CN101027401A

CN101027401A - A method of producing a low molecular weight organic compound in a cell

Info

Publication number: CN101027401A
Application number: CNA2004800170986A
Authority: CN
Inventors: 乔尔根·汉森; 托马斯·安德森海威得; 芬·奥凯尔斯赛格
Original assignee: POALIS AS
Current assignee: POALIS AS
Priority date: 2003-06-19
Filing date: 2004-06-14
Publication date: 2007-08-29

Abstract

A method of producing a low molecular weight organic compound (e.g. a plant or bacteria secondary metabolite) in increased yields involving use of a microorganism cell, which comprises a gene involved in the biosynthesis pathway leading to a low molecular weight organic aglycon compound and a glycosyltransferase gene capable of glycosylating the produced aglycon.

Description

The method that in cell, prepares low molecular weight organic compound

Technical field

The present invention relates to the method for a kind of a kind of low molecular weight organic compound of preparation (for example a kind of plant or bacterium secondary metabolites), this method uses a kind of cell (a for example strain plant or a microorganism cells) that output is increased, contain a participation biosynthetic means in the cell and prepare the gene of the organic glycoside compound of lower molecular weight and the glycosyltransferase gene of the aglycone glycosylation ability that has the generation of making.

Background technology

Plant and microorganism are synthesized a large amount of nature materials, especially bacterium secondary metabolites, varied and usually not clear their function of these materials.Compare with major metabolite (for example amino acid, sugar, lipid acid), these major metabolite relate to for example metabolism of basic function, grow, keep and survive, for these basic function secondary metabolites not necessarily.As everyone knows, many secondary metabolites that come from plant are used as wormer or natural sterilant, be used to defend the herbivore attack or pass to insect (Grisebach as sex attractant, 1988, In:EuropeanConference on Biotechnology, Scientific, technical and industrialchallenges, Verona, Italy, 7-8 November 1998, pages 23-27), yet the secondary metabolites of fungi is usually as plant poison (Osboum, 2001, Proceedings of theNational Academy of the USA 98:14187-14188).

The different secondary metabolites that come from the different plant species of kind more than 100 are proved has very strong anti-microbial activity (Cowan, 1999, Clinical Microbiology Reviews 12:564-582), and a large amount of secondary metabolites that come from common food crop be not only cause distinguish the flavor of, the reason of color, promote healthy active (Eastwood but also be considered to have, 2001, Quarterly Journalof Medicine 94:45-48:Drewnowski ﹠amp; Gomez-Cameros, 2000, AmericanJournal of Clinical Nutrition 72:1424-1435).Therefore, in some different fields, for example as medicine, foodstuff additive, spices, pigment and sterilant, these nature materials have importance economically.

The common small amount of accumulation of secondary metabolites, and existing only in sometimes in the specific cell, therefore, their extraction meeting very difficulty and efficient is low.Improving although organic chemistry synthesizes, a large amount of secondary metabolites structures is very complicated, and with economic standard, they are impossible synthetic in reality.Yet, compare with the product of synthetic, usually the human consumer more is ready to accept natural product.Therefore, the Industrial products of these materials and their functional analogue depend on usually from plant and extract naturally.

Secondary metabolites belongs to low molecular weight organic compound usually from structure.

By biotechnology the Industrial products of secondary metabolites or other formation natural and non-natural low molecular weight organic compound are more prone to.The biosynthesizing of natural products, by the gene conversion, plant or microorganism can be prepared and be different from the compound of preexist in plant or organism.

Glycosyltransferase is defined as: it be a kind of transfer residual sugar (as semi-lactosi, aldopentose, rhamnosyl, glucose, arabinose, Portugal (grape) uronic acid, or the like) to the enzyme of acceptor molecule.Acceptor molecule can be other sugar, protein, grease and other organic substratum, and acceptor molecule is called as aglycone (aglycon is a glucose as fructose).Aglycone is defined as aglucone branch in the glycoside (glucosides).Glucosides is defined as having the organic molecule of Portugal's base group (deriving from the organic chemistry group of sugar or saccharan molecule), links to each other with having such as atoms such as oxygen, nitrogen or sulphur between Portugal's base group.

These are participated in different microorganisms method and process by glycosylated molecule.The part of Portugal's base shifts biological activity, solvability, stability, taste, smell and the transmission performance that can change acceptor, for example performance change in a strain plant and microorganism cells and whole plants.

This patent has been described a large amount of glycosyltransferases, and these glycosyltransferases can make the compound glycosylation, for example the secondary metabolites of plant and fungi (Paqudtte, S or the like, Phytochemistry 62 (2003) 399-413).

WO01/07631, WO01/40491 and (Arend, J etc., Biotech.﹠amp; What Bioeng (2001) 78:126-131) describe is a part of glycosyltransferase, and these glycosyltransferases have the relevant secondary metabolites that makes a large amount of different structures and the glycosylated ability of low molecular weight organic compound of other similar structures.

