CN101029331B - Listeria and toxicity fast test reagent kit - Google Patents
Listeria and toxicity fast test reagent kit Download PDFInfo
- Publication number
- CN101029331B CN101029331B CN2007100669858A CN200710066985A CN101029331B CN 101029331 B CN101029331 B CN 101029331B CN 2007100669858 A CN2007100669858 A CN 2007100669858A CN 200710066985 A CN200710066985 A CN 200710066985A CN 101029331 B CN101029331 B CN 101029331B
- Authority
- CN
- China
- Prior art keywords
- listeria
- positive
- solution
- pipe
- checked
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 241000186781 Listeria Species 0.000 title claims description 64
- 238000012360 testing method Methods 0.000 title abstract description 30
- 239000003153 chemical reaction reagent Substances 0.000 title abstract 2
- 230000001988 toxicity Effects 0.000 title 1
- 231100000419 toxicity Toxicity 0.000 title 1
- 239000000243 solution Substances 0.000 claims abstract description 39
- 239000013641 positive control Substances 0.000 claims abstract description 15
- 108010006785 Taq Polymerase Proteins 0.000 claims abstract description 6
- 239000007853 buffer solution Substances 0.000 claims abstract description 4
- 238000005336 cracking Methods 0.000 claims abstract description 4
- 241000186779 Listeria monocytogenes Species 0.000 claims description 43
- 229940115931 listeria monocytogenes Drugs 0.000 claims description 43
- 238000001514 detection method Methods 0.000 claims description 27
- 241000186780 Listeria ivanovii Species 0.000 claims description 24
- 238000006243 chemical reaction Methods 0.000 claims description 24
- 241000186806 Listeria grayi Species 0.000 claims description 21
- 230000001018 virulence Effects 0.000 claims description 14
- 230000009849 deactivation Effects 0.000 claims description 11
- 239000007788 liquid Substances 0.000 claims description 10
- 239000000872 buffer Substances 0.000 claims description 8
- 239000000203 mixture Substances 0.000 claims description 8
- 241000186805 Listeria innocua Species 0.000 claims description 5
- 241000186807 Listeria seeligeri Species 0.000 claims description 5
- 230000004087 circulation Effects 0.000 claims description 5
- 229920002684 Sepharose Polymers 0.000 claims description 4
- 238000004043 dyeing Methods 0.000 claims description 4
- 238000001962 electrophoresis Methods 0.000 claims description 4
- 238000003384 imaging method Methods 0.000 claims description 4
- 241000186814 Listeria welshimeri Species 0.000 claims description 3
- 239000003085 diluting agent Substances 0.000 claims description 3
- -1 dNTP Substances 0.000 claims description 2
- 241000894006 Bacteria Species 0.000 abstract description 19
- 230000008014 freezing Effects 0.000 abstract 2
- 238000007710 freezing Methods 0.000 abstract 2
- 238000007865 diluting Methods 0.000 abstract 1
- 239000004615 ingredient Substances 0.000 abstract 1
- 241000231286 Neottia Species 0.000 description 15
- 239000003550 marker Substances 0.000 description 13
- 239000000047 product Substances 0.000 description 13
- 238000000034 method Methods 0.000 description 12
- 230000001580 bacterial effect Effects 0.000 description 11
- 238000004519 manufacturing process Methods 0.000 description 11
- 235000013305 food Nutrition 0.000 description 10
- 101100215699 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e) aguA1 gene Proteins 0.000 description 9
- 239000008267 milk Substances 0.000 description 9
- 235000013336 milk Nutrition 0.000 description 9
- 210000004080 milk Anatomy 0.000 description 9
- 230000035945 sensitivity Effects 0.000 description 9
- 238000011144 upstream manufacturing Methods 0.000 description 7
- 108090000623 proteins and genes Proteins 0.000 description 6
- 241000894007 species Species 0.000 description 6
- 241000238557 Decapoda Species 0.000 description 5
- 241000699666 Mus <mouse, genus> Species 0.000 description 5
- 238000013461 design Methods 0.000 description 5
- 239000012895 dilution Substances 0.000 description 5
- 238000010790 dilution Methods 0.000 description 5
- 238000007403 mPCR Methods 0.000 description 5
- 238000012545 processing Methods 0.000 description 5
- 239000010865 sewage Substances 0.000 description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 4
- 241000194032 Enterococcus faecalis Species 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 229940032049 enterococcus faecalis Drugs 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 241000193738 Bacillus anthracis Species 0.000 description 3
- 241000193755 Bacillus cereus Species 0.000 description 3
- 240000001046 Lactobacillus acidophilus Species 0.000 description 3
- 235000013956 Lactobacillus acidophilus Nutrition 0.000 description 3
- 241000191967 Staphylococcus aureus Species 0.000 description 3
- 241000194017 Streptococcus Species 0.000 description 3
- 229940065181 bacillus anthracis Drugs 0.000 description 3
- 239000012153 distilled water Substances 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 229940039695 lactobacillus acidophilus Drugs 0.000 description 3
- 239000013642 negative control Substances 0.000 description 3
- 235000014102 seafood Nutrition 0.000 description 3
- 108020004465 16S ribosomal RNA Proteins 0.000 description 2
- 206010000234 Abortion spontaneous Diseases 0.000 description 2
- 241000193792 Aerococcus viridans Species 0.000 description 2
- 101710148893 Internalin B Proteins 0.000 description 2
- 241001134659 Lactobacillus curvatus Species 0.000 description 2
- 201000009906 Meningitis Diseases 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 206010040047 Sepsis Diseases 0.000 description 2
- 241000194048 Streptococcus equi Species 0.000 description 2
- 241000282898 Sus scrofa Species 0.000 description 2
- 239000008186 active pharmaceutical agent Substances 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000002347 injection Methods 0.000 description 2
- 239000007924 injection Substances 0.000 description 2
- 208000015994 miscarriage Diseases 0.000 description 2
