CN101044116A - 4-phenylsulfonamidopiperidines as calcium channel blockers - Google Patents

4-phenylsulfonamidopiperidines as calcium channel blockers Download PDF

Info

Publication number
CN101044116A
CN101044116A CN 200580034946 CN200580034946A CN101044116A CN 101044116 A CN101044116 A CN 101044116A CN 200580034946 CN200580034946 CN 200580034946 CN 200580034946 A CN200580034946 A CN 200580034946A CN 101044116 A CN101044116 A CN 101044116A
Authority
CN
China
Prior art keywords
alkyl
compound
hydrogen
piperidin
methyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200580034946
Other languages
Chinese (zh)
Inventor
埃尔弗里达·R·本亚明
陈正明
沙德有
莱基·塔费塞
萨缪尔·F·维克托里
约翰·W·F·怀特黑德
周晓明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Euro Celtique SA
Original Assignee
Euro Celtique SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Euro Celtique SA filed Critical Euro Celtique SA
Publication of CN101044116A publication Critical patent/CN101044116A/en
Pending legal-status Critical Current

Links

Abstract

The invention relates to piperidinyl compounds of Formula (I): or a pharmaceutically acceptable salt, prodrug, or solvate thereof, wherein R<SUP>1</SUP>-R<SUP>3</SUP> and Z are defined as set forth in the specification. The invention is also directed to an assay useful for identifying such compounds as N-type calcium channel modulators or blockers. The invention is also directed to the compounds of Formula (I) and compounds identified by the above assay, and the use of such compounds to treat, prevent or ameliorate a disorder responsive to the blockade of calcium channels, and particularly N-type calcium channels. Compounds of the present invention are especially useful for treating pain.