Therefore, when handling, the technician can utilize a large amount of glycosylated different sugar based transferases of low molecular weight organic compound that can make many different secondary metabolites and other structurally associated.

Tattersall, DB or the like, Science (2001) 293:1826-8, describe network propylhomoserin deutero-and give birth to whole synthetic methods that cyanogen is joined sugared dhurrin (a kind of secondary metabolites), it is transferred to model plant Arabidopis thaliana (Arabidopsisthaliana) plant from dichromatism chinese sorghum Sorghum plant (Sorghum bicolor).This synthetic all method comprises two genes that relate in the biosynthetic means (CYP79A1 and CYP71E1), with one can make last intermediate product (right-the hydroxybenzene hydroxyacetonitrile, p-hydroxymandelonitrile) glycosylation becomes glycosyltransferase (sbHMNGT) (see figure 1) of glucosides dhurrin.Prove that genetically modified arabidopsis thaliana has the ability that every gram net weight can generate 4 milligrams of dhurrins.

Arend, J etc., Biotech.﹠amp; Bioeng (2001) 78:126-131 and WO01/07631 have described the vegetative propagation of the glycosyltransferase that comes from snakewood (Rauvolfia serpentina) plant.Clone's glycosyltransferase is introduced in the intestinal bacteria (E.coli), when glucose Resorcinol, Vanillin and right-hydroxy acetophenone are added in the substratum of Bacillus coli cells of change, then corresponding glucosides, arbutin, Vanillin-D-glucosides and piceoside are synthesized out.They are also by in the substratum around being discharged into from cell.

Moehs, CP etc., Journal (1997) 11:227-236 has described the cDNA that is encoded to solanidine glycosyltransferase (SGT) and has separated from tomato.Join glycosides according to the steroid alkaloid glycosyl and have higher toxicity than its corresponding glycosylation form, cDNA uses the irritability method to be selected from a yeast storehouse, and reorganization generates SGT according to isolated genes, and the activity of clone SGT is checked by isolated experiment.

US6372461 has described and has a kind ofly introduced the gene that participates in biosynthetic means by using Bacillus coli cells to produce the method for secondary metabolites Vanillin in Bacillus coli cells, and this synthetic method is from glucose, to generating vanilla aldehydic acid.When containing glucose in the substratum, gene recombined escherichia coli can generate vanilla aldehydic acid.The vanilla aldehydic acid that produces regains from the substratum of fermentation, and is decomposed into Vanillin in the presence of the aromatic aldehyde desaturase.

Summary of the invention

By the problem to be solved in the present invention be, a kind of preparation method of special low molecular weight organic compound newly is provided, described method provides the possibility that obtains the higher output yield compound.

Wherein, this solution is based on present inventor's investigation and comparison, is two kinds of cultured microorganism below.

(i) microorganism that comprises a kind of gene, this gene participates in biosynthetic means, causes the generation of a lower molecular weight aglycone compound; And

(ii) identical microorganism, but also will introduce a glycosyltransferase gene, this gene have the ability of the aglycone that glycosylation generates, and obtain the corresponding glycosylation form of aglycone.

The present inventor finds in the cultivation and fermentation process, with do not having under the condition of glycosyltransferase, the quantity that is generated the glycosylation form of corresponding aglycone by microorganism is compared, and the microorganism that contains glycosyltransferase has the ability of glycosylation form of the aglycone of the bigger quantity of generation.Referring to illustrative embodiment here.

(a) the intestinal bacteria output more substantial Vanillin glucosides of the above-mentioned type in (ii), when it with do not have the glycosyltransferase existence condition under in corresponding Bacillus coli cells, generate corresponding Vanillin aglycon quantity when comparing (intestinal bacteria of the above-mentioned type (i)).

(b) the yeast cell output more substantial Vanillin glucosides of the above-mentioned type in (ii), when it with do not have the glycosyltransferase existence condition under in corresponding yeast cell, generate corresponding Vanillin aglycon quantity when comparing (yeast cell of the above-mentioned type (i)).

(c) the yeast cell output more substantial Protocatechuic Acid-β-D-glucosides (PAG) of the above-mentioned type in (ii) be not when having the quantity of corresponding Protocatechuic Acid (PA) aglycon that generates under the glycosyltransferase condition to compare with corresponding yeast cell (yeast cell of the above-mentioned type (i)).

(d) the yeast cell output more substantial dhurrin of the above-mentioned type in (ii), when not having the quantity of right-hydroxylphenylethyl alcohol nitrile (aglycon of dhurrin is seen Fig. 1) of producing under the glycosyltransferase condition to compare (yeast cell of the above-mentioned type (i)) with corresponding yeast cell.