- 238000005457 optimization Methods 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 239000002574 poison Substances 0.000 description 2
- 231100000614 poison Toxicity 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 239000013558 reference substance Substances 0.000 description 2
- 208000013223 septicemia Diseases 0.000 description 2
- 208000000995 spontaneous abortion Diseases 0.000 description 2
- 235000013311 vegetables Nutrition 0.000 description 2
- FRXSZNDVFUDTIR-UHFFFAOYSA-N 6-methoxy-1,2,3,4-tetrahydroquinoline Chemical compound N1CCCC2=CC(OC)=CC=C21 FRXSZNDVFUDTIR-UHFFFAOYSA-N 0.000 description 1
- 206010010741 Conjunctivitis Diseases 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 241000287828 Gallus gallus Species 0.000 description 1
- 208000005577 Gastroenteritis Diseases 0.000 description 1
- 241000218492 Lactobacillus crispatus Species 0.000 description 1
- 206010024641 Listeriosis Diseases 0.000 description 1
- 241000699670 Mus sp. Species 0.000 description 1
- 101000702488 Rattus norvegicus High affinity cationic amino acid transporter 1 Proteins 0.000 description 1
- 241000194021 Streptococcus suis Species 0.000 description 1
- 230000003187 abdominal effect Effects 0.000 description 1
- 238000005842 biochemical reaction Methods 0.000 description 1
- 238000009835 boiling Methods 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 235000015223 cooked beef Nutrition 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 244000078673 foodborn pathogen Species 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 239000008176 lyophilized powder Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013622 meat product Nutrition 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 235000015277 pork Nutrition 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 238000010926 purge Methods 0.000 description 1
- 108700022487 rRNA Genes Proteins 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000010079 rubber tapping Methods 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 235000015067 sauces Nutrition 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012882 sequential analysis Methods 0.000 description 1
- 230000000405 serological effect Effects 0.000 description 1
- 230000035939 shock Effects 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A Lister bacterium and fast test reagent kit are disclosed. It consists of two freezing tubes containing different ingredients, 100 PCR reactive tubes and test specifications, the freezing tubes include TaqDNApolymerase, 10Xbuffer, dNTP, primer LM, LN, LS, LVSW, LGU, Ld, Lmo0038-1 and Lmo0038-2 and cracking buffer solution, positive control solution and diluting solution. The lowest testing limitreaches to 102FU/mL is correct, specific and sensitive.
Description
Technical field
The invention belongs to biological technical field, relate to the research that pathogenic listerial evaluation in the food, the diagnosis of animal listeriosis and division bacteria are evolved.Foundation is based on each kind of discriminating listeria bacteria of multiplex PCR and distinguish the Fast Detection Technique of Listeria monocytogenes virulence power, i.e. listeria bacteria species and virulence quick detection kit.
Background technology
Listeria (Listeria) bacterium is widely distributed, and is stronger to the tolerance of environment.According to genome sequence, virulence and the ability etc. of decomposing sugar, it can be divided into 6 kinds, be listerisa monocytogenes in mjme (Listeriamonocytogenes, be called for short Listeria monocytogenes), listera innocua (Listeria innocua), listeria ivanovii (Listeriaivanovii), Sai Shi listeria bacteria (Listeria seeligeri), Wei Shi listeria bacteria (Liisteriawelshimeri) and listeria grayi (Listeria grayi), wherein Listeria monocytogenes and listeria ivanovii are main pathogenic kind.Listeria monocytogenes is the important former bacterium of food source property Amphixenosis, can cause gastro-enteritis, septicemia, meningitis and miscarriage etc., is promptly classified as one of food-borne pathogens of detection by WHO food safety work program in 2000, and its harm seriousness has some idea of.But the virulence between the Listeria monocytogenes bacterial strain differs greatly, and low virulent strain has some unique characterization of molecules.And listeria ivanovii main harm animal particularly ruminates beast, often shows as septicemia and miscarriage.Listera innocua, Sai Shi listeria bacteria and listeria grayi also once had the report that causes the serious microbemia of people, purulent meningitis and eye conjunctivitis, but uncommon.Any listerial existence in food all is considered to the bad indication of sanitary condition, but harm seriousness difference.Listeria bacteria family is not huge, and the difference of virulence not of the same race and genome obviously, so the listeria bacteria is again the good model of research virulence molecular evolution.
The listeria bacteria detection method has micro-biochemical reaction and serological method etc., when all having operational cost, effort, and test-results drawback such as differ greatly.Set up some at present both at home and abroad and detected the molecular biology method of listeria and Listeria monocytogenes, but the research to non-Listeria monocytogenes and Listeria monocytogenes different virulence strain discriminating is few, up to now, can identify simultaneously that each kind of listeria bacteria and the method for distinguishing Listeria monocytogenes virulence power still do not have report.The present invention is by the optimization to analysis, selection of primers and the testing conditions of new gene lmo0038, design a kind of accurately, sensitivity, multiple PCR detection kit fast, in the hope of filling up above-mentioned blank.
Summary of the invention
The purpose of this invention is to provide a kind of quick detection kit, by four frozen pipes that contain heterogeneity and 100 PCR pipes and application of samples and detect the step explanation and forms, can carry out 100 detections.
