds some, and other (as platinum class (platins)) even the ability of inducing cell programmed death in lacking the cell of nuclear.Under the situation of " chlormethine ", main difference is present in the active collection of illustrative plates that their difference use is reflected in the various indications: cyclophosphamide is mainly used in treatment NHL; Chlorambucil is used for the treatment of chronic lymphocytic leukemia; Melphalan, the treatment multiple myeloma.

The antitumor action that bendamustine is main, identical with other alkylating agent, crosslinked from forming between the DNA marriage chain, though also can comprise other model of action.Therefore, the antitumor action of bendamustine can come from than the more complicated mechanism of simple classical alkylation activity, because the DNA chain interruption that bendamustine causes than cyclophosphamide or BNCU cause obviously more lasting, bendamustine show to the cell line of external and stripped anti-other alkylating agent to resistant activity, and proved that bendamustine share as single medicament and with other anticarcinogen, in several external tumor models, have unique short apoptosis activity.To the detailed molecular research of bendamustine effect precise mechanism also seldom.For this reason, use the mechanism of action of the abundant labor bendamustine of existing molecular tool.Present embodiment has been introduced result from the pharmacogenomics analysis analyzes the gene expression atlas that bendamustine causes in NHL cell line change.These pharmacogenomics analyses are verified by the functional analysis of the adjusting at startup, DNA repair mechanism and the mitosis outpost of the tax office of processing apoptosis signal.Finally, bendamustine is in in-vitro screening, 60 cell lines of human tumor with National Cancer Institute (National CancerInstitute) characterize, and have studied its comparison activity with respect to alkylating agent storehouse (being chlorambucil and phosphamide chlormethine (metabolite of cyclophosphamide)).Utilize the medicine genome analysis to carry out the analysis that gene expression atlas that bendamustine causes changes in NHL cell line, also produced the result.These pharmacogenomics analyses are verified by the functional analysis of the adjusting at startup, DNA repair mechanism and the mitosis outpost of the tax office of Q-PCR and processing apoptosis signal.In a word, these results show that bendamustine has the multiple mechanism of action different with other alkylation medicine, has explained the activity of bendamustine in the patient who suffers from the intractable tumor of traditional remedies.

B. materials and methods

A. cell

The SU-DHL-1 cell obtains from Santiago, California university (University CaliforniaSan Diego).Cell is gone up growth at the RPMI 1640 (Hyclone) that is supplemented with 10%FBS (Invitrogen) and 100 units/ml penicillin/streptomycin.

B. reagent

Bendamustine hydrochloride derives from Fujisawa Deutschland (Munich, Germany).(PM, NSC69945), the active metabolite of cyclophosphamide derives from National Cancer Institute (NCI) development treatment plan (Developmental Therapeutics Program, synthetic storage DTP) to phosphamide chlormethine cyclohexylamine salt.Other all reagent derives from commercial source, as Sigma-Aldrich.

C. drug treating

For the majority analysis of present embodiment, bendamustine, phosphamide chlormethine (active metabolite of cyclophosphamide) and chlorambucil concentration that select to use are based on their cytotoxic activity of MTT analysis through timing in three days.In DMSO, prepare medicine, in culture medium, dilute then.

D. prepare the RNA sample and analyze expression data

Cell (5 * 10 ⁶Cell) be collected in 1mL TRIZOL liquid (Invitrogen, San Diego, CA) in, separate total RNA according to the description of manufacturer then.Biotin labeled cDNA (15 μ g) and each gene chip array (Affymetrix, Santa Clara) hybridization.In brief, prepare the program that hybridizes to the material on the chip and comprise a plurality of steps.Separate total RNA and pass through photodensitometric quantitation.The generation of CDNA produces cDNA article one chain with the specific specific primer that can discern with the bonded polyA tail of T7 promoter (dT7-(T) 24) with dNTP, DTT and Superscript II.This method has reduced the needs to isolating poly-A (+) mRNA.The second chain is by adding dNTP, and is synthetic with dna ligase, DNA pol I and RNAse H, and before adding T4 archaeal dna polymerase is cultivated 5 minutes again, cultivates 2 hours at 16 ℃.Carry out cDNA column purification and quantitative.Before hybridizing, carry out in vitro transcription (IVT) with high density oligonucleotide array.This reaction to open the beginning material be 1 μ g cDNA, wherein add NTP, this NTP is less than 25% CTP and UTP replaces by adding 10mM biotinylation-11-CTP and 10mM biotinylation-16-UTP.The last T7 enzyme 6h that is added under 37 ℃ in the suitable buffer produces biotinylated IVT RNA, then it is carried out column purification (RNeasy, Qiagen).The segmental IVT RNA of chemistry (15 μ g) mixes in suitable buffer with control oligonucleotide, standard (comprising house-keeping gene) and salmon sperm dna, be heated to 95 ℃ 5 minutes, hybridize 16h with chip at 42 ℃ times.Za Jiao material is not washed off with 2XSSPE, adds the avidin of rhodophyll labelling then in reaction.Wash excessive fluorescent dye off, scan the fluorescence intensity (compound component is 7.5 square microns) of each compound component of chip then.

E. analysis of biological information

Developed the strategy and the method for analyzing gene expression data, it relates to the scanogram that utilization CORGON method is analyzed the Affymetrix gene chip.CORGON is the free software that uses, its core statistical method known (Sasik, et al. (2002), Bioinformatics, vol.18, no.12:1633-40).The gene that only presents p＜0.05 (95% confidence level) under at least a situation will consider to do further analysis.CORGON and Affymetrix Microarray Suite (AMS) 5.0 softwares comparison shows that the error of the first kind rate of CORGON is 4.4%, relatively under, AMS 5.0 is 29%.Selected gene comes sorting according to the meansigma methods or the peak width of regulating.Based on the similarity of expression pattern, select preceding 100 modulateds water saving the highest flat gene to carry out cluster.Adopt the hierarchical clustering method.What is extremely useful in the adjusting approach of major gene and this method in determining research in this primary classification.The gene cluster that shows common adjusting is accepted promoter Analysis.Next step is that GO3 analyzes, and is in Gene Ontology data base (network address: the inclined to one side and no monitoring tool of nothing of finding the significance,statistical condition relevant with this process www.geneontology.org).The GO3 facilitation process of the system core composition significantly regulated of identification.Three kinds of bodies (ontology) are arranged: molecular function in the data base; Bioprocess; And cell component.This analysis is carried out in the UCSD Center of AIDS Research Genomics Core Facility.