(e) the yeast cell output of the above-mentioned type in (ii) is more substantial (for example right-glucosyloxy-phenylethyl alcohol by glycosylated compound, right-glucosyloxy-benzyl cyanide, right-glucosyloxy-phenyl aldehyde or Portugal's base be right-Para Hydroxy Benzoic Acid salt), these compounds are by the dhurrin biosynthetic means, when not having the quantity of the aglycone that produces under the glycosyltransferase condition to compare with corresponding yeast cell (yeast cell of the above-mentioned type (i)).

Therefore, the microorganism cells of the above-mentioned type in (ii) can be used to obtain the very glycosylation form of the corresponding aglycone of high yield.And, it also is used in the process of a preparation high yields of sugars basigamy glycosides, only be by first synthesis of glycoside aglucon by glycosylated form, regain it then, and according to the standard of experimental program (for example use enzymatic beta-glucosidase enzyme or by sufficient chemical hydrolysis) de-glycosylation.

Therefore, a first aspect of the present invention content relates to a kind of method that generates low molecular weight organic compound, may further comprise the steps:

A) a kind of microorganism cells of fermentation or a kind of fibrous fungal cell, cell comprises one and participates in biosynthetic means, generate the encoding gene of the product of a lower molecular weight aglycone organic compound, a glycosyltransferase with an allos glycosyltransferase gene coding, it has the glycosylated ability of aglycone of the generation of making, under suitable condition, described cell produces the glycosylation form of aglycone and corresponding aglycone; And

B) regain the glycosylation form of glycoside compound

(i) molecular weight of the organic glycoside compound of described lower molecular weight is 50-3000g/mol, and

(ii) described glycosyltransferase has the function that sugar is engaged to glycoside compound, and wherein sugar is chosen out from semi-lactosi, Portugal (grape) osamine, N-ethanoyl Portugal (grape) osamine, aldopentose, Portugal (grape) uronic acid, rhamnosyl and glucose.

A second aspect of the present invention content relates to a microorganism cells or fibrous fungal cell; comprise that participates in a biosynthetic means; generate the encoding gene of the product of a lower molecular weight aglycone organic compound; a glycosyltransferase with an allos glycosyltransferase gene coding; it has the product of making glycosyl and joins the glycosylated ability of glycosides; in cell; when in suitable substratum, fermenting; generate the glycosylated form of aglycone and corresponding aglycone; and wherein glycosyltransferase has the function that sugar is engaged to glycoside compound, and wherein sugar is from semi-lactosi; Portugal (grape) osamine; N-ethanoyl Portugal (grape) osamine; aldopentose; Portugal (grape) uronic acid; choose out in rhamnosyl and the glucose.

As above said, the basic principle of method described above is the aglycone (the surplus production of aglycone) that generates the high yield high benefit.

Therefore, a third aspect of the present invention content relates to a kind of a kind of method that generates the organic glycoside compound of lower molecular weight, may further comprise the steps:

A) a kind of cell of growing, cell comprises one and participates in biosynthetic means, generate the encoding gene of the product of a lower molecular weight aglycone organic compound, a glycosyltransferase with a glycosyltransferase gene coding, it has the aglycone glycosylation ability of the generation of making, under suitable condition, described cell produces the glycosylation form of aglycone and corresponding aglycone;

B) de-glycosylation of the glycosylation form of aglycone; And

C) regain glycoside compound;

(i) molecular weight of the organic glycoside compound of described lower molecular weight is 50-3000, and

(ii) described glycosyltransferase has the ability that sugar is engaged to glycoside compound.

Use the advantage of glycosyltransferase to be in the method, may further use the different characteristics of known sugars based transferase.For example, well-known, some glycosyltransferase tool enantiomorph specificitys (referring to for example, Jones, P etc., J.of Biological Chemistry (1999), 274:35483-35491 and WO03/023035).The result is that for example, if want to generate a special structure enantiomorph, for example an aglycone can select to use the such enantiomorph of glycosyltransferase so.

The 4th aspect content of the present invention relates to a method, and this method is that the step that comprises is as follows for the cell of the output of selecting a kind of glycosylation form that increases lower molecular weight organic sugar aglucon:

B) handle described cell, participate in the expression level that biosynthetic means generates at least one gene of lower molecular weight organic sugar aglucon and/or has the glycosylated glycosyltransferase gene of aglycone of the generation of making by changing, to make up a gene cell storehouse with different genes expression level; And

C) select a cell, compare, generate the glycosylation form of higher output yield aglycone with the cell in the step a);

(ii) described glycosyltransferase has the ability that sugar is become glycoside compound.

Described how to make in this way among the embodiment 8, made model plant Arabidopis thaliana (Arabidopsis thaliana plant) possess the ability that every gram nt wt net weight can generate more glucosides dhurrin.Initiator cell in the step a) is a model plant Arabidopis thaliana transgenic cell, and this is at document Tattersall, and DB etc. described among Science (2001) 293:1826-8.Above-mentioned model plant Arabidopis thaliana transgenic cell comprises the synthetic all method of cyanogenic glycoside dhurrin.Transgenosis model plant arabidopsis thaliana has confirmed that tool generates the ability of 4mg dhurrin from every gram nt wt net weight.After the system of selection that executes described in the embodiment 8, select a model plant Arabidopis thaliana transgenic cell according to step c), every gram nt wt net weight can generate the 6mg dhurrin.

