Description of drawings
Fig. 1 judges synoptic diagram for the result
M.2000bp DNALadder Marker, 1. positive reference substance, sample 2. to be checked.
Fig. 2 lmo0035-lmo0042 long range PCR amplified production electrophorogram (one)
M.2000bp DNA Ladder Marker, the 1. strong malicious deactivation strain of Listeria monocytogenes, 2. listeria ivanovii, 3. listera innocua, 4. weak malicious deactivation strain, 5. Sai Shi listeria bacteria, 6. Wei Shi listeria bacteria, 7. listeria grayi of Listeria monocytogenes.
Fig. 3 lmo0035-lmo0042 long range PCR amplified production electrophorogram (two)
M.2000bp DNA Ladder Marker, 1. listera innocua, the 2. weak malicious deactivation strain (F2525) of Listeria monocytogenes, 3. weak malicious deactivation strain (54006), the 4. strong malicious deactivation strain of Listeria monocytogenes (EGD-e) of Listeria monocytogenes.
Fig. 4 lmo0029-lmo0042 long range PCR amplified production electrophorogram
M.2000bp DNALadder Marker, 1. Wei Shi listeria bacteria, 2. Sai Shi listeria bacteria, 3. listeria grayi.
Fig. 5 is a multiplex PCR amplified production electrophorogram
M.2000bp DNA Ladder Marker, the 1. strong malicious deactivation strain of Listeria monocytogenes, 2. listera innocua, 3. listeria ivanovii, 4. Wei Shi listeria bacteria, 5. Sai Shi listeria bacteria, 6. listeria grayi, 7. listeria grayi Mo Shi subspecies, 8. malicious deactivation strain a little less than the Listeria monocytogenes.
Fig. 6 is this test kit detection sensitivity one Listeria monocytogenes different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker,1.10
9CFU/mL,2.10
8CFU/mL,3.10
7CFU/mL,4.10
6CFU/mL,5.10
5CFU/mL,6.10
4CFU/mL,7.10
3CFU/mL,8.10
2CFU/mL,9.10CFU/mL.
Fig. 7 is this test kit detection sensitivity one listera innocua different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker,?1.1.7×10
9CFU/mL,2.1.7×10
8CFU/mL,3.1.7×10
7CFU/mL,4.1.7×10
6CFU/mL,5.1.7×10
5CFU/mL,6.1.7×10
4CFU/mL,7.1.7×10
3CFU/mL,8.1.7×10
2?CFU/mL.9.1.7×10CFU/mL.
Fig. 8 is this test kit detection sensitivity one listeria ivanovii different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker,1.9×10
9CFU/mL,2.9×10
8CFU/mL,3.9×10
7CFU/mL,4.9×10
6CFU/mL,5.9×10
5CFU/mL,6.9×10
4CFU/mL,7.9×10
3CFU/mL,8.9×10
2CFU/mL,9.9×10CFU/mL.
Fig. 9 is this test kit detection sensitivity one Wei Shi listeria bacteria different bacterium amount amplified production electrophorogram
M.2000bp?DNALadder?Marker,?1.1.1×10
9CFU/mL,2.1.1×10
8CFU/mL,3.1.1×10
7CFU/mL,4.1.1×10
6CFU/mL,5.1.1×10
5CFU/mL,6.1.1×10
4CFU/mL,7.1.1×10
3CFU/mL,8.1.1×10
2?CFU/mL.9.1.1×10CFU/mL.
Figure 10 is this test kit detection sensitivity one Sai Shi listeria bacteria different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker,1.10
9CFU/mL,2.10
8CFU/mL,3.10
7CFU/mL,4.10
6CFU/mL,5.10
5CFU/mL,6.10
4CFU/mL,7.10
3CFU/mL,8.10
2CFU/mL,9.10CFU/mL.
Figure 11 is this test kit detection sensitivity one listeria grayi different bacterium amount amplified production electrophorogram
M.2000bp?DNA?Ladder?Marker,?1.4.6×?10
9CFU/mL,2.4.6×10
8CFU/mL,3.4.6×10
7CFU/mL,4.4.6×10
6CFU/mL,5.4.6×10
5CFU/mL,6.4.6×10
4CFU/mL,7.4.6×10
3CFU/mL,8.4.6×10
2CFU/mL,9.4.6×10CFU/mL.