Description

4-phenyl-sulfamide piperidine compounds as calcium channel blocker
Background of invention
Technical field
The invention belongs to the pharmaceutical chemistry field.The present invention relates to new piperidinyl compounds and following discovery: these compounds have calcium (Ca 2+) effect of channel blocker.Especially, the present invention relates to be used to identify the high flux screening analytical method of these compounds.
Background technology
Calcium ion is brought into play basic role in the adjusting of many cell processes.Therefore must strict yet horizontal dimension in their cell be held under the strict dynamic control (Davila, H.M., Annalsof the New York Academy of Sciences, pp.102-117 (1999)).Voltage-gated calcium channel (VGCC) can be used as calcium and flows to a kind of important mechanisms in the cell in fast.Calcium channel is that described pore-forming subunit itself can form functional passage in heterologous expression system by pore-forming subunit (α 1) and one group of complementary or the modulability subunit constitutes different oligomer protein.Calcium channel is classified according to their pharmacology and/or electrophysiology character.Voltage-gated calcium channel is classified as three groups: (i) passage of high-voltage-activation (HVA), and it comprises L-, N-, P-and Q-type; (IVA) R-type passage (ii); The (iii) T-type passage (Davila, the same) of low voltage-activation (LVA).Voltage-gated calcium channel (VGCC) is also referred to as voltage-dependent ca channel (VDCC) or voltage-susceptibility calcium channel (VSCC).
Voltage-susceptibility calcium channel (VSCC) is regulated intracellular calcium concn, calcium concn influences multiple important neuronal function, as cell excitement, neurotransmitter release, hormone secretion, endocellular metabolism, neurosecretion activity and genetic expression (people such as Hu, Bioorganic ﹠amp; MedicinalChemistry 8:1203-1212 (2000)).N-type passage mainly is found in maincenter and the peripheral neurons, and it mainly is positioned at the presynaptic nerve ending.The mediator that these passages regulate are brought out by depolarize is moving from the required calcium current of the terminal release of cynapse.Pain sensation signal from outside circumferentially the transmission of central nervous system (CNS) be people such as (, J.Med.Chem.43:3474-3477 (2000)) Song by the N-type calcium channel mediation that is arranged in spinal cord.
This calcium channel of six types (that is, L, N, P, Q, R and T) is expressed (Wallace, M.S., The Clinical Journal of Pain 16:580-585 (2000)) in whole neural system.N-type voltage-susceptibility calcium channel is present in the upper layer of dorsal horn, is considered to regulate the pain course of processing by central mechanism.N-type calcium channel in the blocking-up dorsal horn surface can be regulated the excitability of film and suppress the release of neurotransmitter, causes pain relief.Based on animal model, Wallace (the same) suggestion, N-type calcium-channel antagonists has bigger pain relieving than sodium channel antagonist and renders a service.
N-type calcium channel blocker can be used for neuroprotective and pain relieving.Have been found that selective N-type calcium channel blocker ziconotide has analgesic activity in animal model, local and have neuroprotective activity people such as (, the same) Song in the ischemia model comprehensively.The example of known calcium channel blocker comprises flunarizine, fluspirilene, cilnipide, PD157767, SB-201823, SB-206284, NNC09-0026 and PD151307 (people such as Hu, the same).
Under multiple test and clinical condition, the retardance of N-type passage can prevent and/or weaken subjectivity pain and former and/or Secondary cases hyperpathia and allodynia (Vanegas, people such as H., Pain 85:9-18 (2000)).N-type voltage-gated calcium channel (VGCC) is brought into play main effect in the release of cynapse medium such as L-glutamic acid, vagusstoff, Dopamine HCL, norepinephrine, γ-An Jidingsuan (GABA) and calcitonin-gene-related peptide (CGRP).
Inhibition to valtage-gated property L-type calcium channel has shown that to neuroprotective be useful (people such as Song, the same).Inhibition to heart L-type calcium channel can cause ypotension.It is believed that the neuroprotective that tends to offset L-type calcium channel blocker fast with very big reduction of arterial pressure.Existence has the optionally needs of antagonist to N-type calcium channel rather than L-type calcium channel, to avoid potential ypotension effect.
The physiology related substrates can be followed the tracks of (Stein, W.D., Transport and Diffusion Across Cell Membranes by multiple physics, optics or chemical technology by moving of ionic channel, 1986, Academic Press, Orlando, Fla.).The analytical method of ion channel modulators comprises electric Physiological Analysis, uses the cell pair cell of microelectrode to analyze (Wu, C.-F., Suzuki, N., and Poo, M.M.J.Neurosci 3 (9): 1888-99 (1983)), that is, and the interior and patch clamp technique (Neher of cell, E. and Sakmann, Sci. Amer.266:44-51 (1992)) and the radioactive tracer ion technology B..When placing electrode, the spatial precision of patch clamp and full cell voltage pincers, current clamp and two electrodes voltage clamp Technology Need height.Can measure full cell currents with patch clamp technique and carry out functional analysis.But the treatment capacity of the analysis times of every day is very limited.
The radioactive tracer ion has been used in the biological chemistry and pharmaceutical research of ion transposition of cellular preparations passage control (Hosford, people such as D.A., Brain Res.516:192-200 (1990)).In the method, with cellular exposure for some time in radioactive tracer ion and activation part, wash this cell then, the counting contamination.Radiating a little isotropic substances is well-known (Evans, E.A., Muramtsu, M.Radiotracer Techniques and Applications, M.Dekker, NewYork (1977)), and their application allows to detect in high sensitivity the target material.But radio isotope needs a lot of security measuress.Therefore, used substituting and safer nonradioactive labeling's agent in the last few years more and more.
Use the optical means of fluoroscopic examination to be fit to substitute patch clamp and Radioactive tracer techniques.Optical means can be measured whole processes unicellular and many groups of cell intermediate ion streams.The advantage that detects transportation by fluorescence technique comprise these methods high-level sensitivity, temporal resolution, to the requirement of biomaterial suitably, do not have radioactivity and can the continuous detecting ion transportation to obtain dynamic information (Eidelman, O. wait the people, Biophys.Acta 988:319-334 (1989)).General Principle by fluoroscopic examination transportation is based on the photoluminescent property relevant with the compound displacement and has the dependent change of separating.
(Grinvald, A., Annu.Rev.Neurosci. 8:263-305 (1985) that electrical activity in the optical detection neurocyte is to use voltage-susceptibility film dyestuff and photodetector array to finish; Loew, L.M., and Simpson, L.L., Biophys.J.34:353-65 (1981); Grinvald, people such as A., Biophys.J.39:301-08 (1983); And Grinvald, people such as A., Biophys.J.42:195-98 (1983)).Developed and be used to measure optical means (Scarpa, A., Methods of Enzymology 56:301 (1979), Academic Press, Orlando, the Florida that calcium ion flows; Tsien, R.Y., Biochemistry 19:2396 (1980); Grynkiewicz, people such as G., J.Biol Chem.260:3440 (1985)).The flowing of calcium ion typically uses calcium-susceptibility fluorescence dye such as Fluo-3, Fluo-4, CalciumGreen to wait and detect.(Molecular ProbesInc.，Handbook of Fluorescent Probes and Research Chemicals，7 th ed.，chapt 1，Eugene，Oregon)。
Need new analytical method, it can be identified to regulate or block calcium ion and comprise the compound that N-type calcium channel moves by voltage-gated calcium channel.
Summary of the invention
The present invention relates to by the piperidinyl compounds of representing with following formula I as calcium (Ca 2+) purposes of channel blocker.Especially, the compound that has been found that formula I is selective N-type calcium channel blocker.
The present invention also relates to by using the formula I compound as described herein of significant quantity, treat, prevent or improve in the active over-drastic Mammals of calcium channel blocking the disease that described passage responds.Especially, the present invention relates to, treat, prevent or improve in the active over-drastic Mammals of N-type calcium channel blocking the disease that described passage responds by using the formula I compound as described herein of significant quantity.
Can be used for numerous compound of the present invention did not all report up to now.Therefore, one aspect of the present invention relates to the piperidinyl compounds of new formula I.
Another aspect of the present invention relates to the purposes of the compound of new formula I as N-type calcium channel blocker.
One aspect of the present invention relates to the compound of new formula X hereinafter, and pharmaceutical composition, and they are as the calcium channel purposes of N-type calcium channel blocker particularly.
Further aspect of the present invention provides a kind of by the formula I compound to the administration significant quantity that needs to treat, prevent or improve, treat, prevent or (for example improve apoplexy, head trauma, epilepsy, pain, acute pain, or chronic pain, it includes but not limited to neuropathic pain and inflammatory pain), migraine, mood disorder, schizophrenia, nerve degenerative diseases (for example, alzheimer's disease, amyotrophic lateral sclerosis (ALS) or Parkinson's disease), depression, anxiety, psychosis, hypertension or ARR method.
A further aspect of the present invention provides and a kind ofly is used for the treatment of, prevents or improve the retardance calcium channel pharmaceutical composition of the disease that responds of N-type calcium channel particularly, described pharmaceutical composition comprises the formula I compound of significant quantity, and it mixes mutually with one or more pharmaceutically acceptable carriers.
A further aspect of the present invention provides 3H or 14The compound of radiolabeled formula I of C or X and they are as the purposes of the radioligand of its binding site on the calcium channel.
The present invention also relates to SCREENED COMPOUND and identify calcium (Ca 2+) conditioning agent of passage or the high throughput analysis method of retarding agent.Analytical method of the present invention is preferred for screening the retarding agent of calcium channel.In one embodiment, analytical method of the present invention is used to screen the compound of retardance N-type calcium channel.Analytical method of the present invention is specially adapted to identify the compound in conjunction with being in the N-type calcium channel of inactivated state.
The present invention also relates to the purposes identified by analytical method described herein as the new compound of the retarding agent of N-type calcium channel.
The invention further relates to by the usefulness of using significant quantity analytical method compounds identified described herein, treat, prevent or improve in the active over-drastic Mammals of calcium channel blocking the disease that described passage responds.
Another aspect of the present invention relates to the compound of identifying by analytical method described herein as N-type calcium channel, and pharmaceutical composition, and described pharmaceutical composition is as the calcium channel purposes of N-type calcium channel blocker particularly.
A further aspect of the present invention provides a kind of by treating to needing, the usefulness analytical method described herein of the administration significant quantity of prevention or improvement is accredited as the compound of N-type calcium channel blocker, treat, prevention or improve apoplexy, head trauma, epilepsy, pain (as, acute pain, or chronic pain, it includes but not limited to neuropathic pain and inflammatory pain), migraine, mood disorder, schizophrenia, nerve degenerative diseases (for example, alzheimer's disease, amyotrophic lateral sclerosis (ALS), or Parkinson's disease), depressed, anxiety, psychosis, hypertension, or ARR method.
A further aspect of the present invention provides a kind of pharmaceutical composition that is used for the treatment of, prevents or improve the disease that retardance N-type calcium channel is responded, the usefulness analytical method described herein that described pharmaceutical composition comprises significant quantity is accredited as the compound of N-type calcium channel blocker, and it mixes mutually with one or more pharmaceutically acceptable carriers.
Other embodiments of the present invention and advantage will be listed in the following description, and can derive from following description, perhaps can grasp by implementing the present invention.By specifically noted key element and combination in the appended claims book, can realize and reach described embodiment of the present invention and advantage.
Should be appreciated that above summary and detailed description hereinafter all only are exemplary and indicative, is not to limit the present invention as claim.
Detailed Description Of The Invention
The piperidinyl compounds that one aspect of the present invention is based on following discovery: formula I can be used as Ca 2+The retarding agent of passage works.Find that based on this compound of formula I is considered to can be used for treating the disease that the retardance calcium channel is responded.In one aspect, have been found that the compound selective ground retardance N-type calcium channel of formula I, therefore, can be used for treating the disease that retardance N-type calcium channel is responded.
The compound that is used for this aspect of the present invention is the piperidinyl compounds of being represented by formula I:
Figure A20058003494600311
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1And R 2Be independently selected from hydrogen, alkyl, haloalkyl, halogen, alkoxyl group, halogenated alkoxy, cyano group, nitro, amino and hydroxyl respectively;
R 3Be selected from alkyl, thiazolinyl, cycloalkyl, cycloalkylalkyl, alkoxyalkyl, hydroxyalkyl, 2-tetrahydrofuran base, 3-tetrahydrofuran base, 2-tetrahydrofuran base alkyl, 3-tetrahydrofuran base alkyl, alkyl sulfonyl-amino alkyl and aminocarboxyl alkyl;
Z is selected from Z 1, Z 2, Z 3, and Z 4, wherein:
Z 1Be
Figure A20058003494600321
Z 2Be
Z 3Be
---CR 8R 9---(CH 2) O---D---R 14With
Z 4Be
——SO 2——R 15；
R 4And R 5Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol, aminoalkyl group and phenyl respectively; Or R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl;
R 6Be hydrogen and R 7Be selected from
Hydrogen;
Alkyl;
Hydroxyalkyl;
Alkoxyalkyl;
Haloalkyl;
Aminoalkyl group;
Cycloalkyl;
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group;
The optional benzyl that replaces with one or more substituting groups that are independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; With
The benzyloxy alkyl; Or
R 6And R 7Form C with the carbon atom that they connected 3-7Cycloalkyl; Or
R 7Be hydrogen; R 4Be hydrogen or C 1-3Alkyl; And R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl with the carbon atom that they connected;
R 8And R 9All be hydrogen or formation=O together;
R 10, R 11, R 12And R 13Be independently selected from hydrogen, alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido respectively;
R 14Be selected from
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
The optional naphthyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
Quinolyl;
Pyridyl;
With the phenyl that phenyl, benzyl, phenoxy group or benzyloxy replace, wherein each phenyl ring is optional replaces with one or two substituting group that is independently selected from halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino and cyano group; With
Alkyl, preferred n-propyl.
R 15Be phenyl or naphthyl, any is chosen wantonly with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, amino, alkylamino and dialkyl amido and replaces;
A is O, CH 2, or not have (covalent linkage) and B be CH, condition is when A is O, so R 8And R 9All be hydrogen; Or
A-B is CH=C;
D be C=O ,-CH=CH-or do not have (covalent linkage);
M is 0 or 1;
N is 0,1,2,3,4 or 5; With
O is 0,1,2 or 3;
Condition be when Z be Z 2, R 3Be alkyl, R 8And R 9All be hydrogen, A is CH 2, B is that CH and n are 1 o'clock, so R 10, R 11, R 12, or R 13In at least one is not a hydrogen.
At Z is Z 1Formula I compound in, with-NR 4R 5The carbon that base links to each other can be chiral centre.Therefore, configuration can be (R) or (S) on this carbon atom, preferably (S).
Because the compound of formula I is calcium (Ca 2+) retarding agent of passage, therefore, can treat much disease and illnesss by the flow of calcium ions mediation by using these compounds.Therefore, the invention provides a kind of treatment, prevention or (for example improve apoplexy, head trauma, epilepsy, pain, chronic pain, neuropathic pain, inflammatory pain, or acute pain), migraine, mood disorder, schizophrenia, nerve degenerative diseases (for example, alzheimer's disease, amyotrophic lateral sclerosis (ALS) or Parkinson's disease), depression, anxiety, psychosis, hypertension or ARR method.In each case, the method for this treatment, prevention or improvement need be given calcium channel blocker of the present invention or its pharmacologically acceptable salts, prodrug or the solvate of the administration significant quantity that needs this treatment, prevention or improvement.
In one embodiment, being used for compound of the present invention is the piperidinyl compounds of being represented by formula II:
Figure A20058003494600351
Or its pharmacologically acceptable salts, prodrug or solvate, wherein R 1, R 2, and Z such as above-mentioned definition.
In one aspect of the invention, being used for compound of the present invention is the piperidinyl compounds of being represented by formula III:
Figure A20058003494600361
Or its pharmacologically acceptable salts, prodrug or solvate, wherein Z such as above-mentioned definition.
Preferably, in the compound of formula I and II, R 1And R 2Be independently selected from hydrogen, halogen, alkyl, haloalkyl, cyano group, alkoxyl group, halogenated alkoxy and nitro respectively.More preferably, R 1And R 2Be independently selected from hydrogen, halogen, C respectively 1-6Alkyl, halo (C 1-6) alkyl, cyano group, C 1-6Alkoxyl group, halo (C 1-6) alkoxyl group and nitro; And more preferably be independently selected from hydrogen, halogen, C 1-3Alkyl, halo (C 1-3) alkyl, cyano group, C 1-3Alkoxyl group, halo (C 1-3) alkoxyl group and nitro.Advantageously, R 1And R 2Be hydrogen, methyl, ethyl, fluorine, chlorine, trifluoromethyl, difluoromethyl, methyl fluoride, cyano group, nitro, methoxyl group or difluoro-methoxy independently.More preferably, R 1Be hydrogen and R 2Be trifluoromethyl or R 1And R 2All be hydrogen.Preferably, R 2Be positioned at phenyl ring between the position.
Preferably, R 3Be selected from alkyl, cycloalkyl, cycloalkylalkyl, 3-tetrahydrofuran base, 2-tetrahydrofuran base alkyl, alkoxyalkyl, hydroxyalkyl, alkyl sulfonyl-amino alkyl and aminocarboxyl alkyl; More preferably be selected from C 1-6Alkyl, C 3-6Cycloalkyl, 3-tetrahydrofuran base, 2-tetrahydrofuran base (C 1-3) alkyl, C 3-6Cycloalkyl (C 1-3) alkyl, C 1-3Alkoxyl group (C 1-6) alkyl, hydroxyl (C 1-6) alkyl, C 1-3Alkyl sulfonyl-amino (C 1-3) alkyl and aminocarboxyl (C 1-3) alkyl.Advantageously, R 3Be selected from methyl, ethyl, isopentyl, isobutyl-, sec.-propyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclopropyl methyl, cyclopropyl ethyl, methoxymethyl, methoxy ethyl, methylol, hydroxyethyl, 3-tetrahydrofuran base, 2-tetrahydrofuran (THF) ylmethyl, 2-tetrahydrofuran base ethyl, sulfonyloxy methyl aminomethyl, sulfonyloxy methyl amido ethyl, amino carbonyl methyl and aminocarboxyl ethyl.More advantageously, R 3Be cyclopropyl, methyl, sec.-propyl or isobutyl-, particularly cyclopropyl.
In the compound of formula I-III, R 4And R 5Preferably be independently selected from hydrogen, alkyl, hydroxyalkyl and phenyl respectively; More preferably be independently selected from hydrogen, C 1-6Alkyl, hydroxyl (C 1-6) alkyl and phenyl; More preferably be independently selected from hydrogen, C 1-3Alkyl, hydroxyl (C 1-3) alkyl and phenyl; And more preferably be independently selected from hydrogen, methyl, ethyl, methylol, hydroxyethyl and phenyl; Perhaps R 4And R 5Form 5-or 6-unit heterocycle, described heterocycle Xuan Zi oxazolidinyl, isoxazole alkyl, pyrrolidyl, pyrazolidyl, imidazolidyl, hexahydropyrimidine base, piperidyl, piperazinyl, 4-methylpiperazine base, morpholinyl, thio-morpholinyl and tetrahydro pyridyl with the nitrogen-atoms that they connected.Advantageously, R 4And R 5Be independently selected from hydrogen, methyl or hydroxyethyl, or R 4And R 5Form 1-pyrrolidyl, 4-thio-morpholinyl, piperazinyl or 4-methylpiperazine base with the nitrogen-atoms that they connected.
Work as R 6When being hydrogen, R 7Be preferably selected from alkyl; Hydroxyalkyl; Cycloalkyl; The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; The optional benzyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; With the benzyloxy alkyl.More preferably, R 7Be selected from straight chain C 1-6Alkyl; Side chain C 3-6Alkyl; Hydroxyl (C 1-6) alkyl; C 3-6Cycloalkyl; Choose wantonly and be independently selected from C with one or two 1-6Alkyl, C 3-6Cycloalkyl, halogen, cyano group, amino, C 1-3Alkylamino, two (C 1-3) alkylamino, hydroxyl, nitro, halo (C 1-6) alkyl and C 1-6The phenyl that the substituting group of alkoxyl group replaces; Choose wantonly and be independently selected from C with one or two 1-6Alkyl, C 3-6Cycloalkyl, halogen, cyano group, amino, C 1-3Alkylamino, two (C 1-3) alkylamino, hydroxyl, nitro, halo (C 1-6) alkyl and C 1-6The benzyl that the substituting group of alkoxyl group replaces; And benzyloxy (C 1-3) alkyl.Advantageously, R 7It is methyl; Propyl group; Sec.-propyl; Butyl; The tertiary butyl; Sec-butyl; Isobutyl-; Methylol; The 1-hydroxyethyl; The optional phenyl that replaces with one or two substituting group that is independently selected from methyl, ethyl, propyl group, sec.-propyl, butyl, the tertiary butyl, halogen, cyano group, amino, methylamino, dimethylamino, hydroxyl, nitro and trifluoromethyl; The optional benzyl that replaces with one or two substituting group that is independently selected from methyl, ethyl, propyl group, sec.-propyl, butyl, the tertiary butyl, halogen, cyano group, amino, methylamino, dimethylamino, hydroxyl, nitro and trifluoromethyl; 1-benzyloxy ethyl; Cyclopentyl; Cyclohexyl; Cyclopentyl-methyl; Or cyclohexyl methyl.
One preferred aspect, work as R 6Be hydrogen and R 7When being alkyl, R 4And R 5Form aforesaid 5-or 6-unit heterocycle together, or R 4And R 5Be hydrogen, alkyl or hydroxyalkyl independently.
Useful compound comprises those, wherein R 6And R 7Form C with the carbon atom that they connected 3-6Cycloalkyl, preferred cyclopentyl or cyclohexyl.
Useful compound comprises those, wherein R 7Be hydrogen, R 4Be hydrogen, methyl or ethyl, and R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl with the carbon atom that they connected.Advantageously, R 5And R 6Formation-CH together 2-CH 2-CH 2-.
Useful compound comprises those, and wherein working as Z is Z 2, A is CH 2Or there is not and B when being CH R 8And R 9All be hydrogen.Other useful compounds comprise those, and wherein working as Z is Z 2, A is CH 2Or do not exist and B is CH, or A-B is when being CH=C, R 8And R 9Formation=O.Useful in addition compound comprises those, and wherein Z is Z 2, R 8And R 9All be that hydrogen and A are O.
Preferably, R 10, R 11, R 12, and R 13Be independently selected from hydrogen, halogen, C respectively 1-6Alkyl, C 1-6Alkoxyl group, halogen, halo (C 1-6) alkyl, hydroxyl, hydroxyl (C 1-6) alkyl, cyano group, amino, amino (C 1-6) alkyl, C 1-3Alkylamino and two (C 1-3) alkylamino.More preferably, R 10, R 11, R 12, and R 13Be independently selected from hydrogen, halogen, C respectively 1-4Alkyl, C 1-3Alkoxyl group, halogen, halo (C 1-3) alkyl, cyano group, amino, amino (C 1-3) alkyl, C 1-3Alkylamino and two (C 1-3) alkylamino.Advantageously, R 10, R 11, R 12, and R 13Be independently selected from hydrogen, halogen, methyl, ethyl, methoxyl group, oxyethyl group, trifluoromethyl, cyano group, amino, methylamino and dimethylamino, particularly halogen respectively.Preferably, R 10And R 12All be hydrogen.Preferably, R 11And R 13One of or the both in they contrapositions of phenyl ring separately.
Preferably, R 14Be selected from the optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido; With the phenyl that phenyl, benzyl, phenoxy group or benzyloxy replace, wherein each phenyl ring is optional replaces with one or two substituting group that is independently selected from halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino and cyano group; Naphthyl; Quinolyl; And pyridyl.
Useful compound comprises those, wherein R 14It is the optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido; Preferably be independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, cyano group, alkylamino and dialkyl amido; More preferably be independently selected from C 1-6Alkyl, C 1-6Alkoxyl group, halogen, halo (C 1-3) alkyl, hydroxyl, cyano group, C 1-3Alkylamino and two (C 1-3) alkylamino.Advantageously, R 14It is the optional phenyl that replaces with one or two substituting group that is independently selected from methyl, ethyl, sec.-propyl, the tertiary butyl, methoxyl group, oxyethyl group, fluorine, trifluoromethyl, methylamino and dimethylamino.
Useful compound comprises those, wherein R 14Be the phenyl that replaces with phenyl, benzyl, phenoxy group or benzyloxy, preferably at para-orientation, wherein arbitrarily substituting group be non-replacement or with halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement, preferably replaced by halogen.
Useful compound also comprises those, wherein R 14Be naphthyl, quinolyl or pyridyl, wherein any one all is non-replacement.
Useful compound also comprises those, wherein R 8And R 9Formation=O together, o is 0, D is-CH=CH-and R 14It is n-propyl.
Preferably, work as R 14Be
Naphthyl;
Quinolyl;
Pyridyl;
By the optional phenyl that is replaced by the phenyl of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement;
By the optional phenyl that is replaced by the benzyl of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement;
By the optional phenyl that is replaced by the phenoxy group of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement; Or
By the optional phenyl that is replaced by the benzyloxy of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement
One of the time, R 8And R 9All be hydrogen.
Preferably, R 15It is the phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, amino, alkylamino and dialkyl amido.Useful compound comprises those, wherein R 15By C 1-6Alkyl, C 1-6Alkoxyl group, halogen, halo (C 1-3) alkyl, amino, C 1-3Alkylamino or two (C 1-3) phenyl that replaces of alkylamino; More preferably replaced by propyl group, butyl, amyl group, propoxy-, butoxy, pentyloxy, fluorine, chlorine, trifluoromethyl, amino, methylamino or dimethylamino.Useful compound also comprises those, wherein R 15By the naphthyl of amino, alkylamino or dialkyl amido replacement; Preferably by amino, C 1-3Alkylamino or two (C 1-3) the alkylamino replacement; More preferably replaced by amino, methylamino or dimethylamino.
Useful compound comprises those, wherein R 8And R 9All be hydrogen or together formation=O and D be do not exist or-CH=CH-.Useful compound comprises those, wherein R 8And R 9Formation=O and D are C=O.
Preferably, n is 0,1 or 2.
Preferably, o is 0,1 or 2.
The present invention also relates to the piperidinyl compounds represented by formula IV:
Figure A20058003494600411
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1And R 2Be independently selected from hydrogen, alkyl, haloalkyl, halogen, alkoxyl group, halogenated alkoxy, cyano group, nitro, amino and hydroxyl respectively;
R 3Be selected from alkyl, thiazolinyl, cycloalkyl, cycloalkylalkyl, alkoxyalkyl, hydroxyalkyl, 2-tetrahydrofuran base, 3-tetrahydrofuran base, 2-tetrahydrofuran base alkyl, 3-tetrahydrofuran base alkyl, alkyl sulfonyl-amino alkyl and aminocarboxyl alkyl;
R 4And R 5Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol, aminoalkyl group and phenyl respectively; Or R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl;
R 6Be hydrogen and R 7Be independently selected from
Hydrogen;
Alkyl;
Hydroxyalkyl;
Alkoxyalkyl;
Haloalkyl;
Aminoalkyl group;
Cycloalkyl;
Optional by one two phenyl that are independently selected from the substituting group replacement of alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group;
Optional by one two benzyls that are independently selected from the substituting group replacement of alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; With
The benzyloxy alkyl; Or
R 6And R 7Form C with the carbon atom that they connected 3-7Cycloalkyl; Or
R 7Be hydrogen, R 4Be hydrogen or C 1-3Alkyl, and R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl with the carbon atom that they connected; And
M is 0 or 1.
R among the formula I 1-R 7With the preferred value of m as mentioned above.In one aspect, the preferred compound that drops in formula IV scope comprises those that represented by formula V:
Figure A20058003494600431
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3As described in to formula IV;
R 41And R 51Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl and aminoalkyl group respectively; With
R 17And R 18Be independently selected from hydrogen, alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group respectively.
Preferably, R 41And R 51Be independently selected from hydrogen, alkyl and hydroxyalkyl respectively; More preferably be independently selected from hydrogen and alkyl.Useful compound comprises those, wherein R 41And R 51All be hydrogen, or R 41Be hydrogen and R 51Be C 1-3Alkyl, preferable methyl.
Preferably, R 17And R 18Be independently selected from hydrogen, C respectively 1-6Alkyl, C 3-6Cycloalkyl, halogen, cyano group, amino, C 1-3Alkylamino, two (C 1-3) alkylamino, hydroxyl, nitro, halo (C 1-6) alkyl and C 1-6Alkoxyl group; More preferably be independently selected from hydrogen, C 1-4Alkyl, halogen, cyano group, amino, C 1-3Alkylamino, two (C 1-3) alkylamino, hydroxyl, nitro, halo (C 1-3) alkyl and C 1-4Alkoxyl group; More preferably be independently selected from hydrogen, methyl, sec.-propyl, the tertiary butyl, cyano group, fluorine, amino, methylamino, dimethylamino, nitro, trifluoromethyl, methoxyl group, isopropoxy and tert.-butoxy.The compound of useful formula V comprises those, wherein R 17And R 18All be hydrogen, or R 17Be hydrogen and R 18Be methyl, the tertiary butyl, cyano group, fluorine, methylamino, dimethylamino, trifluoromethyl or methoxyl group, particularly cyano group.
In one aspect, the preferred compound that drops in the formula IV scope comprises those that represented by formula VI:
Figure A20058003494600451
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3With m such as above definition to formula I;
R 42And R 52Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol and aminoalkyl group respectively; R 42And R 52Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more atoms of heterocyclic are optional by NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl; With
R 19And R 20Be H or CH independently 3
R 1-R 3Preferred value as above described to formula I.Preferably, R 42And R 52Be independently selected from hydrogen, alkyl and hydroxyalkyl respectively; More preferably be selected from hydrogen, C 1-6Alkyl and hydroxyl (C 1-6) alkyl; More preferably be independently selected from hydrogen, C 1-3Alkyl and hydroxyl (C 1-3) alkyl; More preferably be independently selected from hydrogen, methyl, ethyl, methylol and hydroxyethyl; Or R 42And R 52Form 5-or 6-unit heterocycle, described heterocycle Xuan Zi oxazolidinyl, isoxazole alkyl, pyrrolidyl, pyrazolidyl, imidazolidyl, hexahydropyrimidine base, piperidyl, piperazinyl, 4-methylpiperazine base, morpholinyl, thio-morpholinyl and tetrahydro pyridyl with the nitrogen-atoms that they connected.Advantageously, R 42And R 52Be hydrogen, methyl or hydroxyethyl independently; Or R 42And R 52Form 1-pyrrolidyl, 4-thio-morpholinyl or 4-methylpiperazine base with the nitrogen-atoms that they connected.
The compound of useful formula VI comprises those, wherein R 19Or R 20In one be CH 3The compound of the formula VI that other are useful comprises those, wherein works as R 42And R 52When forming 5-or 6-unit heterocycle together, R 19And R 20All be H.Simultaneously, the compound of useful formula VI comprises those, wherein R 42And R 52All be hydrogen, or R 42Be hydrogen and R 52Be alkyl, methyl particularly.Preferably, m is 1 in the compound of formula VI.
Another group compound that is used for this aspect of the present invention is the piperidinyl compounds of being represented by formula VII:
Figure A20058003494600461
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3As the front formula I-III is defined;
R 8And R 9All be hydrogen or formation=O together;
R 10, R 11, R 12And R 13Be independently selected from hydrogen, alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido respectively;
A is O, CH 2, or not have (covalent linkage) and B be CH, condition is when A is O, so R 8And R 9All be hydrogen; Or
A-B is CH=C; With
N is 0,1,2,3,4 or 5.
In formula VII, R 1-R 3, R 8-R 13, A, B and n preferred value be as above in the face of formula I described those.
Further, be used for the piperidinyl compounds that compound of the present invention is formula VIII:
Figure A20058003494600471
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3, R 8, R 9, R 14, D and o such as front define formula I.In formula VIII, R 1-R 3, R 8, R 9, R 14, D and o preferred value be as above in the face of formula I described those.
Can be used for additional compounds of the present invention is the piperidinyl compounds of formula IX representative:
Figure A20058003494600481
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3And R 15As the front formula I is defined.In formula IX, R 1-R 3And R 15Preferred value be as above in the face of formula I described those.
Have been found that also the intermediate with formula X structure has calcium channel blocking activity.Therefore, the present invention relates to the compound of following formula X:
Figure A20058003494600482
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1-R 3As the front formula I is defined.In formula X, R 1-R 3Preferred value be as above in the face of formula I described those.
The example that can be used for preferred compound of the present invention comprises:
N-{1-[3-(4-cyano-phenyl)-2-methylamino propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-{1-[2-amino-3-(4-cyano-phenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-[1-(tolyl propionyl between 2-amino-3-) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-{1-[2-amino-3-(4-fluorophenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino-3-phenyl propionyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(2-amino-3-o-tolyl propionyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-{1-[2-amino-3-(4-tert-butyl-phenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino-3-o-tolyl propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(tolyl propionyl between 2-methylamino-3-) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[3-(4-fluorophenyl)-2-methylamino propionyl]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[3-(4-tert-butyl-phenyl)-2-methylamino-propionyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-thiomorpholine-4-base-caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-methyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-tetramethyleneimine-1-base caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-morpholine-4-base caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[3-(4-methylpiperazine-1-yl) caproyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[3-(piperidines-1-yl) caproyl] piperidin-4-yl } 3-trifluoromethyl benzsulfamide;
N-[1-(3-amino-5-methyl caproyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-methylamino-5-methyl caproyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(3-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-methylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(the amino pentanoyl of 2-) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-sec.-propyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(2-amino-3,3-dimethyl butyrate acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-3[(2-hydroxyethylamino) caproyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-dimethylamino caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino-2-phenyl acetyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide; Or
N-isobutyl--N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(2-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-benzsulfamide;
N-(2-hydroxyethyl)-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-4-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-2-fluorobenzene sulphonamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-2-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino ethanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-isopentyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methoxybenzenesulphoismide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-difluoro-methoxy benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-cyano group benzsulfamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-chlorobenzene sulfonamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methyl benzenesulfonamide;
N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-nitrobenzene sulfonamide;
N-cyclopropyl-N-[1-(the amino propionyl of 3-hydroxy-2-methyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(1-Aminocyclopentane-1-carbonyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(1,2,3,4-tetrahydroisoquinoline-3-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(piperidines-2-acyl group) piperidin-4-yl]-3-trifluoromethyl-benzsulfamide;