Be not limited to theory, we believe that this transgenic plant are for the first time to be provided out, and this transgenic plant can generate greater than the 4mg product from every gram nt wt net weight of the glycosylation form of an organic glycoside compound of lower molecular weight.

Therefore, a fifth aspect of the present invention content relates to transgenic plant, and it has the ability that generates the 5mg product from every gram nt wt net weight of the glycosylation form of an organic glycoside compound of lower molecular weight,

(i) molecular weight of the organic glycoside compound of described lower molecular weight is 50-3000.Definition

Before specific embodiment is discussed, provide a definition that relates to the concrete term of main aspect content among the present invention.

Term " aglycone " (aglycon) is represented the aglucone branch of the corresponding glycosylation form of aglycone.It also can be defined as the acceptor compound that can engage with sugar.In a large amount of relevant embodiment, aglycone is one and is fit to by glycosylated alcohol with oh group.For example right-hydroxylphenylethyl alcohol nitrile (see figure 1), it has an oh group, can become (glycosylation) dhurrin in the presence of glucose.(described dhurrin be aglycone right-the corresponding glycosylation form of hydroxylphenylethyl alcohol nitrile).In this embodiment, sugar wherein is if glucose, and the term of " aglycone (aglycon) " can be " aglycon (aglucone) ".In addition, when sugar is glucose, term uses " glucosyl (glucosylated) ", replaces term " glycosylation (glycosylated) ".

Except hydroxyl, aglycone also can be at different groups by glycosylation, especially other nucleophilic groups, for example carboxylic acid, SH-, nitrogen, amine, imines or C-C group.

Term " participates in biosynthetic means; generates the encoding gene (gene encoding a product involved in thebiosynthesis pathway leading to a low molecular weight aglyconcompound) of the product of a lower molecular weight aglycone organic compound " according to this patent, should be understood that the encoding gene of the product of a biosynthetic means that participates in a lower molecular weight aglycone compound of generation.The product of genes encoding is polypeptide normally.If yet influencing genetic expression, this product also can be the RNA molecule.The product of coding can be participated in biosynthetic means directly or participate in indirectly, for example passes through other precursor or media.Important problem is, and is as described herein-in, and the independently support of accurate mechanism is arranged, and for this cell, gene can synthesize the glycoside compound of doubled amount.This patent is described the suitable embodiment of a large amount of these genoids, just for an embodiment is described, the CYP71E1 that comes from dichromatism chinese sorghum Sorghum plant, from right-hydroxy phenyl acetonitrile, it participates in biosynthetic means, generate lower molecular weight aglycone compound right-hydroxylphenylethyl alcohol nitrile (referring to Fig. 1 and Tattersall, DB etc., Science (2001) 293:1826-8).What other embodiment described is the gene that participates in biosynthetic means, generates lower molecular weight aglycone compound Vanillin by biosynthetic means, as described in an embodiment.

Energy hydrolysis of term " glucosides (glycoside) " expression goes out the compound of sugar and non-sugar (aglycone) resistates, and for example glycoside hydrolysis goes out glucose, and the galactoside hydrolysis goes out semi-lactosi.

One of term " glycosyltransferase (glycosyltransferase) " expression has the glycosyltransferase that sugar is engaged to the ability of aglycone.Described sugar can be D and L type isomer, Portugal (grape) osamine, N-ethanoyl Portugal (grape) osamine, aldopentose, Portugal (grape) uronic acid, rhamnosyl, arabinose, seminose or the glucose of for example semi-lactosi.Alternate sugar can be carbohydrate derivative, and for example inose, D-olive sugar, rose brown sugar and other are available, as the Nucleotide bisphosphate.Another kind of sugar, for example monose, disaccharides or trisaccharide.Under the situation of oligomer of saccharan or sugar, sugar is for example comprised and uses one or more glycosyltransferases by coupling together one by one.In addition, a series of suitable sugar can be referring to the chart among the US2003/0130205A1 [0029] to [0036].As fructose is glucose, and the term of glycosyltransferase " glycosyltransferase " can be Transglucosylase " glucosyltransferase ".

Term in the step a) of third aspect content " a kind of cell of growing (growing a cell) " should extensively be interpreted as a kind of cell of growing in a suitable environment (temperature, nutriment etc.) that allows cell to grow.For example, if cell is a vegetable cell, mean that the growing plants cell is to be grown in the sophisticated plant of a strain.If cell is a microorganism, for example microorganism cells ferments in suitable substratum, and microorganism is fit to growth in substratum.