F. quantitative PCR analysis

Specific expression of transcribing is determined with quantitative PCR (Q-PCR).(Qiagen, Valencia CA) separate total RNA of each SU-DHL-1 cell precipitation of handling with the RNeasymini-prep test kit.CDNA makes according to the scheme of manufacturer of ThermoScript reverse transcription test kit (Invitrogen) and widow-dT primer.The Q-PCR amplification is with quantitatively (Bio-RAD, Hercules CA) carry out with the iCycler machine.Sample amplification contains 2xIQSybrGreen at 25 μ L ^TMCarry out in Mix (Bio-Rad) 12.5 μ L, each primer 1 μ M and the capacity corresponding to the cDNA volume of the total RNA of 80ng.Cycling condition is: 95 ℃ 5 seconds; Following 30 seconds of the suitable annealing temperature of each primer; And 72 ℃ 30 seconds.The target-specific of analyzing is verified by the melting curve analysis.Each expression of gene is carried out standardization with respect to each sample 18s expression.(method vol.25:402-408) is calculated the expression of each gene with respect to untreated contrast for (2001), Methods by Livak and Schmittgen then.Use BeaconDesigner ^TM(Premier Biosoft, Palo Alto, CA) design primer or design according to document.Primer sequence and annealing temperature following (each primer is write by 5 ' to 3 ', and the back is its SEQ IDNO):

Gene I	Forward primer	Reverse primer	Annealing temperature
Gene I	Forward primer	Reverse primer	Annealing temperature	18s p21 Noxa PLK-1 AuroraA AuroraB Cyclin B1 Exo 1	CGCCGCTAGAGGTGAAATTC(1) CCTCATCCCGTGTTCTCCTTT(3) ATTTCTTCGGTCACTACACAA(5) CTCAACACGCCTCATCCT(7) TCCTTGTCAGAATCCATTACCTGT(9) AGAGTGCATCACACAACGAGA(11) AGTGTGACCCAGACTGCCTC(13) TTGGTCTGGAGGTCTTGGAGA(15)	TTGGCAAATGCTTTCGCT(2) GTACCACCCAGCGGACAAGT(4) AACGCCCAACAGGAACAC(6) GTGCTCGCTCATGTAATTGC(8) GAATGCGCTGGGAAGAATTTG(10) CTGAGCAGTTTGGAGATGAGGTC(12) CAAGCCAGGTCCACCTCCTC(14) GAATCGCTCTTTCTTCGGAACTG(16)	55℃ 57℃ 55℃ 57℃ 55℃ 56℃ 57℃ 57℃

G. comparative analysis

Bendamustine experimentizes in the extracorporeal anti-tumor examination of being made up of 60 human tumour cell lines of NCI.Experiment comprises minimum 5 concentration in 10 times of diluents, and each examination repeats twice.Adopt 48 hours lasting drug exposure schemes.Sulphonyl rhodamine (Sulforhodamine) B analysis of protein is estimated the survival ability or the growth of cell.Relative method and related data can be by the website (network address: dtp.nci.nih.gov) the free acquisition of development treatment plan (DTP).The specified bendamustine of NCI number: NSC138783.

The h.Western engram analysis

The SU-DHL-1 cell was cultivated 20 hours with 50 μ M bendamustines, 2 μ M chlorambucils or 20 μ M phosphamide chlormethine.Cell cleans twice and is used in ice-cold lysis buffer (the 1M Tris-HCl (pH7.4) that directly adds before the cracking with 1xPBS, 1M KCl, 5mMEDTA, 1%NP-40,0.5% deoxidation choline sodium has 1mM sodium orthovanadate (sodiumorthovanidate), 1mM sodium fluoride, protease inhibitor cocktail (Roche, Nutley, NJ) and inhibitors of phosphatases mixture (Sigma, St.Louis, MO)) carry out cracking.Precipitate insoluble film, DNA and other precipitate, obtain the albumen supernatant.Protein concentration is analyzed (Pierce, Rockford, IL) mensuration with Bradford.20 μ g pyrolysis products separate on the polyacrylamide gel of 4-12% with gel electrophoresis, transfer on the nitrocellulose filter (Invitrogen), detects by immunoblotting with following monoclonal one is anti-: anti--p53, anti--phosphorylation p53 (Serospecific), anti--21, resist cracked PARP (caspase specificity cleavage site), all available from Cell Signaling (Beverly, MA); Anti--Bax and anti-PARP, available from BD Pharmingen (San Diego, CA); And anti--β actin, as the point sample contrast, available from Sigma (St.Louis, MO).One resists under soft vibration 4 ℃ of overnight incubation.Film is given a baby a bath on the third day after its birth inferior with 1xPBS, with two anti-(1: 4000) (Molecular Probes, Eugene, OR) at room temperature soft cultivation 2 hours that vibrate of Alexa Flour680 goat anti-mouse.Trace is given a baby a bath on the third day after its birth inferior with 1xPBS, scan on LiCor Odyssey scanning device.

I. analyze based on cells in vitro Ape-1 and AGT

Cell or with 6mM methoxamine (Sigma) or with 50 μ M O ⁶-benzyl guanine (Sigma) was cultivated 30 minutes in advance, and the two is respectively the inhibitor of Ape-1 base excision repairase and alkyl amidine transferring enzyme (AGT).Then with cellular exposure under the indicator of various concentration 72 hours.Analyze (13) with MTT and estimate cytotoxicity, measure IC ₅₀Be suppressed 50% o'clock drug level as untreated comparison values.(SanDiego CA) analyzes with 3.00 editions GraphPad softwares of GraphPad Prism.

J. cell cycle analysis

The SU-DHL-1 cell such as uses at malicious concentration (IC ₅₀) bendamustine (50 μ M), chlorambucil (4 μ M) or phosphamide chlormethine (50 μ M) cultivated 8 hours.Cell cleans with PBS, and is fixed in 20 ℃ 70% ethanol at least 1 hour.Fixed cell cleans hydration again by PBS.Cell is suspended in again by 10 μ g/ml propidium iodide (Calbiochem, La Jolla, CA), 10 μ g/mlRNAse A (DNase free, Novagen, Madison is WI) and in the propidium iodide dyeing liquor formed in PBS of 10 μ l/ml Triton-X (Sigma).(BDBiosciences, San Jose CA) analyze sample with FACSCalibur.With DNA ModFit LT (Verity HouseSoftware, Inc.Sunnyvale, CA) prototype software analysis of cells period profile.