Listeria bacteria of the present invention species and virulence quick detection kit are that A, B, C, D, E, F, G, H, I and ten of J contain frozen pipe and 100 PCR reaction tubess of heterogeneity and detect the step specification sheets and form by code name; Frozen pipe A is equipped with Taq DNA polymerase, 10 * buffer, dNTP, primer; Frozen pipe B is equipped with cracking buffer solution 1mL; Frozen pipe C～I is equipped with the different positive control solution of 0.5mL respectively, the C pipe is the strong malicious deactivation strain of listerisa monocytogenes in mjme (Listeria monocytogenes), the D pipe is the weak malicious deactivation strain of listerisa monocytogenes in mjme (Listeria monocytogenes), the E pipe is listera innocua (Listeria innocua), the F pipe is listeria ivanovii (Listeriaivanovii), the G pipe is Sai Shi listeria bacteria (Listeria seeligeri), the H pipe is Wei Shi listeria bacteria (Listeriawelshimer), and the I pipe is listeria grayi (Listeria grayi); Frozen pipe J is equipped with the 0.58mL diluent.The sequence of above-mentioned primer LM, LN, LS, LVSW, LGU, Ld, lmo0038-1, lmo0038-2 is as follows:
LM AAACTGCTAACACAGCTACT
LN TAGCACTCCAGTTGTTAAAC
LS CACAAGCGGCTCCTGCTCAAC
LGU CTGCGAAACCAGCAGTTTCT
LVSW AACTGAGGTAGCGAGCGAA
Ld ATACGCGACCGAAGCCAAC
lmo0038-1 TTTCAATTATGTACGCCCAGGTGT
lmo0038-2 AATATTTCCGCCGCCAAGTAA
The detection step of listeria bacteria species and virulence quick detection kit is as follows:
(1) 0.58 mL solution among the frozen pipe J is added to frozen pipe A, resuspended;
(2) the 10 μ L of the solution among the frozen pipe B are added the PCR reaction tubes, again the 5 μ L of the positive control solution among frozen pipe C～I or sample to be checked (bacterium liquid or template all can) 5 μ L are added to same PCR reaction tubes, mix, solution 5.8 μ L with frozen pipe A in (1) add above-mentioned same PCR reaction tubes at last, detect immediately;
(3) the PCR reaction tubes is increased on the PCR instrument by following reaction conditions: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 25 circulations; 72 ℃ of 5min;
(4) the product electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid after will increasing is analyzed with gel imaging system after Goldview dyeing;
(5) result judges: after the detection, sample to be checked and positive control solution C amplify 720bp, two bands of 403bp simultaneously is the Listeria monocytogenes virulent strain positive (Fig. 1-A); What sample to be checked and positive control solution D amplified the 720bp band simultaneously is the Listeria monocytogenes low virulent strain positive (Fig. 1-B); What sample to be checked and positive control solution E amplified the 986bp band simultaneously is the Listeria innocua positive (Fig. 1-C); What sample to be checked and positive control solution F amplified 1357bp, two bands of 403bp simultaneously is the Listeria ivanovii positive (Fig. 1-D); What sample to be checked and positive control solution G amplified 1 108bp band simultaneously is the Listeria seeligeri positive (Fig. 1-E); What sample to be checked and positive control Solution H amplified the 1363bp band simultaneously is the Listeria welshimeri positive (Fig. 1-F); Sample to be checked is the Listeria grayi positive (Fig. 1-G) with positive to what solution I amplified the 479bp band simultaneously; Band appears in positive control solution and sample to be checked does not have a band is sample feminine gender to be checked (Fig. 1-H); Both do not have all that band appears in band or sample to be checked and positive control solution do not have the need of band detect again and judge (Fig. 1-I, J).
Description of drawings
Fig. 1 judges synoptic diagram for the result
M.2000bp DNALadder Marker, 1. positive reference substance, sample 2. to be checked.
Fig. 2 lmo0035-lmo0042 long range PCR amplified production electrophorogram (one)
M.2000bp DNA Ladder Marker, the 1. strong malicious deactivation strain of Listeria monocytogenes, 2. listeria ivanovii, 3. listera innocua, 4. weak malicious deactivation strain, 5. Sai Shi listeria bacteria, 6. Wei Shi listeria bacteria, 7. listeria grayi of Listeria monocytogenes.
Fig. 3 lmo0035-lmo0042 long range PCR amplified production electrophorogram (two)
M.2000bp DNA Ladder Marker, 1. listera innocua, the 2. weak malicious deactivation strain (F2525) of Listeria monocytogenes, 3. weak malicious deactivation strain (54006), the 4. strong malicious deactivation strain of Listeria monocytogenes (EGD-e) of Listeria monocytogenes.
Fig. 4 lmo0029-lmo0042 long range PCR amplified production electrophorogram
M.2000bp DNALadder Marker, 1. Wei Shi listeria bacteria, 2. Sai Shi listeria bacteria, 3. listeria grayi.
Fig. 5 is a multiplex PCR amplified production electrophorogram
M.2000bp DNA Ladder Marker, the 1. strong malicious deactivation strain of Listeria monocytogenes, 2. listera innocua, 3. listeria ivanovii, 4. Wei Shi listeria bacteria, 5. Sai Shi listeria bacteria, 6. listeria grayi, 7. listeria grayi Mo Shi subspecies, 8. malicious deactivation strain a little less than the Listeria monocytogenes.
Fig. 6 is this test kit detection sensitivity one Listeria monocytogenes different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker，1.10
9CFU/mL，2.10
8CFU/mL，3.10
7CFU/mL，4.10
6CFU/mL，5.10
5CFU/mL，6.10
4CFU/mL，7.10
3CFU/mL，8.10
2CFU/mL，9.10CFU/mL.
Fig. 7 is this test kit detection sensitivity one listera innocua different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker，?1.1.7×10
9CFU/mL，2.1.7×10
8CFU/mL，3.1.7×10
7CFU/mL，4.1.7×10
6CFU/mL，5.1.7×10
5CFU/mL，6.1.7×10
4CFU/mL，7.1.7×10
3CFU/mL，8.1.7×10
2?CFU/mL.9.1.7×10CFU/mL.
Fig. 8 is this test kit detection sensitivity one listeria ivanovii different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker，1.9×10
9CFU/mL，2.9×10
8CFU/mL，3.9×10
7CFU/mL，4.9×10
6CFU/mL，5.9×10
5CFU/mL，6.9×10
4CFU/mL，7.9×10
3CFU/mL，8.9×10
2CFU/mL，9.9×10CFU/mL.