First aspect present invention content step b) term in " regaining the glycosylation form (recovering the glycosylated form of the aglycon compound) of glycoside compound " " regains (recovering) " and third aspect content step c) term mentioned in " regaining glycoside compound (recovering the aglycon compound) " " regains (recovering) ", should be interpreted as widely and from cell, be regained compound, perhaps from float over substratum upper strata liquid, obtain again, cell is fermented in substratum, in order to obtain than purer product in previous " regaining " step.Regain step and comprise more or less detailed purifying step.Alternatively, to a certain degree, regain step after, compound contains the composition of at least 4% (w/w), the compound of preferred at least 10% (w/w), even can reach the compound of at least 20% (w/w), most preferred reaches 50% (w/w) at least.The technician recognizes that suitable purification scheme (as using enough decontaminating columns) can obtain the purity of being expected.After preferably regaining step, regains the 10mg compound to I haven't seen you for ages, the preferred 1g compound that regains to I haven't seen you for ages preferredly regains the 10g compound to I haven't seen you for ages, most preferredly regain the 500g compound to I haven't seen you for ages, preferably can regain 10mg to the 100kg compound.What describe below is the specific embodiment of the present invention, only passes through the mode explanatory view of embodiment

Description of drawings

Fig. 1: the synthetic method of expression network propylhomoserin deutero-cyanogenic glycoside dhurrin (secondary metabolites).Synthetic method comprises two genes that participate in biosynthetic means (CYP79A1 and CYP71E1) and can make last intermediate product (right-the hydroxylphenylethyl alcohol nitrile) glycosylation, obtains the glycosyltransferase (sbHMNGT) of glucosides dhurrin.

Embodiment

Cell

Inventing the cell that the 3rd aspect content step be fit to growth in a) is any suitable cell, for example the cell eucaryon state or protokaryon arbitrarily.Preferredly from vegetable cell, fibrous fungal cell and microorganism cells, choose.

As mentioned above, a major advantage using described cell is the glycosylation form that can obtain the aglycone of higher output yield (doubling output), the de-glycosylation step of the glycosylation form by suitable aglycone obtains the aglycone of higher output yield (doubling output).

Therefore in process of growth, a kind of preferred cell is in the presence of glycosyltransferase, compare with the quantity in the glycosylation form of the corresponding aglycone that does not have cells produce under the condition of glycosyltransferase, it has the ability of the glycosylation form of the aglycone that generates greater amt.

When cell is microorganism cells, cell is represented as microorganism cells, in the process of cultivation and fermentation, under the existence condition of glycosyltransferase, compare with the quantity in the glycosylation form of the corresponding aglycone that does not have same microorganism cells produce under the condition of glycosyltransferase, microorganism cells has the ability of the glycosylation form of the aglycone that generates greater amt.

Preferable cell (especially microorganism cells), when comprising glycosyltransferase, the quantity of the glycosylation form of the aglycone that should produce is 1.1 times of the quantity of the glycosylation form of the corresponding aglycone that does not have same microorganism cells produce under the condition of glycosyltransferase at least, the glycosylation form of the aglycone of preferred production at least 1.25 multiple amounts, the glycosylation form of the aglycone of preferred production at least 1.5 multiple amounts, the glycosylation form of the aglycone of most preferred production at least 2 multiple amounts.

Major advantage of the present invention relates to the glycosylation form that can double to produce aglycone, so the technician also should understand the term of the glycosylation form higher output yield that relates to aglycone like this.Therefore, the higher output yield of the glycosylation form of aglycone accumulates in cell, regains in this cell, for example obtains after the cytolysis.Alternate, the glycosylation form of aglycone can secrete from cell, and accumulates in substratum, and when cell was microorganism cells, the latter was especially relevant.

According to the present invention, the plant that contains vegetable cell that provides also can be the seed that above-mentioned plant produces.

In the preferred implementation of the present invention, above-mentioned plant chooses from following these plant speciess, these plants comprise: cereal (Zea mays Zea), rape (blue type rape, the turnip Btassica), alfalfa (clover man lettuce), rice (paddy rice), rye (rye grass), the plant of sorghum (sorghum amphichrome, sorghum), Sunflower Receptacle (the annual gold-and-silver flower of Sunflower Receptacle belongs to), wheat (summer wheat and other kinds), triticale, rye (rye), soybean (big shield beans), tobacco (tobacco leaf), potato (nightshade stem tuber), peanut (Semen arachidis hypogaeae underground part), cotton (cotton hirsutum), sweet potato (impomoea sweet potato), cassava (manihot edible part), coffee (cofea), coconut (coconut nut), pineapple (golden-rimmed pineapple), the plant of citrus (plant of citrus), cocoa beans (cocoa beans), tea tree (camellia), banana (bajiao banana kind), avacado (U.S.'s avocado Persea), Fructus Fici (ficus carica), piscidia (Psidium), mango (mango), olive (Fructus oleae europaeae sweet-scented osmanthus genus), papaya (papaya), cashew nut (all sons), macadamia (macadamia jackfruit), apricot (first tonsilla), apple (Malus), pear tree (pear), plum and berry tree (Prunus), the plant (Ribes nigrum L. or the like) that the Saxifragaceae ribes belongs to, Vitis, Jerusalem choke (Halimium), non-cereal grass (careless family), sugar and forage beet tails (beta vulgaris), witloof, oat, barley, vegetables and ornamental plant.