The k.H2AX transforming focus forms

Cell Lab-Tek chamber slide (chamber slides) (Nalge Nunc Intl., Naperville, IL) on, in RPMI 1640 culture medium that are supplemented with 10%FBS, grow.Allow cell attachment after at least one day, cell is handled with DMSO or 50 μ M bendamustines in culture medium.Cell was cultivated 30 minutes at 37 ℃, washed twice with PBS then.Cultivated again 4 hours at 37 ℃.Cell washes twice with 1xPBS then, and cultivates 10 minutes fixed cells in-20 ℃ 100% ethanol.Clean then three times, washed 5 minutes with 1xPBS at every turn.(1xPBS of 10%FBS, 1%BSA) middle cultivation is 1 hour at the buffer of blockading under the room temperature.Slide resists-H2AX antibody (R ﹠amp with the one-level polyclone down at 4 ℃; D Systems, Minneapolis, MN) jolting incubated overnight.Antibody in the buffer of blockading with 1: 10,000 dilution proportion.Slide is given a baby a bath on the third day after its birth inferior with 1xPBS, and (OR) soft jolting was cultivated 45 minutes under the room temperature for Molecular Probes, Eugene with Alexa Flour 488 goat antirabbits two anti-(1: 4000).Slide is given a baby a bath on the third day after its birth time with 1xPBS, takes off the cabin then, adds in the cell to have fading of DAPI (Molecular Probes) and prevent agent (SlowFade Light Antifade), and seals slide with coverslip.Analyze with automatically controlled Zeiss AxioPlan 2e imaging microscope with DIC optics and fluorescence, Zeiss AxioCam HRm photographing unit and Zeiss Axiovision software 4.2 editions.

In the immunoblotting H2AX in the phosphorylation of Ser139 residue

Cell line growth is paved with RPMI 1640 culture medium that are supplemented with 10%FBS.Cell is washed twice with 1xPBS then, and be used in ice-cold lysis buffer (the 1M Tris-HCl (pH7.4) that directly adds before the cracking, 1M KCl, 5mM EDTA, 1%NP-40,0.5% deoxidation choline sodium, have 1mM sodium orthovanadate (sodium orthovanidate), 1mM NaF, protease inhibitor cocktail (Roche, Nutley, NJ) and inhibitors of phosphatases mixture (Sigma, St.Louis, MO)) carry out cracking.Precipitate insoluble film, DNA and other precipitate, obtain the albumen supernatant.Protein concentration is analyzed (Pierce, Rockford, IL) mensuration with Bradford.20 microgram pyrolysis products separate on the polyacrylamide gel of 4-12% with gel electrophoresis, transfer to nitrocellulose filter (Invitrogen, Carlsbad, CA) on, with polyclone anti--H2AX antibody (R ﹠amp; DSystems, Minneapolis MN) detects by immunoblotting.With 1: 2000 dilution proportion, film at room temperature softly vibrates to be cultivated 2 hours antibody in the buffer of blockading.Film is given a baby a bath on the third day after its birth inferior with 1xPBS, with two anti-(1: 5000) (Molecular Probes, Eugene, OR) at room temperature soft cultivation 2 hours that vibrate of Alexa Flour 680 goat antirabbits.Trace is given a baby a bath on the third day after its birth inferior with 1xPBS, scan on LiCor Odyssey scanning device.

C. result

A. gene expression atlas has been identified the characterizing gene of the bendamustine adjusting that is different from chlorambucil or cyclophosphamide

By measuring the survival rate of cellular exposure after under the medicine three days, measure bendamustine, chlorambucil and phosphamide chlormethine (cyclophosphamide active metabolite) etc. malicious concentration.For the analysis that this research occurs, the concentration of the bendamustine of selecting for use, phosphamide chlormethine and chlorambucil is based on these data (following table 1).These concentration have reflected that also the clinical of each medicine can the realization level.The analysis of Affymetrix gene chip is used for the SU-DHL-1 (non_hodgkin lymphoma cell line) that comparison crosses in drug treating and surpasses 12,000 expression of gene levels, cell and control cells comparison.SU-DHL-1 cell IC ₅₀Concentration (25 μ M) and IC ₉₀The bendamustine of concentration (35 μ M) is cultivated.Chlorambucil and cyclophosphamide metabolite phosphamide chlormethine are at IC ₉₀, promptly be respectively under 5 μ M and the 50 μ M, test.8 hours gene expression after the drug treating, identify this early stage stress near incident.

Genome analysis discloses, and is subjected between the reagent thing at three, and the adjusting of most genes is similar, shown in bunch figure of preceding 100 genes of being regulated (Figure 1A).Most of genes are raised (redness) after being exposed to medicine.The subgroup of gene is suppressed after drug treating transcribes (blueness).Importantly, identified one group of gene, it shows by the adjusting of bendamustine and is subjected to reagent variant than other two.

Known a lot of derivative genes (Figure 1B) have the p53-response element at its promoter region, and it is dependent to be considered to p53.The example of these genes has: p21 (the inductive cell division inhibitors of kinases of p53-); Wip1 (the inductive protein phosphatase 1 of p53-); NOXA (the inductive short apoptosis Bcl-2 family member of p53-); DR5/KILLER (DNA damage-derivable cell death receptor that ρ 53-regulates); And BTG2.What is interesting is, in 100 genes of being regulated of pro-, identified four members (member 6,9,10 and 10b) of tumor necrosis factor receptor super family.Several have shown in the external apoptosis approach of adjusting (REF, TRAIL/TNF apoptosis) in these genes pivotal role.Several in addition genes are at bendamustine and show opposite tendency (data not shown) between two chemical compounds in addition.These genes are subjected to the rise of two kinds of concentration of bendamustine, but all by chlorambucil and the downward modulation of phosphamide chlormethine.

In order to estimate the pharmacogenomics difference between bendamustine, chlorambucil and the phosphamide chlormethine, the result of gene mapping reanalyses with GO3 software, this software is not have partially and no monitoring tool, be used for (network address: www, geneontologv.org) discovery the condition that significance,statistical arranged relevant with this process Gene Ontology (GO) data base.In the cell that bendamustine is handled, obviously raise or the gene of downward modulation with surpass or to be lower than the gene of at least 1.5 times of cellular expressions of control treatment related with the bioprocess note that Gene Ontology (GO) alliance provides.Based on the hierarchy that GO explains, each back to back sub-project probability (p value) related with selected number gene calculated with probability.The cell that contrast that DMSO handles and bendamustine are handled is (at IC ₉₀The GO analysis result information of dosage) comparing is hereinafter in the table 2.In the table 2 below, the first row explanation general category, the second and the 3rd row are the numbering and the title of particular organisms process, last string is the p value of each process.P value GO3 computed in software.Find that four main function groups are added up horizontal adjustment by bendamustine: (1) DNA damage, stress, apoptosis; (2) DNA metabolism, DNA repairs, and transcribes; (3) cell proliferation, cell cycle, the mitosis outpost of the tax office; (4) cell is regulated.These are organized each and comprise that all several are found the bioprocess that is subjected to the obvious adjusting of bendamustine.Minimum and the bioprocess therefore tool statistical significance of P value is: to DNA damage stress reaction (GO6974); DNA metabolism (GO6259); And cell proliferation (GO8283).

Similarly analyze prompting with chlorambucil and phosphamide chlormethine, seldom have overlapping between the collection of illustrative plates that obtains with bendamustine and chlorambucil.Observe some similaritys of Gene regulation between bendamustine and the phosphamide chlormethine, though be only limited to " DNA metabolism, DNA repairs and transcribes " group.These results carry out the gene array result of quantitative verification bendamustine for selection specific gene product and more definite difference provides the foundation.