Fig. 9 is this test kit detection sensitivity one Wei Shi listeria bacteria different bacterium amount amplified production electrophorogram
M.2000bp?DNALadder?Marker，?1.1.1×10
9CFU/mL，2.1.1×10
8CFU/mL，3.1.1×10
7CFU/mL，4.1.1×10
6CFU/mL，5.1.1×10
5CFU/mL，6.1.1×10
4CFU/mL，7.1.1×10
3CFU/mL，8.1.1×10
2?CFU/mL.9.1.1×10CFU/mL.
Figure 10 is this test kit detection sensitivity one Sai Shi listeria bacteria different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker，1.10
9CFU/mL，2.10
8CFU/mL，3.10
7CFU/mL，4.10
6CFU/mL，5.10
5CFU/mL，6.10
4CFU/mL，7.10
3CFU/mL，8.10
2CFU/mL，9.10CFU/mL.
Figure 11 is this test kit detection sensitivity one listeria grayi different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker，?1.4.6×?10
9CFU/mL，2.4.6×10
8CFU/mL，3.4.6×10
7CFU/mL，4.4.6×10
6CFU/mL，5.4.6×10
5CFU/mL，6.4.6×10
4CFU/mL，7.4.6×10
3CFU/mL，8.4.6×10
2CFU/mL，9.4.6×10CFU/mL.
Figure 12 is a multiplex PCR anti-interference test electrophorogram ()
M.2000bp DNA Ladder Marker, 1. Listeria monocytogenes/listera innocua, 2. Listeria monocytogenes/listeria ivanovii, 3. Listeria monocytogenes/Wei Shi listeria bacteria, 4. Listeria monocytogenes/Sai Shi listeria bacteria, 5. Listeria monocytogenes/listeria grayi, 6. listeria ivanovii/listera innocua, 7. listeria ivanovii/Wei Shi listeria bacteria, 8. listeria ivanovii/Sai Shi listeria bacteria.
Figure 13 is a multiplex PCR anti-interference test electrophorogram (two)
M.2000bp DNA Ladder Marker, 1. listera innocua/Wei Shi listeria bacteria, 2. listera innocua/Sai Shi listeria bacteria, 3. Wei Shi listeria bacteria/Sai Shi listeria bacteria, 4. listera innocua/listeria grayi, 5. listeria ivanovii/listeria grayi, 6. Wei Shi listeria bacteria/listeria grayi, 7. Sai Shi listeria bacteria/listeria grayi, 8. blank.
Embodiment
One, frozen pipe is formed
The A pipe contains 10 * buffer (commercial), dNTP (commercial) for lyophilized powder; Primer (sequence is designed by the contriver, sees Table 1) LM, LN, LS, LVSW, LGU, Ld, lmo0038-1, lmo0038-2; Taq DNA polymerase (commercial).Be stored in-20 ℃.
The B pipe contains cracking buffer solution 1mL, is stored in-20 ℃.
The C-I pipe contains 0.5mL solution, is seven kinds of positive reference substances, is stored in-20 ℃.
The J pipe contains 0.58mL solution, is diluent.
Two, application of sample and the explanation of detection step
1,0.58mL solution in the J pipe is added to the A pipe, resuspended.
2, B is managed solution 10 μ L and add the PCR reaction tubes, once more positive contrast solution 5 μ L or sample to be checked in the C-I pipe (bacterium liquid or template all can) 5 μ L are added to same PCR reaction tubes, mix, at last the solution 5.8 μ L in 1 are added above-mentioned same PCR reaction tubes, detect immediately.
3, on the PCR instrument, increase by following reaction conditions 1: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 25 circulations; 72 ℃ of 5min.
4,, after Goldview dyeing, analyze with gel imaging system with 2 reacted products electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid.
Below by test result of use of the present invention is proved and described.
1 materials and methods
1.1 bacterial strain and cultivation
Listeria bacteria reference strain part is available from ATCC, NCTC and Nat'l Pharmaceutical ﹠ Biological Products Control Institute, and part is so kind as to give (seeing table 1 for details) by state-run veterinary institute doctor M.Jakobsen of Denmark.119 strains separate from Chinese Zhejiang, Fujian, Jiangsu and other places through the relevant strain isolated of listeria bacteria food that listeria bacteria selective coloration culture medium (CHROMagar, French Kerma (unit of kinetic energy) is good) preliminary screening goes out, and are preserved by zooprophylazis Institute for Medical Research of Zhejiang University.Gram-positive microorganism (the G nearer with the listeria bacteria sibship, that G+C content is low
+ Low) as bacillus cereus (Bacillus cereus), Bacillus anthracis (Bacillus anthracis), enterococcus faecalis (Enterococcusfaecalis), streptococcus aureus (Staphylococcus aureus), swine streptococcus (Streptococcus suis), streptococcus equi epizootic disease subspecies (C group) (Streptococcus.equi subspzooepidemicus), lactobacillus acidophilus (Lactobacillus acidophilus), lactobacillus curvatus (Lactobacillus crispatus) and other 12 kinds of negative control bacterial strains are also preserved (seeing table 1 for details) by this institute.Each inoculation is in 5mL BHI (DIFCO) substratum, and 37 ℃ of shaking culture are spent the night.
Table 1 listeria bacteria reference strain and negative control bacterial strain
1.2 dna profiling preparation
Get the 1mL culture, centrifugal collecting precipitation, behind distilled water (Millipore) purge, resuspended with equal-volume 2 * TZ and distilled water ,-20 ℃ leave standstill 45min.Effect is put immediately behind the 8min and is cooled off 7min in the ice bath in boiling water, 4 ℃ of centrifugal 1min of 12000rpm, get supernatant and be stored in-20 ℃ standby.