Preferred, plant of the present invention is crop plants (for example cereal and bean, corn, wheat, potato, cassava, rice, sorghum plant, grain, cassava, barley, pea, beet tails, sweet rattan, soybean, Semen Brassicae campestris, Sunflower Receptacle and other root, stem tuber or seed farm crop).Other important plants can be the trees in fruit tree, farm crop tree, the forest or be used as spices or the plant (Mentha, cloves, artemisia, Thymus, lavender kind, allium, hypericum, Vinca, the climing kind in Changchun, papaver, purple foxglove kind, rawolfia, vanilla kind, petrusilium, eucalyptus kind, tea tree, picea, pineal gland, Abies, Juniperus Linn.) of accent medicine.Can comprise lettuce, witloof for gardening plant of the present invention, the plant rape comprises Caulis et Folium Brassicae capitatae, cabbage, stem flower, Radix Dauci Sativae, carnation and Flos Pelargonii.

The present invention can be applied to tobacco, cucurbit, Radix Dauci Sativae, strawberry, Sunflower Receptacle, tomato, pepper powder, chrysanthemum.

The cereal grass that provides the seed of usefulness comprises Semen Brassicae campestris plant and leguminous plants.Useful seed comprises the cereal seed, the for example plant of corn, wheat, barley, nee, sorghum, rye or the like, the Semen Brassicae campestris plant comprises cotton, soybean, safflower, Sunflower Receptacle, rape, corn, alfalfa, palm, coconut or the like, leguminous plants comprises beans and Peas, and steamed buns stuffed with sweetened bean paste is drawn together guar-bean, cicada beans, Semen Trigonellae beans, soybean, string bean, cowpea, mung bean, lima bean, broad bean, root of Szemao crotalaria, garbanzo.

In another concrete embodiment of the present invention, above-mentioned plant can be selected from following plant: corn, rice, wheat, beet tails, sweet rattan, tobacco, Semen Brassicae campestris, potato and soybean.

The whole genomic sequence of model plant Arabidopis thaliana is arranged (Paquette, S. etc., Phytochemistry62 (2003) 399-413).Therefore, possessed detailed understanding, so preferred at work this vegetable cell for this plant.

Therefore, a kind of preferred vegetable cell is an arabidopsis cell, especially the model plant arabidopsis cell.

Fibrous fungi comprises that to be subdivided into all filamentous forms of Mycophyta (Eumycota) and oomycetes door (Oomycota) (defined as Hawksworth etc.1995，supra)。The feature of fibrous fungi is a kind of plant mycelium, comprises chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans and other complicated saccharans, and plant-growth is the elongation of mycelia, and the katabolism of carbon relies on oxygen.Opposite, by the plant-growth of fermentation, for example yeast saccharomyces cerevisiae is to grow by unicellular thallophytic germination, the katabolism of carbon has fermenting power.

In a preferred embodiment, fibrous fungal cell is the cell of a class, but Acremonium (Acremonium), aspergillus tubigensis (Aspergillus), reaping hook mould (Fusarium), humic bacterium (Humicola), white mould (Mucor), myceliophthora (Myceliophthora), neurospora (Neruospora), Penicillium notatum (Penicillium), Thielavia, particle mould (Tolypocladium) and palisade mould (Trichoderma) or evolution variant or synonym without limits.

Preferred microorganism cells is applicable to the described method of this patent, and microorganism cells is selected from the group that comprises yeast cell and prokaryotic cell prokaryocyte.

Preferred yeast cell is selected from the group that comprises ascomycetes (Ascomycetes), courage bacterium (Basidiomycetes) and imperfect fungi (fungi imperfecti), and ferment order cell preferably is selected from comprise ascomycetous group.

Preferred ascomycetous yeast cell is from comprising A Shu capsule mould (Ashbya), Botryoascus, genera cryptococcus (Debaryomyces), Hansenula (Hansehula), Crewe Fu Shi yeast belong (Kluveromyces), saccharomyces oleaginosus belongs to (Lipomyces), yeast belong (Saccharomycesspp.) (yeast saccharomyces cerevisiae [Saccharomyces cerevisiae] for example, Pichia [Pichiaspp.], the saccharomyces hominis belongs to [Schizosaccharomyces spp.]) in choose.

Preferred yeast cell is selected from by yeast belong, for example the group of yeast saccharomyces cerevisiae and Pichia composition.

In the described method of this patent, cell very preferably is a prokaryotic cell prokaryocyte, and preferred prokaryotic cell prokaryocyte is to choose from the group that comprises genus bacillus (Bacillus), streptomycete (Streptomyces), club shape bacterium (Corynebacterium), pseudomonas (Pseudomonas), milk-acid bacteria (lactic acidbacteria) and especially intestinal bacteria (E.coli).