N-[1-(3-benzyloxy-2-methylamino propionyl)-piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(N-methylpyrrolidin-2-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(tetramethyleneimine-2-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(2-cyclohexyl-2-methylamino ethanoyl) piperin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl methyl-N-[1-(2-methylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-dimethylamino benzyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[(3-trifluoromethyl-4-methoxyl group) benzoyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-dimethylamino-3,3-dimethyl butyrate acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide; With
N-cyclopropyl-N-[1-(1-phenyl amino hexamethylene-1-acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
Or its pharmacologically acceptable salts, prodrug or solvate.
Can be used for other exemplary preferred compounds of the present invention comprises:
(2S) N-cyclopropyl-N-[1-(2-methylamino-3-phenyl propionyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-methyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(3S) N-[1-(3-amino-5-methyl caproyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(3S) N-cyclopropyl-N-[1-(3-methylamino-5-methyl caproyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(3S) N-[1-(3-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(3S) N-cyclopropyl-N-[1-(3-methylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2R) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2R) N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(3-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(the amino pentanoyl of 2-) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-sec.-propyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(2-amino-3,3-dimethyl butyrate acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2R) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(2-methylamino-2-phenyl acetyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-isobutyl--N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2R) N-[1-(2-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-benzsulfamide;
(2S) N-(2-hydroxyethyl)-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-4-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-2-fluorobenzene sulphonamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-2-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(2-methylamino propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-isopentyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methoxybenzenesulphoismide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-difluoro-methoxy benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-cyano group benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-chlorobenzene sulfonamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methyl benzenesulfonamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-nitrobenzene sulfonamide;
(2S) N-cyclopropyl-N-[1-(the amino propionyl of 3-hydroxy-2-methyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(1-Aminocyclopentane-1-carbonyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(3-benzyloxy-2-methylamino propionyl)-piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(tetramethyleneimine-2-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(2-cyclohexyl-2-methylamino ethanoyl) piperin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl methyl-N-[1-(2-methylamino-4-methylpent acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopentyl-N-[1-(4-methyl-2-methylamino-pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-3-yl)-3-trifluoromethyl benzsulfamide and
(2S) N-cyclopropyl-N-[1-(2-dimethylamino-3,3-dimethyl butyrate acyl group)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-(2-methoxy ethyl)-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-2-yl) methyl-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-fluorobenzene sulphonamide;
(2S) N-[1-(2-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-benzsulfamide; Or its pharmacologically acceptable salts, prodrug or solvate.
Can be used for other exemplary compounds of the present invention comprises:
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-] piperidin-4-yl } benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-] piperidin-4-yl }-the 3-chlorobenzene sulfonamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) fourths of 4--3-enoyl-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) fourths of 4--3-enoyl-] piperidin-4-yl } benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl } benzsulfamide;
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-3-fluorobenzene sulphonamide;
N-cyclopropyl-N-[1-(2, the 2-diphenyl-ethyl) piperidin-4-yl] benzsulfamide;
N-cyclopropyl-N-[1-(3,3-diphenylprop acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-2-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[2-two (4-fluorophenyl) methoxy ethyl] piperidin-4-yl } benzsulfamide; With
N-cyclopropyl-N-{1-[2-two (4-fluorophenyl) methoxy ethyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
Or its pharmacologically acceptable salts, prodrug or solvate.
Can be used for other exemplary compounds of the present invention comprises:
N-cyclopropyl-N-[1-(naphthalene-2-ylmethyl) piperidin-4-yl] benzene-sulphonamide;
N-cyclopropyl-N-[1-(4-phenylbenzyl) piperidin-4-yl] benzene-sulphonamide;
N-cyclopropyl-N-[1-(4-isopropyl benzyl) piperidin-4-yl] benzene-sulphonamide;
N-cyclopropyl-N-[1-(4-trifluoromethyl-4-methoxy-benzyl) piperidin-4-yl] benzsulfamide;
N-cyclopropyl-N-[1-(4-dimethylamino benzyl) piperin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-tertiary butyl benzyl) piperidin-4-yl] benzene-sulphonamide;
N-cyclopropyl-N-[1-(4-trifluoromethyl-4-methoxy-benzyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-methyl-4-methoxy-benzyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(3-methyl-4-methoxy-benzyl) piperidin-4-yl]-benzsulfamide;
N-cyclopropyl-N-[1-(3-pyridylmethyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-quinolyl methyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-methoxy-benzyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen-butyl] piperidin-4-yl } benzsulfamide;
N-cyclopropyl-N-{1-[(3-trifluoromethyl-4-methoxyl group) phenyl-formyl radical] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen butyryl radicals] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen butyryl radicals] piperidin-4-yl } benzsulfamide;
N-[1-(4-benzyloxy benzyl) piperidin-4-yl]-N-cyclopropyl-benzsulfamide;
N-cyclopropyl-N-[1-(4-methoxy-benzyl) piperidin-4-yl] benzsulfamide;
N-cyclopropyl-N-{1-[3-(4-dimethylaminophenyl) propylene-2-yl] piperidin-4-yl } benzsulfamide;
N-cyclopropyl-N-[1-(4-dimethylamino benzyl) piperidin-4-yl] benzsulfamide;
N-cyclopropyl-N-{1-[4-(4-fluorophenoxy) benzoyl] } piperidin-4-yl }-3-trifluoromethyl benzsulfamide; With
N-cyclopropyl-N-[1-(4-dimethylamino benzoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
Or its pharmacologically acceptable salts, prodrug or solvate.
Can be used for other exemplary compounds of the present invention comprises:
N-[1-(4-butyl phenyl ether alkylsulfonyl) piperidin-4-yl]-N-cyclopropyl-benzsulfamide;
N-cyclopropyl-N-[1-(4-propylbenzene alkylsulfonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-[1-(4-butyl phenyl ether alkylsulfonyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-propylbenzene alkylsulfonyl) piperidin-4-yl] benzsulfamide; With
N-cyclopropyl-N-[1-(5-dimethylamino naphthalene sulfonyl base) piperidin-4-yl] benzsulfamide, or its pharmacologically acceptable salts, prodrug or solvate.
Useful cycloalkyl is C 3-12Cycloalkyl.Typical cycloalkyl comprises cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, suberyl and ring octyl group.
Useful halogen or halogen group comprise fluorine, chlorine, bromine and iodine.
Useful alkyl comprises straight chain and side chain C 1-10Alkyl, more preferably C 1-6Alkyl.Typical C 1-10Alkyl comprises methyl, ethyl, propyl group, sec.-propyl, butyl, sec-butyl, the tertiary butyl, isobutyl-, 3-amyl group, hexyl and octyl group.
Useful thiazolinyl is C 2-6Thiazolinyl, preferred C 2-4Thiazolinyl.Typical C 2-4Thiazolinyl comprises vinyl, propenyl, pseudoallyl, butenyl and secondary butenyl.
Useful cycloalkylalkyl comprises by above-mentioned any C of above-mentioned any cycloalkyl substituted 1-10Alkyl.
Useful haloalkyl comprises the C that is replaced by one or more fluorine, chlorine, bromine or iodine atom 1-10Alkyl (for example, a methyl fluoride, difluoromethyl, trifluoromethyl, pentafluoroethyl group, 1,1-two fluoro ethyls and trichloromethyl).
Useful hydroxyalkyl comprises the C that is replaced by hydroxyl 1-10Alkyl (for example, methylol, hydroxyethyl, hydroxypropyl and hydroxyl butyl).
Useful alkoxyl group comprises by an above-mentioned C 1-10The oxygen that alkyl replaces.
Useful halogenated alkoxy comprises by an above-mentioned C 1-10The oxygen (for example, fluorine methoxyl group, difluoro-methoxy and trifluoromethoxy) that haloalkyl replaces.
Term used herein " heterocyclic " and " heterocycle " are meant saturated or undersaturated wholly or in part 3-7 unit's monocycle or 7-10 unit second cycle line system, it is made up of carbon atom and 1 to 4 heteroatoms that is independently selected from O, N and S, wherein nitrogen and sulphur atom are optional can be oxidized, nitrogen is optional can be quaternary, and any heterocycle and any bicyclic radicals of phenyl ring condensed of definition more than comprising wherein, if and wherein the gained compound is stable, heterocycle can be substituted on carbon atom or nitrogen-atoms so.Example includes but not limited to, tetramethyleneimine, piperidines, piperazine, morpholine, tetrahydroglyoxaline, pyrazolidine, Benzodiazepine or the like.
Useful alkylamino and dialkyl amido are-NHR 21With-NR 21R 22, R wherein 21And R 22Be C 1-10Alkyl.
Useful alkyl sulfonyl-amino alkyl comprises by alkyl-SO 2Above-mentioned any C that-NH-group replaces 1-10Alkyl.
Useful aminocarboxyl alkyl comprises by aminocarboxyl 2The above-mentioned any C that replaces 1-10Alkyl.
Useful alkyl thiol (alkylthiol) comprises the above-mentioned any C that is replaced by-SH 1-10Alkyl.
Amino is-NH 2
The present invention disclosed herein also comprises the prodrug of disclosed compound.Prodrug is considered to discharge in vivo any covalently bound carrier of active parent drug.The example of prodrug comprises with hydroxyalkyl or aminoalkyl group ester or the acid amides as substituent formula I-X, and they can react by these compounds and acid anhydrides such as succinyl oxide and prepare.
The present invention disclosed herein also comprises the interior metabolism product of disclosed compound.For example, these products can come from oxidation, reduction, hydrolysis, amidation, esterification of institute's administered compound or the like, and this depends primarily on the enzyme catalysis process.Therefore, the present invention includes the compound that is produced by following method, this method comprises compound of the present invention is contacted for some time with Mammals, to be enough to obtain its meta-bolites.The typically following evaluation of this product: prepare radiolabeled The compounds of this invention, it is applied to animal such as rat, mouse, cavy, monkey or people as parent can detect dosage, allow to carry out the sufficiently long time so that metabolism to take place, and from urine, blood or other biological sample, separate its converted product.
The present invention disclosed herein also comprises isotope-labeled disclosed compound, the atom that its atom with the different atomic masses of one or more quilts or total mass number is replaced.Can be incorporated into the isotropic substance that isotopic example in the disclosed compound comprises hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, respectively for example 2H, 3H, 13C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F and 36Cl.Isotope-labeled compound of the present invention can prepare by methods known in the art.
The present invention also is particularly related to 3H and 14The formula I of C mark or the compound of X and they are as the purposes of the radioligand of its binding site on the calcium channel.For example, tagged compound of the present invention purposes is the combination that characterizes specific receptors.Another purposes of tagged compound of the present invention is the animal experiment that substitutes evaluation structure-activity relationship.In competitive analysis, carry out receptor assay with the tagged compound of the formula I of fixed concentration or X and the test compounds that increases concentration gradually.The tritiated compound of formula I or X can be by preparing in the compound with tritium drawing-in system I or X, for example by using tritium catalysis dehalogenation.This method be included in suitable catalyst such as Pd/C exist down, alkali exist or not in the presence of, suitable halogen-the replacements precursor and the tritium gas of formula I or X compound reacted.Other appropriate means of preparation tritiated compound can be referring to Filer, Isotopes in thePhysical and Biomedical Sciences, and Vol.1, Labeled Compounds (PartA), Chapter 6 (1987). 14The compound of C-mark can have by use 14The initial substance of C prepares.
Some compounds disclosed herein can comprise one or more asymmetric centers, therefore, can produce enantiomorph, diastereomer and other stereoisomeric forms in any ratio.The present invention comprises all these possible forms, and their racemize and fractionation form and composition thereof.Single enantiomorph can separate according to method known to a person of ordinary skill in the art.When compound as herein described comprised alkene double bond or other how much asymmetric centers, except as otherwise noted, they comprised E and Z geometrical isomer.All tautomers also are included among the present invention.
Term used herein " steric isomer " is the general designation of atom all isomer of different individual moleculars on dimensional orientation only.It comprises enantiomorph and has the isomer (diastereomer) of the compound of the chiral centre of mutual non-mirror image more than.
The carbon atom that the different groups with 4 of term " chiral centre " expression connect.
Term " enantiomorph " and " enantiomer " expression can not be on its mirror image the eclipsed molecule, be optically active therefore, wherein enantiomorph is on the plane of a direction rotatory polarization light, and its mirror image plane of rotatory polarization light in the opposite direction.
Term " raceme " expression relates to the mixture of the enantiomorph of equal portions, and these mixture right and wrong are optically active.
Term " fractionation " expression separates or concentrates or remove two kinds of enantiomeric forms wherein a kind of of a molecule.
Term " one " (" a kind of ") (" a " and " an ") is contained one or more (one or more).
The present invention disclosed herein also comprises all non-toxicity pharmacologically acceptable salts of disclosed compound.The example of pharmacy acceptable addition salt comprises mineral acid and organic acid addition salt.Pharmacologically acceptable salts includes but not limited to, metal-salt such as sodium salt, sylvite, cesium salt or the like; Alkaline-earth metal such as calcium salt, magnesium salts or the like; Organic ammonium salt such as triethylammonium salts, pyridinium salt, picoline salt, alcohol salt, tri ethanol ammonium salt, dicyclohexyl ammonium salt, N, N '-dibenzyl ethylenediamine salt or the like; Inorganic acid salt, example hydrochloric acid salt, hydrobromate, phosphoric acid salt, vitriol or the like; Organic acid salt such as Citrate trianion, lactic acid salt, tartrate, maleate, fumarate, mandelate, acetate, dichloroacetate, trifluoroacetate, oxalate, formate or the like; Sulfonate such as mesylate, benzene sulfonate, tosilate or the like; With amino acid salts such as arginic acid salt, l-asparagine hydrochlorate, glutaminate or the like.
Following formation acid salt: the solution of the acceptable non-toxicity acid of solution and pharmacy of specific piperidinyl compounds of the present invention is mixed described non-toxicity acid example hydrochloric acid, fumaric acid, toxilic acid, succsinic acid, acetate, citric acid, tartrate, carbonic acid, phosphoric acid, oxalic acid, dichloro acetic acid or the like.Following formation basic salt: the solution of the acceptable non-toxic bases of the solution and the pharmacy of piperidinyl compounds of the present invention such as sodium hydroxide, potassium hydroxide, bursine, yellow soda ash or the like is mixed.
The present invention also relates to suffering from the retardance calcium channel method of the described disease of treatment among the patient of the disease that responds of selectivity retardance N-type calcium channel particularly, described method comprises the represented piperidinyl compounds of usefulness formula I-X definition arbitrarily of using significant quantity to this animal.
The present invention also relates to calcium mobilization's analytical method, it can be used to identify the compound that can regulate or block calcium channel.In one aspect, analytical method as herein described is used to identify the particularly compound of N-type calcium channel of retardance voltage-gated calcium channel.In yet another aspect, analytical method as herein described is used to predict whether a kind of compound can combine with the N-type calcium channel that is in inactivated state.
In one aspect, have been found that with analytical method compounds identified as herein described and optionally block N-type calcium channel, therefore, can be used for the treatment of the disease that selectivity retardance N-type calcium channel is responded.Therefore, the invention provides a kind of evaluation is used for the treatment of, prevents or (for example improve apoplexy, head trauma, epilepsy, pain, acute pain, or chronic pain, it includes but not limited to neuropathic pain and scorching pain), the method for migraine, mood disorder, schizophrenia, nerve degenerative diseases (for example, alzheimer's disease, amyotrophic lateral sclerosis (ALS) or Parkinson's disease), depression, anxiety, psychosis, hypertension or ARR compound.In each case, use the usefulness analytical method compounds identified described herein of significant quantity can for the animal that needs this treatment, prevention or improvement.
The present invention disclosed herein also comprises all non-toxicity pharmacologically acceptable salts of institute's authenticating compound.
The present invention also relates to suffering from the retardance calcium channel method of the described disease of treatment among the patient of the disease that responds of selectivity retardance N-type calcium channel particularly, described method comprises the pharmacologically acceptable salts with analytical method compounds identified of the present invention or this authenticating compound of using significant quantity to this animal.
Chronic pain includes but not limited to, inflammatory pain, postoperative pain, pain caused by cancer, with shift Cancer-Related osteoarthritis pain, trigeminal neuralgia, acute bleb and postherpetic neuralgia, diabetic neuropathy, cusalgia, brachial plexus are torn, occipital neuralgia, reflection sympathetic dystrophy, fibromyalgia, gout, phantom limb pain, burn pain and other forms of neurodynia, nervosa and Te Fa pain syndrome.In each case, method of the present invention all requires to use calcium channel blocker of the present invention or its pharmacologically acceptable salts, prodrug or the solvate of significant quantity to the animal of this treatment of needs.
Chronic somatalgia generally by tissue injury such as nerve are absorbed in, operation technique, cancer or arthritic Inflammatory response cause (Brower, Nature Biotechnology 2000; 18:387-391).Although current inflammatory pain for the treatment of many types with NSAID still has bigger space for improving treatment.
Inflammatory process is a kind of to tissue injury or exist exterior materials to react and biochemistry and cell incident (Levine, Inflammatory Pain, In:Textbook ofPain, Wall and Melzackeds., 3 of a series of complexity of activated RdEd., 1994).Inflammation often occurs in the position of damaged tissue or exterior materials, and promotes tissue repair and agglutination.The important symbol of inflammation comprises erythema (rubescent), heating, oedema (swelling), pain and afunction (the same).The most of patient who suffers from the inflammation pain can not experience pain continuously, but can feel that when moving or touch inflammation part pain strengthens.Inflammatory pain includes but not limited to osteoarthritis and rheumatoid arthritis.
Chronic neuropathic pain is a kind of exogenous morbid state of cause of disease the unknown.In chronic neuropathic pain, pain can be mediated by Different types of etiopathogenises.Such pain normally since the damage of periphery or central nervous tissue cause.This syndrome comprises the pain relevant with Spinal injury, multiple sclerosis, postherpetic neuralgia, trigeminal neuralgia, phantom pain, cusalgia and reflection sympathetic dystrophy and low back pain.Chronic neuropathic pain is different from acute pain, and the patient has suffered unusual pain perception in acute pain, and this pain sensation can be described as spontaneous pain, continuous shallow table cusalgia and/or deep pain (aching pain).This pain can by heat-, cold-and machinery-hyperpathia or by heat-, cold-and machinery-allodynia bring out.
Neuropathic pain can be caused by the damage or the infection of peripheral sensory nerve.It includes but not limited to, derives from that peripheral nerve injury, herpesvirus infection, diabetes, cusalgia, reticulattion are torn, neuroma, dismemberment and vasculitic pain.Neuropathic pain also can be that origin comes from chronic alcoholism, human immunodeficiency virus infection, hypothyroidism, uremia or avitaminous nervous lesion and causes.Apoplexy (spinal cord or brain) and Spinal injury also can be induced neuropathic pain.Cause owing to the tumor growth compressing closes on nerve, brain or spinal cord with the neuropathic pain of related to cancer.In addition, cancer therapy comprises that chemistry and radiotherapy also can cause nerve injury.Neuropathic pain includes but not limited to the pain that caused by nerve injury, for example pain that the diabetic subject suffered from.
Synthesizing of compound
According to disclosed content, can use methods known in the art to prepare compound of the present invention.For example wherein Z is Z 1Formula I compound can shown in scheme 1, prepare:
Scheme 1
Figure A20058003494600671
Wherein R is that hydrogen, alkyl, hydroxyalkyl, alkoxyalkyl, haloalkyl, aminoalkyl group, cycloalkyl, the optional phenyl that replaces, the optional benzyl that replaces or benzyloxy alkyl and R ' are hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, aminoalkyl group or phenyl.
For example, with hydrochloric acid N-ethyl-dimethylaminopropyl carbodiimide (EDCI) (1.0 equivalent) N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (1.0 equivalent), BOC-amino acid (1.0 equivalent) and the mixture of I-hydroxybenzotriazole hydrate (0.5-1.0 equivalent) in suitable solvent such as DMF were at room temperature handled about 8 hours.Use the EtOAc diluted reaction mixture then, water and salt water washing.Concentrate organic layer, and with post (silica gel, EtOAc/ hexane) purifying, obtain being subjected to the material of BOC protection, it is at room temperature used HCl solution (4N is 1, in the 4-diox) processing, obtain the expectation product of HCl-salt form.
Wherein Z is Z 1Formula I compound also can shown in scheme 2, prepare:
Scheme 2
Figure A20058003494600691
Wherein R is hydrogen, alkyl, hydroxyalkyl, alkoxyalkyl, haloalkyl, aminoalkyl group, cycloalkyl, the optional phenyl that replaces, optional benzyl or the benzyloxy alkyl that replaces, and R " be hydrogen, or R and R " forms C with the carbon atom that they connected 3-7Cycloalkyl.
For example, amine A (1 equivalent) and amino acid tail B (1 equivalent) are dissolved in the 4mL dimethyl formamide, in this mixture, add hydrochloric acid 1-[3-(dimethyl methyl amino) propyl group then]-3-ethyl carbodiimide (1 equivalent) and I-hydroxybenzotriazole hydrate (1 equivalent).The mixture concussion is spent the night, and dilutes with the 20mL ethyl acetate then, and uses the 10%HCl aqueous solution, saturated sodium bicarbonate and the salt water washing of 15mL respectively.The water layer that merges is extracted 2 times the dry organic layer that merges on sodium sulfate with the 20mL ethyl acetate.Removal of solvent under reduced pressure, this material of purifying for example uses the combiflash purification system.Handle to make pure material deprotection with excessive 4M HCl dioxane solution, obtain Compound C.In nitrogen atmosphere, Compound C is dissolved in the methyl alcohol with 4  molecular sieves.To wherein adding paraformaldehyde (1 equivalent) and acetate (catalytic amount), and reaction mixture stirred 30 minutes.In mixture, add sodium cyanoborohydride (2 equivalent) then, and the reaction mixture stirring is spent the night.If do not see reaction this moment, can add the paraformaldehyde and the sodium cyanoborohydride of other part.After one day, with 20mL ethyl acetate diluted reaction mixture, and with 20mL1M sodium hydroxide stopped reaction.With ethyl acetate extraction water layer 3 times, the organic layer that merges with dried over sodium sulfate.Handle this material with excessive 4M HCl dioxane solution, obtain HCl salt.After breaking into pieces with ether/hexane, dry this material obtains the HCl salt of Compound D.
Wherein Z is Z 1The another kind of preparation method of formula I compound shown in scheme 3:
Scheme 3
Figure A20058003494600701
The method of scheme 3 and scheme 1 described method are similar, and difference is that initial amino acid is a beta-amino acids, rather than a-amino acid.
Shown in scheme 4, can use amine and α, the Michael reaction of beta-unsaturated acyl amine synthesizes wherein that Z is Z 1And m is 1 formula I compound:
Scheme 4
Figure A20058003494600702
Wherein R is hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, aminoalkyl group or phenyl, or RN-is 5-or 6-unit heterocycle, and wherein one or more carbon atoms are optional by NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl.
For example, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (250mg, 0.56mmol) and primary amine or secondary amine (2mL) together in sealing Reacti-vial container 130 ℃ of heating 3 days.This container of cooling in ice is then at Speed-Vac Middle evaporation is with vacuum-drying.Residue can be composed in the quick enterprising circumstances in which people get things ready for a trip of silica gel and obtain the Michael addition thing.
Wherein Z is Z 2And R 8And R 9The formula I compound of formation=O can prepare shown in scheme 5 together:
Scheme 5
Figure A20058003494600711
Therefore, in nitrogen atmosphere, amine and carboxylic acid are joined among the dried THF.In this mixture, add HOBT, EDCI and triethylamine, and mixture at room temperature stirred spend the night.Resulting mixture distributes between ethyl acetate and 1.0M sodium-chlor.Separate organic layer, dry and concentrated, obtain crude product, it can come purifying by hexane/ether crystallization.
Wherein Z is Z 2And R 8And R 9The formula I compound that all is hydrogen can prepare shown in scheme 6:
Scheme 6
Figure A20058003494600712
Wherein Z is Z 3And R 8And R 9The formula I compound that all is hydrogen can prepare shown in scheme 7
Scheme 7
Figure A20058003494600721
With amine, promptly described piperidinyl compounds is dissolved among the DMF, and adds triethylamine, adds halogenide R ' CH then 2X, wherein R ' is the optional phenyl that replaces.Reaction mixture stirred 12 hours down at 80 ℃, evaporating solvent.Residue can be used purification by flash chromatography, obtains expecting product.In the time can not obtaining suitable phenmethyl halogenide, can the corresponding aldehyde R ' C of following use (O): sodium triacetoxy borohydride (1.4 equivalent) is joined in the dichloroethane solution of amine and aldehyde.Reaction mixture at room temperature stirred 12 hours.After this, pour out solution, and use purification by flash chromatography, obtain expecting product.
Wherein Z is Z 3And R 8And R 9The formula I compound of formation=O can be with synthesizing with scheme 5 similar methods together.
Wherein Z is Z 4Formula I compound can prepare shown in the scheme 8:
Scheme 8
Figure A20058003494600722
For example, the suitable SULPHURYL CHLORIDE of getting 0.5mmol sulphonamide and about 0.5mmol is dissolved among the 5mLDCM, and merges with the 1.5 equivalent DIEA (0.134mL) that add by syringe.Mixture at room temperature stirs and spends the night, then vacuum concentration.Can come the resulting product of purifying with 0% to 20%EtOAc hexane solution gradient with silicagel column, from elutriant, concentrate pure substance.
The initial aminated compounds that uses in above-mentioned reaction can for example prepare as embodiment 3, and perhaps they can commercially obtain, for example from Lancaster.
The compound of formula X can for example prepare shown in embodiment 19.
The compound test
Estimate compound of the present invention by calcium mobilization and/or electrophysiology analysis to calcium channel blocking activity.One aspect of the present invention is to have found that compound as herein described is selective N-type calcium channel blocker.Based on above-mentioned discovery, these compounds are considered to can be used for treatment, prevent or improve migraine, epilepsy, mood disorder, schizophrenia, nerve degenerative diseases (for example, alzheimer's disease, amyotrophic lateral sclerosis (ALS) or Parkinson's disease), psychosis, depression, anxiety, hypertension or irregular pulse.Expect also that simultaneously compound of the present invention can treat, prevents or improve pain effectively, as acute pain, neuropathic pain, inflammatory pain, operation pain or chronic pain.
More particularly, the present invention relates to compound as the formula I-X of calcium channel blocker.According to the present invention, these compounds with preferred N-type calcium channel blocking character show about 100 μ M or littler IC in calcium mobilization as herein described and/or electrophysiology analysis 50Preferably, compound exhibits 10 μ M of the present invention or littler IC 50More preferably, about 1.0 μ M of compound exhibits of the present invention or littler IC 50Can test the N-type and the L-type Ca of The compounds of this invention by following calcium mobilization and/or electrophysiology analysis 2+The channel blocking activity.
In one embodiment, being used for compound of the present invention is to analyze with respect to L-type calcium channel in calcium mobilization described herein and/or electrophysiology to show N-type calcium channel those compounds of any representative of formula I-X optionally.Term used herein " with respect to the selectivity of L-type calcium channel to N-type calcium channel " is meant that compound of the present invention is to the active IC of L-type channel blocking 50With this compound to the active IC of N-type channel blocking 50Ratio greater than 1, i.e. LTCC IC 50/ NTCCIC 50＞1.Preferably, compound exhibits LTCC IC of the present invention 50/ NTCC IC 50Ratio is about 2 or bigger.More preferably, compound exhibits LTCC IC of the present invention 50/ NTCC IC 50Ratio is about 30 or bigger.Advantageously, compound exhibits LTCC IC of the present invention 50/ NTCC IC 50Ratio is about 100 or bigger.
The calcium mobilization analyzes
The invention provides a kind of method of measuring the functionally active of N-type calcium channel in the viable cell, this is by come the activity of measuring N-type calcium channel with the calcium sensitivity analysis.Analytical method of the present invention is provided for detecting the optical means easily of calcium current moving (flowing into or outflow).Can directly move the activity of measuring and observing N-type calcium channel by calcium current in the detection cell.
Further, the invention provides a kind of analytical method of regulating the active compound of N-type calcium channel of identifying.In one aspect, analytical method as herein described provides a kind of method of identifying the active compound of retardance N-type calcium channel.In yet another aspect, analytical method as herein described is used to predict whether the compound of adjusting or retardance N-type calcium channel combines with the N-type calcium channel that is in inactivated state.
" channel modulators " is the compound of a kind of direct or indirect adjusting ion by the ionic channel migration.Described compound can pass through direct inaccessible hole, by in conjunction with and stop the hole open, by in conjunction with and promote the hole open, or by influence the effect that time that ionic channel opens and frequency are brought into play it.
" channel blocker " is directly or indirectly to suppress the compound of ion by the ionic channel migration.Described compound can pass through direct inaccessible hole, by in conjunction with and stop the hole open, or the time by influence the ionic channel opening and the frequency effect of bringing into play it.
Analytical method of the present invention is measured the calcium mobilization in the cell.Like this, analytical method of the present invention can be used to identify to have that N-type calcium channel is regulated or the compound of blocking activity.By measure and observe the functionally active of N-type calcium channel with calcium sensitivity analytical method as herein described, can observe the effect of N-type calcium channel modulators or retarding agent.Especially, can use analytical method as herein described to come test compounds to regulate or block the ability of N-type calcium channel.Described analytical method can predict that also can described retarding agent or conditioning agent compound combine with the N-type calcium channel that is in inactivated state.
Voltage-gated calcium channel is opened as the function of membrane potential, makes open probability increase with membrane potential.Voltage-gated calcium channel makes the probability of inactivation along with the reduction of membrane potential or cell depolarization and increase as the function of membrane potential and inactivation, close or lose quick.Usually understand the show state dependency with voltage-gated calcium channel bonded compound, make the changing according to channel status of compound in conjunction with affinity.The control of membrane potential can allow operating walk way to be in different states to promote the combination of candidate's blocking compounds, and this control realizes by voltage-pincers electrophysiological method typically.Analytical method of the present invention can be determined the interaction of state dependence compound and N-type calcium channel with optical means.
The analytical method general introduction
The present invention includes and detect and identify analytical method as the compound of the potential conditioning agent of target N-type calcium channel or retarding agent.Analytical method of the present invention can predict also whether described compound can combine with the N-type calcium channel that is in inactivated state.
Analytical method of the present invention is to carry out on the cell that maintains under one or more compound existence conditions, the activity of the calcium channel of the exogenous expression beyond wherein said one or more compound specificity ground retardances N-type calcium channel, for example L-type calcium channel, P-type calcium channel, Q-type calcium channel, R-type calcium channel and T-type calcium channel.The compound of specificity retardance L-, P-, Q-, R-or T-type calcium channel comprises nifedipine, nimodipine, verapamil, Odizem, nicardipine, lercanipidine, efonidipine, Lacidipine (62, Mibefradil and nitrendipine, ω-agatoxin-TK, Pb 2+, SNX-482, efonidipine R (-)-isomer and other compounds known in the art.
In analytical method of the present invention, use cell depolarization with two-step approach.At first, in the presence of the compound of the endogenous expression calcium channel beyond the retardance N-type calcium channel, reduce the membrane potential of cell.When cell is in the depolarize state it can be increased this compound and passage bonded effectiveness with this compound cultivation, this will and then strengthen the blocking activity of this compound.Secondly, in the presence of candidate compound, reduce membrane potential.If candidate compound combines with the N-type calcium channel that is in inactivated state, when cell is in the depolarize state, candidate compound can be increased candidate compound and N-type calcium channel bonded effectiveness with the cell cultivation, and then strengthen candidate compound active adjusting of N-type calcium channel or retardation.If candidate compound does not combine with the N-type calcium channel that is in inactivated state, when cell is in the depolarize state candidate compound being cultivated with cell will not increase candidate compound and N-type calcium channel bonded and render a service, and then also not strengthen candidate compound to the active retardation of N-type calcium channel.Therefore, whether analytical method of the present invention can combine with the N-type calcium channel that is in inactivated state by the predicting candidate compound.
Analytical method of the present invention provides a kind of method of regulating the active compound of N-type calcium channel of identifying.This method comprises the following steps:
(a) cell that will express N-type calcium channel is cultivated for some time with the calcium sensitivity indicator, makes indicator mix in the cell;
(b) with cell depolarization;
(c) unpolarized cell is cultivated with candidate's adjusting compound, cell is maintained be fit to cause that calcium ion passes through in the solution of channel flow simultaneously;
(d) signal of measurement calcium sensitivity indicator in the presence of candidate's adjusting compound; With
(e) signal and the standard value with calcium sensitivity indicator under candidate's the adjusting compound existence compares.