1.3 mouse LD
50
6-8 week ICR female mice in age (20-22g) adapts to and attacks poison after 3 days available from Zhejiang University of Traditional Chinese Medicine's Experimental Animal Center.Each bacterial strain is established 6 dosage groups, 6 every group.After the bacterium incubated overnight, 8000rpm is centrifugal to collect thalline, and (0.01M pH7.2) adjusts bacterial count to 10 with PBS
10About, and carry out a series of ten times of gradient dilutions, with the dosage abdominal injection of 0.1mL; Simultaneously, establish control group injection 0.1mL PBS, another control group is not injected.Attack the poison back and observed 10 days continuously, calculate the LD of each bacterial strain according to the mouse death rate of each group, by the improvement karber's method
50
1.4 the mensuration and the analysis of full gene of lmo0038 and both sides sequence thereof
The full length sequence of design primer amplification Listeria monocytogenes lmo0038 and listeria ivanovii homologous region (i-lmo0038).After purifying is reclaimed in the amplified production rubber tapping, be connected in the pMD18-T carrier according to T-A clone strategy, and the thermal shock method is transformed into competent escherichia coli cell DH5a.Recombinant plasmid is sent to the order-checking of Shanghai Ying Jun Bioisystech Co., Ltd with positive colony after identifying by PCR and EcoR I, HindIII double digestion.Check order row by Clustal X (version 1.8) software analysis.
The homologous region sequence of Listeria monocytogenes lmo0035-0042, lmo0029-0042 and other kinds increases by long range PCR, grows apart from enzyme (LA Taq DNApolymerase) available from TaKaRa Bioisystech Co., Ltd.Primer sees table 2 for details.
Table 2 primer sequence and product length (one)
Annotate: v represents that product length changes because of species are different
1.5 the PCR system is set up
1.5.1 design of primers
According to the lmo0038 complete sequence of measuring, design primer lmo0038-1/lmo0038-2.By analysis, and, design five upstream primers (LM, LN, LVSW, LGU, LS) and combine with downstream primer (Ld) competition with reference to pertinent literature to conserved regions and variable region in the iap sequence.Primer sequence sees table 3 for details.
1.5.2 PCR reaction system and condition
By the optimization of PCR system and condition, determine that the multi-PRC reaction system is: 10 * Taq Buffer (contains Mg
2+) 3 μ L, 10mmol/L dNTP Mix 0.6 μ L, each 0.6 μ L of 50 μ M primers, dna profiling (or bacterium liquid) 2 μ L, Taq DNApolymerase 0.8 μ L adds ddH
2O supplies volume to 30 μ L; Reaction conditions is: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 5min.
1.5.3 the order-checking of PCR product is identified
By 1.3 described methods, the PCR product is cloned, checked order.
1.5.4 specificity test
, increase as negative control and blank with 20 kinds of bacteriums such as bacillus cereus, Bacillus anthracis, enterococcus faecalis, streptococcus aureus, swine streptococcus, streptococcus equi epizootic disease subspecies (C group), lactobacillus acidophilus, lactobacillus curvatus and distilled water with the PCR method of setting up.
1.5.5 sensitivity test
The reference strain of each kind of listeria bacteria in BHI after 37 ℃ of incubated overnight, get 1mL bacterium liquid centrifugal and with PBS (0.01M, pH7.2) resuspended, adjust bacterial concentration to 10
9CFU/mL (OD
600Be about 0.18-0.2), do 10 times of continuous gradient dilutions.Choose 10
-5, 10
-6, 10
-7, 10
-8Extent of dilution carries out plate count, and gets each dilution bacterium liquid and carry out the PCR detection.
1.5.6 anti-interference test
With any two or three listerial template (about 10
9CFU/mL) balanced mix, the former has 15 kinds of combinations, and the latter is totally 9 kinds of combinations, increases with the PCR system of setting up, and identifies multiple listerial ability simultaneously to determine this method.
1.6 the relevant strain isolated of food is identified
Food relevant strain isolated in the doubtful listeria bacteria of 119 strains separates sea-food, milk preparation, meat product, vegetables and food processing plant's utensil from the South China, sewage etc.These strain isolateds all detect with this test kit, and (Biomerieux France) identifies to use the API system simultaneously.
1.7 species confirmatory test
Choose 16S rRNA, 23S rRNA and Listeria monocytogenes specific gene hly, mpl, InlB, lmo0733 is a target gene, and bacterial strain to be checked and reference strain are carried out pcr amplification and order-checking.Sequence contrasts through NCBIBLAST, to prove conclusively the species of this bacterial strain.Primer sees table 2 for details.
1.8 application of sample and detection step
1.8.1 0.58 mL solution in the test kit D pipe is added to the A pipe, resuspended.
Add the PCR reaction tubes 1.8.2 B is managed solution 10 μ L, once more C pipe (or sample to be checked) 5 μ L are added to same PCR reaction tubes, mix, at last the resuspended solution 5.8 μ L of 1.6.1 are added above-mentioned same PCR reaction tubes, detect immediately.
1.8.3 1.6.1 is increased on the PCR instrument by following reaction conditions: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 40s, 72 ℃ of 50s, 30 circulations; 72 ℃ of 5min.
1.8.4, after Goldview dyeing, analyze with gel imaging system with the reacted product of 1.6.2 electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid.
2 results
2.1 mouse LD
50
As shown in table 4, reference strain F2525,54006 is that low virulent strain is (to the LD of mouse
5010
8), and EGD, ScottA, 10403S are the standard virulent strain.