Figure 12 is a multiplex PCR anti-interference test electrophorogram ()
M.2000bp DNA Ladder Marker, 1. Listeria monocytogenes/listera innocua, 2. Listeria monocytogenes/listeria ivanovii, 3. Listeria monocytogenes/Wei Shi listeria bacteria, 4. Listeria monocytogenes/Sai Shi listeria bacteria, 5. Listeria monocytogenes/listeria grayi, 6. listeria ivanovii/listera innocua, 7. listeria ivanovii/Wei Shi listeria bacteria, 8. listeria ivanovii/Sai Shi listeria bacteria.
Figure 13 is a multiplex PCR anti-interference test electrophorogram (two)
M.2000bp DNA Ladder Marker, 1. listera innocua/Wei Shi listeria bacteria, 2. listera innocua/Sai Shi listeria bacteria, 3. Wei Shi listeria bacteria/Sai Shi listeria bacteria, 4. listera innocua/listeria grayi, 5. listeria ivanovii/listeria grayi, 6. Wei Shi listeria bacteria/listeria grayi, 7. Sai Shi listeria bacteria/listeria grayi, 8. blank.
Embodiment
One, frozen pipe is formed
The A pipe contains 10 * buffer (commercial), dNTP (commercial) for lyophilized powder; Primer (sequence is designed by the contriver, sees Table 1) LM, LN, LS, LVSW, LGU, Ld, lmo0038-1, lmo0038-2; Taq DNA polymerase (commercial).Be stored in-20 ℃.
The B pipe contains cracking buffer solution 1mL, is stored in-20 ℃.
The C-I pipe contains 0.5mL solution, is seven kinds of positive reference substances, is stored in-20 ℃.
The J pipe contains 0.58mL solution, is diluent.
Two, application of sample and the explanation of detection step
1,0.58mL solution in the J pipe is added to the A pipe, resuspended.
2, B is managed solution 10 μ L and add the PCR reaction tubes, once more positive contrast solution 5 μ L or sample to be checked in the C-I pipe (bacterium liquid or template all can) 5 μ L are added to same PCR reaction tubes, mix, at last the solution 5.8 μ L in 1 are added above-mentioned same PCR reaction tubes, detect immediately.
3, on the PCR instrument, increase by following reaction conditions 1: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 25 circulations; 72 ℃ of 5min.
4,, after Goldview dyeing, analyze with gel imaging system with 2 reacted products electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid.
Below by test result of use of the present invention is proved and described.
1 materials and methods
1.1 bacterial strain and cultivation
Listeria bacteria reference strain part is available from ATCC, NCTC and Nat'l Pharmaceutical ﹠ Biological Products Control Institute, and part is so kind as to give (seeing table 1 for details) by state-run veterinary institute doctor M.Jakobsen of Denmark.119 strains separate from Chinese Zhejiang, Fujian, Jiangsu and other places through the relevant strain isolated of listeria bacteria food that listeria bacteria selective coloration culture medium (CHROMagar, French Kerma (unit of kinetic energy) is good) preliminary screening goes out, and are preserved by zooprophylazis Institute for Medical Research of Zhejiang University.Gram-positive microorganism (the G nearer with the listeria bacteria sibship, that G+C content is low
+ Low) as bacillus cereus (Bacillus cereus), Bacillus anthracis (Bacillus anthracis), enterococcus faecalis (Enterococcusfaecalis), streptococcus aureus (Staphylococcus aureus), swine streptococcus (Streptococcus suis), streptococcus equi epizootic disease subspecies (C group) (Streptococcus.equi subspzooepidemicus), lactobacillus acidophilus (Lactobacillus acidophilus), lactobacillus curvatus (Lactobacillus crispatus) and other 12 kinds of negative control bacterial strains are also preserved (seeing table 1 for details) by this institute.Each inoculation is in 5mL BHI (DIFCO) substratum, and 37 ℃ of shaking culture are spent the night.
Table 1 listeria bacteria reference strain and negative control bacterial strain
1.2 dna profiling preparation
Get the 1mL culture, centrifugal collecting precipitation, behind distilled water (Millipore) purge, resuspended with equal-volume 2 * TZ and distilled water ,-20 ℃ leave standstill 45min.Effect is put immediately behind the 8min and is cooled off 7min in the ice bath in boiling water, 4 ℃ of centrifugal 1min of 12000rpm, get supernatant and be stored in-20 ℃ standby.