Analytical method of the present invention relates to cultivates the test mixing thing, and it comprises the cell of expressing N-type passage, can detect calcium sensitivity reagent, the potassium ion of (generation signal) and be arrested in the active compound of other voltage-gated calcium channels of expressing in the cell.The active adjusting or blocking compounds of N-type calcium channel that adds the candidate then.Before adding candidate compound and measure the optical signal of calcium sensitivity reagent afterwards.This analytical method takes place to carry out under the active condition of N-type calcium channel being suitable for.The optical signal of measuring calcium sensitivity reagent with proper device changes.The enhancing of signal or weaken the migration of indication calcium ion by N-type calcium channel.The variation that signal strengthens or weakens, the indication calcium ion changes by the amplitude of N-type calcium channel migration, thus the adjusting activity of indication candidate compound.
Analytical method of the present invention relates to cultivates the test mixing thing, the calcium sensitivity reagent that it comprises the cell of expressing target N-type calcium channel, can detect (generation signal) (for example, Fluo-3, Fluo-4, Calciumgreen and other), the voltage-gated calcium channel of retardance endogenous expression such as the active compound of L-type calcium channel (for example, nifedipine, nitrendipine and other), be enough to make the potassium concentration (10-150mM) of cell depolarization and candidate's the active retarding agent of N-type calcium channel.This analytical method takes place to carry out under the active condition of N-type calcium channel being suitable for, and in whole analysis, cell maintains under the condition of certain compound existence, wherein the activity of other voltage-gated calcium channels of the endogenous expression beyond this compound retardance N-type calcium channel.
The calcium channel that adds the candidate regulate or blocking compounds before and measure the optical signal of calcium sensitivity reagent afterwards.Measure the variation of calcium sensitivity reagent optical signal.The enhancing of signal or weaken the migration of indication calcium ion by N-type calcium channel.The variation that signal strengthens or weakens, indication is to adjusting or the retardance of calcium ion by the migration of N-type calcium channel.
The embodiment that calcium mobilization of the present invention analyzes is to implement with the intact cell of expressing N-type calcium channel, and comprises the following steps: 1) grow under proper condition and express the cell of N-type calcium channel; 2) make cells contacting or load to produce the calcium sensitivity reagent of signal, for example Fluo-3 or Fluo-4 to it; 3) handle cell (for example, washing or interpolation extracellular quencher) under proper condition to remove extracellular excessive calcium sensitivity reagent; 4) measure detectable signal as base measurement; 5) cell is contacted with candidate's adjusting of N-type calcium channel or blocking compounds; With 6) detect any signal, when wherein above-mentioned each step is carried out, cell all maintains under the condition of L-type calcium channel blocker existence, wherein said retarding agent for example, nifedipine, nimodipine, verapamil, Odizem, nicardipine, lercanipidine, efonidipine, Lacidipine (62, Mibefradil or nitrendipine or the like, and wherein when the N-type calcium channel that adds various L-type calcium channel blocking immunomodulator compounds, candidate regulate or during blocking compounds cell maintain the depolarize state.
By the background signal in the experiment with measuring mixture before adding candidate's calcium channel blocking compound and afterwards, determine the variation of calcium sensitivity reagent place generation signal.
Typically, by directly carrying out electricity irritation or, make the voltage gated channel inactivation by causing membrane potential to change the particularly solution of unpolarized ionic composition with comprising with electrode.In comprising the solution that causes the specific ion composition (outside potassium) that membrane potential changes, cultivate as height can driving voltage gate ionic channel to inactivated state.
Analytical method of the present invention is included in culturing cell in the solution that comprises the specific ion composition that causes the membrane potential change, and the selection of wherein said ionic composition is based on the type of the ionic channel that uses in this method.Select suitable ionic composition in the scope of this area general technology.
The ionic composition that selection is used for analytical method of the present invention can comprise and is used to make the unpolarized activating reagent of film (for example, ionophore, valinomycin, high extracellular potassium etc.).
In analytical method of the present invention, be selected to the unpolarized ionic composition solution of cytolemma and comprise certain density sylvite, so that the ultimate density scope of potassium ion is about 10-150mM (for example, 90mM KCl) in comprising the hole of cell.
Analytical method of the present invention is utilized the cell of endogenous expression N-type calcium channel.Analytical method of the present invention is also utilized the cell of endogenous expression potassium channel.Exemplary cell comprises the N18 neuroblastoma cell, AtT-20 mouse neuroendocrine cell, A7r5 rat chest aorta cell, the SH-SY5Y neuroblastoma cell, PC12 pheochromocyte oncocyte, the ScGT1-1 neuronal cell, the HN2 neuronal cell, the F11 neuroblastoma cell, L6 rat muscle cell, NG108-15 neuroblastoma glioma hybrid cell, the small cell lung cancer in SCLC neuroendocrine source, NT2-N people's teratocarcinoma cell, rat suprarenal gland glomerular zone cell, the rat pancreatic beta cell, the INS-1 cell, the SN56 neuronal cell, the SKNSH neuroblastoma cell, with IMR32 human neuroblastoma cell.
Cell can be grown in solution or on solid phase carrier.Cell can be adherent or non-adherent.Solid phase carrier comprises glass or plastic culture dish, has single chamber or multicellular plate, as porous plate.
Although can in single hole or porous plate, use the cell that in analysis, can send any amount that can detect fluorescent signal, but be chosen in the quantity of the cell of implanting in each hole, make when analyzing near converging but not overgrowth of cell, so that the signal of signal/background is than improving.
An embodiment of the responsive reagent of calcium of the present invention is a fluorescent chemicals.Can use the calcium sensitivity fluorescent chemicals that can be loaded into arbitrarily basically in the cell.Preferably, select described compound to detect the calcium ion of lower concentration.These fluorescent chemicalses can show weakening or strengthening of fluorescence in the presence of calcium ion.
The calcium sensitivity fluorescent reagent of adequate types comprises Fluo3, Fluo4, Fluo5, CalciumGreen, Calcium Orange, Calcium Yellow, Oregon Green, Fura-2, Fura-4, Fura-5, Fura-6, Fura-FF, Fura Red, indo-1, indo-5, BTC (MolecularProbes, Eugene, OR) and FLIPR Calcium 3 disposable dyestuffs (Molecular Devices, Sunnyvale CA).The calcium sensitivity fluorescent reagent can be hydrophilic or hydrophobic.
By cell is contacted with the solution that comprises membrane-permeable dye derivate, the calcium sensitivity fluorescent reagent is loaded in the tenuigenin.But, can the secondary load process when using more hydrophobic indicator.Therefore, fluorescent indicator is known and can obtains its hydrophobicity acetyl oxygen methyl esters that it is than the easier permeate through cell membranes of unmodified dyestuff.When the dyestuff of acetyl oxygen methyl ester form enters in the cell, remove ester group by esterase in the cytoplasm, thereby dyestuff is limited in the cytosol.
The fluorescence of the measurement device calcium sensitivity reagent by detecting fluorescent signal.The example of operable device comprise fluorescence imaging plate reader (FLIPR) (Molecular Devices Corp., Sunnyvale, Calif.), flow cytometer, photofluorometer and fluorescent microscope.
If cell is grown having on list or the multicellular solid phase carrier, can in one or more chambers, measure simultaneously or check and analysis in fluorescent signal.The adjusting or the blocking compounds that therefore, can once in one or more chambers, add the candidate.
One of ordinary skill in the art will appreciate that the controlled trial that to carry out analytical method described herein, assist analysis, or the standard value that can compare N-type calcium channel activity change is provided the effect of candidate N-type calcium channel modulators or blocker.Carry out controlled trial below can using: (1) maintains the cell of not expressing N-type calcium channel under analytical method the same terms of the present invention; (2) keep under the same conditions cell, but do not have candidate's N-type calcium channel to regulate or blocking compounds; And/or (3) be in the cell under the inventive method the same terms, but use known N-type calcium channel blocker.
Be the more detailed example of analytical method of the present invention below.
Calcium mobilization and electric Physiological Analysis scheme:
Cell is kept and is broken up.Except as otherwise noted, cell culture reagent is available from LifeTechnologies of Rockville, MD.IMR32 cell (American Type CultureCollection, ATCC, Manassas, VA) the conventional cultivation by containing 10% foetal calf serum (FBS, Hyclone, Logan, UT), in the growth medium formed of the minimum minimum medium of 100U/mL penicillin, 100 μ g/mL Streptomycin sulphates, 2mM L-glutaminate, 1mM Sodium.alpha.-ketopropionate and 1xMEM non-essential amino acid.Make the cytodifferentiation that 80-90% converges in the bottle with following division culture medium: growth medium adds dibutyryl ring AMP, and (Sigma, St.Louis is MO) with 2.5 μ M bromodeoxyribouridines (Sigma).Changed division culture medium by every 2-3 days and made cytodifferentiation 8 days.
A7r5 (ATCC) cell is kept and conventional the cultivation in the A7r5 growth medium, and described substratum is made up of Dulbecco ' the s MEM that contains 10%FBS, 100U/mL penicillin, 100 μ g/mL Streptomycin sulphates, 4mM L-glutaminate, 1mM Sodium.alpha.-ketopropionate and 0.15% sodium bicarbonate.Make the cytodifferentiation that 80-90% converges in the bottle with following division culture medium: the A7r5 growth medium adds dibutyryl ring AMP (Sigma).Changed division culture medium by every 2-3 days and made cytodifferentiation 8 days.
The FLIPR calcium mobilization of N-type calcium channel analyzes.Carrying out this analysis the day before yesterday, handling the IMR32 cell of differentiation with 1xCellStripper, and be implanted to 200,000 cells/well poly--D-Methionin bag quilt 96-hole clear bottom black plate (Becton Dichinson, Franklin Lakes, NJ) on.Analyzing the same day, with IMR32 damping fluid (127mM NaCl, 1mM KCl, 2mMMgCl 2, 700 μ M NaH 2PO 4, 5mM CaCl 2, 5mM NaHCO 38mM HEPES, 10mM glucose, pH7.4) wash this cell plate, stimulate in advance with KCl then, and following loading: add 0.05mL and be diluted in KCl and Fluo-4 (ultimate density 3 μ M, the Molecular Probes that every kind of test-compound, 0.1mL in the IMR32 damping fluid that contains 20 μ M nitrendipines (Sigma) is dissolved in the IMR32 damping fluid, Eugene, OR).Test-compound ultimate density scope is that about 846pM arrives about 17 μ M, and final nitrendipine concentration is 5 μ M, and final KCl concentration is 90mM.After 1 hour, be used in the every kind of test-compound washed cell of 0.05mL 2 times in the IMR32 damping fluid (not containing KCl or Fluo-4) that contains nitrendipine, be replaced by the every kind of test-compound of 0.1mL in containing the IMR32 damping fluid of nitrendipine then.Then plate is transferred to fluorescence imaging plate reading apparatus (FLIPR 96, Molecular Devices, Inc., Sunnyvale analyzes on CA).FLIPR Fundamentals of Measurement Fluo-4 fluorescence 315 seconds (promptly 5 minutes and 15 seconds) adds the 0.1mL KCl agonist that is dissolved in the IMR32 damping fluid then, measures fluorescence again 45 seconds.Behind the FLIPR reading, the final test-compound concentration range on the cell arrives about 17 μ M for about 846pM, and the ultimate density of nitrendipine is 5 μ M, and the ultimate density of KCl is 90mM.In whole time-histories, collect data, and with Excel, Graph Pad Prism (version 3.02, GraphPad, SanDiego, CA) or Activity Base (version 5.1, IDBS, Parsippany, NJ) software analysis.
The FLIPR calcium mobilization of L-type calcium channel analyzes.Carrying out this analysis the day before yesterday, with the A7r5 cell of trypsin treatment differentiation, T150cm then from converging 2In the culturing bottle by 1: 1 the dilution be implanted to 96-hole clear bottom black plate (Becton Dickinson, Franklin Lakes, NJ) on.Analyzing the same day, with A7r5 lavation buffer solution (127mM NaCl, 2mM MgCl 2, 700 μ MNaH 2PO 4, 5mM CaCl 2, 5mM NaHCO 3, 8mM HEPES, 10mM glucose pH7.4) washs this plate, loads 0.1mL then and contains Fluo-4 (ultimate density 3 μ M, Molecular Probes, Eugene, A7r5 lavation buffer solution OR).After 1 hour,, and be suspended from the A7r5 analysis buffer of 0.05mL by A7r5 lavation buffer solution and 50 μ M valinomycin (Sigma) with 0.1mLA7r5 lavation buffer solution washed cell.Then plate is transferred to FLIPR 96On analyze.FLIPR Fundamentals of Measurement Fluo-4 fluorescence 15 seconds adds every kind of test-compound of 0.05mL then, and all cpds is diluted in the A7r5 analysis buffer, and the ultimate density scope is that about 846pM is to about 17 μ M.Measure Fluo-4 fluorescence then 5 minutes, and added the 0.1mL KCl agonist be dissolved in the A7r5 analysis buffer to obtain the KCl of ultimate density 90mM to cell then, measured fluorescence again 45 seconds.In whole time-histories, collect data, and with Excel, Graph PadPrism or Activity Base software analysis.
The clone of N-and L-type calcium channel subunit opening code-reading frame cDNA.5 kinds of cDNA by pcr amplification clones coding rat N-or L-type calcium channel subunit are with recombination function passage in the allos system.They are alpha1b (α 1b), beta1 (β 1), beta3 (β 3), alpha2delta (α 2 δ) and alpha1c (α 1c) subunit cDNA.Alpha1b subunit cDNA has been described in people such as Dubel, among the Proc.Natl.Acad.Sci. U.S.A 89:5058-5062 (1992).Beta1 subunit cDNA has been described in people such as PragneH, among the FEBS Lett.291:253-258 (1991).Beta3 subunit cDNA has been described in people such as Castellano, among the J.Biol.Chem.268:12359-12366 (1993).Alpha2delta subunit cDNA has been described in people such as Kim, among the Proc.Natl.Acad.Sci.U.S.A.89:3251-3255 (1992).Alpha1c subunit cDNA has been described in people such as Koch, among the J.Biol.Chem.265:17786-17791 (1990).
The 7.0kb cDNA that will comprise whole α 1b opening code-reading frames (ORF) carries out pcr amplification, and it comprises 2 eclipsed cDNA fragments, i.e. 2.7kb 5 ' fragment and 4.4kb 3 ' fragment.5 ' fragment increases from rat brain cdna with primer 1 (SEQ ID NO:1, table 1) and 2 (SEQ ID NO:2, tables 1), and 3 ' fragment increases from rat spinal cord cDNA with primer 3 (SEQ ID NO:3, table 1) and 4 (SEQ ID NO:4, tables 1).By connecting 2 fragments are linked together, form complete 7.0kb cDNA at total restriction site.The protein isoforms body (isoform) that this ORF coding produces by the alternative splicing that is called "+A Δ SFMG Δ ET " according to people such as Lin (Neuron18:153-166 (1997)) nomenclature.On two chains, global cDNA is checked order by the redundancy covering.Use then Gateway system (Invitrogen) by homologous recombination with this cDNA be inserted into mammalian expression vector pcDNA6.2DEST (Invitrogen, CarlsbadCA) in.
By the 1.8kb cDNA of pcr amplification clones coding β 1 subunit from rat spinal cord cDNA (β 1) or brain cDNA (β 3, α 2 δ), the 3.3kb cDNA of the 1.45kb cDNA of coding beta3 subunit and coding alpha2delta subunit.Use primer 5 (SEQ ID NO:5, table 1) and 6 (SEQ ID NO:6, tables 1) to be used for β 1 cDNA amplification; Use primer 7 (SEQ ID NO:7, table 1) and 8 (SEQ ID NO:8, tables 1) to be used for β 3 cDNA amplification; Use primer 9 (SEQ IDNO:9, table 1) and 10 (SEQ ID NO:10, table 1) to be used for α 2 δ cDNA amplification.Subclone PCR product and order-checking fully on two chains.Will with canonical sequence (β 1:NM_017346; β 3:NM_012828; α 2 δ: M86621) and the clone of the GenBank rat genomic dna sequences match of gene recombinate that (β 1 for mammalian expression vector pcDNA3.2DEST, β 3) or pcDNA3.1-Zeo (α 2 δ) in, described carrier has used Gateway carrier joint test kit (Invitrogen) to be modified into the carrier compatible with the Gateway recombination system.The zone that produces reorganization by order-checking confirms correct reorganization.For β 3 expression vectors,, confirm correct protein expression by the HEK293 cell lysate of transfection being carried out the Western engram analysis with the rabbit polyclonal antiserum(antisera) (USA Biological) of the mouse β of the Chinese People's Anti-Japanese Military and Political College 3 subunits.
By pcr amplification 6.5kbcDNA with primer 11 (SEQ ID NO:11, table 1) and 12 (SEQ ID NO:12, table 1) clones coding L-type calcium channel α 1c subunit from rat heart cDNA.Subclone PCR fragment, and on two chains, check order fully to confirm its consistence.To recombinate with the clone of total canonical sequence M59786 and rat genomic dna sequences match among the mammalian expression vector pcDNA6.2DEST.Sequence around the mensuration recombination region is recombinated exactly with confirmation in the expression vector.
Table 1
Primer sequence SEQ ID NO.
CACC ATG GTC CGC TTC GGG GAC 1
CCG TTC AGT GGC CTC CTC C 2
C TAG CAC CAG TGA TCC TGG TCTG 3
AGT GCG TTG TGA GCG CAG TA 4
CAC CAT GGT CCA GAA GAG CGG 5
TCTCAGCGGATGTAGACGCCT 6
CAC CAT GTA TGA CGA CTC CTA C 7
GGT GGT CAG TAG CTG TCC TTA GG 8
CAC CAT GGC TGC TGG CTG CCT 9
AGA GGG TCA CCA TAG ATA GTG TCT G 10
CACCATGATTCGGGCCTTCGCT 11
AGCCTGCGGACTACAGGTTGCTGAC 12
The exploitation of N-type recombinant cell lines.Divide the preparation of 2 stages to express the HEK-293 cell of N-type calcium channel.Following establishing stage 1.According to manufacturers explanation with Lipofectamine Plus reagent (Invitrogen) with rat α 1b and β 3 cDNA expression construct (every kind 2.5 μ g) cotransfection in human embryo kidney (HEK) (HEK-293) cell.After 24 hours, cell is assigned in the selection substratum of a plurality of 96 orifice plates with limiting dilution, wherein said selection substratum contains 20 μ g/mL blasticidins and 500 μ g/mL Geneticins, and at 37 ℃, 5%CO 2, cultivated for 3 weeks under 95% humidity.Cultivate every hole and contain≤1 clone's plate, converge until mono-clonal male hole.Then single clone is assigned in the hurdle of target 96-orifice plate with array, and part is assigned in the 6-orifice plate to keep cultivation.With array board washing 1 time, (ultimate density 3 μ M, 0.1mL IMR32 damping fluid MolecularProbes) loaded cell 1 hour with containing Fluo-4 with the IMR32 damping fluid.Wash 2 times with 0.1mL IMR32 damping fluid then, and be replaced by 0.1mL IMR32 damping fluid.Then plate is transferred to FLIPR 96On analyze.FLIPR Fundamentals of Measurement Fluo-4 fluorescence 315 seconds adds the 0.1mL KCl agonist that is dissolved in the IMR32 damping fluid then, measures fluorescence again 45 seconds.The ultimate density of KCl is 90mM.In whole time-histories, collect data, and with Excel, Graph PadPrism or Activity Base software analysis.Amplification has maximum signal to noise ratio, passage number is had optimum stabilization reaction and PDL precoating plate (Becton Dickinson) is had the clone of optimal adherence, characterizes, and is used for the clone exploitation in stage 2.
The following N-type clone exploitation of carrying out the stage 2.According to manufacturers explanation with Lipofectamine Plus reagent (Invitrogen) with rat α 2 δ cDNA expression construct (every kind 5 μ g) transfection in the N-type cloned cell line in stage 1.After 24 hours, cell is assigned in the selection substratum of a plurality of 96 orifice plates with limiting dilution, wherein said selection substratum contains 20 μ g/mL blasticidins, 500 μ g/mL Geneticins and 250 μ g/mL zeocin, and at 37 ℃, 5%CO 2, cultivated for 3 weeks in 95% humidity.According to described identical step of stage 1 clone and method, cultivate and handle every hole and contain≤1 clone's plate.Amplification has maximum signal to noise ratio, has optimum stabilization to react and PDL precoating plate (Becton Dickinson) is had the clone of optimal adherence to passage number, characterize, and optimum current size, N-type pharmacology, N-type characteristic current-voltage relation and kinetics in the test electrophysiology as described below.
N-type electrophysiology.For carrying out the electrophysiology record, with about 10 4The density of cell/ware is implanted to the cell of express alpha 1b, β 3 and α 2 δ subunits in the 35-mm Petri culture dish and remains on the record that was used for subsequently up to 3 days in the incubator.For record, culture dish is placed on the worktable of inverted microscope (Nikon, Eclipse E600, Japan), and cover with dipping bath solution, wherein said dipping bath solution comprises BaCl 2(11mM), MgCl 2(1.5mM), HEPES (10mM), TEA muriate (120mM), glucose (10mM), and regulate pH to 7.4 with KOH.Down carry out full cell voltage in room temperature (22-24 ℃) and clamp record with conventional patch clamp technique people such as (, Pfluegers Arch.391:85-100 (1981)) Hamill.(WPI, Sarasota pull out patch-clamp pipette in FL) from WPI, heavy wall borosilicate glass.With Axopatch 200A amplifier (Axon Instruments, Union City, CA) record current, and deduction leakage current (P/4), low-pass filtering (1kHz, 4-utmost point Bessel), digitizing (20-50-μ s at interval), and with Digidata 1200B interface and Pclamp8.0/Clampex software (Axon Instruments, Union City CA) preserve.Oppositely fill suction pipe with interior solution, described interior solution comprises CsCl (110mM), MgCl 2(3mM), EGTA (3mM), HEPES (40mM), Mg-ATP (4mM), Na 2GTP (0.5mM), and regulate pH to 7.2 with CsOH.The suction pipe impedance ranges is 2 to 3 megaohms, and by built-in electronic circuit compensation 75-80%.
Cause electric current, kept 20 milliseconds from keeping current potential-90mV to rise to 0mV by per 10 seconds.When-90mV membrane voltage, there is a certain proportion of passage to be in inactivated state.Therefore, contacting the passage that will be referred to tranquillization and inactivation with retarding agent interacts.This scheme is used as the screening of first level.For two kinds of components (the apparent dissociation constant K of tranquillization part that separates inhibition rK with the inactivated state part i), collect the stable state inactivation curve with the two pulse scheme.With 3 seconds long depolarize prepulses that the 10mV step increases, be 10 milliseconds of test pulses subsequently to 0mV.
The stock solution for preparing every kind of test compounds with DMSO.To expectation concentration, DMSO concentration is 0.1% in final solution with the serial dilution of dipping bath solution.Apply medicine with the plane multitube array pipettor that is placed on apart from cell～1mm by run by gravity.
With Origin software (5.0 editions Microcal) are finished all fitting of a curve.Carry out the match of concentration-response curve with Hill's equation, and definite IC 50Value.Carry out the match of inactivation curve with the Boltzman equation, obtain half inactivation voltage V 0.5, slope p and the strength of current when maximum negative voltage when all passages are in quiescent condition at last.Calculate apparent dissociation constant with these parameters: K r=((Ab/Ac)/(1-(Ab/Ac)) * [b]), wherein [b] is drug level, and Ac is the full test strength of current under collating condition, and Ab is the full test strength of current when having retarding agent; K i=[b]/((exp ((dx/p)) * (1+ ([b]/K r))-1), wherein dx exists or half inactivation voltage V when not containing medicine 0.5Between difference, p is a slope.
Pharmacology in the body
Can be used in multiple arbitrarily anticonvulsion test in the mouse, comprise maximum electric shock outbreak test (MES), anti-convulsant activity in the body of test The compounds of this invention behind vein, oral or abdominal injection.In the Sprague-Dawley rat of the male NSA mouse of body weight 15-20g and body weight 200-225g, apply electric current (mouse: 50mA, 60 pulse/sec, 0.8 millisecond of pulse width with Ugo Basile ECT device (Model 7801), 1 second time length, D.C.; Rat: 99mA, 125 pulse/sec, 0.8 millisecond of pulse width, D.C.) is induced maximum electric shock outbreak at 2 seconds time length.Limit mouse by the sagging skin that grips its back surfaces, and the Corneal electrode of salt solution coating is leaned against on two corneas gently.Allow rat on testing table, to move freely, and use the ear clip electrode.Apply electric current and continuing to observe 30 seconds time of animal to observe the appearance of tetanic property hind leg extensor response.Tonic seizures is defined as hind leg and surpasses 90 degree from the health planar extension.With the quantization method result.
Can be as Hunskaar, S., O.B.Fasmer, and K.Hole, the anti-pain sensation (antinociceptive) activity of these compounds of test in the described formalin model of J.Neurosci.Methods 14:69-76 (1985).In all tests, can use male Swiss Webster NIH mouse (20-30g; Harlan, San Diego, CA).Removed food the same day in test.Mouse was positioned in the synthetic glass jar 1 hour at least, to conform.After conforming, mouse is weighed, in contrast with the carrier (10%Tween-80) of vein or Orally administered any compound of interest or proper volume.Behind the intravenously administrable behind 15 minutes and the oral administration 30 minutes, be expelled to the back side of the right back pawl of mouse with formalin (salt brine solution of 20 μ L, 5% formaldehyde).Mouse is transferred in the synthetic glass jar, and monitoring is licked or is stung the injection pawl institute's time spent amount of biting.After injection of formalin, continue 1 hour, with 5 minute interval record lick or sting the time of biting.In the bright cycle, finish all tests with blind method.Between 0-5 minute, lick/sting the commitment of biting as measuring the formalin reaction, measured late stage from 15-50 minute.Analyze difference between carrier and the drug treating group with one-way analysis of variance (ANOVA).P value＜0.05 is thought significantly.If these compounds in retardance early stage and subordinate phase formalin induce to lick and all have activity in the pawl activity, think that then they are for treating acute or chronic pain is effective.
Can come the potentiality of test compounds treatment chronic pain (promptly anti-allodynia and anti-hyperpathia activity) with the Chung model (Kim and Chung, Pain 50:355-363 (1992)) of peripheral neuropathy.With fluothane (accounting for 1-3% in the mixture of 70% air and 30% oxygen) anesthesia weight is the male Sprague-Dawley rat of 200-225g, controls their body temperature with the constant temperature blanket at anestheticing period.Make the back midline incision of 2-cm then on L5 and L6 level, paraspinal muscle the group shrink to both sides.Expose then, separate and with 6-0 or tight ligation L5 of 7-0 suture silk and L6 spinal nerves.On offside L5 that exposes and L6 spinal nerves, carry out sham-operation, and not ligation, as negative control.
Sense of touch sexual abnormality pain: can in animal, measure susceptibility, to estimate sense of touch sexual abnormality pain to non-hazardous property mechanical stimulus.Rat is transferred in the test cage with wire netting bottom of rising, allowed it shake down 5 to 10 minutes.The sole of the foot face that a series of vonFrey ultimate fibres are put on rear solid end is determined the threshold value of shrinking back of animal.Employed first fiber has the surrender weight (buckling weight) (.96log value) of 9.1gms, it is applied nearly 5 times whether cause withdrawing reaction to observe.If animal has withdrawing reaction, so should series in and then the lightest fiber can apply nearly and determine whether it also can induce reaction 5 times.Repeat this operation with lighter fiber subsequently, until not reaction, the identity of the lightest fiber that record induces reaction.If animal does not have withdrawing reaction for initial 9.1gms filament, the fiber that then can operating weight increases induces reaction until fiber, and writes down the identity of this fiber.For each animal, carry out measuring for 3 times mean value with the threshold value of determining to shrink back at each time point.Can be before administration and administration after tested in 1,2,4 and 24 hour.
Mechanical hyperalgesia: can press with pawl and test the susceptibility of in animal, measuring the hazardous property mechanical stimulus, to estimate mechanical hyperalgesia.As Stein (Biochemistry ﹠amp; Behavior 31:451-455 (1988)) described, in rat, measure in the rear solid end of the g threshold value (" PWT ") of shrinking back with pain sensation survey meter (algesymeter) (Model7200 is available from Ugo Basile of Italy) hazardous property mechanical stimulus reaction.The rat pawl is placed on the chain-wales, apply weight, until maximum 250g with hierarchical approaches.Weight when shrinking back fully with pawl is as terminal point.Every rat is at PWT of each time point determining.Can only on the pawl of damaged, perhaps on damaged or non-invasive pawl, all measure PWT.Before operation, test rat, to determine baseline or normal PWT.Different time (for example, 1,3,5 and 24 hour) is tested rat again before 2 to 3 weeks, the administration and after the administration after operation.The increase of PWT shows that test compounds has reduced mechanical hyperalgesia after the administration.
Pharmaceutical composition
Although The compounds of this invention can be applied to Mammals with the pure chemistry product form that does not contain other any components, but preferred described compound is to use as part of pharmaceutical compositions, and wherein said pharmaceutical composition comprises the combination of described compound and suitable pharmaceutical acceptable carrier.This carrier can be selected from acceptable vehicle of pharmacy and assistant agent.
Composition within the scope of the present invention comprises all compositions of The compounds of this invention and pharmaceutically acceptable carrier associating.In a preferred embodiment, the amount that is present in the described compound in the composition can effectively realize expecting therapeutic purpose.Although individual need can change, the optimum range of determining the significant quantity of every kind of compound is in the scope of art technology.Typically, described compound can be applied to Mammals such as people, with every day every kg weight of mammal about 0.0025 to about 1500mg oral dosage or its pharmaceutically acceptable salt of a great deal of, treats specified disease.The useful oral dosage that is applied to mammiferous The compounds of this invention is every kg weight of mammal about 0.0025 to about 50mg, or its pharmaceutically acceptable salt of a great deal of.For intramuscularly, dosage typically oral dosage pact half.
The unit oral dosage can comprise about 0.01 to about 50mg, preferred about 0.1 to about 10mg described compound.This unitary dose can be used as one or more tablets and uses one or many every day, and each tablet comprises about 0.01 to about 50mg described compound respectively, or its pharmacologically acceptable salts or the solvate of a great deal of.
In one embodiment, pharmaceutical composition of the present invention can be Orally administered, and be mixed with tablet, sugar-coat agent, capsule or oral liquid.
As an alternative, pharmaceutical composition of the present invention can be used by per rectum, and is mixed with suppository.
As an alternative, pharmaceutical composition of the present invention can be used through injection.
Pharmaceutical composition of the present invention can comprise about 0.01 to 99% weight, the active compound of preferred about 0.25 to 75% weight.
Pharmaceutical composition of the present invention can be administered to any animal of the beneficial effect that can experience The compounds of this invention.Although the present invention is not limited to these, the most important thing is Mammals in these animals, as people and companion animals.
Pharmaceutical composition of the present invention can be used by any way that can reach predetermined purpose.For example, can use by parenteral, subcutaneous, intravenously, intramuscular, intraperitoneal, transdermal or buccal approach.As an alternative, or side by side, can by oral route use.Application dosage can be different with route of administration, and this depends on the environment of special object, and consider multiple factor, age, health and body weight as object, the patient's condition to be treated or disease, if the type of combination therapy-character of therapeutic frequency and expectation function would be arranged.
Pharmaceutical composition of the present invention is preferably made by known method own, for example, and by routine mixing, granulation, the agent of sugaring clothing, dissolving or freeze-drying operation.Therefore, the work of oral pharmaceutical composition, can be by active compound and solid excipient be made up, randomly break the gained mixture into pieces, if expectation or necessary can also add suitable assistant agent, process mixture particle after this is to obtain tablet or sugar-coat agent core.
Suitable vehicle comprises that weighting agent as sugar (for example, lactose, sucrose, N.F,USP MANNITOL or Sorbitol Powder), cellulosics, calcium phosphate (for example, tricalcium phosphate or secondary calcium phosphate), and tackiness agent such as starch paste (for example, using W-Gum, wheat starch, rice starch or yam starch), gelatin, tragacanth gum, methylcellulose gum, Vltra tears, Xylo-Mucine and/or polyvinylpyrrolidone.If expectation can add one or more disintegrating agents, for example above-mentioned starch and carboxymethyl-starch, cross-linked polyvinylpyrrolidone, agar or Lalgine or its salt are as sodium alginate.
Assistant agent is flowing regulator and lubricant typically, for example silica gel, talcum, stearic acid or its salt (for example Magnesium Stearate or calcium stearate) and polyoxyethylene glycol.Sugar-coat agent core has the resistive suitable dressing of gastric juice.For this purpose, can use concentrated sugar solution, it can randomly comprise gum arabic, talcum, polyvinylpyrrolidone, polyoxyethylene glycol and/or titanium dioxide, lacquer solution and appropriate organic solvent or solvent mixture.In order to prepare, can use the solution of suitable cellulosics such as phthalic acid cellulose acetate or Hydroxypropyl Methylcellulose Phathalate to the resistive dressing of gastric juice.Can in tablet or dragee coatings, add dyestuff or pigment, for example, be used to discern or in order to characterize the combination of active compound doses.
The other drug examples of formulations that can orally use comprises the sucking fit capsule by gelatin preparation, perhaps by soft, the seal capsule of gelatin and softening agent such as glycerine or Sorbitol Powder preparation.The sucking fit capsule can comprise the compound of particle form, described compound can with weighting agent such as lactose, tackiness agent such as starch, and/or lubricant such as talcum or Magnesium Stearate mix mutually with stablizer randomly.In soft capsule, active compound preferred dissolution or be dispersed in the suitable liquid is in fatty oil or whiteruss.In addition, can add stablizer.
The possible pharmaceutical preparation that is used for rectal administration comprises, for example, suppository, its combination by one or more active compounds and suppository base is formed.Suitable suppository base comprises natural or synthetic glycerine three esters and paraffinic hydrocarbon etc.Also can use gelatin rectal capsule, its combination by active compound and substrate material is formed, described substrate material for example, liquid triglycerides, polyoxyethylene glycol or paraffinic hydrocarbon.
Be used for the aqueous solution that appropriate formulation that parenteral uses comprises the water-soluble form active compound, for example water-soluble salt, basic solution or acidic solution.As an alternative, the suspension of active compound can be prepared into the oiliness suspension.The suitable lipophilic solvent or the carrier that are used for this suspension can comprise fatty oil (for example sesame oil), synthetic fatty acid ester (for example ethyl oleate), triglyceride level or polyoxyethylene glycol such as polyoxyethylene glycol-400 (PEG-400).Aqueous suspensions can comprise one or more materials that increases suspension viscosity, comprises for example Xylo-Mucine, Sorbitol Powder and/or dextran.Suspension can randomly comprise stablizer.
The following example of compound of the present invention, composition and method is illustrative, rather than restrictive.That in clinical treatment, often run into and it will be apparent to those skilled in the art according to present disclosure, to the suitable improvement of multiple condition and parameter with adapt to all within the spirit and scope of the present invention.
Embodiment
Embodiment 1
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzene sulfonyl
Amine fumarate (4)
Figure A20058003494600941
A) 4-(3-trifluoromethyl phenylsulfonamido) piperidines-1-carboxylic acid tert-butyl ester (1): get 4-amino-N-tert-butoxycarbonyl piperidines (4.55g, 22.72mmol) and triethylamine (4.7mL 94.7mmol) is dissolved in the exsiccant methylene dichloride (50mL).(3.64mL 22.72mmol), stirs mixture 12 hours to add 3-trifluoromethyl benzene sulfonyl chloride.Solvent removed in vacuo, residue are distributed between ice-cold 1M hydrochloric acid (500mL) and ether (500mL), separate organic phase, dry (MgSO 4) and vacuum evaporating solvent to dry, the solid title compound 1 that obtains being white in color (9g, 100%).LC：100％。MS：m/z＝438.1(M+Na)。