Preferred genus bacillus is Bacillus subtilus (B.subtilis), genus bacillus or Bacillus licheniformis (B.amyloliquefaciens or B.licheniformis).

Preferred streptomycete is S.setonii.

Preferred club shape bacterium is L-glutamic acid bacterium (C.glutamicum).

Preferred pseudomonas is pseudomonas or Pseudomonas fluorescens (P.fluorescens).

Preferred cell is not have active cell, and a beta-glycosidase of at least some genes encodings, and it makes the glycosylation form de-glycosylation of glycoside compound of the doubled amount of generation, and is as described herein-in.In addition, compare with the cell that only can carry out glycosylation, preferred cell comprises permease or other transfer proteins, and it can make cell discharge or secrete glucosides to substratum, or to volume inside.

As previously described, to transfer in the cell be technician's routine work to the DNA that will comprise carrier.Appropriate carriers can be configured, and contains suitable regulating and controlling sequence, comprises initiating sequence, terminator sequence, poly adenosine sequence, enhancement sequences, marker gene and other suitable sequences.For further describing, (1989) Molecular cloning such as Sambrook for example: laboratory operation handbook, ColdSpring laboratory, Cold Spring Harbor, NY; Ausubel, F.M. etc. (eds.)." Current protocols in Molecular Biology " .John Wiley and Sons, 1995:Harwood, C.R, and Cutting, S.M. (eds) " Molecular BiologicalMethods for Bscillus ".John Wiley and Sons, 1990.

About the embodiment of suitable vegetable cell carrier and suitably the plant transfer techniques with reference to WO02/103022.About fibrous fungal cell with reference to EP869167.

Preferably, described cell is the cell of expressing heterologous glycosyltransferase gene in cell, especially microorganism cells or fibrous fungal cell, their expressing heterologous glycosyltransferase genes.

In this relation, according to present technique, term " allos glycosyltransferase gene heterologousglycosyltransferase gene " should be understood that to be introduced into the glycosyltransferase gene in the cell, before introducing, does not express glycosyltransferase gene.

Alternate saying, glycosyltransferase gene be by cell generate naturally and interior growth glycosyltransferase gene.

Glycosyltransferase

As mentioned above, the invention describes the glycosylated a large amount of glycosyltransferases of the low molecular weight organic compound that can make doubled amount, for example the secondary metabolites of plant and fungi.According to the sequence alloplasm that is sorted genome plant model plant Arabidopis thaliana DNA, we can believe contains about 100 kinds of different glycosyltransferases at present.These glycosyltransferases and other a large amount of glycosyltransferases are at Paquette, and S. etc. analyze in Phytochemistry62 (2003) the 399-413 document and sum up.Fig. 1 of this paper provides a large amount of suitably so-called many organisms relational trees of glycosyltransferase title.

WO01/07631, WO01/40491 and (Arend, J etc., Biotech.﹠amp; Bioeng (2001) 78:126-131) described at least some and can make a large amount of different structure secondary metabolites and the glycosylated glycosyltransferase of other structure low molecular weight organic compounds.

On the other hand, the suitable sequence of a large amount of glycosyltransferases can find in Carbohydrate-ActiveenZYmes (CAZY) database.In the CAZY database, the website of link archive files of the present invention is http://afmb.cnrs-mrs.fr/CAZY/index.html.

In the CAZY database, comprise from all of reality and can find suitable glycosyltransferase sequence animal, insect, plant and the microbe species.

Therefore, the technician is when handling, and he can utilize has the different sugar based transferase that makes many different secondary metabolites and other low molecular weight organic compound glycosylation abilities in a large number.This fact further describes by the embodiment of some specific illustrative.

Though it is relevant with concrete substrate material that glycosyltransferase is considered to usually, if introducing enzyme, the substrate material that then shows other can be processed under effective standard, show that Ah cloth belongs to the sorghum plant in (Arabidopsis), expression by reaction CYP79A1 generates right in a large number-hydroxy phenyl Portugal (grape) glucosides ester, and reaction can not generate Ah cloth usually and belong to (Arabidopsis) glucosides ester (Bak or the like, 2000, Plant Physiology 123:1437-1448).New glucosides ester is generated by right-hydroxy phenyl ethylidenehydroxylamine (p-hydroxyphenylacetaldoxime), the network propylhomoserin obtains right-hydroxy phenyl ethylidenehydroxylamine by CYP79A1 reaction, is directed to subsequently in biosynthetic means and the relevant glycosyltransferase under existing prior to the glucosides ester.