2.2 the mensuration and the analysis of its both sides sequence of the full gene of lmo0038
Listeria monocytogenes lmo0038 and listeria ivanovii homologous region (i-lmo0038) sequence total length are 1092bp, and homology is 83.9%.Lmo0035-0042 long range PCR amplification shows, two of Listeria monocytogenes virulent strain and listeria ivanoviis cause a disease to plant and can amplify the 7538bp band, Listeria monocytogenes low virulent strain and listera innocua all amplify the 876bp band and homology is 78.6-82%, all the other are planted does not all have amplification (Fig. 2,3); Lmo0029-0042 long range PCR amplification shows that Wei Shi listeria bacteria and Sai Shi listeria bacteria can amplify the 750bp band, and listeria grayi does not have any band amplification (Fig. 4).Each kind of above results suggest listeria bacteria be in the gene of this section difference of arranging, and lmo0038 exists only in and causes a disease kind.
2.3 multiplex PCR and test kit detected result
Utilize test kit that the reference strain of each kind of listeria bacteria is increased, as shown in Figure 5, the Listeria monocytogenes virulent strain can obtain the purpose band of 720bp and 403bp, and low virulent strain only obtains the 720bp band; Listera innocua can obtain the 986bp band, listeria ivanovii can obtain 1357bp and two bands of 403bp, the Wei Shi listeria bacteria can obtain the 1363bp band, and the Sai Shi listeria bacteria can obtain 1 108bp band, and form listeria bacteria and Mo Shi subspecies all obtain the 479bp band.
2.4 the order-checking of PCR product is identified
Pcr amplification product is after the BLAST comparison, and the result shows that the iap sequence of each kind and the homology of known array are 98.2%-100%; The homology of lmo0038 and known array is 100%, with the homology of i-lmo0038 sequence be 79.4% (still not having the i-lmo0038 sequence on the net).Show that this PCR method has higher accuracy.
2.5 specificity test
Utilize this test kit respectively 20 kinds of other bacteriums to be increased, the result shows no any band, shows that this PCR reaction amplification listeria bacteria gene fragment has good specificity.
2.6 sensitivity test
Utilize test kit that each dilution listeria bacteria bacterium liquid is detected, the results are shown in Figure 6-Figure 11.When containing respectively, each kind have an appointment 10
2During the CFU/mL bacterium, visible corresponding target band product shows that this method all can reach 10 to the susceptibility of each kind of listeria bacteria
2CFU/mL.
2.7 anti-interference test
Shown in Figure 12,13, after two kinds of listerial template balanced mix, 15 kinds of combinations all can amplify purpose band clearly simultaneously, do not produce interference.And, only can amplify less fragment with after three kinds of listerial template balanced mix, as the listerial iap fragment of lmo0038 Ji Geshi, so this method does not detect when being suitable for three kinds.
2.8 the relevant strain isolated of food is identified and the species conclusive evidence
In the food relevant strain isolated of 119 strains from the South China, evaluation by this test kit, 86 strains are Listeria monocytogenes, and wherein milk strain isolated mLm4 only amplifies iap band (Fig. 3), the iap band less (about 600-650bp) that Er salt baked chicken strain isolated L92 amplifies.LD
50Result's (table 4) shows, in 20 strain Listeria monocytogenes strain isolateds, except that mLm4 virulence and standard low virulent strain F2525,54006 quite, all the other are virulent strain, coincide with the test kit detected result.All the other 27 strains are listera innocua, and 1 strain is the Sai Shi listeria bacteria, and 1 strain is the Wei Shi listeria bacteria, and 4 strains are non-listeria bacteria.API result also meets fully with it.
Find that by the species confirmatory test mLm4, L92 all can amplify hly, the mpl identical with the Listeria monocytogenes reference strain, InlB, lmo0733 band, prove conclusively both and be Listeria monocytogenes.And PCR, order-checking and sequential analysis by 16S rRNA, 23S rRNA gene, 3 strains are enterococcus faecalis in the non-listeria bacteria of 4 strains, 1 strain is comparatively rare aerococcus viridans (Aerococcus viridans).Above result all confirms the reliability of this multiple PCR fast detection kit.
Table 3 primer sequence and product length (two)
| Primer | Goal gene | Primer sequence 5 '-3 ' | Product length (bp) | |
| LM (upstream) | L.monocytogenes-iap | CAAACTGCTAACACAGCTACT | 720? | |
| LN (upstream) | L.innocua-iap | ACTAGCACTCCAGTTGTTAAAC | 986? | |
| LS (upstream) | L.seeligeri-iap | TACACAAGCGGCTCCTGCTCAAC | 1108? | |
| LGU (upstream) | L.grayi-iap | CCTGCGAAACCAGCAGTTTCT | 479bp? | |
| LVSW (upstream) | L.ivanovii，L.welshimeri，L.s eeligeri- | TAACTGAGGTAGCGAGCGAA | 1，357-1，366? | |
| Ld (downstream) | Listeria-iap | TTATACGCGACCGAAGCCAAC | ? | |
| Lmo0038-1 (upstream) | L.monocytogenes-lmo0038 L.ivanovii-lmo0038 homologue | TTTCAATTATGTACGCCCAGGTGT | 403? | |
| Lmo0038-2 (downstream) | ? | AATATTTCCGCCGCCAAGTAA | ? |
Table 4 Listeria monocytogenes reference strain and strain isolated source and mouse LD50
| Bacterial strain | The source | 1gLD50 |
| EGD? | Reference strain | <7.04 |
| ScottA? | Reference strain | 6.79? |
| 10403S? | Reference strain | 5.49? |
| F2525? | Reference strain | 8.10? |
| 54006? | Reference strain | 8.35? |
| fLml? | Cooked beef | 6.26? |
| fLm2? | The young row of sauce | 6.45? |
| fLm3? | Raw pork | 6.07? |
| fLm4? | Vegetables | 6.11? |
| mLm3? | Raw material milk | 3.86? |
| mLm4? | Sterile milk | 8.14? |