B) N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (2): get 4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carboxylic acid tert-butyl ester (1) (9.0g under stirring; 22.04mmol) be dissolved in the trifluoroacetic acid (20mL), mixture was at room temperature stirred 4 hours.Water (300mL) dilutes this mixture, and with ether (300mL) extraction, discards ether then.Carefully water is basified to pH 10 with salt of wormwood, with ethyl acetate (2 * 300mL) extractions, dry (MgSO 4), vacuum evaporating solvent is to drying, the solid title compound 2 that obtains being white in color (6.3g, 93%).LC：87％。MS；m/z＝309.2(M+H)。
C) (2S) methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl]-butyl } t-butyl carbamate (3): get N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (2) (6.3g; 20.4mmol); I-hydroxybenzotriazole (3.32g; 24.52mmol); hydrochloric acid N-ethyl-dimethylaminopropyl carbodiimide (EDCI) (4.7g; 24.52mmol) and the N-BOC-N-methylleucine (5.5g 22.44mmol) is suspended in the dry tetrahydrofuran (100mL).(8.5ml, 61.2mmol), mixture stirs and spends the night to add triethylamine (TEA) in this suspension.Mixture is poured into 1M sodium hydroxide solution (300mL), and (2 * 300mL) extract, dry (MgSO with ethyl acetate 4), vacuum evaporating solvent obtains pale solid to dry.Break this solid solid title compound 3 (yield 10.35g, 95%) that obtains being white in color into pieces with ether (100mL). 1HNMR (400MHz, CDCl 3): δ (2: 1 mixtures of rotational isomer) 8.15 (1H, s), 8.07 (1H, d, J=12Hz), 7.85 (1H, d, J=12Hz), 7.66 (1H, m), 5.05-3.8 (4H, m), 3.55 (1H, m), 3.20-2.90 (1H, m), 2.65 (2s, 3H), 2.90-2.57 (1H, m), 1.74 (2H, m), 1.70-1.10 (15H, m), 0.90 (6H, d, J=15Hz).LC：100％。MS：m/z＝558.3(M+Na)。
D) (2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate (4): get methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl]-butyl }-t-butyl carbamate (3) (1.0g; 1.87mmol) be dissolved in the trifluoroacetic acid (5mL), mixture at room temperature stirred 3 hours.Water (100mL) dilutes this mixture, and (2 * 100mL) extractions discard ether then with ether.With salt of wormwood water is basified to pH10, with methylene dichloride (2 * 100ml) extractions, dry (MgSO 4), vacuum evaporating solvent is to dry, obtain colourless foam (679mg, 1.56mmol).This foam is dissolved in the ether (25ml), in mixture, adds and contain fumaric acid (181mg, methyl alcohol 1.56mmol) (2mL).Filter this mixture, vacuum-drying product, the solid title compound that obtains being white in color (680mg, 66%).LC：98.1％。
1H NMR (400MHz, CDCl 3): δ 8.18 (1H, s), 8.10 (1H, d, J=6.8Hz), 7.86 (1H, t, J=6.8Hz), 7.70 (1H, m), 6.75 (2H, s), 4.40-4.20 (1H, m), 4.17-4.03 (1H, m), 3.43-2.75 (4H, m), 2.55 and 2.45 (2s, 3H), 1.95-1.37 (7H, m), 0.96 (6H, m).MS(e/z)：513(M+H +)。
Embodiment 2
The alkylation conditions of the sulphonamide of embodiment 1 (3)
Method A
Scheme 9
Get methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino)-piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (1.0g, 1.87mmol), and triphenylphosphine (0.59g 2.24mmol) is dissolved in the exsiccant tetrahydrofuran (THF) (10mL).Add alcohol roh (2.24mmol) in mixture, (0.44mL, 2.24mmol), mixture stirred 24 hours at 50 ℃ to add the azoformic acid diisopropyl ester then.Solvent removed in vacuo, residue is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use hexane: ethyl acetate (3: 1) wash-out obtains being the product that colourless gelationus BOC protects.In trifluoroacetic acid (6mL), and low-grade fever continues 5 minutes to about 50 ℃ with this substance dissolves.Mixture is distributed water phase separated between water (50mL) and ether (50mL).With salt of wormwood water is basified to pH10, with ethyl acetate (2 * 50ml) extractions, dry (MgSO 4), vacuum evaporating solvent obtains jelly to dry.This jelly is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use ethyl acetate: methyl alcohol: ammoniacal liquor (200: 40: 4) wash-out obtains being colourless gelationus free alkali.It is dissolved in the ethyl acetate (5ml), and in this mixture, adds the methyl alcohol (1mL) that contains fumaric acid (1mol equivalent).Vacuum evaporating solvent is to dry, breaks the residue solid fumarate that obtains being white in color into pieces with ether.
Method B
Scheme 10
Under argon gas in the suspension that in dry DMF (5mL), is dispersed in the sodium hydride 95% in the mineral oil disposable whole adding methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (0.93mmol), mixture stirred 2 hours down at 70 ℃.Add alkyl bromide RBr (1.12mmol) in mixture, reaction mixture is heated to 100 ℃ and continues 48 hours.(5mL) makes the reaction mixture stopped reaction with methyl alcohol, and vacuum evaporating solvent is to dry.Handle residue and stirred 4 hours with trifluoroacetic acid (4mL).Mixture is distributed water phase separated between ether (50mL) and 1M hydrochloric acid (50mL).To pH10, (2 * 50mL) extract, dry (MgSO with ethyl acetate with salt of wormwood alkalization water 4) and vacuum evaporating solvent to dry.Residue is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use ethyl acetate: methyl alcohol: ammoniacal liquor (250: 40: 4) wash-out obtains free alkali.This alkali dissolution is added the diox 4M (1mL) that contains hydrogenchloride in methylene dichloride (5mL) and in mixture.The vacuum-evaporation mixture is to dry, and (20mL) breaks this mixture into pieces with ether, and the solid hydrochloride obtains being white in color.
As an alternative, be prepared as follows fumarate.Get described free alkali and be dissolved in the ether (20mL), adding contains in the methyl alcohol (1-2mL) of fumaric acid (1mol equivalent).Vacuum evaporating solvent is to dry, and (5-10mL) breaks this mixture into pieces with ether, and the solid fumarate obtains being white in color.By the following compound of method for preparing:
A) (2S) N-methyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate (5): by method B; with methyl iodide with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (0.5g, 0.93mmol) alkylation.With method B free alkali (300mg) is changed into fumarate, solid compound (5) (305mg, 59%) obtains being white in color.LC：100％。MS：m/z＝450.2，451.2(M+H)。 1H NMR (400MHz, CDCl 3): δ (1: 1 mixture of rotational isomer) 8.09 (1H, s), 8.02 (1H, m), 7.86 (1H, d, J=7.5Hz), 7.72 (1H, t, J=7.5Hz), 7.6-6.9 (2H, bs, CO 2H), 6.77 (2H, s), 4.75 (1H, d, J=13Hz), 4.06 (1H, m), 4.96 (1H, d, J=13Hz), 3.62-3.75 (1H, m), 3.10 (1H, m), 2.78 (3H, s), 2.55 (1H, m), 2.40,2.32 (3H, 2s), 1.85-1.30 (7H, m), 0.92 (6H, m).
B) (2S) N-sec.-propyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate (6): usefulness method A, Mitsunobu condition with Virahol with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl }-t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.With product carry out chromatogram (hexane: ethyl acetate 4: 1), TLC (SiO 2, ethyl acetate: hexane 1: 4, Rf=0.14).Handled the purifying after product 5 minutes with trifluoroacetic acid (6ml) at 50 ℃.With condition A treating mixture, and use the flash chromatography ethyl acetate: methyl alcohol: ammoniacal liquor (250: 40: 4) purifying obtains foamed free alkali (123mg).Convert it into fumarate (condition A) the solid title compound (6) (120mg, 10%) that obtains being white in color.LC：100％。MS(m/z)：478.2，479.2(M+H)。 1H NMR (400MHz, DMSO-d 6): δ 8.18 (1H, d, J=7.5Hz), 8.06 (2H, m), 7.87 (1H, t, J=7.5Hz), 6.52 (2H, s), 4.48 (1H, m), 3.96 (1H, d, J=13Hz), 3.92-3.60 (4H, m), 3.15 (1H, m), 2.65 (1H, m), 2.28 and 2.20 (3H, 2s), 2.05-1.85 (2H, m), 1.80-1.55 (3H, m), 1.35 (2H, m), 1.12 (6H, m), 0.86 (6H, m).TLC (SiO 2, ethyl acetate: methyl alcohol: Rf=0.12 ultraviolet detection ammoniacal liquor 250: 40: 4).
Similarly, preparation (2S) N-isobutyl--N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide.LC：80.9％。MS(m/z)：492.3，493.4(M+H +)，494.2(M+2H +)。1H NMR(400MHz，CD 3OD)：δ 8.16(1H，m)，8.13(1H，m)，8.00(1H，d，J＝7.2Hz)，7.84(1H，m)，4.42(1H，m)，3.92(2H，m)，3.22(1H，m)，3.06(2H，m)，2.67(4H，m)，2.00(1H，m)，1.69(8H，m)，0.99(12H，m)。
C) (2S) N-cyclopropyl methyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate (7): by method B; with the cyclopropyl monobromomethane with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl }-t-butyl carbamate (3) (0.5g, 0.93mmol) alkylation.Handle product with trifluoroacetic acid, and handle according to method B.Flash chromatography (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor 250: 20: 2) obtain being colourless gelationus free alkali (88mg).This glue is converted into fumarate, and solid title compound (7) (80mg, 14%) obtains being white in color.TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 250: 40: 4): Rf=0.31 (UV detects and platinum potassium iodine).LC：100％。MS(m/z)：490.2，491.2(M+H)。 1H NMR (400MHz, DMSO-d 6): δ 8.20 (1H, d, J=7Hz), 8.12 (1H, s), 8.07 (1H, d, J=7Hz), 7.85 (1H, t, J=7Hz), 6.56 (2H, s), 4.45 (1H, m), 4.00-3.05 (5H, m), 2.65 (2H, m), 2.30 and 2.22 (3H, 2s), 1.73-1.48 (5H, m), 1.35 (2H, m), 0.95 (1H, m), 0.85 (6H, m), 0.45 (2H, m), 0.25 (2H, m).
D) (2S) N-cyclopentyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate (8): usefulness method A, Mitsunobu condition with cyclopentanol with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl }-t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.Use hexane: ethyl acetate (3: 1) is carried out the material (150mg) that chromatogram obtains the BOC protection with product.Handled this material 20 minutes at 40 ℃ with trifluoroacetic acid (4mL).With the condition reaction mixture of method A, use ethyl acetate then: methyl alcohol: ammoniacal liquor (200: 40: 4) carries out chromatogram and obtains free alkali (106mg).This alkali is converted into the fumarate solid title compound (8) (100mg, 18%) that obtains being white in color.LC：100％。MS(m/z)：504.3，505.4(M+H)。 1H NMR (400MHz, DMSO-d 6): δ 8.16 (1H, d, J=7.5Hz), 8.07 (2H, m), 7.86 (1H, t, J=7.5Hz), 6.57 (2H, s), 4.45 (1H, m), 4.08-3.86 (4H, m), 3.57 (1H, m), 3.15 (1H, m), 2.67 (1H, m), 2.36 and 2.30 (3H, 2s), 1.95 (2H, m), 1.75-1.35 (14H, m), 0.90 (6H, m).
E) (2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-3-yl)-3-trifluoromethyl benzsulfamide fumarate (9): usefulness method A, Mitsunobu condition; with 3-hydroxyl-tetrahydrofuran (THF) with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl }-t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.Use hexane: ethyl acetate (2: 1) is carried out the material (75mg) that chromatogram obtains being subjected to the BOC protection, TLC SiO with reaction mixture 2(hexane: ethyl acetate 2: 1, Rf=0.31), UV detects.Stirred this material 20 minutes at 40 ℃ with trifluoroacetic acid (4mL).Handle this mixture circumstances in which people get things ready for a trip spectrum (method A) of going forward side by side, obtain free alkali (46mg).This alkali is converted into the fumarate solid title compound (9) (48mg, 8%) that obtains being white in color.LC：100％。MS：506.2，507.3(M+H)。 1H NMR (400MHz, DMSO-d 6): δ 8.17 (1H, d, J=7.5Hz), 8.08 (2H, m), 7.87 (1H, t, J=7.5Hz), 6.53 (2H, s), 4.45 (2H, m), 3.93 (2H, m), 3.78-3.50 (6H, m), 2.38 and 2.30 (3H, 2s), 2.13-1.83 (4H, m), 1.80-1.57 (3H, m), 1.33 (2H, m), 1.88 (6H, m).
F) (2S) 2-[[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-(3-trifluoromethyl benzenesulfonyl) amino] acetamide hydrochloride (10): the condition of usefulness method B; with the 2-bromoacetamide with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino) piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.Remove the BOC protecting group with trifluoroacetic acid, product is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use ethyl acetate: methyl alcohol: ammoniacal liquor (250: 40: 4) wash-out obtains free alkali.This alkali is converted into the hydrochloride solid title compound (10) (170mg, 30%) that obtains being white in color.TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 250: 40: 4): Rf=0.22; UV detects, Dragendorff ' s reagent.LC：100％。MS(m/z)：493.2，494.2(M+H)。 1H NMR (400MHz, CDCl 3): (mixture of rotational isomer) δ 9.6-8.9 (2H, bs), 8.32 (1H, s), 8.22 (1H, d, J=8.8Hz), 7.85 (1H, d, J=8.8Hz), 7.70 (1H, t, J=8.8Hz), 7.30 (1H, bs), 6.90 (1H, bs), 4.60 (1H, bd, J=13Hz), 4.25 (3H, m), 4.05-3.8 (2H, m), 3.06 (1H, t, J=13Hz), 2.75 (3H, s), 2.53 (1H, t, J=13Hz), 2.20 (1H, m), 1.95-1.65 (6H, m), 0.93 (6H, m).
G) (2S) N-(2-hydroxyethyl)-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethylbenzene sulfonamide hydrochloride (11): the condition of usefulness method B; with ethylene bromohyrin with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethylbenzene sulfuryl amino)-piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.Remove the BOC protecting group with trifluoroacetic acid, product is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use ethyl acetate: methyl alcohol: ammoniacal liquor (250: 40: 4) wash-out obtains free alkali.This alkali is converted into hydrochloride, and solid title compound (11) (65mg, 11%) obtains being white in color.TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 250: 40: 4): Rf=0.26; UV detects; Dragendorff ' s reagent.LC：100％。MS(m/z)：480.2(M+H)，502.2(M+Na)。 1H NMR (400MHz, CDCl 3): (mixture of rotational isomer) δ 9.90 (1H, bs), 9.35 (1H, bs), 8.13 (1H, s), 8.06 (1H, d, J=9.0Hz), 7.84 (1H, d, J=9.0Hz), 7.70 (1H, t, J=9.0Hz), 4.61 (1H, m), 4.10-3.70 (6H, m), 3.45 (2H, m), and 3.30-3.05 (2H, m), 2.75-2.40 (7H, m), 1.95-1.45 (6H, m), 0.97 (6H, m).
H) (2S) N-(2-methylsulfonyl amino-ethyl)-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide fumarate) (12): the condition of usefulness method B; with N-(2-bromotrifluoromethane)-Toluidrin with methyl-{ 3-methyl isophthalic acid-[4-(3-trifluoromethyl-benzenesulfonyl amino) piperidines-1-carbonyl] butyl } t-butyl carbamate (3) (1.0g, 1.87mmol) alkylation.Remove the BOC protecting group with trifluoroacetic acid, product is in the enterprising circumstances in which people get things ready for a trip spectrum of quick silica gel and use ethyl acetate: methyl alcohol: ammoniacal liquor (250: 40: 4) wash-out obtains free alkali.This alkali is converted into the fumarate solid title compound (12) (190mg, 30%) that obtains being white in color.TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 250: 40: 4): Rf=031; UV detects; Dragendorff ' s reagent.LC：100％。MS(m/z)：557.3，558.3(M+H)，579.2(M+Na)。 1H NMR (400MHz, DMSO-d 6): (mixture of rotational isomer) δ 8.22 (1H, d, J=10Hz), 8.15 (1H, s), 8.10 (1H, d, J=10Hz), 7.89 (1H, t, J=10Hz), 7.24 (1H, m), 6.55 (2H, s), 4.44 (1H, d, J=12Hz), 4.02-3.75 (6H, m), 2.91 (3H, s), 2.70-2.55 (2H, m), 2.25 (3H, 2s), 1.75-1.28 (7H, m), 0.86 (6H, m).
Embodiment 3
N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (14)
Figure A20058003494601021
A) N-(1-benzyl piepridine-4-yl)-N-cyclopropyl-3-trifluoromethyl-benzsulfamide (13): get N-benzyl-4-cyclopropyl amino piperidine (5.0g, 21.71mmol) and triethylamine (3.6mL, 26.05mmol) be dissolved in methylene dichloride (DCM, 100mL).(3.47mL, 21.71mmol), reaction mixture stirs and spends the night to add 3-trifluoromethyl benzene sulfonyl chloride.Then mixture is poured in the solution of potassium carbonate (200mL), with ether (2 * 200mL) extractions, dry (MgSO 4), and vacuum concentration, obtaining being yellow gelationus crude product, it comes purifying by carry out column chromatography on silica gel (hexane/EtOAc, 2: 1).Obtain being the title compound 13 (9g, 95% yield) of faint yellow glue.Rf=0.42 (UV detection).
B) N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (14): (9.0g 20.52mmol) is dissolved in the ethanol (100mL) to get N-(1-benzyl piepridine-4-yl)-N-cyclopropyl-3-trifluoromethyl benzsulfamide (13).Add entry (10mL) in mixture, (12.94g is 205.20mmol) with 10% palladium/carbon (1.0g) to add ammonium formiate then.Heated mixt is 2 hours under refluxing.Cooling mixture also passes through diatomite filtration.Vacuum concentrated filtrate obtains colourless residue, distributes between ethyl acetate (250mL) and solution of potassium carbonate (250mL) then.Separate organic phase, dry (MgSO4) concentrates and obtains white solid, breaks into pieces with hexane (100mL) and obtains being white in color solid expectation product 14 (6.0g, 84% yield).LC：100％。1H NMR(CDCl 3)：δ8.15(1H，s)，8.07(1H，d，J＝7.9Hz)，7.85(1H，d，J＝7.9Hz)，7.69(1H，t，J＝7.9Hz)，3.95(1H，tt，J＝8.0，3.8Hz)，3.10(2H，dd，J＝12.2，3.8Hz)，2.62(2H，dt，J＝10.0，2.2Hz)，1.98(1H，m)，1.83(2H，dq，J＝12.2，4.1Hz)，1.62-1.50(4H，m)，1.00(2H，m)，0.78(2H，m)。MS：m/z＝349.2，350.2(M+H)。TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 250: 10: 1): Rf=0.30.
Embodiment 4
N-cyclopropyl-N-[1-(naphthalene-2-ylmethyl) piperidin-4-yl]-benzsulfamide (15)
Get N-cyclopropyl-N-piperidin-4-yl-benzsulfamide (56mg 0.2mmol) is dissolved among the DMF (2.5ml), and add triethylamine (75 μ L, 54mg, 0.54mmol), add then 2-brooethyl-naphthalene (88mg, 0.4mmol).Reaction mixture stirred 12 hours down at 80 ℃, then evaporating solvent.By the purification by flash chromatography product, obtain 12.8mg expectation product N-cyclopropyl-N-[1-(naphthalene-2-ylmethyl)-piperidin-4-yl] benzsulfamide (15). 1H NMR(CDCl 3)：δ8.06-7.71(m，7H)，7.61-7.44(m，5H)，3.94-3.84(m，1H)，3.68(S，2H)，3.01-2.94(m，2H)，2.18-1.94(m，5H)，1.58-1.49(m，2H)，1.02-0.96(m，2H)，0.81-0.74(m，2H)。MS(EI)：m/z 421(M+H +)。
Embodiment 5
N-cyclopropyl-N-[1-(4-phenylbenzyl) piperidin-4-yl]-benzsulfamide (16)
Figure A20058003494601041
Get N-cyclopropyl-N-piperidin-4-yl-benzsulfamide (56mg 0.2mmol) is dissolved among the DMF (2.5ml), and add triethylamine (75 μ L, 54mg, 0.54mmol), add then 4-chloromethyl-biphenyl (81mg, 0.4mmol).Reaction mixture stirred 12 hours down at 80 ℃, then evaporating solvent.By the purification by flash chromatography product, obtain 16.4mg expectation product N-cyclopropyl-N-[1-(4-phenylbenzyl) piperidin-4-yl] benzsulfamide (16). 1H NMR(CDCl 3)：δ7.92-7.85(m，1H)，7.63-7.31(m，9H)，7.30-7.25(m，4H)，3.93-3.83(m，1H)，3.54(s，2H)，3.00-2.89(m，2H)，2.14-1.89(m，5H)，1.66-1.49(m，2H+H 2O)，1.04-0.97(m，2H)，0.81-0.72(m，2H)。LC：98％。MS(EI)：m/z 447(M+H +)。
Embodiment 6
N-cyclopropyl-N-[1-(4-isopropyl benzyl) piperidin-4-yl]-benzsulfamide (17)
Figure A20058003494601051
Get N-cyclopropyl-N-piperidin-4-yl-benzsulfamide (100mg 0.36mmol) is dissolved among the DMF (2.5mL), and add triethylamine (75 μ L, 54mg, 0.54mmol), add then 1-brooethyl-4-isopropyl benzene (83.5mg, 0.39mmol).Reaction mixture stirred 12 hours down at 80 ℃, then evaporating solvent.By the purification by flash chromatography residue, obtain the title compound 17 that 29mg is yellow oily. 1H NMR(CDCl 3)：δ7.88-7.83(m，2H)，7.59-7.47(m，3H)，7.21-7.14(m，4H)，3.89-3.78(m，1H)，3.45(s，2H)，2.95-2.88(m，3H)，2.03-1.84(m，5H)，1.51-1.44(m，m，2H)，1.23(d，6H，J＝7.01Hz)，1.01-0.93(m，2H)，0.79-0.69(m，2H)。LC：100％。MS(EI)：m/z 413(M+H +)。
Similarly, prepare N-cyclopropyl-N-[1-(4-dimethylamino benzyl) piperidin-4-yl from N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide and 1-brooethyl-4-dimethylamino benzene]-3-trifluoromethyl benzsulfamide.
Equally, prepare N-cyclopropyl-N-[1-(4-tertiary butyl benzyl) piperidin-4-yl from N-cyclopropyl-N-piperidin-4-yl-benzsulfamide and 1-brooethyl-4-tert.-butylbenzene]-benzsulfamide.LC：100％，MS：m/z＝427.2，428.3(M+H +)。 1H NMR(400MHz，CDCl 3)：δ7.85(2H，m)，7.56(1H，m)，7.50(2H，m)，7.32(2H，d，J＝8.4Hz)，7.19(2H，d，J＝8.4Hz)，3.85(1H，m)，3.44(2H，s)，2.89(1H，s)，2.87(1H，s)，1.97(5H，m)，1.59(4H，s)，1.49(1H，s)，1.47(1H，s)，1.32(9H，s)，0.97(2H，m)，0.75(2H，m)。
Embodiment 7
N-cyclopropyl-N-[1-(3-trifluoromethyl-4-methoxy-benzyl) piperidin-4-yl]-the 3-trifluoromethyl
Benzsulfamide (18)
Figure A20058003494601061
Get N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (200mg, 0.57mmol) be dissolved among the DMF (4mL), and the adding triethylamine (200 μ L, 1.43mmol), add then 4-brooethyl-1-methoxyl group-2-trifluoromethyl-benzene (154mg, 0.57mmol).Reaction mixture stirred 12 hours down at 80 ℃, then evaporating solvent.By the purification by flash chromatography residue, obtain the title compound 18 that 244mg is yellow solid. 1H NMR(CDCl 3)：68.14-8.11(m，1H)，8.07-8.03(m，1H)，7.86-7.80(m，1H)，7.70-7.64(m，1H)，7.50-7.47(m，1H)，7.42-7.37(m，1H)，6.96-6.91(m，1H)，3.93-3.79(m，4H)，3.42(s，2H)，2.91-2.80(m，2H)，2.03-1.85(m，m，5H)，1.53-1.44(m，2H)，1.02-0.96(m，2H)，0.83-0.76(m，2H)。LC：100％。MS(EI)：m/z 537(M+H +)。
Similarly, prepare N-cyclopropyl-N-[1-(3-trifluoromethyl-4-methoxy-benzyl)-piperidin-4-yl by N-cyclopropyl-N-piperidin-4-yl-benzsulfamide] benzsulfamide.LC：98％。MS：m/z＝469.2，470.1(M+H +)。 1H NMR(400MHz，CDCl 3)：δ7.86(2H，m)，7.57(1H，m)，7.49(3H，m)，7.39(1H，d，J＝8.4Hz)，6.93(1H，d，J＝8.4Hz)，3.89(3H，s)，3.84(1H，m)，3.42(2H，s)，2.84(1H，s)，2.82(1H，s)，1.95(5H，m)，1.59(2H，s)，1.51(1H，s)，1.48(1H，s)，0.97(2H，m)，0.75(2H，m)。
According to aforesaid method, prepare N-cyclopropyl-N-[1-(3-methyl-4-methoxy-benzyl) piperidin-4-yl by 4-brooethyl-1-methoxyl group-2-methylbenzene]-3-trifluoromethyl benzsulfamide.LC：99.6％。MS：m/z＝483.1，484.2(M+H +)，485.1(M+2H +)。 1H NMR(400MHz，CDCl 3)：δ8.12(1H，s)，8.04 1H，d，J＝7.6Hz)，7.82(1H，d，J＝6.8Hz)，7.66(1H，m)，7.05(2H，m)，6.75(1H，m)，3.83(1H，m)，3.81 3H，m)，3.39(2H，s)，2.88(2H，m)，2.20(3H，s)，1.96(5H，m)，1.57(2H，s)，1.49(2H，s)，0.98(2H，m)，0.78(2H，m)。
According to aforesaid method, prepare N-cyclopropyl-N-[1-(3-methyl-4-methoxy-benzyl) piperidin-4-yl by 4-brooethyl-1-methoxyl group-2-methylbenzene and N-cyclopropyl-N-piperidin-4-yl-benzsulfamide] benzsulfamide.LC：100％。MS：m/z＝415.2，416.2(M+H +)。 1H NMR(400MHz，CDCl 3)：δ7.82(2H，d，J＝8.0Hz)，7.60(1H，m)，7.52(2H，m)，7.29(1H，m)，7.21(1H，s)，6.85(1H，d，J＝8.8Hz)，4.13(2H，s)，4.05(1H，s)，3.85(3H，s)，3.54(2H，m)，2.63(4H，m)，2.22(3H，s)，1.75(3H，m)，0.93(2H，m)，0.86(2H，m)。
Embodiment 8
N-cyclopropyl-N-[1-(3-pyridylmethyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (19)
Figure A20058003494601071
To N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (150mg, 0.43mmol) and pyridine-3-formaldehyde (46mg adds sodium triacetoxy borohydride (128mg, 0.60mmol, 1.4 equivalents) in dichloroethane solution 0.43mmol).Reaction mixture at room temperature stirred 12 hours.After this, pour out solution, and, obtain being the title compound 19 of yellow oily by purification by flash chromatography. 1H NMR(CDCl 3)：δ8.55-8.48(m，2H)，8.15-8.11(m，1H)，8.08-8.02(m，1H)，7.87-7.81(m，1H)，7.71-7.59(m，1H)，7.25-7.20(m，1H)，3.92-3.81(m，1H)，3.48(s，2H)，2.91-2.81(m，2H)，2.10-1.87(m，5H)，1.56-1.45(m，2H)，1.01-0.94(m，m，2H)，0.82-0.74(m，2H)。LC：100％。MS(EI)：m/z 440(M+H +)。
Similarly, prepare N-cyclopropyl-N-[1-(4-quinolyl methyl) piperidin-4-yl by quinoline-4-formaldehyde]-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝490.2，491.1(M+H +)，492.1 M+2H+)。 1H NMR(400MHz，CDCl 3)：68.85(1H，d，J＝4Hz)，8.13(3H，m)，8.06(1H，d，J＝7.6Hz)，7.83(1H，d，J＝7.2Hz)，7.70(2H，m)，7.56(1H，m)，7.41(1H，d，J＝4Hz)，3.90(3H，m)，2.97(1H，s)，2.94(1H，s)，2.17(2H，t，J＝11Hz)，1.98(3H，m)，1.56(4H，m)，0.98(2H，m)，0.80(2H，m)。
Embodiment 9
N-cyclopropyl-N-[1-(4-methoxy-benzyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (20)
Figure A20058003494601081
Get N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (150mg, 0.43mmol) be dissolved among the DMF (3mL) and add triethylamine (150 μ L, 1.07mmol, 2.5 equivalents), add then 1-chloromethyl-4-anisole (58mg, 0.43mmol).Reaction mixture stirred 12 hours down at 80 ℃, then evaporating solvent.By the purification by flash chromatography residue, obtain the title compound 20 that 244mg is yellow oily: 1H NMR (CDCl 3): δ 8.15-8.10 (m, 1H), 8.07-8.01 (m, 1H), 7.85-7.80 (m, 1H), and 7.67-7.62 (m, 1H), 7.23-7.15 (m, 2H), 6.87-6.82 (m, 2H), 3.91-3.76 (m, 4H), 3.42 (s, 2H), 2.93-2.88 (m, 2H), 2.03-1.87 (m, 5H), 1.52-1.43 (m, 2H), 1.01-0.94 (m, 2H), 0.81-0.73 (m, 2H).LC：100％。MS(EI)：m/z469(M+H +)。
Embodiment 10
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (21)
Figure A20058003494601091
In argon gas and under the room temperature, in 15 minutes to the N-cyclopropyl in methylene dichloride (20mL)-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (1.0g, 2.9mmol), BOC-L-Meleu-OH (0.72g, 2.9mmol), I-hydroxybenzotriazole hydrate (HOBt, 50mg, 0.37mmol), 4-dimethylaminopyridine (DMAP, 20mg adds 1 in mixture 0.16mmol), 3-DIC (DIC, 0.44mL, 2.9mmol).Reaction mixture at room temperature vibrated 8 hours.Reaction mixture to 0 ℃, solids removed by filtration.With the NaOH aqueous solution (2N, 15mL) washing organic layer.Solvent removed in vacuo; by post (silica gel; EtOAc/ hexane 3/7) the purifying residue obtain being the viscosity colorless oil intermediate (1-{4-[cyclopropyl-(3-trifluoromethyl-benzenesulfonyl) amino] piperidines-1-carbonyl }-the 3-methyl butyl) methyl-t-butyl carbamate (1.3g, 78%).Handle methylene dichloride (10mL) liquid 2.5 hours of this viscous oil, solvent removed in vacuo then at 0 ℃ with trifluoroacetic acid (1.5mL).Residue is dissolved in methylene dichloride (20mL); neutralize with 2N NaOH solution; water (5mL) and salt solution (5mL) washing; vacuum concentration obtains expectation product (2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl as free alkali]-3-trifluoromethyl-benzsulfamide (21) (colorless oil; 0.9g, 90%).
This free alkali is dissolved in 1, and in the 4-diox, (4N, 1.5mL) handles in the 4-diox 1 to use HCl then.(20mL) breaks the gained mixture into pieces with ether, filters the collecting precipitation thing.(2 * 5mL) washings, and vacuum-drying 12 hours obtain being the expectation product (white solid, 0.9g, 93%) of HCl-salt form with ether.1H NMR (HCl-salt, CD 3OD): δ 8.21 (d, 1H, J=8.1Hz), 8.19 (s, 1H), 8.04 (d, 1H, J=8.3Hz), 7.87 (dd, 1H, J=7.9 ﹠amp; 8.0Hz), 4.61-4.64 (m, 1H), 4.44-4.49 (m, 1H), 4.16-4.24 (m, 1H), 3.92-3.98 (m, 1H), 3.22-3.28 (m, 1H), 2.72-2.8 (m, 1H), 2.68 (s, 1.7H, NHCH 3), 2.72 (s, 1.3H, NHCH 3), 1.64-2.12 (m, 8H), 1.02-1.08 (m, 6H), 0.92-0.94 (m, 2H), 0.78-0.82 (m, 2H).MS(e/z)：476(m+1)。
Similarly, prepare (2R) N-cyclopropyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl with BOC-D-Meleu-OH as initial substance]-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝476(M+H +)。 1H NMR(CDCl 3)：δ8.14(bs，1H)，8.06(bd，1H，J＝8.11Hz)，7.85(bt，1H，J＝8.33Hz)，7.71(bt，1H，J＝7.67Hz)，4.82-4.72(m，1H)，4.17-3.94(m，2H)，3.34-3.37(m，1H)，3.14-2.98(m，1H)，2.62-2.47(m，1H)，2.28(d，3H，J＝10.08Hz)，2.01-1.94(m，1H)，1.90-1.71(m，4H)，1.48-1.19(m，2H)，1.01-0.70(m，10H)。
According to aforesaid method; prepare (2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl with N-cyclopropyl-N-piperidin-4-yl-3-difluoro-methoxy benzsulfamide as initial substance]-3-difluoro-methoxy benzsulfamide, wherein said initial substance can prepare according to embodiment 3 described methods.LC：100％。MS：m/z＝474(M+H +)。 1H NMR(CDCl 3)：δ7.76-7.71(m，1H)，7.67-7.64(m，1H)，7.59-7.54(m，1H)，7.40-7.35(m，1H)，6.61(t，1H，J＝7.8Hz)，4.79-4.71(m，1H)，4.15-3.92(m，2)，3.46-3.37(m，1H)，3.15-2.96(m，1H)，2.63-2.47(m，1H)，2.29(d，3H，J＝10.74Hz)，2.03-1.94(m，2H)，1.88-1.69(m，4H)，1.67-1.56(m，1H)，1.48-1.19(m，2H)，1.04-0.84(m，8H+H 2O)，0.82-0.70(m，m，2H)。
According to the following compound of method for preparing:
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-2-fluoro-5-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝494(M+H +)。 1H NMR(CDCl 3)：δ8.29-8.22(m，1H)，7.92-7.83(m，1H)，7.39-7.33(m，1H)，4.87-4.75(m，1H)，4.33-4.21(m，1H)，4.10-3.95(m，1H)，3.61-3.44(m，1H)，3.22-3.03(m，1H)，2.71-2.55(m，1H)，2.51-2.24(m，6H)，2.23-2.11(m，1H)，2.07-1.69(m，5H)，1.54-1.22(m，2H)，1.01-0.64(m，10H+H 2O)；
(2S) N-[1-(the amino pentanoyl of 2-) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝448(M+H +)。 1H NMR(CD 3OD)：δ8.24-8.16(m，2H)，8.06-8.00(m，1H)，7.90-7.84(m，1H)，4.66-4.54(m，1H)，4.46-4.36(m，1H)，4.25-4.09(m，1H)，3.99-3.88(m，1H)，3.28-3.16(m，1H)，2.80-2.68(m，1H)，2.14-2.02(m，1H)，2.02-1.59(m，6H)，1.55-1.35(m，2H)，1.06-0.97(m，3H)，0.96-0.87(m，2H)，0.84-0.74(m，2H)；
(2S) N-cyclopropyl-N-[1-(2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝462(M+H +)。 1H NMR(CD 3OD)：δ8.24-8.16(m，2H)，8.07-8.01(m，1H)，7.91-7.84(m，1H)，4.68-4.58(m，1H)，4.49-4.38(m，1H)，4.24-4.12(m，1H)，4.00-3.90(m，1H)，3.30-3.18(m，1H)，2.87-2.70(m，1H)，2.66(d，3H，J＝11.4Hz)，2.14-2.04(m，1H)，2.02-1.60(m，6H)，1.56-1.28(m，2H)，1.07-0.96(m，3H)，0.96-0.89(m，2H)，0.84-0.76(m，2H)；
(2S) N-[1-(2-amino-3-dimethyl butyrate acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝462(M+H +)。 1H NMR(CD 3OD)：δ8.23-8.14(m，2H)，8.05-7.99(m，1H)，7.90-7.83(m，1H)，4.71-4.61(m，1H)，4.33-4.24(m 1H)，4.22-4.09(m，1H)，3.27-3.11(m，2H)，2.81-2.64(m，1H)，2.11-2.02(m，1H)，2.01-1.78(m，2H)，1.77-1.61(m，2H)，1.16-1.04(m，9H)，0.99-0.86(m，2H)，0.84-0.77(m，2H)；
(2S) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝488.2(M+H +)。 1H NMR(400MHz，MeOD)：δ8.40(2H，m)，8.19(1H，m)，7.87(1H，t，J＝7.5Hz)，4.61(1H，d，J＝11.5Hz)，4.23(1H，m)，4.17(1H，m)，3.22(1H，m)，2.75(1H，q，J＝11.5Hz)，2.11(1H，m)，1.61-1.98(10H，m)，1.03-1.39(5H，m)，0.92(2H，m)，0.79(2H，m)；
(2R) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝488.1，489.1(M+H +)。 1H NMR (400MHz, MeOD): δ 8.20 (2H, m), 7.99 (1H, d, J=12Hz), 7.87 (1H, t, J=7.5Hz), 4.62 (1H, d, J=7.5Hz), 4.28 (1H, m), 4.18 (1H, m), 3.98 (1H, m), 3.19 (1H, m), 2.76 (1H, m), 2.06 (1H, m), 1.75 (10H, m), 1.21 (5H, m), 0.92 (2H, m), 0.80 (2H, m); With
(2S) N-cyclopropyl-N-[1-(2-methylamino-2-phenyl acetyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝496.2，497.2(M+H +)。 1H NMR(400MHz，MeOD)：δ8.07(3H，m)，7.82(1H，m)，7.53(5H，m)，5.44(1H，m)，4.63(1H，d，J＝7.5Hz)，4.02(1H，m)，3.82(1H，m)，3.12(1H，m)，2.67(4H，m)，1.73(4H，m)，0.58(5H，m)。
Embodiment 11
(2S) N-cyclopropyl-N-[1-(3-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (22)
Figure A20058003494601131
N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (100mg, 0.29mmol), BOC-L-MeIle-OH (70g, 0.29mmol), I-hydroxybenzotriazole hydrate (HOBt, 39mg, 0.29mmol), hydrochloric acid 1-(3-dimethylaminopropyl)-3-ethyl carbodiimide (EDCI, 55mg, 0.29mmol) and the mixture of DMF (5mL) at room temperature vibrated 2 hours.Reaction mixture is poured in the 20mL ethyl acetate, with 5mL 2N HCl solution, saturated NaHCO 3(20mL), water (10mL) and salt solution (10mL) washing.Vacuum concentration organic phase, and with post (silica gel, EtOAc/ hexane 1/1) purifying, obtain being colorless oil intermediate (1-{4-[cyclopropyl-(3-trifluoromethyl benzenesulfonyl) amino]-piperidines-1-carbonyl-the 2-methyl butyl) the methyl carbamic acid tert-butyl ester.
This intermediate is dissolved in 1, and in the 4-diox (3mL), (4N 1, in the 4-diox, 2mL) handled 4 hours at room temperature to use HCl solution then.(20mL) breaks reaction mixture into pieces with ether; filter the collecting precipitation thing; with ether (2 * 5mL) washings; and vacuum-drying 12 hours; obtain being expectation material (2S) N-cyclopropyl-N-[1-(3-methyl-2-methylamino pentanoyl) piperidin-4-yl of HCl-salt form]-3-trifluoromethyl benzsulfamide (22) (white solid; 80mg, yield 54%). 1HNMR (HCl-salt, CD 3OD): δ 8.22 (d, 1H, J=7.7Hz), 8.17 (s, 1H), 8.04 (d, 1H, J=8.1Hz), 7.87 (dd, 1H, J=7.7 ﹠amp; 8.3Hz), 4.62-4.68 (m, 1H), 4.3-4.38 (m, 1H), 4.14-4.22 (m, 1H), 3.94-4.02 (m, 1H), 3.22-3.29 (m, 1H), 2.74-2.82 (m, 1H), 2.65 (s, 1.7H, NHCH 3), 2.62 (s, 1.3H, NHCH 3), 1.6-2.1 (m, 7H), 0.98-1.2 (m, 7H), 0.88-0.94 (m, 2H), 0.78-0.82 (m, 2H).LC：100％。MS(e/z)：476(m+1)。
Embodiment 12
N-[1-(tolyl propionyl between 2-amino-3-) piperidin-4-yl]-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (23)
Get N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (400mg, 1.15mmol), tolyl-propionic acid (334mg between 2-tert-butoxycarbonyl amino-3-, 1.2mmol), I-hydroxybenzotriazole hydrate (HOBt, 50mg, 0.37mmol), hydrochloric acid 1-(3-dimethylaminopropyl)-3-ethyl carbodiimide (EDCI, 218mg, 1.15mmol) and the mixture of DMF (5mL) at room temperature vibrated 8 hours.Reaction mixture is poured in the 20mL ethyl acetate, with 2NHCl solution, the saturated NaHCO of 5mL 3(20mL), water (10mL) and salt solution (10mL) washing.The vacuum concentration organic layer; and by post (silica gel; EtOAc/ hexane 1/1) purifying obtains being intermediate [2-{4-[cyclopropyl-(the 3-trifluoromethyl benzenesulfonyl)-amino] piperidines-1-yl of colorless oil }-1-(3-methyl-benzyl)-2-oxygen-ethyl] t-butyl carbamate (600mg, yield 85%).
This intermediate is dissolved in 1, and in the 4-diox (5mL), (4N 1, in the 4-diox, 2mL) handled 4 hours at room temperature to use HCl solution then.(20mL) breaks reaction mixture into pieces with ether, filters the collecting precipitation thing, and (2 * 5mL) washings, and vacuum-drying 12 hours obtain being the title compound 23 (white solid, 400mg, yield 70%) of HCl-salt form with ether.LC：98％。 1HNMR(DMSO d 6)：δ8.31(bs，3H)，8.12(m，2H)，8.06(s，1H)，7.89(m，1H)，7.11(cm，4H)，4.58(m，1H)，4.40(m，1H)，3.91(m，1H)，3.07(m，1H)，2.88(m，1.5H)，2.36(m，0.5H)，2.26(d，3H)，1.79-1.99(m，1H)，1.43-1.71(m，2.5H)，1.28(m，1H)，0.92(d，0.5H)，0.74(d，4H)，0.15(q，0.5H)。MS(e/z)：510(m+1)。
Prepare following compounds similarly:
N-{1-[2-amino-3-(4-fluorophenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝514.2，515.2(M+H +)。 1H NMR(400MHz，DMSO-d 6)：δ8.17(6H，m)，7.91(1H，t，J＝7.5Hz)，7.23(4H，m)，4.64(1H，m)，4.38(1H，m)，4.02(1H，m)，3.73(1H，m)，2.95(3H，m)，1.19-1.98(4.5H，m)，0.77(4.5H，m)；
N-[1-(2-amino-3-o-tolyl propionyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝589.2，590.2(M+H +)。 1H NMR (400MHz, DMSO-d 6): δ 8.15 (6H, m), 7.91 (1H, t, J=7.5Hz), 7.15 (4H, m), 4.62 (1H, m), 4.38 (1H, m), 4.00 (1H, m), 3.69 (1H, m), 2.95 (3H, m), 2.19 (3H, m), 1.10-2.01 (4.5H, m), 0.76 (4H, m), 0.56 (0.5H, m); With
N-{1-[2-amino-3-(4-tert-butyl-phenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝552.3，553.3(M+H +)。 1H NMR(400MHz，DMSO-d 6)：δ8.13(6H，m)，7.90(1H，m)，7.32(2H，m)，7.19(1H，d，J＝7.5 Hz)，7.10(1H，d，J＝7.5Hz)，4.61(1H，m)，4.43(1H，m)，3.89-4.01(1H，m)，3.62(1H，m)，2.92(3H，m)，1.54-2.02(3H，m)，1.15(11H，m)，0.75(4H，m)。
Embodiment 13
N-{1-[2-amino-3-(4-cyano-phenyl) propionyl] piperidin-4-yl }-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (24)
Get N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (400mg, 1.15mmol), 2-tert-butoxycarbonyl amino-3-(4-cyano-phenyl) propionic acid (320mg, 1.2mmol), I-hydroxybenzotriazole hydrate (HOBt, 50mg, 0.37mmol), hydrochloric acid 1-(3-dimethylaminopropyl)-3-ethyl carbodiimide (EDCI, 218mg, 1.15mmol) and the mixture of DMF (5mL) at room temperature vibrated 8 hours.Then reaction mixture is poured in the 20mL ethyl acetate, with 5mL2N HCl solution, saturated NaHCO 3(20mL), water (10mL) and salt solution (10mL) washing.The vacuum concentration organic layer; and by post (silica gel, EtOAc/ hexane 1/1) purifying obtain being colorless oil intermediate (1-(4-cyano group benzyl)-2-{4-[cyclopropyl-(3-trifluoromethyl benzenesulfonyl) amino] piperidines-1-yl }-2-oxygen-ethyl) t-butyl carbamate.
This intermediate is dissolved in 1, and in the 4-diox (5mL), (4N 1, in the 4-diox, 2mL) handled 4 hours at room temperature to use HCl solution then.(20mL) breaks reaction mixture into pieces with ether, filters the collecting precipitation thing, and (2 * 5mL) washings, and vacuum-drying 12 hours obtain being the title compound 24 (white solid, 400mg, yield 67%) of HCl-salt form with ether. 1H NMR (HCl-salt, DMSO-d 6): δ 8.28-8.36 (br, 3H, NH 2.HCl), 8.18 (dd, J=8.1 ﹠amp; 8.7Hz), 8.13 (d, 1H, J=8.3Hz), 8.11 (s, 1H), 7.92 (dd, 1H, J=7.8 ﹠amp; 7.9Hz), 7.83 (d, 1H, J=8.3Hz), 7.81 (d, 1H, J=8.3Hz), 7.46 (d, 1H, J=8.1Hz), 7.41 (d, 1H, J=8.3Hz), 4.68-4.76 (m, 1H), 4.34-4.39 (m, 1H), and 4.02-4.08 (m, 1H), 3.74-3.78 (m, 1H), 2.98-3.18 (m, 2.5H), 2.56-2.66 (m, 2H), 1.96-1.99 (m, 0.5H), 1.25-1.86 (m, 4H), 0.73-0.83 (m, 4H).LC：100％。MS(e/z)：521(m+1)。
Embodiment 14
(2S) N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (25)
Figure A20058003494601171
Get (2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (see embodiment 10,323mg, 0.7mmol), methyl alcohol (4mL), paraformaldehyde (50mg, 1.0mmol), NaBH 3(CN) (132mg, 2mmol) and acetate (0.01mL) at room temperature vibrated 20 hours.Solvent removed in vacuo.Residue is dissolved in the methylene dichloride (15mL), and with saturated K 2CO 3(5mL) aqueous solution is handled.Separate organic layer; use the salt water washing; vacuum concentration; by post (silica gel; EtOAc/ hexane 3/7) purifying solid title compound (2S) N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group) piperidin-4-yl that obtains being white in color]-3-trifluoromethyl-benzsulfamide (30mg, yield 10%). 1H NMR(CDCl 3)：δ8.14(s，1H)，8.08(d，1H，J＝7.9Hz)，7.87(d，1H，J＝7.7Hz)，7.7(dd，1H，J＝7.7 & 8.1Hz)，4.7-4.76(m，1H)，4.18-4.24(m，1H)，4.06-4.12(m，1H)，3.34-3.4(m，1H)，2.94-3.06(m，1H)，2.44-2.54(m，1H)，2.26(br，6H)，1.35-1.98(m，8H)，0.94-1.02(m，2H)，0.86-0.95(m，6H)，0.74-0.78(m，2H)。LC：100％。MS(e/z)，490(m+1)。
Similarly, from (2R) N-cyclopropyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (seeing embodiment 10) prepares (2R) N-cyclopropyl-N-[1-(2-dimethylamino-4-methylpent acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝490.2，491.2(M+H +)。 1H NMR(400MHz，CDCl 3)：δ8.13(1H，s)，8.06(1H，d，J＝7.7Hz)，7.86(1H，d，J＝7.9Hz)，7.69(1H，t，J＝7.9Hz)，4.77-4.68(1H，m)，4.23(1H，m)，4.09(1H，m)，3.36(1H，m)，3.08-2.92(1H，m)，2.57-2.43(1H，m)，2.25(6H，s)，1.95(2H，m)，1.77(3H，m)，1.60(1H，m)，1.45(1H，m)，1.39-1.23(1H，m)，1.01-0.81(8H，m)，0.74(2H，m)。
Embodiment 15
(2S) N-{1-[3-(4-cyano-phenyl)-2-methylamino propionyl] piperidin-4-yl }-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (26)
At room temperature use NaH (67mg; 60% mineral oil; 1.8mmol) with N-{1-[2-amino-3-(4-cyano-phenyl) propionyl] piperidin-4-yl-N-cyclopropyl-3-trifluoromethyl benzsulfamide (sees embodiment 13; 300mg; 0.58mmol), MeI (830mg, 5.9mmol) and the mixture process of DMF (5mL) 20 hours.With ethyl acetate (20mL) diluted reaction mixture, and water (5mL) and salt solution (5mL) washing.The evaporation organic layer; with post (silica gel; EtOAc/ hexane 1/1) the purifying residue obtains being title compound N-{1-[3-(4-the cyano-phenyl)-2-methylamino-propionyl of free alkali form] piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl-benzsulfamide (26); it is dissolved in 1; in the 4-diox (4mL), and with HCl solution (4N is 1; in the 4-diox, 1mL) handle.(10mL) breaks the gained mixture into pieces with ether, filters the collecting precipitation thing, and (2 * 5mL) washings, and vacuum-drying 12 hours obtain being the title compound 26 (white solid, 0.2g, yield 65%) of HCl-salt form with ether. 1H NMR (HCl-salt, CD 3OD): δ 8.12-8.19 (m, 2H), 8.03 (d, 1H, J=9.2Hz), 7.86 (dd, 1H, J=7.7 ﹠amp; 7.8Hz), 7.77 (dd, 2H, J=4.3 ﹠amp; 8.1Hz), 7.49 (dd, 2H, J=1.9 ﹠amp; 8.3Hz), 4.76-4.79 (m, 1H), 4.52-4.59 (m, 1H), 3.96-4.06 (m, 1H), 3.6-3.7 (m, 1H), 3.34-3.38 (m, 1H), 3.06-3.14 (m, 2H), 2.68-2.72 (m, 3H, NCH 3), 2.34-2.65 (m, 2H), 1.52-2.02 (m, 4H), 0.62-0.92 (m, 4H).LC：100％。MS(e/z)：535(m+1)。
Prepare following compounds similarly:
N-cyclopropyl-N-[1-(2-methylamino-3-o-tolyl propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝524.3，525.3(M+H +)。 1H NMR(400MHz，MeOD)：δ8.11(2H，m)，8.00(1H，m)，7.83(1H，m)，7.28-7.11(2H，m)，7.09-6.96(2H，m)，4.68(1H，m)，4.59-4.49(1H，m)，3.93(1H，m)，3.68-3.49(1H，m)，3.21(1H，m)，2.94(1H，m)，2.72-2.58(4H，m)，2.51-2.07(4H，m)，2.03-1.73(2H，m)，1.65-1.39(2H，m)，1.27-0.40(5H，m)；
N-cyclopropyl-N-[1-(tolyl propionyl between 2-methylamino-3-) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝524.3，525.3(M+H +)。 1H NMR(400MHz，MeOD)：δ8.07(2H，m)，7.97(1H，m)，7.81(1H，m)，7.26-7.05(4H，m)，4.66-4.49(2H，m)，3.91-3.76(1H，m)，3.40-3.20(2H，m)，3.12-2.88(2H，m)，2.73(3H，d)，2.64-2.54(1H，t)，2.34-2.28(3H，s)，2.00-1.91(1H，m)，1.82-1.64(2H，m)，1.61-1.31(2H，m)，1.10-1.01(1H，m)，0.87-0.65(4H，m)；