1.3 mouse LD
50
6-8 week ICR female mice in age (20-22g) adapts to and attacks poison after 3 days available from Zhejiang University of Traditional Chinese Medicine's Experimental Animal Center.Each bacterial strain is established 6 dosage groups, 6 every group.After the bacterium incubated overnight, 8000rpm is centrifugal to collect thalline, and (0.01M pH7.2) adjusts bacterial count to 10 with PBS
10About, and carry out a series of ten times of gradient dilutions, with the dosage abdominal injection of 0.1mL; Simultaneously, establish control group injection 0.1mL PBS, another control group is not injected.Attack the poison back and observed 10 days continuously, calculate the LD of each bacterial strain according to the mouse death rate of each group, by the improvement karber's method
50
1.4 the mensuration and the analysis of full gene of lmo0038 and both sides sequence thereof
The full length sequence of design primer amplification Listeria monocytogenes lmo0038 and listeria ivanovii homologous region (i-lmo0038).After purifying is reclaimed in the amplified production rubber tapping, be connected in the pMD18-T carrier according to T-A clone strategy, and the thermal shock method is transformed into competent escherichia coli cell DH5a.Recombinant plasmid is sent to the order-checking of Shanghai Ying Jun Bioisystech Co., Ltd with positive colony after identifying by PCR and EcoR I, HindIII double digestion.Check order row by Clustal X (version 1.8) software analysis.
The homologous region sequence of Listeria monocytogenes lmo0035-0042, lmo0029-0042 and other kinds increases by long range PCR, grows apart from enzyme (LA Taq DNApolymerase) available from TaKaRa Bioisystech Co., Ltd.Primer sees table 2 for details.
Table 2 primer sequence and product length (one)
Annotate: v represents that product length changes because of species are different
1.5 the PCR system is set up
1.5.1 design of primers
According to the lmo0038 complete sequence of measuring, design primer lmo0038-1/lmo0038-2.By analysis, and, design five upstream primers (LM, LN, LVSW, LGU, LS) and combine with downstream primer (Ld) competition with reference to pertinent literature to conserved regions and variable region in the iap sequence.Primer sequence sees table 3 for details.
1.5.2 PCR reaction system and condition
By the optimization of PCR system and condition, determine that the multi-PRC reaction system is: 10 * Taq Buffer (contains Mg
2+) 3 μ L, 10mmol/L dNTP Mix 0.6 μ L, each 0.6 μ L of 50 μ M primers, dna profiling (or bacterium liquid) 2 μ L, Taq DNApolymerase 0.8 μ L adds ddH
2O supplies volume to 30 μ L; Reaction conditions is: 95 ℃ of 3min; 95 ℃ of 45s, 62 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 5min.
1.5.3 the order-checking of PCR product is identified
By 1.3 described methods, the PCR product is cloned, checked order.
1.5.4 specificity test
, increase as negative control and blank with 20 kinds of bacteriums such as bacillus cereus, Bacillus anthracis, enterococcus faecalis, streptococcus aureus, swine streptococcus, streptococcus equi epizootic disease subspecies (C group), lactobacillus acidophilus, lactobacillus curvatus and distilled water with the PCR method of setting up.
1.5.5 sensitivity test
The reference strain of each kind of listeria bacteria in BHI after 37 ℃ of incubated overnight, get 1mL bacterium liquid centrifugal and with PBS (0.01M, pH7.2) resuspended, adjust bacterial concentration to 10
9CFU/mL (OD
600Be about 0.18-0.2), do 10 times of continuous gradient dilutions.Choose 10
-5, 10
-6, 10
-7, 10
-8Extent of dilution carries out plate count, and gets each dilution bacterium liquid and carry out the PCR detection.
1.5.6 anti-interference test
With any two or three listerial template (about 10
9CFU/mL) balanced mix, the former has 15 kinds of combinations, and the latter is totally 9 kinds of combinations, increases with the PCR system of setting up, and identifies multiple listerial ability simultaneously to determine this method.