| mLm10? | Sterile milk | 5.55? |
| eLml? | Sea-food processing ground sewage | 5.53? |
| eLm2? | The milk-producing tool surfaces | 6.46? |
| eLm3? | Milk processing plant's ground sewage | 6.43? |
| eLm4? | Milk processing plant's ground sewage | 6.32? |
| eLm5? | Homogeneous milk cylinder surfaces | 5.45? |
| sLml? | The American Red fillet | 6.74? |
| sLm2? | The American Red fillet | 6.19? |
| sLm3? | The American Red fillet | 6.72? |
| sLm4? | Peeled shrimp | 5.94? |
| sLm5? | Peeled shrimp | 4.40? |
| sLm6? | Peeled shrimp | 5.79? |
| sLm7? | Peeled shrimp | 5.08? |
| sLm8? | Peeled shrimp | 6.31? |
| eLml? | Sea-food processing ground sewage | 5.53? |
Sequence table:
LM AAACTGCTAACACAGCTACT
LN TAGCACTCCAGTTGTTAAAC
LS CACAAGCGGCTCCTGCTCAAC
LGU CTGCGAAACCAGCAGTTTCT
LVSW AACTGAGGTAGCGAGCGAA
Ld ATACGCGACCGAAGCCAAC
lmo0038-1 TTTCAATTATGTACGCCCAGGTGT
lmo0038-2 AATATTTCCGCCGCCAAGTAA
Claims (2)
1. listeria bacteria species and virulence quick detection kit, comprise that 10 contain frozen pipe A, B, C, D, E, F, G, H, I and J and 100 PCR reaction tubess of heterogeneity and detect the step specification sheets, it is characterized in that: frozen pipe A is equipped with Taq DNA polymerase, 10 * buffer, dNTP, primer; Frozen pipe B is equipped with cracking buffer solution 1mL; Frozen pipe C～I is equipped with the different positive control solution of 0.5mL respectively, the C pipe is listerisa monocytogenes in mjme (Listeriamonocytogenes, be called for short Listeria monocytogenes) strong malicious deactivation strain, the D pipe is the weak malicious deactivation strain of listerisa monocytogenes in mjme, the E pipe is harmless Liszt (Listeria innocua), the F pipe is listeria ivanovii (Listeria ivanovii), the G pipe is Sai Shi listeria bacteria (Listeria seeligeri), the H pipe is Wei Shi listeria bacteria (Listeria welshimer), and the I pipe is listeria grayi (Listeria grayi); Frozen pipe J is equipped with the 0.58mL diluent; Described primer is LM, LN, LS, LVSW, LGU, Ld, lmo0038-1, lmo0038-2, and its sequence is as follows:
LM AAACTGCTAACACAGCTACT
LN TAGCACTCCAGTTGTTAAAC
LS CACAAGCGGCTCCTGCTCAAC
LGU CTGCGAAACCAGCAGTTTCT
LVSW AACTGAGGTAGCGAGCGAA
Ld ATACGCGACCGAAGCCAAC
lmo0038-1 TTTCAATTATGTACGCCCAGGTGT
lmo0038-2 AATATTTCCGCCGCCAAGTAA
2. by claim 1 described listeria bacteria species and virulence quick detection kit, the detection method that it is characterized in that it is following steps:
(1) 0.58mL solution among the frozen pipe J is added to frozen pipe A, resuspended;
(2) the 10 μ L of the solution among the frozen pipe B are added the PCR reaction tubes, again 5 μ L of the positive control solution among frozen pipe C～I or sample to be checked 5 μ L are added to same PCR reaction tubes, mix, solution 5.8 μ L with frozen pipe A in (1) add above-mentioned same PCR reaction tubes at last, carry out following detection step immediately;
(3) the PCR reaction tubes is increased on the PCR instrument by following reaction conditions: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 25 circulations; 72 ℃ of 5min;
(4) the product electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid after will increasing is analyzed with gel imaging system after Goldview dyeing;
(5) result judges: after the detection, sample to be checked is listerisa monocytogenes in mjme (Listeria monocytogenes) the virulent strain positive with positive to what solution C amplified 720bp, two bands of 403bp simultaneously; Sample to be checked is listerisa monocytogenes in mjme (Listeria monocytogenes) the low virulent strain positive with positive to what solution D amplified the 720bp band simultaneously; Sample to be checked is harmless Liszt (Listeria innocua) positive with positive to what solution E amplified the 986bp band simultaneously; Sample to be checked is listeria ivanovii (Listeriaivanovii) positive with positive to what solution F amplified 1357bp, two bands of 403bp simultaneously; Sample to be checked is Sai Shi listeria bacteria (Listeriaseeligeri) positive with positive to what solution G amplified the 1108bp band simultaneously; Sample to be checked is Wei Shi listeria bacteria (Listeriawelshimeri) positive with positive to what Solution H amplified the 1363bp band simultaneously; Sample to be checked is listeria grayi (Listeriagrayi) positive with positive to what solution I amplified the 479bp band simultaneously; Positive control solution band appears and sample to be checked do not have band for sample feminine gender to be checked; Both do not have all that band appears in band or sample to be checked and positive control solution does not have the need of band detects again and judge.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100669858A CN101029331B (en) | 2007-01-30 | 2007-01-30 | Listeria and toxicity fast test reagent kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100669858A CN101029331B (en) | 2007-01-30 | 2007-01-30 | Listeria and toxicity fast test reagent kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101029331A CN101029331A (en) | 2007-09-05 |
| CN101029331B true CN101029331B (en) | 2011-01-05 |
Family
ID=38714882
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100669858A Expired - Fee Related CN101029331B (en) | 2007-01-30 | 2007-01-30 | Listeria and toxicity fast test reagent kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101029331B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286631B (en) * | 2011-09-14 | 2013-10-09 | 厦门出入境检验检疫局检验检疫技术中心 | Method for multiplex polymerase chain reaction (PCR) fast detection and five-Listeria-bacterium identification |