N-cyclopropyl-N-{1-[3-(4-fluorophenyl)-2-methylamino propionyl]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝528.2，529.2(M+H +)。 1H NMR(400MHz，MeOD)：δ8.09(2H，m)，7.98(1H，d，J＝7.5Hz)，7.81(1H，t，J＝7.9Hz)，7.28(1H，m)，7.20(1H，m)，7.80(2H，m)，4.69-4.63(1H，m)，4.53(1H，d)，4.02-3.88(1H，m)，3.67-3.52(1H，m)，3.28-2.93(3H，m)，2.71-2.57(4H，m)，2.55-2.23(1H，m)，2.03-1.73(2H，m)，1.65-1.41(2H，m)，1.33-0.51(5H，m)；
N-cyclopropyl-N-{1-[3-(4-tert-butyl-phenyl)-2-methylamino-propionyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝566.2，567.3(M+H +)。 1HNMR (400MHz, MeOD): δ 8.10 (2H, m), 8.00 (1H, d), 7.82 (1H, t), 7.40 (2H, m), 7.23 (1H, d), 7.13 (1H, d), 4.60-4.40 (2H, m), 3.97-3.72 (1H, m), 3.46 (1H, t), 3.09 (1H, m), and 3.01-2.31 (6H, m), 2.01-1.87 (1H, m), 1.78-1.57 (2H, m), 1.57-0.57 (16H, m); With
(2S) N-cyclopropyl-N-[1-(2-methylamino-3-phenyl propionyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝510(M+H +)。 1H NMR(CDCl 3)：δ8.12(1H，s)，8.09(1H，d)，7.98(1H，d)，7.82(1H，m)，7.36(2H，m)，7.21(2H，m)，7.15(1H，t)，4.69(1H，t)，4.53(1H，d)，3.92(1H，m)，3.60(2H，d)，3.33(1H，d)，2.99(1H，m)，2.68(3H，d)，2.30(1H，m)，2.02(1H，m)，1.86(1H，m)，1.64(2H，m)，1.21(1H，m)，0.78(4H，m)，0.60(1H，m)。
Embodiment 16
N-[1-(4-butyl phenyl ether alkylsulfonyl) piperidin-4-yl]-N-cyclopropyl-phenyl sulphonamide (27)
Get the N-cyclopropyl-N-piperidin-4-yl-benzsulfamide (available from Lancaster) of 143mg (0.513mmol) and the 4-butyl phenyl ether SULPHURYL CHLORIDE (available from MatrixScientific) of 128mg (0.513mmol) and be dissolved in respectively in the 5mL methylene dichloride (DCM), merge then.In this mixture, add 1.5 normal diisopropylethylamine (DIEA) (0.134mL) by syringe.Mixture at room temperature stirs and spends the night, then vacuum concentration.Come purifying products therefrom 27 by silicagel column and 0% to 20%EtOAc gradient elution in hexane, concentrate this pure substance (yield 24%, white solid). 1H NMR(CDCl 3)：δ7.813-7.783(m，2H)，7.673-7.636(m，2H)，7.597-7.553(m，1H)，7.520-7.475(m，2H)，7.011-6.974(m，2H)，4.053-4.020(t，2H)，3.821-3.721(m，3H)，2.266-2.200(t，2H)，2.033-1.902(m，3H)，1.843-1.779(m，2H)，1.601-1.470(m，4H)，1.015-0.978(t，3H)，0.935-0.896(m，2H)，0.761-0.712(m，2H)。LC：100％。MS(e/z)：494(M+H +)。
Embodiment 17
N-cyclopropyl-N-[1-(4-propylbenzene alkylsulfonyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (28)
Figure A20058003494601221
Get the N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (available from Lancaster) of 150mg (0.434mmol) and the 4-propylbenzene SULPHURYL CHLORIDE (available from MatrixScientific) of 95mg (0.434mmol) and be dissolved in respectively among the DCM of 10mL, merge then.In this mixture, add 1.5 normal DIEA (0.113mL) by syringe.Mixture at room temperature stirs and spends the night, then vacuum concentration.Come purifying products therefrom 28 by silicagel column and 0% to 20%EtOAc gradient elution in hexane, and concentrate this pure substance (yield 11%, white solid). 1H NMR(CDCl 3)：δ8.053(s，1H)，8.003-7.982(d，1H)，7.852-7.832(d，1H)，7.686-7.630(m，3H)，7.366-7.340(d，2H)，3.868-3.764(m，3H)，2.699-2.660(t，2H)，2.313-2.246(t，2H)，2.071-1.900(m，3H)，1.738-1.587(m，4H)，0.991-0.954(t，3H)，0.936-0.896(m，2H)，0.789-0.739(m，2H)。LC：100％。MS(e/z)：532(M+H +)。
Similarly, prepare N-cyclopropyl-N-[1-(4-propylbenzene alkylsulfonyl) piperidin-4-yl from N-cyclopropyl-N-piperidin-4-yl-benzsulfamide] benzsulfamide.Equally, according to aforesaid method, begin to prepare N-cyclopropyl-N-[1-(5-dimethylamino naphthalene sulfonyl base) piperidin-4-yl from N-cyclopropyl-N-piperidin-4-yl-benzsulfamide and 5-dimethylamino naphthalic sulfonic chloride] benzsulfamide.
Embodiment 18
N-[1-(4-butyl phenyl ether alkylsulfonyl) piperidin-4-yl]-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (29)
Figure A20058003494601231
Get the N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (available from Lancaster) of 150mg (0.434mmol) and the 4-butyl phenyl ether SULPHURYL CHLORIDE (available from Matrix Scientific) of 108mg (0.434mmol) and be dissolved in respectively among the DCM of 10mL, merge then.In this mixture, add 1.5 normal DIEA (0.113mL) by syringe.Mixture at room temperature stirs and spends the night, then vacuum concentration.Come purifying products therefrom 29 by silicagel column and 0% to 20%EtOAc gradient elution in hexane, and concentrate this pure substance (yield 25%, white solid). 1HNMR(CDCl 3)：δ8.058(s，1H)，8.003-7.983(d，1H)，7.851-7.831(d，1H)，7.688-7.641(m，3H)，7.017-6.980(m，2H)，4.055-4.022(t，2H)，3.843-3.746(m，3H)，2.286-2.226(t，2H)，2.068-1.901(m，3H)，1.843-1.773(m，2H)，1.6151-1.470(m，4H)，1.014-0.976(t，3H)，0.944-0.903(m，2H)，0.793-0.744(m，2H)。LC：100％。MS(e/z)：562(M+H +)。
Embodiment 19
N-cyclopropyl-N-{1-[3-(4-methylpiperazine base) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (31)
N-cyclopropyl-N-{1-[3-(piperidines-1-yl) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (32)
Figure A20058003494601241
A) N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl benzsulfamide (30): in nitrogen atmosphere, get N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide (6.0g; 17.22mmol) and the 2-caproic acid (1.79g 17.22mmol) joins among the exsiccant THF (100mL).In this mixture, add HOBT (2.79g, 20.66mmol) and EDCI (3.69g, 20.66mmol), and triethylamine (7.2mL, 51.66mmol).Mixture at room temperature stirs and spends the night.The gained mixture is distributed between EtOAc and 1.0M sodium-chlor (250mL).Separate organic layer, dry (MgSO4) concentrates and obtains being gelationus crude product, by hexane/ether (2: 1) crystallization solid expectation compound 30 (7.58g, 100% yield) that obtains being white in color.LC：100％。MS：m/z＝445.2(M+H)，467.3(M+Na)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.14 (1H, s), 8.07 (1H, d, J=7.5Hz), 7.88 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 6.86 (1H, dt, J=15.0,6.0Hz), 6.32 (1H, d, J=15.0Hz), 4.75 (1H, bd, J=10.7Hz), 4.10 (2H, m), 3.06 (1H, bt, J=13.0Hz), 2.56 (1H, bt, J=13.0Hz), 2.20 (2H, q, J=8.9Hz), 1.95 (1H, m), 1.90-1.45 (7H, m), 1.05-0.85 (5H, m), 0.75 (2H, m).
B) N-cyclopropyl-N-{1-[3-(4-methylpiperazine base) caproyl]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide (31): get N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl benzsulfamide (30) (250mg; 0.56mmol) and N methyl piperazine (1.80g; 18mmol) in screw-cap vial, mix, and on metal block, be heated to 130 ℃ and continue 3 days.Cool off this mixture, and vacuum-evaporation, at silica gel (EtOAc/MeOH/NH 2OH, 100: 10: 1) go up by column chromatography purifying residue the solid title compound 31 that obtains being white in color (120mg, 39% yield). 1H NMR(CDCl 3)：δ8.14(S，1H)，8.06(d，1H)，7.87(d，1H)，7.71(t，1H)，4.71(d，1H)，4.09(t，1H)，3.95(d，1H)，3.07(m，2H)，2.51(m，9H)，2.25(m，3H)，2.16(m，1H)，1.95(m，1H)，1.73(m，4H)，1.35(m，5H)，0.99(m，1H)，0.80(m，6H)。LC：100％。MS(M+H +)：545。
According to aforesaid method; N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl benzsulfamide (30) and piperidines reaction, the solid N-cyclopropyl-N-{1-[3-that obtains being white in color (piperidines-1-yl) caproyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (32). 1H NMR(CDCl 3)：δ8.15(S，1H)，8.06(d，1H)，7.87(d，1H)，7.71(t，1H)，4.71(d，1H)，4.09(m，1H)，3.95(d，1H)，3.02(m，2H)，2.39(m，6H)，2.15(m，1H)，1.96(m，1H)，1.80(m，3H)，1.40(m，11H)，0.96(m，1H)，0.80(m，6H)。LC：100％。MS(M+H +)：530。
Embodiment 20
N-cyclopropyl-N-{1-[4, two (4-the fluorophenyl)-Ding of 4--3-enoyl-] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (33)
Figure A20058003494601261
Method according to the described synthetic N-cyclopropyl-N-of embodiment 19 step a (2-hexenoyl) piperazine-4-base-3-trifluoromethyl-benzsulfamide (30); with N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide and 4; two (4-the fluorophenyl)-Ding of 4--3-olefine acid reaction; prepare N-cyclopropyl-N-{1-[4, two (4-the fluorophenyl)-Ding of 4--3-enoyl-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (33). 1H NMR(CDCl 3)：δ 8.12(s，1H)，8.03(d，1H)，7.86(d，1H)，7.71(t，1H)，7.15(m，6H)，6.96(m，2H)，6.21(t，1H)，4.68(m，1H)，4.02(m，1H)，3.61(m，1H)，3.15(d，2H)，2.93(m，1H)，2.51(m，1H)，1.93(m，1H)，1.69(m，2H)，1.25(m，1H)，0.90(m，5H)。LC：100％。MS(M+H +)：605。
Similarly, preparation following compounds:
Prepare N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen butyryl radicals by N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide and 4-(4-fluorophenyl)-4-oxygen-butyric acid]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝527(M+H +)。 1H NMR(CDCl 3)：δ8.14(1H，s)，8.04(3H，m)，7.87(1H，d)，7.70(1H，t)，7.12(2H，t)，4.68(1H，d)，4.09(2H，m)，3.30(2H，m)，3.09(1H，t)，2.77(2H，m)，2.53(1H，t)，1.85(5H，m)，0.92(2H，m)，0.75(2H，m)；
By N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide and 3, the 3-diphenyl-propionic acid prepares N-cyclopropyl-N-[1-(3,3-diphenylprop acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝557(M+H +)。 1H NMR(CDCl 3)：δ8.11(1H，s)，8.02(1H，d)，7.84(1H，d)，7.70(1H，t)，7.23(10H，m)，4.64(2H，m)，3.98(1H，m)，3.85(1H，d)，3.00(2H，m)，2.82(1H，t)，2.37(1H，t)，1.86(1H，m)，1.60(4H，m)，0.91(1H，m)，0.72(3H，m)；
By N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide and 4, two (4-fluorophenyl) butyric acid of 4-prepare N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝607(M+H +)。 1H NMR(CDCl 3)：δ8.12(1H，s)，8.04(1H，d)，7.86(1H，d)，7.69(1H，t)，7.16(4H，dd)，6.98(4H，dd)，4.71(1H，d)，3.98(1H，d)，3.80(1H，t)，3.68(1H，d)，2.91(1H，t)，2.50(1H，t)，2.33(2H，m)，2.21(2H，m)，1,93(1H，m)，1.75(4H，m)，0.91(4H，m)；
By N-cyclopropyl-N-(piperidin-4-yl)-2-trifluoromethyl benzsulfamide and 4; two (4-fluorophenyl) butyric acid of 4-prepare N-cyclopropyl-N-{1-[4; two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-2-trifluoromethyl benzsulfamide; wherein 4, two (4-fluorophenyl) butyric acid of 4-can be according to people such as Sindelar (Collection ofCzechoslovak Chemical Communications 38 (12): described preparation 3879-3901 (1973)).LC：100％。MS：m/z＝607(M+H +)。 1H NMR (CDCl 3): δ 8.29 (1H, d), 7.88 (1H, d), 7.72 (2H, m), 7.18 (4H, dd), 6.98 (4H, dd), 4.76 (1H, d), 4.25 (1H, m), 3.95 (1H, m), 3.72 (1H, d), 3.00 (1H, t), 2.55 (1H, t), 2.30 (5H, m), 1,84 (4H, m), 0.61 (2H, m), 0.49 (1H, m), 0.36 (1H, m); With
Prepare N-cyclopropyl-N-{1-[(3-trifluoromethyl-4-methoxyl group by N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl-benzsulfamide and 3-trifluoromethyl-4-methoxyl group benzophenone) benzoyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide.LC：100％。MS：m/z＝551(M+H +)。 1H NMR(CDCl 3)：δ8.15(1H，s)，8.07(1H，d)，7.86(1H，d)，7.69(2H，m)，7.58(1H，d)，7.02(1H，d)，4.13(1H，m)，4.08(3H，s)，2.98(2H，m)，1.98(4H，m)，1.65(3H，m)，0.94(2H，t)，0.80(2H，t)。
Embodiment 21
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (34)
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (34) is prepared as follows, with N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl benzsulfamide (110.6mg, 0.318mmol) be dissolved among the DMF of 10mL, add triethylamine (48.3mg then, 0.477mmol) and two (4-fluorophenyl) Butyryl Chloride (98.2mg, 0.350mmol).Reaction mixture stirs down at 85 ℃ and spends the night, and by silica gel column chromatography (hexane/EtOAc, 7: 3) purifying crude compound, obtains being the title compound 34 of yellow viscous solid. 1H NMR(CDCl 3)：δ8.12(s，1H)，8.04(d，1H)，7.84(d，1H)，7.61(t，1H)，7.13(dd，4H)，6.94 t，4H)，3.84 t，2H)，2.85(d，2H)，2.30(t，2H)，1,92(m，7H)，1.48(m，2H)，1.37(m，2H)，0.96(m，2H)，0.75(m，2H)。LC：100％。MS(M+H +)：593。
Similarly, preparation N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-]-piperidin-4-yl } benzsulfamide.LC：100％。MS：m/z＝525.3，526.2(M+H +)。 1H NMR(400MHz，CDCl 3)：δ11.1(1H，br)，7.81-7.84(2H，m)，7.59-7.63(1H，m)，7.5-7.54(2H，m)，7.12-7.16(4H，m)，6.95-6.99(4H，m)，4.08-4.14(1H，m)，3.86-3.89(1H，m)，3.48-3.52(2H，m)，2.92-2.96(2H，m)，2.57-2.74(4H，m)，1.95-2.05(3H，m)，1.7-1.8(4H，m)，0.9-0.95(4H，m)。
Embodiment 22
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl } benzsulfamide (37)
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (38)
Figure A20058003494601291
A) two (4-fluorophenyl) methoxyl groups of 1-[]-2-monochloroethane (35): get ethylene chlorhydrin (2.7g, 34mmol), sulfuric acid (0.8g, 8mmol) and 5mL toluene be warming to 40 ℃, and with 4,4 '-difluoro diphenyl methanol (5g, toluene solution processing 23mmol).Gained solution is heated to 85 ℃.3 hours postcooling reaction mixtures are used dilution with toluene, use saturated NaHCO 3With water washing several times, at Na 2SO 4Last dry and evaporation.Without being further purified crude product 35 is directly used in next step.
B) two (4-fluorophenyl) methoxyl groups of 1-[]-two (4-fluorophenyl) methoxyl groups of 2-iodoethane (36): 1-[]-2-monochloroethane (35) (888mg 3mmol) is dissolved in the methylethylketone of 5mL, and the adding sodium iodide (1.3g, 8.4mmol).With mixture 80 ℃ of heated overnight.LC/MS shows has 80% to transform.The elimination solid, concentrated filtrate.Without being further purified crude product 36 is directly used in next step.
C) two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-]-piperidin-4-yl } benzsulfamide (37): get two (4-fluorophenyl) methoxyl groups of 1-[]-2-iodoethane (36) (393mg, 1.05mmol) be dissolved in the 3mL methylethylketone, in this mixture, add N-cyclopropyl-N-(4-piperidyl) benzsulfamide (200mg, 0.71mmol) and K 2CO 3(294mg, 2.2mmol).With mixture 80 ℃ of heated overnight.In mixture, add entry, use the EtOAc extraction product.Through Na 2SO 4Dry organic layer and evaporation.By using CH 2Cl 2And CH 2Cl 2/ EtOAc (4: 1) wash-out obtains being brown buttery title compound 37 through silicagel column purifying crude product: 1H NMR (CDCl 3): δ 7.878-7.849 (d, 2H), 7.600-7.557 (m, 1H), 7.535-7.490 (m, 2H), and 7.282-7.231 (m, 4H), 7.029-6.970 (m, 4H), 5.300 (s, 1H), 3.870-3.790 (m, 1H), 3.536-3.506 (t, 2H), and 2.928-2.899 (d, 2H), 2.642-2.612 (t, 2H), 2.109-2.053 (t, 2H), 2.000-1.868 (m, 3H), 1.523-1.492 (d, 2H), and 0.980-0.940 (m, 2H), 0.760-0.712 (m, 2H).LC：98％。MS(e/z)：527(M+H +)。
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (38): get two (4-the fluorophenyl)-methoxyl groups of 1-[]-2-iodoethane (36) (294mg, 0.79mmol) be dissolved in the 5mL methylethylketone, in this mixture, add N-cyclopropyl-N-(4-piperidyl)-3-(trifluoromethyl) benzsulfamide (200mg, 0.57mmol) and K 2CO 3(157mg, 1.1mmol).With mixture 80 ℃ of heated overnight.In mixture, add entry, use the EtOAc extraction product.Use Na 2SO 4Dry organic layer and evaporation.By using CH 2Cl 2And CH 2Cl 2/ EtOAc (4: 1) wash-out obtains being the title compound 38 of yellow oily through silicagel column purifying crude product. 1H NMR(CDCl 3)：δ8.127(s，1H)，8.061-8.042(d，1H)，7.856-7.833(d，1H)，7.694-7.655(t，1H)，7.282-7.233(m，4H)，7.035-6.972(m，4H)，5.302(s，1H)，3.882-3.806(t，1H)，3.551-3.491(t，2H)，2.965-2.887(d，2H)，2.670-2.605(t，2H)，2.127-2.064(t，2H)，1.986-1.939(m，3H)，1.531-1.493(d，2H)，0.992-0.952(m，2H)，0.794-0.760(m，2H)。LC：100％。MS(e/z)：596(M+H +)。
Embodiment 23
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (38)
A) 1-[two (4-fluorophenyl) methoxyl group]-2-monochloroethane (35): get ethylene chlorhydrin (2.3mL, 34mmol), toluene (5mL) and sulfuric acid (0.44mL, mixture 8.2mmol) is warming to 40 ℃, and with 4,4 '-difluoro diphenyl methanol (5.0g, handle by toluene solution 22.7mmol).Gained solution is heated to 85 ℃, and stirs 3 hours.After envrionment temperature is got back in reaction, use dilution with toluene, and use saturated NaHCO 3Solution washing washes with water, through dried over sodium sulfate.Evaporating solvent obtains the yellow oil product of 6.07g (95% yield).
B) N-cyclopropyl-N-{1-[2-two (4-fluorophenyl) methoxy ethyl]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide (38): get two (4-fluorophenyl) methoxyl groups of 1-[]-2-monochloroethane (3.0g, 10.7mmol), sodium iodide (4.3g, 28.9mmol) and the mixture heating up to 80 of MEK (20mL) ℃ continue 24 hours.Get back to the envrionment temperature after-filtration in reaction.(294mg is 2.13mmol) with N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide (0.71mmol) to add salt of wormwood in the filtrate (0.78mmol) of aliquot.Mixture was 80 ℃ of heating 16 hours.After TLC shows that reaction is finished, in reaction mixture, add entry and EtOAc.Separate each phase, use EtOAc aqueous phase extracted 2 times.Wash the organic extract of merging with water, use the salt water washing again, use dried over sodium sulfate, and concentrate.As described in embodiment 22, carry out purifying then with silica gel chromatography.
Embodiment 24
N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen-butyl] piperidin-4-yl } benzsulfamide (39)
Figure A20058003494601321
Be prepared as follows N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen-butyl] piperidin-4-yl } benzsulfamide (39).Be taken at N-cyclopropyl-N-(4-piperidyl) benzsulfamide among the DMF (100mg, 0.36mmol), 4-chlorine 4 '-fluorobenzene third ketone (79mg, 0.39mmol) and TEA (54mg, mixture 0.54mmol) was 70 ℃ of heating 36 hours.Remove and desolvate, purifying crude product on silicagel column is used CH earlier 2Cl 2Wash-out is used EtOAc and 10%MeOH/EtOAc wash-out then, obtains being orange buttery title compound 39. 1H NMR(CDCl 3)：δ8.006-7.956(m，2H)，7.868-7.844(d，2H)，7.599-7.556(m，1H)，7.535-7.490(m，2H)，7.147-7.089(t，2H)，3.855-3.773(m，1H)，2.950-2.871(m，4H)，2.421-2.330(t，2H)，2.020-1.772(m，7H)，1.518-1.454(d，2H)，0.950-0.910(m，2H)，0.730-0.682(m，2H)。LC：98％。MS(e/z)：446(M+H +)。
Embodiment 25
N-cyclopropyl-N-{1-[3-(2-hydroxyethylamino) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (40)
Figure A20058003494601331
With N-cyclopropyl-N-(1-oneself-2-enoyl--piperazine-4-yl)-3-trifluoromethyl-benzsulfamide (250mg, 0.56mmol) and 2-monoethanolamine (2mL) in screw-cap vial, mix, and on metal block, be heated to 130 ℃ and continue 3 days.The chilled mixture of vacuum-evaporation, residue is by silica gel column chromatography (EtOAc/MeOH/NH 2OH, 100: 10: 1) purifying, obtain title compound 40 (95mg). 1H NMR(CDCl 3)：δ8.21(d，J＝7.9Hz，1H)，8.12(d，J＝8.5Hz，1H)，8.10(br s，1H)，7.91(dd，J＝7.76，7.78Hz，1H)，4.43(d，J＝13.0Hz，1H)，4.10(m，1H)，3.90(d，J＝12.1Hz，1H)，3.55(m，2H)，3.25(m，1H)，3.05(m，1H)，2.86(m，2H)，2.60(m，3H)，2.00(m，1H)，1.82-1.21(m，8H)，0.85(m，5H)，0.75(m，2H)。LC：100％。MS：506.2(M+1)。
Embodiment 26
N-cyclopropyl-N-[1-(3-thiomorpholine-4-base-caproyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (41)
Be prepared as follows N-cyclopropyl-N-[1-(3-thiomorpholine-4-base-caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (41).N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (30) (250mg, 0.56mmol) and thiomorpholine (2mL) in sealed reaction bottle (React-vial), heated 3 days together at 130 ℃.This bottle of cooling in ice is then at Speed-Vac The middle cooled mixture of vacuum-evaporation is to dry.Residue is through the fast silica gel chromatogram ethyl acetate: hexane (1: 1) wash-out, the solid title compound 41 that obtains being white in color (110mg, 36%).LC：100％。MS：m/z＝548.3，549.3(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.15 (1H, s), 8.06 (1H, d, J=7.5Hz), 7.88 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 4.73 (1H, d, J=17.7Hz), 4.10 (1H, m), 3.95 (1H, d, J=17.7Hz), 3.05 (2H, m), 2.84 (2H, m), 2.74 (2H, m), 2.67-2.43 (6H, m), 2.15 (1H, m), 1.96 (1H, m), 1.75 (3H, m), 1.52-1.22 (4H, m), 0.98 (1H, m), 0.93-0.70 (6H, m).
Embodiment 27
N-cyclopropyl-N-[1-(3-morpholine-4-base-caproyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (42)
Be prepared as follows N-cyclopropyl-N-[1-(3-morpholine-4-base-caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (42).As described in above embodiment 26, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl benzsulfamide (30) (250mg, 0.56mmol) and morpholine (2mL) react.Residue is through the fast silica gel chromatogram ethyl acetate: methyl alcohol: ammoniacal liquor (100: 10: 1) the wash-out solid title compound 42 (120mg, 40%) that obtains being white in color.LC：100％。MS：m/z＝532.3，533.3(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.15 (1H, s), 8.07 (1H, d, J=7.5Hz), 7.88 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 4.75 (1H, d, J=15Hz), 4.10 (1H, m), 3.96 (1H, d, J=15Hz), 3.70 (4H, m), 3.09 (2H, m), 2.64-2.44 (6H, m), 2.20 (1H, dd, J=8.8Hz), 1.99 (1H, m), and 1.50-1.25 (4H, m), 1.02-0.70 (7H, m).
Embodiment 28
N-cyclopropyl-N-[1-(3-tetramethyleneimine-1-base caproyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (43)
Be prepared as follows N-cyclopropyl-N-[1-(3-tetramethyleneimine-1-base caproyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide (43).As described in above embodiment 26, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (30) (250mg, 0.56mmol) and tetramethyleneimine (2mL) react.Residue is through the fast silica gel chromatogram ethyl acetate: methyl alcohol: ammoniacal liquor (100: 10: 1) wash-out, the solid title compound 43 that obtains being white in color (140mg, 48%).LC：98.9％。m/z＝516.3，517.3(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.14 (1H, s), 8.05 (1H, d, J=7.5Hz), 7.86 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 4.75 (1H, d, J=15Hz), 4.10 (1H, m), 3.97 (1H, d, J=15Hz), 3.05 (2H, m), 2.65-2.45 (6H, m), 2.35 (1H, m), 1.96 (1H, m), 1.85-1.30 (16H, m), 0.98 (1H, m), 0.92-0.70 (6H, m).
Embodiment 29
N-cyclopropyl-N-[1-(3-dimethylamino caproyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (44)
Get N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (30) (250mg, 0.56mmol) and the methyl alcohol of dimethylamine (2M, 3mL) solution together in the sealed reaction bottle 120 ℃ of heating 24 hours.Solution after the transpiration cooling, the vacuum-drying residue carries out fast silica gel chromatogram and with ethyl acetate (3x column length) wash-out, uses ethyl acetate then: methyl alcohol: ammoniacal liquor (100: 10: 1) wash-out, solid title compound 44 (150mg, 34%) obtains being white in color.TLC (SiO 2, ethyl acetate: methyl alcohol: ammoniacal liquor, 100: 10: 1) and Rf=0.15 (UV detects, Dragendorff ' s reagent).LC：100％。MS：m/z＝490.3，491.2(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.14 (1H, s), 8.07 (1H, d, J=8Hz), 7.88 (1H, d, J=8Hz), 7.70 (1H, t, J=8Hz), 4.74 (1H, d, J=12Hz), 4.07 (1H, m), 3.95 (1H, d, J=12Hz), 3.05 (2H, m), 2.50 (2H, m), 2.24 (6H, s), 2.15 (1H, 2d), 1.96 (1H, m), and 1.86-1.69 (3H, m), 1.58-1.24 (6H, m), 0.98 (1H, m), 0.90 (3H, t, J=8Hz), 0.87-0.75 (3H, m).
Embodiment 30
(3S) N-[1-(3-amino-5-methyl caproyl) piperidin-4-yl]-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (46)
A) (3S) 1-{4-[cyclopropyl-(3-trifluoromethyl benzenesulfonyl)-amino] piperidines-1-ethanoyl }-3-methyl butyl t-butyl carbamate (45): at room temperature to N-cyclopropyl-N-(piperidin-4-yl)-3-trifluoromethyl benzsulfamide (0.287mmol; add HOBt (0.287mmol in DMF 100mg) (5mL) solution; 39mg), EDCI (0.287mmol; 55mg) and the BOC-L-b-homoleucine (0.287mmol, 70mg).The gained mixture at room temperature keeps shaken overnight.Add EtOAc (20mL) then, and with 10%HCl (20mL), saturated NaHCO 3(20mL) and water (10mL) wash this mixture.Through Na 2SO 4Dry organic layer is concentrated into drying.Come the purifying crude product with silicagel column and 25% to 100%EtOAc gradient elution in hexane, obtain (3S) 1-{4-[cyclopropyl-(3-trifluoromethyl benzenesulfonyl) amino] piperidines-1-ethanoyl }-3-methyl butyl t-butyl carbamate (45).
B) (3S) N-[1-(3-amino-5-methyl caproyl)-piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide (46): get above-claimed cpd 45 and at room temperature be dissolved among the 4N HCl 3 hours.Evaporating mixture comes purifying to obtain crude product with silicagel column and the 30%EtOAc gradient elution in hexane to dry then, obtains title compound 46 (45mg). 1H NMR(CDCl 3)：δ8.21(d，J＝8.1Hz，1H)，8.18(br s，1H)，8.04(d，J＝8.1Hz，1H)，7.87(dd，J＝7.84，7.86Hz，1H)，4.63(m，1H)，4.15(m，1H)，3.95(d，J＝12.8Hz，1H)，3.59(m，1H)，3.23(m，1H)，2.86(dt，J＝3.4，17.4Hz，1H)，2.60(m，2H)，2.07-1.51(m，8H)，1.00(m，6H)，0.93(m，2H)，0.80(m，2H)。LC：100％。MS：476.2(M+1)。
Similarly, preparation following compounds:
(3S) N-[1-(3-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝462.3，463.3(M+H +)。 1H NMR(400MHz，MeOH-d 4)：δ8.21(1H，d，J＝8.1Hz)，8.17(1H，s)，8.03(1H，d，J＝7.9Hz)，7.87(1H，dd，J＝7.7，7.9Hz)，4.63-4.66(1H，m)，4.11-4.18(1H，m)，3.96-4.03(1H，m)，3.38-3.45(1H，m)，3.11-3.17(1H，m)，2.82-2.9(1H，m)，2.54-2.68(m，2H)，1.65-2.05(6H，m)，1.03-1.07(6H，m)，0.91-0.94(2H，m)，0.79-0.81(2H，m)。
Embodiment 31
(3S) N-cyclopropyl-N-[1-(5-methyl-3-methylamino-caproyl) piperidin-4-yl]
-3-trifluoromethyl benzsulfamide (47)
Figure A20058003494601371
Under the room temperature to the compound 46 of embodiment 30 preparation (0.325mmol, add in methyl alcohol 150mg) (5mL) solution paraformaldehyde (0.813mmol, 25mg), Na (OAc) 3The HOAc of BH and catalytic amount.The gained mixture at room temperature keeps shaken overnight.In mixture, add EtOAc (20mL) then, use saturated NaHCO 3And water washing.Through Na 2SO 4Dry organic layer also is concentrated into drying.Come the purifying crude product with silicagel column and 0% to 50%MeOH gradient elution in DCM, obtain title compound 47. 1H NMR(CDCl 3)：δ8.21(d，J＝8.1Hz，1H)，8.18(br s，1H)，8.04(d，J＝8.1Hz，1H)，7.87(dd，J＝7.84，7.86Hz，1H)，4.63(m，1H)，4.15(m，1H)，3.95(m，1H)，3.52(m，1H)，3.23(m，1H)，2.90-2.55(m，3H)，2.70(d，J＝5.4Hz，3H)，2.07-1.54(m，8H)，1.00(m，6H)，0.92(m，2H)，0.80(m，2H)。LC：100％。MS：490.2(M+1)。
Similarly, preparation following compounds:
(3S) N-cyclopropyl-N-[1-(4-methyl-3-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝476.2，477.2(M+H +)。 1H NMR(400MHz，MeOH-d 4)：δ8.21(1H，d，J＝7.7Hz)，8.17(1H，s)，8.03(1H，d，J＝7.9Hz)，7.87(1H，dd，J＝7.8，7.9Hz)，4.61-4.65(1H，m)，4.11-4.18(1H，m)，3.99-4.04(1H，m)，3.36-3.43(1H，m)，3.12-3.19(1H，m)，2.82-2.9(1H，m)，2.75(1.5H，s)，2.73(1.5H，s)，2.64-2.69(m，2H)，2.16-2.21(1H，m)，2.06-2.09(1H，m)，1.61-1.95(4H，m)，1.02-1.09(6H，m)，0.92-0.94(2H，m)，0.79-0.83(2H，m)。
Embodiment 32
N-cyclopropyl-N-{1-[3-(4-methylpiperazine-1-yl) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (31)
Be prepared as follows N-cyclopropyl-N-{1-[3-(4-methylpiperazine-1-yl) caproyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (31).As described in above embodiment 26, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (30) (250mg, 0.56mmol) and N-methyl-piperazine (2mL) reaction.Residue is through fast silica gel chromatogram and use ethyl acetate: methyl alcohol: ammoniacal liquor (100: 10: 1) wash-out, the solid title compound 31 that obtains being white in color (120mg, 40%).LC：100％。MS：m/z＝545.3，546.3(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.14 (1H, s), 8.07 (1H, d, J=7.5Hz), 7.88 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 4.74 (1H, d, J=13Hz), 4.09 (1H, t, J=13Hz), 3.95 (1H, d, J=13Hz), 3.08 (2H, m), 2.67-2.33 (9H, m), 2.26 (3H, s), 2.15 (1H, dd, J=8.8Hz), 1.96 (1H, m), 1.85-1.65 (3H, m), and 1.52-1.22 (4H, m), 0.98 (1H, m), and 0.98-0.70 (6H, m).
Embodiment 33
N-cyclopropyl-N-{1-[3-(2-hydroxyethylamino) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (40)
Be prepared as follows N-cyclopropyl-N-{1-[3-(2-hydroxyethylamino) caproyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide (40).As described in above embodiment 26, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (250mg, 0.56mmol) and thanomin (2mL) react.Reaction mixture is also distributed it between ether (100mL) and 1M sodium hydroxide solution (100mL).Separate organic phase, dry (MgSO 4), and vacuum evaporating solvent obtains colourless jelly to dry.Residue is through fast silica gel chromatogram and use ethyl acetate: methyl alcohol: ammoniacal liquor (100: 10: 1) wash-out obtains free alkali 40 (100mg).Be translated into the solid fumarate that is white in color (95mg, 27%).LC：100％。MS：m/z＝506.2，507.3，508.2(M+H)。 1H NMR (400MHz, DMSO-d 6): (1: 1 mixture of rotational isomer) δ 8.22 (1H, d, J=7.5Hz), 8.13 (2H, m), 7.92 (1H, t, J=7.5Hz), 6.47 (1H, s), 4.43 (1H, d, J=13.3Hz), 4.10 (1H, t, J=13.3Hz), 3.88 (1H, d, J=13.3Hz), 3.55 (2H, m), 3.25 (1H, m), 3.05 (1H, t, J=13.3Hz), 2.85 (2H, m), 2.70-2.50 (3H, m), 1.96 (1H, m), 1.80-1.20 (8H, m), 0.88-0.65 (7H, m).
Embodiment 34
N-cyclopropyl-N-{1-[3-(piperidines-1-yl) caproyl] piperidin-4-yl }-3-
Trifluoromethyl benzsulfamide (32)
Be prepared as follows N-cyclopropyl-N-{1-[3-(piperidines-1-yl) caproyl] piperidin-4-yl)-3-trifluoromethyl benzsulfamide (32).As described in above embodiment 26, with N-cyclopropyl-N-(1-oneself-2-enoyl--piperidin-4-yl)-3-trifluoromethyl-benzsulfamide (30) (250mg, 0.56mmol) and piperidines (2mL) react.Residue is through fast silica gel chromatogram and use ethyl acetate: methyl alcohol: ammoniacal liquor (100: 10: 1) wash-out, the solid title compound 32 that obtains being white in color (100mg, 34%).LC：100％。MS：m/z＝530.3，531.3，532.3(M+H)。 1H NMR (400MHz, CDCl 3): (1: 1 mixture of rotational isomer) δ 8.13 (1H, s), 8.06 (1H, d, J=7.5Hz), 7.86 (1H, d, J=7.5Hz), 7.70 (1H, t, J=7.5Hz), 4.75 (1H, d, J=15Hz), 4.09 (1H, m), 3.97 (1H, d, J=15Hz), and 3.10-2.92 (2H, m), 2.65-2.35 (6H, m), 2.15 (1H, m), 1.95 (1H, m), 1.90-1.70 (3H, m), 1.65-1.20 (11H, m), 0.95 (1H, m), 0.92-0.70 (6H, m).
Embodiment 35
N-[1-(1-Aminocyclopentane-1-carbonyl) piperidin-4-yl]-N-cyclopropyl-3-
Trifluoromethyl benzsulfamide (48)
(0.400g 1.15mmol) absorbs among the dry DMF of 10mL with N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (14).In this mixture, add HOBt (0.154g, 1.15mmol), EDCI (0.218g, 1.15mmol) and 1-tert-butoxycarbonyl Aminocyclopentane-1-carboxylic acid (0.263g, 1.15mmol).Mixture at room temperature stirred 16 hours.The concentrating under reduced pressure reaction mixture is to dry, and thick material is through fast silica gel chromatogram and with 25% ethyl acetate/hexane wash-out.The product part that concentrate to merge is to dry, among ethyl acetate/dense HCl (19: 1) of 40mL with the purified material deprotection that protected by BOC-.Removing desolvates obtains white solid matter.Break this material into pieces with ether, and vacuum filtration, the sulphonamide (48) of the HCl-salt form that obtains expecting.LC：97％。MS(e/z)：460(M+H +)。Salt 1H NMR (CD 3OD): δ 8.02 (m, 2H), 7.83 (d, 1H, J=7.86Hz), 7.66 (t, 1H, J=7.86Hz), 4.01 (m, 2.5H), 2.80 (bs, 1.5H), 2.11 (m, 2H), 1.7-2.0 (m, 10H), 1.51 (m, 2H), 0.60 (m, 2H), 0.50 (m, 2H).
Similarly, preparation N-cyclopropyl-N-[1-(1-phenyl amino hexamethylene-1-acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝550.2，551.2(M+H +)。 1HNMR(400MHz，CDCl 3)：δ8.07(1H，s)，7.98(1H，d，J＝7.5Hz)，7.84(1H，d，J＝7.7Hz)，7.66(1H，dd，J＝7.8 & 7.9Hz)，7.08-7.12(2H，m)，6.64-6.68(1H，m)，6.52-6.55(2H，m)，5.04-5.14(1H，m)，4.84-4.92(1H，m)，3.92-3.98(2H，m)，2.82-2.9(1H，m)，2.42-2.48(1H，m)，1.82-2.14(4H，m)，1.62-1.68(2H，m)，1.26-1.44(6H，m)，0.48-0.78(4H，m)。
Embodiment 36
N-cyclopropyl-N-[1-(N-methylpyrrolidin-2-carbonyl) piperidin-4-yl]-3-
Trifluoromethyl benzsulfamide (49)
Figure A20058003494601421
(0.400g 1.15mmol) absorbs among the dry DMF of 10mL with N-cyclopropyl-N-piperidin-4-yl-3-trifluoromethyl-benzsulfamide (14).In this mixture, add HOBt (0.154g, 1.15mmol), EDCI (0.218g, 1.15mmol) and the N-methylproline (0.148g, 1.15mmol).Mixture at room temperature stirred 16 hours.The concentrating under reduced pressure reaction mixture is to dry, and thick material is through fast silica gel chromatogram and with 25% ethyl acetate/hexane wash-out.It is extremely dry to concentrate the product part that merges, and absorbs among the 20mL MeOH.In this mixture, add 1.1 normal fumaric acids.Except that desolvating and breaking surplus materials into pieces with ether.After vacuum filtration, the product (49) of the fumaric acid salt form that obtains expecting.LC：98％。MS(e/z)：460(M+H+)。Salt 1H NMR (DMSO-d 6): δ 8.20 (m, 1H), 8.12 (m, 2H), 7.90 (t, 1H, J=7.82Hz), 4.40 (m, 1H), 4.10 (m, 2H), 3.07 (m, 2H), 2.65 (m, 1.5H), 2.40 (s, 1.5H), 2.31 (d, 3H), 2.05 (m, 1H), 1.99 (m, 1H), 1.66 (m, 5H), 1.50 (m, 2H), 0.75 (m, 4H).
Similarly, preparation following compounds:
N-cyclopropyl-N-[1-(1,2,3,4-tetrahydroisoquinoline-3-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝508.3，509.3(M+H +)。 1H NMR(400MHz，DMSO-d 6)：δ10.7(1H，br)，9.4(1H，br)，8.22-8.25(1H，m)，8.12-8.16(2H，m)，7.9-7.94(1H，m)，7.22-7.28(4H，m)，4.72-4.82(1H，m)，4.42-4.44(1H，m)，4.16-4.32(3H，m)，3.9-3.94(1H，m)，3.15-3.22(2H，m)，2.86-2.96(1H，m)，2.74-2.8(1H，m)，1.98-2.04(1H，m)，1.48-1.82(4H，m)，0.74-0.86(4H，m)。
N-cyclopropyl-N-[1-(piperidines-2-acyl group) piperidin-4-yl]-3-trifluoromethyl benzsulfamide: LC:100%.MS：m/z＝460.2，461.2(M+H +)。 1H NMR(400MHz，MeOD)：δ8.164(2H，t)，7.998(1H，d，J＝6.8Hz)，7.837(1H，t)，4.536(1H，d)，4.327-4.218(1H，m)，4.181-4.087(1H，m)，3.861(1H，d)，3.452(1H，d)，3.178(1H，t)，3.016(1H，t)，2.691(1H，t)，2.125-1.995(2H，m)，1.995-1.760(4H，m)，1.756-1.493(6H，m)，0.891(2H，s)，0.770(2H，s)。
Embodiment 37
When testing in to the calcium mobilization of N-type calcium channel blocking activity and/or electric Physiological Analysis, the about 0.09 μ M of compound exhibits of the present invention is to the IC of about 10 μ M 50Value, this is that (the 57th page in specification sheets) described in detail in " the FLIPR calcium mobilization of N-type calcium channel analyzes " at above the 0200th section title.More described compounds are also tested in to the calcium mobilization of L-type calcium channel blocking activity and/or electric Physiological Analysis, this above the 0201st section title for " the FLIPR calcium mobilization of L-type calcium channel analyzes " in (the 58th page in specification sheets) describe in detail.The IC that they show 50Be worth about 0.45 μ M to about＞20 μ M.Representational value is as shown in table 2.
Table 2
Behind calcium mobilization and/or electric physiology analyzed in vitro to the test-compound conduct
The evaluation of N-type calcium channel (NTCC) retarding agent and L-type calcium channel (LTCC) retarding agent
Compound NTCCIC 50(μM) LTCCIC 50 (μM)
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyl of 4-]-piperidin-4-yl }-3-trifluoromethyl benzsulfamide 0.11 3.78
N-{1-[2-amino-3-(4-fluorophenyl) propionyl]-piperidin-4-yl }-N-cyclopropyl-3-trifluoromethyl benzsulfamide 0.18 8.60
N-cyclopropyl-N-[1-(3-thiomorpholine-4-base caproyl) piperidin-4-yl]-3-trifluoromethyl-benzsulfamide 0.28 10-20
N-cyclopropyl-N-{1-[(3-trifluoromethyl-4-methoxyl group) benzoyl] piperidin-4-yl }-3-trifluoromethyl benzsulfamide 0.30 4.57
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 0.36 10.02
N-cyclopropyl-N-[1-(4-propylbenzene alkylsulfonyl)-piperidin-4-yl]-3-trifluoromethyl-benzsulfamide 0.44 0.94
N-cyclopropyl-N-(1-oneself-2-enoyl-piperidin-4-yl)-3-trifluoromethyl benzsulfamide 1.21
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) fourths of 4--3-enoyl-] piperidin-4-yl } benzsulfamide 1.24 2.59
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl } benzsulfamide 1.09 3.24
(2S) N-[1-(2-amino-4-methylpent acyl group) piperidin-4-yl]-N-cyclopropyl-benzsulfamide 4.28 10-20
N-cyclopropyl-N-{1-[4-(4-fluorophenyl)-4-oxygen butyryl radicals] piperidin-4-yl } benzsulfamide 6.21
(2S) N-(2-methoxy ethyl)-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidines-4-yl]-3-trifluoromethyl benzsulfamide 1.22
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-fluorobenzene sulphonamide 4.66
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-3-fluorobenzene sulphonamide 0.97 1.43
(2S) N-isobutyl--N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 0.95 9.12
(2S) N-isopentyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 1.26
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methoxybenzenesulphoismide 7.29
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-2-yl) methyl-3-trifluoromethyl benzsulfamide 5.06
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-difluoro-methoxy benzsulfamide 2.44
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-cyano group benzsulfamide 4.27
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-chlorobenzene sulfonamide 2.63
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methyl benzenesulfonamide 8.29
(2S) N-methyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 0.39 5.12
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-nitrobenzene sulfonamide 3.62
(2S) N-(2-hydroxyethyl)-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide 2.23
(2S) N-cyclopropyl methyl-N-[1-(2-methylamino-4-methyl-pentanoyl)-piperidin-4-yl]-3- 1.31
Compound NTCCIC 50(μM) LTCCIC 50(μM)
The trifluoromethyl benzsulfamide
(2S) N-cyclopentyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 1.56
(2S) N-sec.-propyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide 0.87 ＞20
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-3-yl)-3-trifluoromethyl benzsulfamide 1.84
N-cyclopropyl-N-[1-(4-quinolyl methyl) piperidin-4-yl]-3-trifluoromethyl-benzsulfamide 0.86 1.70
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide 0.78 2.23
N-[1-(1-Aminocyclopentane-1-carbonyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide 1.08
N-cyclopropyl-N-[1-(1,2,3,4-tetrahydroisoquinoline-3-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 1.58
N-cyclopropyl-N-[1-(N-methylpyrrolidin-2-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 1.38
N-cyclopropyl-N-[1-(2-methylamino-3-o-tolyl propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide 0.39 10-20
(2R) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide 0.44 ＞20
Above the present invention has been carried out complete description, it should be understood by one skilled in the art that and in wide with the equivalent scope of condition, composition and other parameters, to realize identical purpose, and do not influence scope of the present invention or its any embodiment.
By considering this specification sheets and claims and implement invention disclosed herein that other embodiments of the present invention will be conspicuous for those skilled in the art.Should be known in that specification sheets and embodiment are regarded as merely exemplary, true scope of the present invention and spirit are by shown in the following claim.
Whole rights and publication that this paper is quoted all are incorporated herein by the integral body of reference with them.
Sequence table
＜110〉Euro Celtique SA
＜120〉as the 4-phenyl-sulfamide piperidine compounds of calcium channel blocker
<130>E8492
<150>US 60/618,419
<151>2004-10-14
<150>US 60/694,972
<151>2005-06-30
<160>12
<170>PatentIn version 3.3
<210>1
<211>22
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>1
caccatggtc cgcttcgggg ac 22
<210>2
<211>19
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>2
ccgttcagtg gcctcctcc 19
<210>3
<211>23
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>3
ctagcaccag tgatcctggt ctg 23
<210>4
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>4
agtgcgttgt gagcgcagta 20
<210>5
<211>21
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>5
caccatggtc cagaagagcg g 21
<210>6
<211>21
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>6
tctcagcgga tgtagacgcc t 21
<210>7
<211>22
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>7
caccatgtat gacgactcct ac 22
<210>8
<211>23
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>8
ggtggtcagt agctgtcctt agg 23
<210>9
<211>21
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>9
caccatggct gctggctgcc t 21
<210>10
<211>25
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>10
agagggtcac catagatagt gtctg 25
<210>11
<211>22
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>11
caccatgatt cgggccttcg ct 22
<210>12
<211>25
<212>DNA
＜213〉artificial
<220>
＜223〉primer
<400>12
agcctgcgga ctacaggttg ctgac 25