B. analyze with real-time quantitative Q-PCR and carry out the checking of genome analysis

The confirmation of array data and checking are undertaken by real-time quantitative PCR analysis (Q-PCR).When bendamustine was compared with the alkylating agent of other checks, several participated in p53-signal transduction, apoptosis, DNA repairs and the gene at cell cycle/mitosis outpost of the tax office is all regulated by difference.

Two examples verifying " classics " p53-dependent gene of selecting for Q-PCR are p21 (Cip1/Waf1), cell cycle protein dependent kinase inhibitor 1A and short apoptosis BH3-only Bcl-2 family member, NOXA.Be exposed to bendamustine after 8 hours, find that two genes are all induced in the SU-DHL-1 cell.Two genes also by etc. the phosphamide chlormethine and the chlorambucil of malicious concentration induce but degree much lower (Fig. 2 A).

One of the most surprising result who manifests from check analysis is that the differentiation of several mitosis-related genes is regulated, and comprises polo-class kinases 1 (PLK-1), Aurora kinases A and B and cell periodic protein B 1.These genes are considered to bring into play important function in the adjusting at the mitosis outpost of the tax office.The 60-80% that handled the mRNA down-regulated expression cause all these genes with bendamustine.By contrast, phosphamide chlormethine and chlorambucil have originally only been brought into play very little effect to these gene transcription, may be except Aurora kinases (Fig. 2 B).

In expressing, the mRNA of analyzing DNA-reparation gene nucleic acid excision enzyme-1 (EXO1) also shows difference.The inductive Exo1 up-regulated of bendamustine (2.5 times) (Fig. 2 C) is strong a little than phosphamide chlormethine (1.5-doubly) or chlorambucil (1.8-doubly).Fen1 (flap Cobra venom endonuclease 1) is also raised by bendamustine, and when the phosphamide chlormethine of malicious concentration such as using, this gene is also raised same level (Fig. 2 C).

The apoptosis signal transduction of bendamustine in the c.NHL cell

In order to scrutinize the molecular events that participates in bendamustine-inductive programmed cell death in the NHL cell, with the crucial proteic expression of apoptosis of immunoblotting assay monitoring.The result clearlys show, bendamustine can be effectively and promptly triggered typical p53-dependent cell programmed death approach.Detect as the antibody with specific recognition serine-15 residue phosphorylation, one of initial sum top incident is to induce the p53 phosphorylation.Observe serine-15 phosphorylation p53 and raised 8 times in being exposed to the SU-DHL-1 cell of bendamustine, and in the cell that the phosphamide chlormethine is handled, only see slight rise, the cell that chlorambucil is handled does not find to change (Fig. 3, the picture left above).

P53 is parallel with phosphorylation, and in the cell that bendamustine is handled, the expression of total p53 is risen strongly.The cell that chlorambucil is handled shows a small amount of increase of total p53, does not induce the p53 level to change and be exposed to the phosphamide chlormethine.Compare with the change of p53 protein expression level, observed variation in the p21 protein expression is slight for each medicine.Only in the SU-DHL-1 cell that bendamustine is handled, the protein expression of observing Bax (the short apoptosis Bcl-2 family member of crucial BH3-only) increases (Fig. 3, lower-left plate).

Comparing bendamustine and phosphamide chlormethine and chlorambucil on, the most surprising observed difference is to find when comparing the expression of PARP (poly-ADP ribose polymerase-1).PARP is the enzyme that crucial NAD needs, and is very important in the DNA repair mechanism.PARP also is " in early days " substrate of the Proteolytic enzyme caspase (caspase) of short apoptosis.The rapid minimizing (Fig. 3, top right plot) that the SU-DHL-1 cell of handling with bendamustine shows the PARP protein expression.The reason of PARP expression decreased is that it is cut by caspase, and this is confirmed (Fig. 3, middle right figure) by the appearance of the Proteolytic enzyme cleaved products of " cutting-specificity " antibody recognition.It should be noted that with etc. in the NHL cell handled of the phosphamide chlormethine of malicious concentration or chlorambucil, do not detect the change that PARP expresses.When with double phosphamide chlormethine (40 μ M) and the chlorambucil (4 μ M) that waits the toxic agent amount, and during the dosage of maintenance bendamustine (50 μ M), the result is similar (data not shown).Therefore, estimate the PARP expression and can be used for various purposes.For example, PARP analyzes the indication that concrete therapeutic scheme effectiveness can be provided, wherein the PARP expression decreased (preferably measure at protein level, for example by the PARP activity, the existence of PARP cleaved products, or the like) medicine used of indication has required effect.In addition, PARP analyzes can be used for determining that for example, the cell of tissue (for example perspectively, cell from biopsy or other biological sample) whether may react to particular treatment (as, bendamustine single therapy or wherein one of therapy utilized the combined therapy of bendamustine).

D. suppress the base excision and repair, but be not O ⁶-methyl guanine-dnmt rna reparation has been blocked the activity of bendamustine

With the effect of Ape-1 inhibitor methoxamine evaluation repairase Ape-1, it is a kind of apurinic acid restriction endonuclease, in the cytotoxic activity of bendamustine and cyclophosphamide metabolite phosphamide chlormethine, repairs the effect of playing key in (BER) in the base excision.Add methoxamine, the IC of bendamustine ₅₀About four times (from about 50 μ M to about 12 μ M) (Fig. 4 A) have been reduced.Otherwise, when adding methoxamine, the ICs of phosphamide chlormethine ₀Has only slight change.Results suggest BER may play important function in repairing the inductive DNA damage of bendamustine, rather than in repairing the inductive damage of cyclophosphamide.

O ⁶-benzyl guanine, a kind of known O ⁶-alkyl guanine-DNA alkyl-transferase (AGT) is also tested in the SU-DHL-1 cell the effect of the anti-tumor activity of bendamustine.The result shows, adds O ⁶-benzyl guanine does not improve the bendamustine cell toxicant and renders a service.Cyclophosphamide has obtained opposite result, points out differently with cyclophosphamide, and bendamustine is to O ⁶-methyl guanine-dnmt rna DNA repair mechanism does not rely on (Fig. 4 B) especially.