| CN104328187A (en) * | 2014-11-05 | 2015-02-04 | 上海大学 | Primer pair for detecting listeria monocytogenes and method for detecting listeria monocytogenes |
| CN104388567B (en) * | 2014-11-27 | 2017-10-13 | 大连工业大学 | For a kind of quick determination method of Listeria monocytogenes inlB virulence genes |
| CN106442795B (en) * | 2016-10-24 | 2018-12-18 | 山东出入境检验检疫局检验检疫技术中心 | A kind of detection method of quick differentiation Listeria monocytogenes and Si Shi Listeria |
| CN107746890B (en) * | 2017-11-29 | 2021-03-30 | 南京农业大学 | Multiplex PCR detection primer and method for identifying Listeria monocytogenes serotype |
| CN107988330A (en) * | 2017-12-11 | 2018-05-04 | 南京农业大学 | The dual-PCR method of Listeria monocytogenes and listeria ivanovii is detected at the same time |
| CN110423833B (en) * | 2019-08-28 | 2023-06-20 | 华南理工大学 | Multiplex PCR method for identifying listeria monocytogenes serotype based on specific targets |
| CN110512012B (en) * | 2019-08-28 | 2022-11-18 | 华南理工大学 | Multiple PCR primers for identifying Listeria monocytogenes serotype based on specific target and application thereof |
| CN111057776B (en) * | 2019-12-30 | 2022-05-20 | 广东省微生物研究所（广东省微生物分析检测中心） | Listeria and 6 common Listeria specific novel molecular targets and rapid detection method thereof |
-
2007
- 2007-01-30 CN CN2007100669858A patent/CN101029331B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| ANDREAS BUBERT, ET AL..DETECTION AND DIFFERENTIATION OF LISTERIA SPP.BY A SINGLE REACTION BASED ON MULTIPLEX PCR.APPLIED AND ENVIRONMENTAL MICROBIOLOGY65 10.1999,65(10),4688-4692. |
| ANDREAS BUBERT, ET AL..DETECTION AND DIFFERENTIATION OF LISTERIA SPP.BY A SINGLE REACTION BASED ON MULTIPLEX PCR.APPLIED AND ENVIRONMENTAL MICROBIOLOGY65 10.1999,65(10),4688-4692. * |
| 曾海燕.单核细胞增多性李斯特菌的三重PCR鉴定与分子分型技术研究.中国优秀博硕士学位论文全文数据库（硕士）农业科技辑 01.2005,(01),1-76. |
| 曾海燕.单核细胞增多性李斯特菌的三重PCR鉴定与分子分型技术研究.中国优秀博硕士学位论文全文数据库(硕士)农业科技辑 01.2005,(01),1-76. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101029331A (en) | 2007-09-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101029331B (en) | Listeria and toxicity fast test reagent kit | |
| Lambertz et al. | Real-time PCR method for detection of pathogenic Yersinia enterocolitica in food | |
| Rodríguez-Lázaro et al. | Quantitative detection of Listeria monocytogenes and Listeria innocua by real-time PCR: assessment of hly, iap, and lin02483 targets and AmpliFluor technology | |
| Julien et al. | Sources of clostridia in raw milk on farms | |
| Fusco et al. | Novel PCR-based identification of Weissella confusa using an AFLP-derived marker | |
| Ei-Jakee et al. | Rapid method for detection of Staphylococcus aureus enterotoxins in food | |
| Oh et al. | Epidemiological investigation of eaeA-positive Escherichia coli and Escherichia albertii strains isolated from healthy wild birds | |
| Shan et al. | Rapid detection of food-borne Listeria monocytogenes by real-time quantitative loop-mediated isothermal amplification | |
| Mansouri-Najand et al. | Prevalence of Listeria monocytogenes in raw milk in Kerman, Iran | |
| Quero et al. | Quantitative detection of Listeria monocytogenes in raw milk and soft cheeses: Culture-independent versus liquid-and solid-based culture-dependent real time PCR approaches | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| Heo et al. | Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products | |
| Grenda et al. | Prevalence of C. botulinum and C. perfringens spores in food products available on Polish market | |
| Tahoun et al. | Molecular characterisation, genotyping and survival of Aeromonas hydrophila isolated from milk, dairy products and humans in Egypt | |
| Thorsen et al. | Identification, genetic diversity and cereulide producing ability of Bacillus cereus group strains isolated from Beninese traditional fermented food condiments | |
| Chen et al. | Diversity of lactic acid bacteria associated with banana fruits in Taiwan | |
| Xie et al. | Simultaneous enumeration of Cronobacter sakazakii and Staphylococcus aureus in powdered infant foods through duplex TaqMan real-time PCR | |
| Belfiore et al. | Identification, technological and safety characterization of Lactobacillus sakei and Lactobacillus curvatus isolated from Argentinean anchovies (Engraulis anchoita) | |
| Olobatoke et al. | Incidence of non-typhoidal Salmonella in poultry products in the North West Province, South Africa | |
| Akyol | Development and application of RTi-PCR method for common food pathogen presence and quantity in beef, sheep and chicken meat | |
| Wu et al. | Development of an ultra-sensitive single-tube nested PCR assay for rapid detection of Campylobacter jejuni in ground chicken | |
| Afendy et al. | Pre-enrichment effect on PCR detection of Salmonella Enteritidis in artificially-contaminated raw chicken meat | |
| Armany et al. | Detection of some foodborne pathogens in meat products by Polymerase Chain Reaction | |
| Lee et al. | Combined enrichment and quantitative polymerase chain reaction to improve sensitivity and reduce time of detection of Listeria monocytogenes in mushrooms | |
| Gharib et al. | Multiplex polymerase chain reaction for detection of toxin genes of Bacillus cereus group isolated from meat and chicken products |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20070905 Assignee: DNA Sci-tech Co., Ltd. Assignor: Zhejiang University Contract record no.: 2013330000064 Denomination of invention: Listeria and toxicity fast esting reagent kit Granted publication date: 20110105 License type: Common License Record date: 20130412 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110105 Termination date: 20140130 |