Claims (69)

1. the compound that has formula I:
Figure A2005800349460002C1
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1And R 2Be independently selected from hydrogen, alkyl, haloalkyl, halogen, alkoxyl group, halogenated alkoxy, cyano group, nitro, amino and hydroxyl respectively;
R 3Be selected from alkyl, thiazolinyl, cycloalkyl, cycloalkylalkyl, alkoxyalkyl, hydroxyalkyl, 2-tetrahydrofuran base, 3-tetrahydrofuran base, 2-tetrahydrofuran base alkyl, 3-tetrahydrofuran base alkyl, alkyl sulfonyl-amino alkyl and aminocarboxyl alkyl;
Z is selected from Z 1, Z 2, Z 3, and Z 4, wherein
Z 1Be
Figure A2005800349460002C2
Z 2Be
Z 3Be
-CR 8R 9-(CH 2) O-D-R 14With
Z 4Be
—SO 2—R 15；
R 4And R 5Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol, aminoalkyl group and phenyl respectively; Or R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl;
R 6Be hydrogen and R 7Be selected from;
Hydrogen;
Alkyl;
Hydroxyalkyl;
Alkoxyalkyl;
Haloalkyl;
Aminoalkyl group;
Cycloalkyl;
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group;
The optional benzyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; With
The benzyloxy alkyl; Or
R 6And R 7Form C with the carbon atom that they connected 3-7Cycloalkyl; Or
R 7Be hydrogen; R 4Be hydrogen or C 1-3Alkyl; And R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl with the carbon atom that they connected;
R 8And R 9All be hydrogen or formation=O together;
R 10, R 11, R 12And R 13Be independently selected from hydrogen, alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido respectively;
R 14Be selected from
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
The optional naphthyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
Quinolyl;
Pyridyl;
With the phenyl that phenyl, benzyl, phenoxy group or benzyloxy replace, wherein each phenyl ring randomly replaces with the substituting group that one or two is independently selected from halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino and cyano group; With
Alkyl;
R 15Be phenyl or naphthyl, wherein any is chosen wantonly with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, amino, alkylamino and dialkyl amido and replaces;
A is O, CH 2, or do not exist and B is CH, condition is when A is O, so R 8And R 9All be hydrogen; Or
A-B is CH=C;
D be C=O ,-CH=CH-or do not exist;
M is 0 or 1;
N is 0,1,2,3,4 or 5; With
O is 0,1,2 or 3;
Condition be when Z be Z 2, R 3Be alkyl, R 8And R 9All be hydrogen, A is CH 2, B is that CH and n are 1 o'clock, so R 10, R 11, R 12, or R 13In at least one is not a hydrogen.
2. the compound that has formula I:
Figure A2005800349460005C1
Or its pharmacologically acceptable salts, prodrug or solvate, wherein:
R 1And R 2Be independently selected from hydrogen, alkyl, haloalkyl, halogen, alkoxyl group, halogenated alkoxy, cyano group, nitro, amino and hydroxyl respectively;
R 3Be selected from alkyl, thiazolinyl, cycloalkyl, cycloalkylalkyl, alkoxyalkyl, hydroxyalkyl, 2-tetrahydrofuran base, 3-tetrahydrofuran base, 2-tetrahydrofuran base alkyl, 3-tetrahydrofuran base alkyl, alkyl sulfonyl-amino alkyl and aminocarboxyl alkyl;
Z is selected from Z 1, Z 2, Z 3, and Z 4, wherein
Z 1Be
Figure A2005800349460006C1
Z 2Be
Z 3Be
-CR 8R 9-(CH 2) O-D-R 14With
Z 4Be
—SO 2—R 15；
R 4And R 5Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol, aminoalkyl group and phenyl respectively; Or R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl;
R 6Be hydrogen and R 7Be selected from;
Hydrogen;
Alkyl;
Hydroxyalkyl;
Alkoxyalkyl;
Haloalkyl;
Aminoalkyl group;
Cycloalkyl;
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group;
The optional benzyl that replaces with one or two substituting group that is independently selected from alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group; With
The benzyloxy alkyl; Or
R 6And R 7Form C with the carbon atom that they connected 3-7Cycloalkyl; Or
R 7Be hydrogen; R 4Be hydrogen or C 1-3Alkyl; And R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl with the carbon atom that they connected;
R 8And R 9All be hydrogen or formation=O together;
R 10, R 11, R 12And R 13Be independently selected from hydrogen, alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido respectively;
R 14Be selected from
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
The optional naphthyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido;
Quinolyl;
Pyridyl; With
With the phenyl that phenyl, benzyl, phenoxy group or benzyloxy replace, wherein each phenyl ring is optional replaces with one or two substituting group that is independently selected from halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino and cyano group;
R 15Be phenyl or naphthyl, wherein any is chosen wantonly with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, amino, alkylamino and dialkyl amido and replaces;
A is O, CH 2, or do not exist and B is CH, condition is when A is O, so R 8And R 9All be hydrogen; Or
A-B is CH=C;
D be C=O ,-CH=CH-or do not exist;
M is 0 or 1;
N is 0,1,2,3,4 or 5; With
O is 0,1,2 or 3;
Condition be when Z be Z 2, R 3Be alkyl, R 8And R 9All be hydrogen, A is CH 2, B is that CH and n are 1 o'clock, so R 10, R 11, R 12, or R 13In at least one is not a hydrogen.
3. claim 1 or 2 compound, wherein R 3Be selected from methyl, ethyl, isopentyl, isobutyl-, sec.-propyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclopropyl methyl, cyclopropyl ethyl, methoxymethyl, methoxy ethyl, methylol, hydroxyethyl, 3-tetrahydrofuran base, 2-tetrahydrofuran (THF) ylmethyl, 2-tetrahydrofuran base ethyl, sulfonyloxy methyl aminomethyl, sulfonyloxy methyl amido ethyl, amino carbonyl methyl and aminocarboxyl ethyl, preferably cyclopropyl, methyl, sec.-propyl or isobutyl-.
4. claim 1,2 or 3 compound, wherein R 3Be cyclopropyl, have formula II:
Figure A2005800349460009C1
Or its pharmacologically acceptable salts, prodrug or solvate.
5. the compound of claim 1 to 4, wherein R 1And R 2Be independently selected from hydrogen, halogen, alkyl, haloalkyl, cyano group, alkoxyl group, halogenated alkoxy and nitro respectively, and be preferably selected from hydrogen, methyl, ethyl, fluorine, chlorine, trifluoromethyl, difluoromethyl, methyl fluoride, cyano group, nitro, methoxyl group and difluoro-methoxy.
6. the compound of claim 1 to 5, wherein R 1Be hydrogen and R 2Be trifluoromethyl, or R 1And R 2All be hydrogen.
7. the compound of claim 1 to 6, wherein R 2Position between phenyl ring, and preferably have formula III:
Figure A2005800349460010C1
Or its pharmacologically acceptable salts, prodrug or solvate.
8. the compound of claim 1 to 7, wherein Z=Z 1, have formula IV:
Figure A2005800349460010C2
Or its pharmacologically acceptable salts, prodrug or solvate.
9. the compound of claim 8, wherein R 4And R 5Be independently selected from hydrogen, alkyl, hydroxyalkyl and phenyl respectively, preferably be independently selected from hydrogen, methyl, ethyl, methylol, hydroxyethyl and phenyl respectively, more preferably be independently selected from hydrogen, methyl and hydroxyethyl respectively.
10. the compound of claim 8, wherein R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl, and it is Xuan Zi oxazolidinyl, isoxazole alkyl, pyrrolidyl, pyrazolidyl, imidazolidyl, hexahydropyrimidine base, piperidyl, piperazinyl, 4-methylpiperazine base, morpholinyl, thio-morpholinyl and tetrahydro pyridyl preferably, more preferably forms 1-pyrrolidyl, 4-thio-morpholinyl, piperazinyl or 4-methylpiperazine base.
11. the compound of claim 8 to 10, wherein R 6Be hydrogen and R 7It is methyl; Propyl group; Sec.-propyl; Butyl; The tertiary butyl; Sec-butyl; Isobutyl-; Methylol; The 1-hydroxyethyl; The optional phenyl that replaces with one or two substituting group that is independently selected from methyl, ethyl, propyl group, sec.-propyl, butyl, the tertiary butyl, halogen, cyano group, amino, methylamino, dimethylamino, hydroxyl, nitro and trifluoromethyl; The optional benzyl that replaces with one or two substituting group that is independently selected from methyl, ethyl, propyl group, sec.-propyl, butyl, the tertiary butyl, halogen, cyano group, amino, methylamino, dimethylamino, hydroxyl, nitro and trifluoromethyl; 1-benzyloxy ethyl; Cyclopentyl; Cyclohexyl; Cyclopentyl-methyl; Or cyclohexyl methyl.
12. the compound of claim 8 to 11, wherein R 6Be hydrogen, R 7Be alkyl, and R 4And R 5Be hydrogen, alkyl or hydroxyalkyl independently, or R 4And R 5Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl.
13. the compound of claim 8 to 10, wherein R 6And R 7Form cyclopentyl or cyclohexyl together.
14. the compound of claim 8, wherein R 7Be hydrogen, R 4Be hydrogen or C 1-3Alkyl, and R 5And R 6Form bridge-CH together 2-CH 2-CH 2-or-CH 2-CHG 1-CHG 2-CH 2-, G wherein 1And G 2All be hydrogen or form the condensed phenyl, preferably R wherein with the carbon atom that they connected 5And R 6Formation-CH together 2-CH 2-CH 2-.
15. the compound of claim 8 to 14 is wherein with-NR 4R 5The configuration of the carbon atom that connects is (S).
16. the compound of claim 1 to 8 has formula V:
Or its pharmacologically acceptable salts, prodrug or solvate,
Wherein:
R 41And R 51Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl and aminoalkyl group respectively; With
R 17And R 18Be independently selected from hydrogen, alkyl, cycloalkyl, halogen, cyano group, amino, alkylamino, dialkyl amido, hydroxyl, nitro, haloalkyl and alkoxyl group respectively.
17. the compound of claim 16, wherein R 41And R 51Being independently selected from hydrogen, alkyl and hydroxyalkyl respectively, preferably is hydrogen or alkyl independently.
18. the compound of claim 17, wherein R 41And R 51All be hydrogen, or R 41Be hydrogen and R 51Be C 1-3Alkyl.
19. the compound of claim 16 to 18, wherein R 17And R 18Be independently selected from hydrogen, C respectively 1-6Alkyl, C 3-6Cycloalkyl, halogen, cyano group, amino, C 1-3Alkylamino, two (C 1-3) alkylamino, hydroxyl, nitro, halo (C 1-6) alkyl and C 1-6Alkoxyl group preferably is independently selected from hydrogen, methyl, sec.-propyl, the tertiary butyl, cyano group, fluorine, amino, methylamino, dimethylamino, nitro, trifluoromethyl, methoxyl group, isopropoxy and tert.-butoxy.
20. the compound of claim 19, wherein R 17And R 18All be hydrogen, or R 17Be hydrogen and R 18Be methyl, the tertiary butyl, cyano group, fluorine, methylamino, dimethylamino, trifluoromethyl or methoxyl group.
21. the compound of claim 1 to 8 has formula VI:
Or its pharmacologically acceptable salts, prodrug or solvate,
Wherein:
R 42And R 52Be independently selected from hydrogen, alkyl, thiazolinyl, hydroxyalkyl, haloalkyl, alkyl thiol and aminoalkyl group respectively; Or R 42And R 52Form 5-or 6-unit heterocycle with the nitrogen-atoms that they connected, wherein the one or more carbon atoms of heterocyclic are randomly used NR 16, O or S replace, R wherein 16Be hydrogen or C 1-3Alkyl; With
R 19And R 20Be H or CH independently 3
22. the compound of claim 21, wherein R 42And R 52Be independently selected from hydrogen, methyl, ethyl, methylol and hydroxyethyl respectively.
23. the compound of claim 21, wherein R 42And R 52Form 5-or 6-unit heterocycle, described heterocycle Xuan Zi oxazolidinyl, isoxazole alkyl, pyrrolidyl, pyrazolidyl, imidazolidyl, hexahydropyrimidine base, piperidyl, piperazinyl, 4-methylpiperazine base, morpholinyl, thio-morpholinyl and tetrahydro pyridyl with the nitrogen-atoms that they connected.
24. the compound of claim 21, wherein R 42And R 52Be hydrogen, methyl or hydroxyethyl independently; Or R 42And R 52Form 1-pyrrolidyl, 4-thio-morpholinyl or 4-methylpiperazine base with the nitrogen-atoms that they connected.
25. claim 21,23 or 24 compound are wherein worked as R 42And R 52R when forming 5-or 6-unit heterocycle together 19And R 20All be H.
26. the compound of claim 21, wherein R 42And R 52All be hydrogen, or R 42Be hydrogen and R 52It is alkyl.
27. the compound of claim 21 to 26, wherein m is 1.
28. the compound of claim 1 to 7, wherein Z=Z 2, have formula VII:
Figure A2005800349460015C1
Or its pharmacologically acceptable salts, prodrug or solvate.
29. the compound of claim 28, wherein R 8And R 9All be hydrogen, A is CH 2Or do not exist, and B is CH.
30. the compound of claim 28, wherein R 8And R 9Formation=O together, A is CH 2Or do not exist and B is CH, or A-B is CH=C.
31. the compound of claim 28, wherein R 8And R 9All be hydrogen, and A is O.
32. the compound of claim 28 to 31, wherein n is 0,1 or 2.
33. the compound of claim 28 to 32, wherein R 10, R 11, R 12, and R 13Be independently selected from hydrogen, halogen, C respectively 1-6Alkyl, C 1-6Alkoxyl group, halogen, halo (C 1-6) alkyl, hydroxyl, hydroxyl (C 1-6) alkyl, cyano group, amino, amino (C 1-6) alkyl, C 1-3Alkylamino and two (C 1-3) alkylamino, preferably be independently selected from hydrogen, halogen, methyl, ethyl, methoxyl group, oxyethyl group, trifluoromethyl, cyano group, amino, methylamino and dimethylamino.
34. the compound of claim 28 to 33, wherein R 10And R 12All be hydrogen.
35. the compound of claim 28 to 34, wherein R 11And R 13All be positioned at the contraposition of phenyl ring.
36. the compound of claim 1 to 7, wherein Z=Z 3, have formula VIII:
Figure A2005800349460016C1
Or its pharmacologically acceptable salts, prodrug or solvate.
37. the compound of claim 36, wherein R 14Be selected from:
The optional phenyl that replaces with one or two substituting group that is independently selected from alkyl, alkoxyl group, halogen, haloalkyl, hydroxyl, hydroxyalkyl, cyano group, amino, aminoalkyl group, alkylamino and dialkyl amido, described substituting group preferably is independently selected from methyl, ethyl, sec.-propyl, the tertiary butyl, methoxyl group, oxyethyl group, fluorine, trifluoromethyl, methylamino and dimethylamino;
With the phenyl that phenyl, benzyl, phenoxy group or benzyloxy replace, wherein each phenyl ring is optional replaces with one or two substituting group that is selected from halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino and cyano group; Naphthyl; Quinolyl; And pyridyl, and preferably replace with phenyl, benzyl, phenoxy group or benzyloxy, wherein any described substituting group is unsubstituted or by halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement, preferred wherein said phenyl is substituted in contraposition.
38. the compound of claim 36, wherein R 14Be naphthyl, quinolyl or pyridyl, wherein any all is unsubstituted.
39. the compound of claim 36 to 38 is wherein worked as R 14When being one of following, R 8And R 9All be hydrogen:
Naphthyl;
Quinolyl;
Pyridyl;
By the optional phenyl that is replaced by the phenyl of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement;
By the optional phenyl that is replaced by the benzyl of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement;
By the optional phenyl that is replaced by the phenoxy group of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement; Or
By the optional phenyl that is replaced by the benzyloxy of halogen, haloalkyl, alkyl, alkoxyl group, hydroxyl, amino or cyano group replacement.
40. the compound of claim 36 to 38, wherein R 8And R 9Formation=O together.
41. the compound of claim 36 to 40, wherein R 8And R 9All be hydrogen or formation=O together, and D does not exist or-CH=CH-.
42. claim 36 to 38,40 and 41 compound, wherein R 8And R 9Formation=O and D are C=O together.
43. the compound of claim 36 to 42, wherein o is 0 or 1.
44. the compound of claim 1 to 7, wherein Z=Z 4, have formula IX:
Figure A2005800349460018C1
Or its pharmacologically acceptable salts, prodrug or solvate.
45. the compound of claim 44, wherein R 15It is phenyl or naphthyl, wherein any is replaced by one or more substituting groups that are independently selected from alkyl, alkoxyl group, halogen, haloalkyl, amino, alkylamino and dialkyl amido, is preferably replaced by propyl group, butyl, amyl group, propoxy-, butoxy, pentyloxy, fluorine, chlorine, trifluoromethyl, amino, methylamino or dimethylamino.
46. the compound of claim 44, wherein R 15By the naphthyl of amino, alkylamino or dialkyl amido replacement, and preferably replaced by amino, methylamino or dimethylamino.
47. the compound of claim 1 and 3 to 7, wherein Z=Z 3, R 8And R 9Formation=O together, o is 0, D is-CH=CH-and R 14Be n-propyl, have formula X:
Figure A2005800349460019C1
Or its pharmacologically acceptable salts, prodrug or solvate.
48. the compound of claim 1, wherein said compound is:
N-cyclopropyl-N-{1-[4, two (4-fluorophenyl) butyryl radicalies of 4-] piperidin-4-yl }-3-fluorobenzene sulphonamide;
(2S) N-isobutyl--N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-isopentyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methoxybenzenesulphoismide;
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-2-yl) methyl-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-difluoro-methoxy benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-cyano group benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-chlorobenzene sulfonamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-methyl benzenesulfonamide;
(2S) N-methyl-N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-the 3-nitrobenzene sulfonamide;
(2S) N-(2-hydroxyethyl)-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopropyl methyl-N-[1-(2-methylamino-4-methyl-pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-cyclopentyl-N-[1-(4-methyl-2-methylamino-pentanoyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-sec.-propyl-N-[1-(4-methyl-2-methylamino pentanoyl)-piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
(2S) N-[1-(4-methyl-2-methylamino pentanoyl) piperidin-4-yl]-N-(tetrahydrofuran (THF)-3-yl)-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(4-quinolyl methyl) piperidin-4-yl]-3-trifluoromethyl-benzsulfamide;
Two (4-fluorophenyl) methoxy ethyls of N-cyclopropyl-N-{1-[2-] piperidin-4-yl }-3-trifluoromethyl benzsulfamide;
N-[1-(1-Aminocyclopentane-1-carbonyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(1,2,3,4-tetrahydroisoquinoline-3-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(N-methylpyrrolidin-2-carbonyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide;
N-cyclopropyl-N-[1-(2-methylamino-3-o-tolyl propionyl) piperidin-4-yl]-3-trifluoromethyl benzsulfamide; Or
(2R) N-[1-(2-amino-2-cyclohexyl ethanoyl) piperidin-4-yl]-N-cyclopropyl-3-trifluoromethyl benzsulfamide,
Or its pharmacologically acceptable salts, prodrug or solvate.
49. a pharmaceutical composition, it comprises each compound and pharmaceutically acceptable carrier of claim 1-48.
50. a method for the treatment of, prevent or improve described disease in the Mammals that suffers from the disease that the retardance calcium channel is responded comprises the described formula I compound of claim 1 to 48 to the administration significant quantity of this treatment of needs, prevention or improvement.
51. the method for claim 50 is wherein treated, is prevented or improves blocking the disease that N-type calcium channel responds.
52. a treatment in Mammals, prevent or improve apoplexy, head trauma, epilepsy, pain, migraine, mood disorder, schizophrenia, nerve degenerative diseases, depression, anxiety, psychosis, hypertension or ARR method, comprise the described formula I compound of claim 1 to 48 to the administration significant quantity of this treatment of needs, prevention or improvement.
53. the method for claim 52, wherein said method are used for the treatment of, prevent or improve the pain that is selected from chronic pain, neuropathic pain, acute pain and operation pain.
54. the described formula I compound of claim 1 to 48 is in the purposes for preparing treatment, prevents or improve in apoplexy in the Mammals, head trauma, epilepsy, pain, migraine, mood disorder, schizophrenia, nerve degenerative diseases, depression, anxiety, psychosis, hypertension or the ARR medicine.
55. the purposes of the described formula I compound of claim 1 to 48 in the medicine for preparing treatment, prevents or improve the pain that is selected from chronic pain, neuropathic pain, acute pain and operation pain.
56. claim 1 to 48 compound with formula I required for protection, wherein this compound is 3H or 14C is radiolabeled.
57. identify the method for regulating the active compound of N-type calcium channel, comprising for one kind:
(a) cell that will express N-type calcium channel is cultivated for some time with the calcium sensitivity indicator, and this time is enough to make indicator to mix in the cell;
(b) with cell depolarization;
(c) unpolarized cell is cultivated with candidate's adjusting compound, cell is maintained be fit to cause in the solution of calcium ion by described channel flow simultaneously;
(d) signal of measurement calcium sensitivity indicator in the presence of candidate's adjusting compound; With
(e) signal and the standard value with calcium sensitivity indicator under candidate's the adjusting compound existence compares.
58. the method for claim 57, wherein calcium sensitivity indicator indication calcium ion passes through flowing of N-type calcium channel, and compare with standard value, the variation of calcium sensitivity indicator indicates described candidate compound by changing the activity that flow regulate N-type calcium channel of calcium ion by N-type calcium channel in the presence of candidate's adjusting compound.
59. the method for claim 57 or 58, wherein cell endogenous expression potassium channel.
60. the method for claim 57 to 59, further be included in cell before described candidate's adjusting compound is cultivated, the active compound of calcium channel of the endogenous expression of cell beyond effective retardance N-type calcium channel is cultivated, and the active compound of calcium channel of the endogenous expression beyond wherein said effective retardance N-type calcium channel preferably is selected from L-type calcium channel blocker; P-type calcium channel blocker; Q-type calcium channel blocker; R-type calcium channel blocker; With T-type calcium channel blocker; Perhaps their mixture, and more preferably be selected from nifedipine, nimodipine, verapamil, Odizem, nicardipine, lercanipidine, efonidipine, Lacidipine (62, Mibefradil, nitrendipine, ω-agatoxin-TK, Pb 2+, SNX-482 and efonidipine R (-)-isomer or its mixture.
61. the method for claim 57 to 60 wherein makes cell depolarization by cell is cultivated in the solution that comprises 90mM potassium.
62. the method for claim 57 to 61, wherein said standard value is the signal of calcium sensitivity indicator in the basic identical cell that candidate's adjusting compound is cultivated not, or cultivate with candidate's adjusting compound but do not express the signal of calcium sensitivity indicator in the cell of N-type calcium channel.
63. the method for claim 57 to 62 is wherein compared with standard value, the variation indication that calcium ion flows in the presence of candidate's adjusting compound is to the active quantitative measure of regulating of N-type calcium channel.
64. the method for claim 57 to 63, wherein said cell expressing endogenous N-type calcium channel.
65. the method for claim 57 to 64, wherein said cell is selected from the N18 neuroblastoma cell, AtT-20 mouse neuroendocrine cell, A7r5 rat chest aorta cell, the SH-SY5Y neuroblastoma cell, PC12 pheochromocyte oncocyte, the ScGT1-1 neuronal cell, the HN2 neuronal cell, the F11 neuroblastoma cell, L6 rat muscle cell, NG108-15 neuroblastoma glioma hybrid cell, the small cell lung cancer in SCLC neuroendocrine source, NT2-N people's teratocarcinoma cell, rat suprarenal gland glomerular zone cell, the rat pancreatic beta cell, the INS-1 cell, the SN56 neuronal cell, the SKNSH neuroblastoma cell, with IMR32 human neuroblastoma cell, preferred IMR32 human neuroblastoma cell.
66. the method for claim 57 to 65 is wherein carried out described measurement by photofluorometer, flow cytometer, fluorescent microscope or fluorescence imaging plate reader, preferably by fluorescence imaging plate reader.
67. the method for claim 57 to 66, wherein said calcium sensitivity indicator is selected from Fluo3, Fluo4, Fluo5, Calcium Green, Calcium Orange, Calcium Yellow, OregonGreen, Fura-2, Fura-4, Fura-5, Fura-6, Fura-FF, Fura Red, indo-1, indo-5, BTC and the disposable dyestuff of FLIPR calcium or its mixture, and wherein said calcium sensitivity indicator acetyl oxygen methyl ester form preferably.
68. the method for claim 57 to 67, wherein said cell maintains in the culture vessel with single chamber or has in the culture vessel that separates of single array of compartments, wherein preferably once candidate compound is added in the more than one chamber, and wherein said measurement is preferably once carried out in more than one chamber.
69. method compounds identified by claim 57 to 68.
CN 200580034946 2004-10-14 2005-10-14 4-phenylsulfonamidopiperidines as calcium channel blockers Pending CN101044116A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US61841904P 2004-10-14 2004-10-14
US60/618,419 2004-10-14
US60/694,972 2005-06-30