1.6 the relevant strain isolated of food is identified
Food relevant strain isolated in the doubtful listeria bacteria of 119 strains separates sea-food, milk preparation, meat product, vegetables and food processing plant's utensil from the South China, sewage etc.These strain isolateds all detect with this test kit, and (Biomerieux France) identifies to use the API system simultaneously.
1.7 species confirmatory test
Choose 16S rRNA, 23S rRNA and Listeria monocytogenes specific gene hly, mpl, InlB, lmo0733 is a target gene, and bacterial strain to be checked and reference strain are carried out pcr amplification and order-checking.Sequence contrasts through NCBIBLAST, to prove conclusively the species of this bacterial strain.Primer sees table 2 for details.
1.8 application of sample and detection step
1.8.1 0.58 mL solution in the test kit D pipe is added to the A pipe, resuspended.
Add the PCR reaction tubes 1.8.2 B is managed solution 10 μ L, once more C pipe (or sample to be checked) 5 μ L are added to same PCR reaction tubes, mix, at last the resuspended solution 5.8 μ L of 1.6.1 are added above-mentioned same PCR reaction tubes, detect immediately.
1.8.3 1.6.1 is increased on the PCR instrument by following reaction conditions: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 40s, 72 ℃ of 50s, 30 circulations; 72 ℃ of 5min.
1.8.4, after Goldview dyeing, analyze with gel imaging system with the reacted product of 1.6.2 electrophoresis in 1% sepharose, 0.5 * tbe buffer liquid.
2 results
2.1 mouse LD
50
As shown in table 4, reference strain F2525,54006 is that low virulent strain is (to the LD of mouse
5010
8), and EGD, ScottA, 10403S are the standard virulent strain.
2.2 the mensuration and the analysis of its both sides sequence of the full gene of lmo0038
Listeria monocytogenes lmo0038 and listeria ivanovii homologous region (i-lmo0038) sequence total length are 1092bp, and homology is 83.9%.Lmo0035-0042 long range PCR amplification shows, two of Listeria monocytogenes virulent strain and listeria ivanoviis cause a disease to plant and can amplify the 7538bp band, Listeria monocytogenes low virulent strain and listera innocua all amplify the 876bp band and homology is 78.6-82%, all the other are planted does not all have amplification (Fig. 2,3); Lmo0029-0042 long range PCR amplification shows that Wei Shi listeria bacteria and Sai Shi listeria bacteria can amplify the 750bp band, and listeria grayi does not have any band amplification (Fig. 4).Each kind of above results suggest listeria bacteria be in the gene of this section difference of arranging, and lmo0038 exists only in and causes a disease kind.
2.3 multiplex PCR and test kit detected result
Utilize test kit that the reference strain of each kind of listeria bacteria is increased, as shown in Figure 5, the Listeria monocytogenes virulent strain can obtain the purpose band of 720bp and 403bp, and low virulent strain only obtains the 720bp band; Listera innocua can obtain the 986bp band, listeria ivanovii can obtain 1357bp and two bands of 403bp, the Wei Shi listeria bacteria can obtain the 1363bp band, and the Sai Shi listeria bacteria can obtain 1 108bp band, and form listeria bacteria and Mo Shi subspecies all obtain the 479bp band.
2.4 the order-checking of PCR product is identified
Pcr amplification product is after the BLAST comparison, and the result shows that the iap sequence of each kind and the homology of known array are 98.2%-100%; The homology of lmo0038 and known array is 100%, with the homology of i-lmo0038 sequence be 79.4% (still not having the i-lmo0038 sequence on the net).Show that this PCR method has higher accuracy.
2.5 specificity test
Utilize this test kit respectively 20 kinds of other bacteriums to be increased, the result shows no any band, shows that this PCR reaction amplification listeria bacteria gene fragment has good specificity.
2.6 sensitivity test
Utilize test kit that each dilution listeria bacteria bacterium liquid is detected, the results are shown in Figure 6-Figure 11.When containing respectively, each kind have an appointment 10
2During the CFU/mL bacterium, visible corresponding target band product shows that this method all can reach 10 to the susceptibility of each kind of listeria bacteria
2CFU/mL.
2.7 anti-interference test
Shown in Figure 12,13, after two kinds of listerial template balanced mix, 15 kinds of combinations all can amplify purpose band clearly simultaneously, do not produce interference.And, only can amplify less fragment with after three kinds of listerial template balanced mix, as the listerial iap fragment of lmo0038 Ji Geshi, so this method does not detect when being suitable for three kinds.