E. bendamustine hydrochloride causes that rapidly the double-strand break that causes exclusive cell cycle to change forms

In order to study the ability that bendamustine hydrochloride causes double-strand break (DSBs), two biochemical markers have been analyzed: the position of appraising and deciding of carrying out the H2AX histone with immunofluorescence; With phosphorylation with immunoblotting assay H2AX Ser139 residue.The result confirms that bendamustine hydrochloride is induced DSBs effectively and promptly in various tumor cells, comprise the cell line of multi-drug resistance and p53 defective.Cultivate with 50 μ M bendamustine hydrochlorides, cause to detect the formation of transforming focus in the nuclear being as short as in time of 30 minutes.Time-history analysis shows, is exposed to medicine (30 minutes) after 24 hours and in very short time continuing to be exposed to bendamustine hydrochloride, and medicine is eliminated (behind the eluting) subsequently, can detect the Ser139 phosphorylation of γ-H2AX.The inductive H2AX phosphorylation of bendamustine hydrochloride takes place early than other 2-chloroethyl amine DNA alkylating agent such as cyclophosphamide.The SU-DHL-1 lymphoma cell is exposed to 8 hours cell cycle analysis of 50 μ M bendamustine hydrochlorides and shows, the average S-phase distributes to have increased and surpasses 40%, and the G2M that does not follow stagnates.The chlorambucil and the cyclophosphamide of malicious concentration such as be exposed to, increased the S-phase respectively and distributed about 20% and 15%.These find explanation, and bendamustine hydrochloride energy inducing DNA double-strand break even if after exposing in of short duration 30 minutes.

F. use the NCI comparative analysis, bendamustine shows unique active collection of illustrative plates

Antitumor drug is found in 60 human cell lines of screening (NCI screening) before National Cancer Institute (National Cancer Institute) clinical, the cytotoxicity of evaluation bendamustine.The NCI screening is applicable to from the large-scale database that surpasses 45,000 chemical compounds and natural product, the relative effectivenes of more potential antitumor agent and known treatment agent.COMPARE analyzes the GI50 result's operation that produces as " seed " with bendamustine.Chemical compound with high Pearson correlation coefficient (PCC) often has similar mechanism of action.In the NCI screening, do not show that bendamustine and any medicine have strong correlation (＞0.8) (following table 3).With the first six of bendamustine coupling outside, have only methylating agent DTIC (dacarbazine) to show about 80% relevant concordance (r value).Otherwise, identified 25 active metabolite correlation coefficienies and surpassed 0.83 chemical compound with melphalan, chlorambucil or cyclophosphamide.In addition, in this screening, directly comparison shows that of melphalan, chlorambucil and cyclophosphamide sensitivity pattern has high correlation coefficient (0.762-0.934, data not shown) between these three medicines.These data show the statistics concordance and the shared high likelihood ratio of mechanism of action of sensitivity collection of illustrative plates of medicament.It is noticeable lacking dependency between other member of bendamustine and nitrogen mustards, and discloses the anti-tumor activity pattern that bendamustine has uniqueness.

D. discuss

These result of experiment that obtain with various biologies and analytical tool show, compare with chlorambucil with other chemical compound such as cyclophosphamide of sharing the clinical practice of identical " chlormethine " active part, and bendamustine has unique mechanism of action.

One of instrument that this research is adopted is the medicine genome method, and it can analyze and monitor the thousands of expression of gene levels that characterize fully simultaneously after target cell system cultivates with selected medicine, be successfully used to illustrate the mechanism of action of other cancer therapy drug.Its main advantage is to produce does not have the breath that believes one side only, and causes the evaluation of bendamustine unique effect mechanism, and itself and other DNA alkylating agent is made a distinction.

In this way, detect the intensive classical p53-dependency stress of bendamustine " feature ", in the cell of phosphamide chlormethine and chlorambucil processing, also exist, but intensity is much lower.Q-PCR analyzes and to have confirmed the gene array analysis, has confirmed to contain the rise of the gene of p53-response element, as p21 (Waf/Cip1) and NOXA.As the inhibitor of cyclin-dependant kinase, particularly those are at the G of cell cycle ₁The inhibitor that phase works is according to believing that p21/Waf1/Cip1 is mediation, to small part mediation, the inductive G of p53- ₁Stagnate.Cause the mechanism of inductive cell cycle arrest of p53-and apoptosis to be widely studied and to report.Bcl-2 autoploid 3 (the BH3)-only member of Noxa coding Bcl-2 protein family.NOXA demonstrates the target of the trans-activation that is the p53-mediation, and plays the effect of the mediation body of p53-dependent cell programmed death unusually by mitochondrial function.The Noxa defect map reveals the remarkable resistance of the proto-oncogene dependent cell programmed death that DNA damage is reacted in the mouse embryo fibroblasts.

By immunoblotting assay, detect the p53 (Ser15) of phosphorylation then, and the rise of Bax, the activation of the short apoptosis approach of p53 confirmed.Though before other nitrogen mustards being induced the stress of p53-mediation report has been arranged, with the cyclophosphamide metabolite (PM) that waits the toxic agent amount or chlorambucil relatively, bendamustine provides stronger and inducement signal faster.Find that also bendamustine is induced fast and PARP cutting widely, PARP is the enzyme of catalysis various proteic poly-(ADP-ribosylation).Though bendamustine is induced the PARP cutting, in the SU-DHL-1 cell, it is significant causing the difference of ability of PARP cutting between three kinds of medicines.Rapid induction PARP cutting may be brought into play crucial effects in the mechanism of action of bendamustine, given the importance of PARP to the DNA repair mechanism.In fact, DNA damage is reacted, cell activates PARP at first, causes the nearness of DNA and DNA repairase and transcription factor to increase.In addition, PARP is by apoptosis or the downright bad startup cell death that participates in.

The bendamustine that shows from the pharmacogenomics collection of illustrative plates and other another main difference of being tried chlormethine are the effect to polo-class kinases 1 (PLK-1), Aurora kinases (A and B) and cell periodic protein B 1 expression.Mitosis checkpoint kinase PLK-1 and Aurora have participated in a lot of aspects of Cycle Regulation, as activate and the assembling of deactivation CDK/ cyclin complex, centrosome and maturation and the mid-term-tour in later stage between the activation later stage promote complex (APC), also have cytokinesis.What is interesting is, when suppressing these outposts of the tax office instrumentality, observed the enhancing of DNA-damage medicine effect, together with mitosis catastrophe occurring with siRNA or with the target micromolecule.Mitosis catastrophe is a kind of form of cell death, occurs in mid-term, and is completely different with apoptosis on the form.Mitosis catastrophe can occur under the situation that does not have functional p53 or in the repressed cell of caspase dependent cell programmed death of routine.Therefore, mitosis catastrophe is the tempting mechanism of death of neoplastic cells, because also may work in the tumor cell that it is selected after with conventional chemotherapy medicine number wheel chemotherapy.Extensive and persistent DNA-damage that bendamustine causes and bendamustine may trigger mitosis catastrophe to the collaborative inhibition at the M-phase specificity outpost of the tax office in the cell that is subject to processing.This can explain the activity to the patient of refractory in the scheme that comprises cyclophosphamide and chlorambucil of bendamustine in the clinical data.