Publications (1)

Publication Number Publication Date
CN101044116A true CN101044116A (en) 2007-09-26

Family

ID=38808946

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200580034946 Pending CN101044116A (en) 2004-10-14 2005-10-14 4-phenylsulfonamidopiperidines as calcium channel blockers

Country Status (1)

Country Link
CN (1) CN101044116A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102659670A (en) * 2012-05-14 2012-09-12 南通惠康国际企业有限公司 Method for preparing light stabilizer 4-p-toluenesulfonamide-2,2,6,6-tetramentylniperidine
CN109180566A (en) * 2018-10-09 2019-01-11 山东理工大学 A method of preparing 2- amino -3- methylene -1,2,3,6- 5,6-tetrahydropyridine derivative
US10407413B2 (en) 2015-06-19 2019-09-10 Zhejiang Yongtai Technology Co., Ltd. Method for preparing pyrazolecarboxylic acid derivative, and intermediate thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102659670A (en) * 2012-05-14 2012-09-12 南通惠康国际企业有限公司 Method for preparing light stabilizer 4-p-toluenesulfonamide-2,2,6,6-tetramentylniperidine
US10407413B2 (en) 2015-06-19 2019-09-10 Zhejiang Yongtai Technology Co., Ltd. Method for preparing pyrazolecarboxylic acid derivative, and intermediate thereof
CN109180566A (en) * 2018-10-09 2019-01-11 山东理工大学 A method of preparing 2- amino -3- methylene -1,2,3,6- 5,6-tetrahydropyridine derivative

Similar Documents

Publication Publication Date Title
CN1078889C (en) Non-peptide tachykinin receptor antagonists
CN1133648C (en) Subtsituted phenylalanine type compounds which inhibit leukocyte adhesion mediated by VLA-4
CN1119340C (en) Carbamyloxy compounds which inhibit leukocyte adhesion mediated by VLA-4
CN1114403C (en) Vitronectin receptor antagonists
CN1212839C (en) Method for treating allergies using substituted pyrazoles
CN1187326C (en) Novel compounds
CN1265674A (en) 4-amino-phenylalanine type compounds which inhibit leukocyte adhesion mediated by VLA-4
CN1291988C (en) Triazaspiro [5,5] undecane derivatrives and drugs containing the same as active ingredient
CN1805929A (en) Phosphodiesterase 4 inhibitors
CN1625410A (en) 2,4,6-triamino-1,3,5-triazine derivative
CN1265670A (en) Dipeptide and related compounds which inhibit leukocyte adhesion medicated by VLA-4
CN1436175A (en) Cyclic lactams as inhibitors of A beta-protein production
CN1531527A (en) Carbazole derivatives and their use as neuropeptide Y5 receptor ligands
CN1642599A (en) ACC inhibitors
CN1173867A (en) Indolyl neuropeptide Y receptor antagonists
CN1294577A (en) Potassium channel inhibitors
CN1437471A (en) Benzothiazole derivatives
CN1265672A (en) Sulfonylated dipeptide compounds which inhibit leukocyte adhesion mediated by VLA-4
CN1387514A (en) Aromatic sulfone hydroxamic acid metalloprotease inhibitor
CN1229373C (en) Piperidinee derivatives as neurokinin/antagonists
CN1471536A (en) Chemokine receptor antagonsis and method of use thereof
KR20070063043A (en) 4-phenylsulfonamidopiperidines as calcium channel blockers
CN1871225A (en) Preferentially substituted calcium channel blockers
CN101048393A (en) Substituted N-arylsulfonylheterocyclic amines as gamma-secretase inhibitors
CN1434803A (en) Cyclic lactams as inhibitors os A-alpha protein production

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20070926