2.8 the relevant strain isolated of food is identified and the species conclusive evidence
In the food relevant strain isolated of 119 strains from the South China, evaluation by this test kit, 86 strains are Listeria monocytogenes, and wherein milk strain isolated mLm4 only amplifies iap band (Fig. 3), the iap band less (about 600-650bp) that Er salt baked chicken strain isolated L92 amplifies.LD
50Result's (table 4) shows, in 20 strain Listeria monocytogenes strain isolateds, except that mLm4 virulence and standard low virulent strain F2525,54006 quite, all the other are virulent strain, coincide with the test kit detected result.All the other 27 strains are listera innocua, and 1 strain is the Sai Shi listeria bacteria, and 1 strain is the Wei Shi listeria bacteria, and 4 strains are non-listeria bacteria.API result also meets fully with it.
Find that by the species confirmatory test mLm4, L92 all can amplify hly, the mpl identical with the Listeria monocytogenes reference strain, InlB, lmo0733 band, prove conclusively both and be Listeria monocytogenes.And PCR, order-checking and sequential analysis by 16S rRNA, 23S rRNA gene, 3 strains are enterococcus faecalis in the non-listeria bacteria of 4 strains, 1 strain is comparatively rare aerococcus viridans (Aerococcus viridans).Above result all confirms the reliability of this multiple PCR fast detection kit.
Table 3 primer sequence and product length (two)
Primer |
Goal gene |
Primer sequence 5 '-3 ' |
Product length (bp) |
LM (upstream) |
L.monocytogenes-iap |
CAAACTGCTAACACAGCTACT |
720? |
LN (upstream) |
L.innocua-iap |
ACTAGCACTCCAGTTGTTAAAC |
986? |
LS (upstream) |
L.seeligeri-iap |
TACACAAGCGGCTCCTGCTCAAC |
1108? |
LGU (upstream) |
L.grayi-iap |
CCTGCGAAACCAGCAGTTTCT |
479bp? |
LVSW (upstream) |
L.ivanovii,L.welshimeri,L.s eeligeri-iap | TAACTGAGGTAGCGAGCGAA | |
1,357-1,366? |
Ld (downstream) |
Listeria-iap |
TTATACGCGACCGAAGCCAAC |
? |
Lmo0038-1 (upstream) |
L.monocytogenes-lmo0038 L.ivanovii-lmo0038 homologue |
TTTCAATTATGTACGCCCAGGTGT |
403? |
Lmo0038-2 (downstream) |
? |
AATATTTCCGCCGCCAAGTAA |
? |
Table 4 Listeria monocytogenes reference strain and strain isolated source and mouse LD50
Bacterial strain |
The source |
1gLD50 |
EGD? |
Reference strain |
<7.04 |
ScottA? |
Reference strain |
6.79? |
10403S? |
Reference strain |
5.49? |
F2525? |
Reference strain |
8.10? |
54006? |
Reference strain |
8.35? |
fLml? |
Cooked beef |
6.26? |
fLm2? |
The young row of sauce |
6.45? |
fLm3? |
Raw pork |
6.07? |
fLm4? |
Vegetables |
6.11? |
mLm3? |
Raw material milk |
3.86? |
mLm4? |
Sterile milk |
8.14? |
mLm10? |
Sterile milk |
5.55? |
eLml? |
Sea-food processing ground sewage |
5.53? |
eLm2? |
The milk-producing tool surfaces |
6.46? |
eLm3? |
Milk processing plant's ground sewage |
6.43? |
eLm4? |
Milk processing plant's ground sewage |
6.32? |
eLm5? |
Homogeneous milk cylinder surfaces |
5.45? |
sLml? |
The American Red fillet |
6.74? |
sLm2? |
The American Red fillet |
6.19? |
sLm3? |
The American Red fillet |
6.72? |
sLm4? |
Peeled shrimp |
5.94? |
sLm5? |
Peeled shrimp |
4.40? |
sLm6? |
Peeled shrimp |
5.79? |
sLm7? |
Peeled shrimp |
5.08? |
sLm8? |
Peeled shrimp |
6.31? |
eLml? |
Sea-food processing ground sewage |
5.53? |