Verified, effectively the DNA repair mechanism is being brought into play pivotal role in the mechanism of action of DNA-alkanisation medicine.For the medicine of total similar chemical feature, activate discrete DNA medicine repair mechanism and also can give unique active collection of illustrative plates.Pharmacogenomics Analysis and Identification as herein described the DNA-repair gene of being had any different and regulating than phosphamide chlormethine and chlorambucil by bendamustine.Such gene, endonuclease 1 (Exo1) is and MutS and interactional 5 '-3 ' endonuclease of MutL congener, and involves the excision step of dna mismatch reparation and the processing and the reparation of double-strand break.Exo1 participates in somatic hypermutation and classification conversion reorganization, and therefore extremely important in B cell function and antibody generation.

In order further to study the difference of repair mechanism between bendamustine, cyclophosphamide and the chlorambucil, carry out functional analysis.Two main mechanism have been studied: dna repair protein, O ⁶-alkyl guanine-DNA alkyl-transferase (AGT); With no purine/apyrimidinic endonuclease Ape-1.AGT, a kind of ubiquitin enzyme is removed the O that is caused by several alkylating agents (comprising nitre ureas and triazenes class) ⁶-alkyl guanine-dna adduct.The clinical evidence prompting, the cerebral tumor is expressed high-level AGT, can therefore have more resistance to some DNA alkylating agent such as temozolomide.Nucleoside O ⁶-benzyl guanine (O ⁶-BG) provide effective deactivation AGT proteic method.In some cell lines, the benzyl guanine has clearly improved the toxicity of cyclophosphamide activated state.As shown here, add O ⁶-benzyl guanine has improved the cell toxicant of cyclophosphamide rather than bendamustine and has renderd a service, and shows that bendamustine do not induce the O that can be repaired by AGT ⁶-alkyl guanine DNA addition product.

Ape-1/Ref-1 is no purine/apyrimidinic endonuclease, repairs the very important effect of performance in (BER) approach in the base excision.BER is by various DNA-damage medicines, comprise DNA alkylating agent and dna methylation agent such as the inductive damage of temozolomide activation.The work of Ape-1 is in order to chemical compound methoxamine (MX), the special inhibitor-test of this enzymatic activity.Suppress Ape-1 with MX, improved the cytotoxic activity of bendamustine, shown effect BER.Do not observe change with the cyclophosphamide metabolite, the latent main difference of having shown between the activatory DNA repair mechanism of these medicines.

Possible antitumor agent and other known therapeutic agent are compared, be suitable for the external examination of NCI human tumor 60 cell lines.Also verified, in many cases,, then to estimate as the COMPARE statistical analysis program when finding that the pairing chemical compound has high correlation coefficient between the The selection result serial with this, these medicines have similar mechanism of action usually.The observed high correlation of nitrogen mustards melphalan, chlorambucil and cyclophosphamide is all like this in known alkylating agent, has confirmed that COMPARE analyzes the ability of finding combined effect mechanism.Except match with bendamustine preceding 6, have only methylating agent DTIC (dacarbazine) to show about 80% relevant concordance (r value).These results disclose, bendamustine with the relation of other known alkylating agent in, show unique mechanism of action.

Based on the result that present embodiment presents, the derivation mechanism of action of bendamustine is presented among Fig. 5.Bendamustine can effectively enter tumor cell, and induces long-time and DNA alkylation widely and fracture, may be because the high chemical stability of the ethylene imine conversion attitude ring that the benzimidazole member ring systems of bendamustine is given.Bendamustine is handled and has been started three main signal pathways: the 1) activation of " classics " p53 dependency stress pathways, cause the strong activation of inherent apoptosis, and it is by short apoptosis BCL-2 family member such as NOXA and Bax mediation; 2) activation of DNA repair mechanism, element (machinery) is repaired in excision as base, and it can't help to be usually used in other nitrogen mustards activation of NHL or CLL patient; With 3) suppress several mitosis outposts of the tax office, as kinases PLK-I and Aurora A and B.The co-induction DNA damage and the inhibition mitosis outpost of the tax office can make the tumor cell that is exposed to bendamustine before the experience mitosis, fully DNA plerosis damage.DNA with extensive injuries enters mitotic cell, perhaps can not proceed the cell of " routine " p53 dependent cell programmed death, will stand death by mitosis catastrophe.This alternate programmed cell death approach together with the strong activation of conventional cell programmed death, has shown that bendamustine why is in external drug resistance cell and suffering among the patient of the intractable tumor of chemotherapy effectively.Therefore, at other on, treat for the clinician in whole Therapeutic Method (armamentarium) of the patient who suffers from chronic non_hodgkin lymphoma and other leukemia, it is important replenishing that the bendamustine treatment will show.

Embodiment 2

The activity inducement of bendamustine in the NHL cell the dead approach of mitosis catastrophe

Embodiment 1 is described as mentioned, and bendamustine is the alkylating agent with unique effect mechanism, and has carried out clinical trial in the NHL of traditional DNA damage agent refractory and CLL patient.Bendamustine has been induced exclusive change in the NHL gene expression of cells, and finds expression in other 2-chloroethyl amine alkylating agent and lack cross tolerance.Quantitative PCR analysis confirms that after 8 hours, reduce in the cell by G2/M outpost of the tax office regulator Polo-class kinases 1 (PLK-I) and Aurora A kinases (AurkA) in the clinical related concentrations that is exposed to medicine for NHL cell line SU-DHL-1.When the active metabolite of cellular exposure, in same these genes, do not change at chlorambucil that waits the toxic agent amount or cyclophosphamide.

Ability to bendamustine inducing cytotoxic in the cell of the apoptosis that can not stand classical caspase mediation is investigated.The RKO-E6 colon adenocarcinoma cell of the MCF-7/ADR of multi-drug resistance and p53 defective exposes two or three days having only under 50 μ M bendamustines or 50 μ M bendamustines and the general caspase inhibitor of the 20 μ M zVAD-fmk.Increase though zVAD-fmk can suppress the inductive Annexin-V positive cell of bendamustine, bendamustine separately or with the cell of zVAD-fmk Combined Treatment in, the microscopic analysis of carrying out nuclear morphology with DNA stain DAPI shows, the microkernel incidence increase.The two is the labelling of mitosis catastrophe for multinuclear/micronucleus and unusual chromatin agglutination, and observes in the tumor cell that is exposed to microtubule bound drug such as Changchun alkaloids and Ramulus et folium taxi cuspidatae class.The cytotoxicity that the activation of mitosis catastrophe can enlarge bendamustine with and activity in the downtrod tumor cell of classical apoptosis approach.

Embodiment 3

In lymphoma and leukaemia, the bendamustine of quick acting activates effective apoptosis and cell death

As mentioned above, at other on, the alkylating agent bendamustine shows the chemotherapeutic activity that antagonism has the cancer of drug resistance, and when relevant antitumor agent with other compares, has unique mechanism of action.Consistent with the situation of other antitumor nitrogen mustards, the serum half-life of bendamustine in the mankind lacked (about 2 hours) relatively, and clinically uses by intravenous injection.The work purpose of present embodiment report is, when estimating the bendamustine short burst and being exposed to cancer cell in vitro, and the ability of inducing cell death and apoptosis.The activity of bendamustine is compared with the medicine of other structurally associated in this experimental model.The result who obtains shows, bendamustine is after (30 minutes) are exposed in the cell in short-term, the anti-tumor activity that performance is maximum.For obtaining these results, NHL cell line SU-DHL-1 short-term (30 minutes to 4 hours) is exposed under the 50 μ M bendamustines, cleans, and recovers 20 hours in no medicine culture medium.Cellular exposure reaches 30 minutes and promptly shows survival ability forfeiture widely in that bendamustine is short-and-medium, and this measures with various bioanalysiss, is included in after the drug exposure 48 and 72 hours, measures the interior ATP of cell and is discharged into adenylate kinase (Fig. 6 and 7) in the supernatant.On the contrary, cell (is the metabolite phosphamide chlormethine of chlorambucil, melphalan and cyclophosphamide with other member's processing of this class alkylating agent here; Data presented is chlorambucil and phosphamide chlormethine), when being exposed to these medicaments in the time of 30,60 and 120 minutes, survival rate has extremely slight loss.In these were analyzed, other these chlormethine needed the much longer exposure period (at least 4 hours) to induce the cytotoxicity suitable with bendamustine.With MTT is that the analysis on basis has confirmed these results, wherein in be exposed to medicine after 30 minutes, 4 hours or 72 hours 72 hours SU-DHL-1 and HL-60 cell, and the IC of bendamustine ₅₀Similar.By contrast, chlorambucil, melphalan and phosphamide chlormethine were cultivated 30 minutes with same these cell lines, exposed relatively with lasting (72 hours), demonstrated IC ₅₀Want high 10-20 doubly.

The ATP level is that basic ATP analyzes with following luciferase in the cell.The CellTiter-Glo substrate of 10mL CellTiter-Glo  reagent and appropriate amount is (according to the description of manufacturer; Promega Corp.) mixes mixture balance 10 minutes.This solution 100 μ L combine with the culture medium that 100 μ L contain cell then, allow mixture cultivate 10 minutes.With CCD is that basic plate reader detects luminous.

Selecting adenylate kinase (ADK) analysis is that ADK is discharged in the culture medium, perhaps under the condition of biological sample, is discharged into intercellular substance, blood etc. because the cell integrity of handling is loosened.Analyze in order in 96 orifice plates, to carry out ADK, in each instrument connection, the supernatant 20 μ L of the culture medium aliquot of centrifugation cell in short-term, (according to manufacturer specification, 20mL Cambrex ToxiLight reagent adds the Cambrex ToxiLight substrate of appropriate amount with the ADK reagent of 100 μ L prepared fresh; Cambrex Corp. NJ) mixes, and makes its balance 15 minutes.Cultivated reactant mixture then two minutes, kinase reaction is taken place.On plate reader, read the luminous of sample then immediately.

Also pass through aliquot and 180 μ L GuavaViaCount reagent (Guava Technologies, Hayward, CA) mixing, 1: 10 diluent that dilutes at once before the use, the evaluation cell survival rate of 20 μ L specific cells cultures.Each mixture was cultivated 5 minutes afterwards.Carry out the ViaCount cell counting with Guava PC flow-cytometer then, measure the viable count in per 1,000 total cell.Survival and dead cell are distinguished with dyestuff 7AAD, and it can diffuse in the dead or dying cell by the cell membrane that damages.

As described in embodiment 1, rapid induction PARP (poly-[ADP-ribose] polymerase) fracture is that bendamustine is induced dead sign in the NHL cell.The SU-DHL-1 cellular exposure reaches 30 minutes in 50 μ M SDX-105 weak points, and the flush away medicine was further cultivated 8 hours afterwards, observes the maximum fracture of PARP.In in a similar manner with 40 μ M phosphamide chlormethine, 4 μ M chlorambucils or 30 minutes cell of 2 μ M melphalans processing, do not observe the PARP fracture.Each used drug level has been represented the malicious concentration such as grade of comparing with 50 μ M bendamustines, and this is to be exposed under the medicine after 72 hours, with MTT[3-(4,5-dimethylthiazole-2-yl)-2,5-brominated diphenyl base tetrazolium] be basic assay determination.

The ascending-dose that MTT analyzes with various medicines carries out, and mensuration is killed 50% and is subject to processing the required valid density of cell.These analyses are carried out in 96 orifice plates.Concentration range reaches as high as 500 μ M.In each was analyzed, contrast comprised untreated cell and kills contrast.For the flat board that in " eluting " experiment, is used to check cell, centrifugal dull and stereotyped 5 minutes, sedimentation cell.Remove culture medium then, cell precipitation is washed once with IX PBS, is suspended in the fresh culture again then.Cell is containing 5.0%CO with the medicine of given dose ₂Atmosphere in, cultivated 3 days for 37 ℃.After three days, each hole adds 10 μ L MTT (12mM) reagent (5mg/mL MTT (Promega) is dissolved in the fresh culture, and filter-sterilized is kept at 2-8 ℃).Cultivate after four hours, each hole adds 100 μ L lysis buffers (20%SDS, 0.015M HCl).Mixture is containing 5.0%CO ₂Atmosphere in, 37 ℃ of placements are spent the night.In second day morning, under 595nm, measure the lysis level with the porous scanning spectrophotometer.

Handle human cancer cell line HL-60 with 100 μ M bendamustines or 12 μ M chlorambucils, obtain analogous result.The time that is exposed under the medicine is 30 minutes, 1 hour or 2.5 hours, wherein after the time of being mentioned, removes the culture medium that contains medicine, replaces with the fresh culture that does not contain medicine.

Gather, even if these results have shown after the of short duration cultivation of bendamustine and cancerous cell that can activate the unique ability of irreversible cell death approach, this ability is different from other relevant alkylating agent.The cytotoxicity of described quick acting has confirmed the effective clinical activity of bendamustine, and shows that it will be applicable to the various cancers of treatment, comprise the cancer of traditional chemotherapy refractory.

Embodiment 4 clinical datas

This research evaluation bendamustine suffer from recurrence or before effectiveness and toxicity among the NHL patient of chemotherapy regimen refractory.The patient of Rituximab refractory is PD in 6 months of treatment.

Method: this II phase multiple center trial is raised the B-cell NHL patient of the Rituximab refractory of suffering from the chronic of recurrence or transforming in the U.S. and Canadian 17 places.In 84% patient, found chronic histology's phenotype, and 16% there is the disease of conversion.Patient's The median age is 63 years old (38-84 year), and 88% has III/IV phase disease.The patient accepted bendamustine 120mg/m at the 1st and 2 day through 30-60 minute ², 21 days was 1 cycle, until 6 cycles.With international working group (International Working Group) standard test reaction.

The result: purpose treatment (ITT) crowd is that 75 intractable patients of 2 form by chemotherapy median before.ITT crowd's overall goal response rate (ORR) is 74%; 25% has reaction completely, and 49% has partial reaction, 12% stable disease, 14% PD.Former alkylating agent is treated (the contain alkylating agent of patient before at least once treated the back PD) among 15 patients rambunctious, and 10 people (67%) have experienced the target response to bendamustine.All reaction metas periods is 6.6 months, and chronic patients is 9.3 months, and transforming the patient is 2.4 months.

Conclusion: at the chronic of the Rituximab refractory of pretreat with transform among the NHL patient, the patient of the alkylating agent treatment refractory before comprising, bendamustine list medicine can produce persistent target response, and toxicity can be accepted, though pessimistic prognosis feature is arranged.

Though the present invention is described with reference to the foregoing description, be to be understood that the modifications and variations to it are also included within the spirit and scope of the present invention.Therefore, the present invention only is subjected to the restriction of appended claim.

According to the disclosure, open and all compositionss that require of this paper and method need not too much experiment and can prepare and carry out.Though the compositions and methods of the invention are described according to its embodiment preferred, but obviously various for those skilled in the art variations can be applied to this compositions and method, and according to the step of method described herein or the order of step, and do not deviate from the spirit and scope that the present invention limits with appended claim.

The level of the those of ordinary skill in the field under all inventions of mentioning in the description, application and demonstration the present invention.All inventions, application and open comprise requirement priority or other interests person, this with it in full as with reference to introducing, as each open separately specifically and separately being shown as with reference to introducing.

The suitably invention described of illustrative of this paper is lacking under any situation that does not have a concrete element disclosed herein and can implement.Therefore, for example, in each example of this paper, any term " comprises ", " substantially by ... form " and " composition " can replace with one of other two terms.The term that adopts is unrestricted with expressing illustrative term, and there is not purpose in the using and express of described term, any equivalent features or its part having got rid of performance and described need understanding in the scope that the present invention requires, and various modifications all are possible.Therefore, be to be understood that, though the present invention is concrete open with optional feature institute by embodiment preferred, but those skilled in the art can take the various modifications and variations of theory disclosed herein, and such modifications and variations are considered to be in the scope of the invention of appended claim qualification.

Claims

1. treatment method for cancer comprises and determines that the patient suffers from the cancer that is characterised in that the anti-death of cancerous cell, gives the bendamustine of described patient's administering therapeutic effective dose then.

2. according to the process of claim 1 wherein described cancer anti-cell programmed death.

3. according to the process of claim 1 wherein that anti-dead cancerous cell comprises the p53 defective.

4. be selected from non_hodgkin lymphoma and chronic lymphocytic leukemia according to the cancer that the process of claim 1 wherein.

5. treatment cancer patient's method comprises and uses bendamustine, wait at least about 30 minutes but no longer than about 48 hours, and use another kind of chemotherapeutics or when cell at cell cycle S more effective medicament during the phase.

6. according to the method for claim 5, chemotherapeutics was wherein used after using bendamustine in about 30 minutes to about 36 hours.

7. according to the method for claim 5, chemotherapeutics was wherein used after using bendamustine in about 30 minutes to 24 hours.

8. according to the method for claim 5, chemotherapeutics was wherein used after using bendamustine in about 30 minutes to 12 hours.

9. according to the method for claim 5, chemotherapeutics was wherein used after using bendamustine in about 30 minutes to 6 hours.

10. according to the method for claim 5, patient wherein suffers from the cancer that is characterised in that the anti-death of cancerous cell.

11. estimate the method for treatment of cancer effectiveness, comprise whether the level of determining cancer cell death labelling from the biological sample that the cancer patient gathers is relevant with the treatment effectiveness, wherein saidly determine during using purpose to be to treat the treatment for cancer scheme or carry out afterwards that therapeutic scheme wherein comprises uses alkylating agent.

12. according to the method for claim 11, alkylating agent wherein is a bendamustine.

13. estimate the method for the effectiveness of treatment of cancer, comprising:

A. treat cancer with the bendamustine of treatment effective dose;

B. wait for the required therapeutical effect of chien shih bendamustine performance when sufficiently long; And

C. measure the level of cancer cell death labelling, whether effective to determine with the bendamustine treatment.

14. reduce and comprise the relevant toxic method of treatment of cancer of using the bendamustine of a plurality of dosage to the cancer patient, comprise the bendamustine of using the treatment effective dose of first dosage to the patient, the dosage of described first bendamustine causes unwanted toxicity, and postpone to use second dose of bendamustine for the treatment of effective dose to the patient, begin to disappear until unwanted toxicity.

15. whether the cancer of evaluate patient to the method for bendamustine sensitivity, comprising:

A. under the growth conditions that does not exist the virose chemical compound of cancerous cell, at least a portion of the cell sample of patient's cancerous tissue is exposed to bendamustine, make cancer cell multiplication; And

B. whether estimate cancer to being exposed to the bendamustine sensitivity.

16., wherein estimate cancer and whether comprise the level of measuring the cancer cell death labelling to being exposed to the bendamustine sensitivity according to the method for claim 15.

17. according to the method for claim 16, cancer cell death labelling wherein is selected from the level of adenylate kinase 3 enzyme activity level, cell survival rate and PARP cleaved products.

18. the treatment method for cancer comprises and determines that the patient suffers from the cancer that is characterised in that anti-one or more alkylating agents and anti-CD20 agent, comprises the bendamustine to described patient's administering therapeutic effective dose.

19. according to the method for claim 18, wherein said cancer is a non_hodgkin lymphoma.

20. according to the method for claim 18, anti-CD20 agent wherein is a Rituximab.

21. be characterised in that with treatment cancerous cell resists the method for work of dead related to cancer, comprise that promoting bendamustine to be used for the treatment of is characterised in that the anti-dead cancer of cancerous cell.

22. according to the method for claim 21, cancer wherein is the cancer that is difficult to treat with the combination that comprises one or more alkylating agents and anti-CD20 agent.

23. the method for work relevant with the treatment for cancer that is difficult to treat comprises promoting that bendamustine is used for the treatment of the cancer that is difficult to treat.

24. according to the method for claim 23, the cancer that wherein is difficult to treat is the cancer that the combination with one or more alkylating agents and anti-CD20 agent is difficult to treat.

25. being used for the treatment of in preparation, bendamustine is characterised in that cancerous cell resists the application in the dead cancer drug.

26. bendamustine is used for the treatment of application in the cancer drug that is difficult to treat in preparation.

27. according to the application of claim 26, the cancer that wherein is difficult to the property controlled is the cancer that the combination with one or more alkylating agents and anti-CD20 agent is difficult to treat.