And, glycosyltransferase, red bayberry synthase (arbutin synthase), separate from medicine plant Rauwolfia (tropical poisonous plants), show with natural Resorcinol and compare, it has sizable activity (Arend or the like, 2001, Biotechnology andBioengineering76:126-131) for other substrate materials.When some substrate materials, for example Vanillin or right-glycoloyl benzene are put into the intestinal bacteria that have been designed and are cultivated, and express the plant glycosyltransferase, and substrate material is converted to corresponding glucosides, Vanillin-β-D-glucosides and cloud shirt glycosides.These two products discharge from bacterium subsequently, and the both has economic benefit.

These embodiment show that Transglucosylase can work to substrate material, and substrate material wherein is non-existent in the metabolism reaction, causes the formation of the glucoside of new natural product.

As mentioned above, the technician is when handling, and he can utilize many different sugar based transferases that make a large amount of different secondary metabolites and other low molecular weight organic compound glycosylation abilities that have.In addition, he utilizes known ordinary method, is easy to determine to make the glycosylated glycosyltransferase that is more suitable for of low molecular weight organic compound of doubled amount.Be the embodiment of some proper methods below.

Many known DNA transferase sequences are used to produce the new glycosyltransferase of suitable substance P CR introduction clone, and the step that this method comprises is as follows:

(a) prepare a cDNA storehouse, come from a cell (as plant tissue cell), express Transglucosylase,

(b) use relevant known dna glycosyltransferase sequence, produce suitable substance P CR introduction, amplify the Transglucosylase cDNA of the part in the cDNA storehouse,

(c) use the DNA that obtains in the step (b) as detector screening DNA storehouse, dna library is that the Transglucosylase by cell expressing makes up, and

(e) definite and purification carrier DNA, it comprises the reading frame of an opening, the useful Transglucosylase of encoding.

Alternate, suitable Transglucosylase can determine that suitably clone's scheme of expressing comprises following steps by using so-called cloning by expression scheme:

(b) in the express cell of growth, by using an expression vector express cell is introduced in the cDNA storehouse, carrier makes cDNA express (transcribe and translate);

(c) grown cell in substratum, described substratum comprises the organic glycoside compound of lower molecular weight of deleterious doubled amount and (can grow as a special independent cell, cell comprises the Transglucosylase of an expression, and Transglucosylase has the glycosylated ability of the aglycone of the doubled amount of making);

(d) separate the cell of one or more growths, and determine the cell that to express useful Transglucosylase.

As document Moehs, CP etc., Plant Journal (1997) 11:227-236 is described, and this cloning by expression scheme can realize by using yeast cell.The present invention proves, and is littler than the toxicity of corresponding aglycone for the glycosylation form of bacterium aglycone, and therefore, the cloning by expression scheme can realize by bacterial cell, for example intestinal bacteria.

Therefore, an independent aspects content of the present invention is related to the cloning by expression method that obtains useful glycosyltransferase, and the step that comprises is as follows:

(b) in the useful express cell of growth, by using an expression vector express cell is introduced in the cDNA storehouse, carrier makes cDNA express (transcribe and translate);

Preferably, the bacterial expression cell in the step (b) is a Bacillus coli cells.

An advantage of above-mentioned cloning by expression scheme is the Transglucosylase that it can directly obtain making the aglycone glycosylation ability of doubled amount.

Preferably; glycosyltransferase has the ability that sugar is engaged to glycoside compound, and wherein sugar is to choose from the group of containing semi-lactosi, Portugal (grape) osamine, N-ethanoyl Portugal (grape) osamine, aldopentose, Portugal (grape) uronic acid, rhamnosyl, arabinose, seminose and glucose.

In another desirable embodiment, glycosyltransferase is the NDG-glycosyltransferase.This glycosyltransferase is determined and is present in plant, animal, fungi, bacterium and the virus.The feature of this glycosyltransferase is, by using the active sugared moeties of NDP-as the donor molecule and contain the UGT-definition preface structure of a transformation near the C-end points.

In a preferable embodiment, glycosyltransferase is a UDPG-Transglucosylase (UGT).The UGT glycosyltransferase is determined and is present in plant, animal, fungi, bacterium and the virus.The feature of these glycosyltransferases is by using the active sugared moeties of UDP-as the donor molecule and contain the UGT-definition preface structure of a transformation near the C-end points.In order to further describe the definition of relevant UDPG-Transglucosylase, referring to (Paquette, S. etc., Phytochemistry62 (2003) 399-413).

Preferably, described glycosyltransferase can be engaged to aglycone to monose or disaccharides.Most preferred glycosyltransferase can be engaged to aglycone to monose.

One preferred embodiment in, glycosyltransferase (glycosyltransferase) is Transglucosylase (glucosyltransferase).

That describe below is the embodiment of some suitable glycosyltransferases.

WO01/40491 describes the clone of the glycosyltransferase that comes from dichromatism chinese sorghum Sorghum plant, and glycosyltransferase is named as sbHMNGT.Described in the WO01/40491 this has with relevant homologous glycosyltransferase makes the glycosylated ability of the organic glycoside compound of the lower molecular weight of enumerating at least below, (referring to the table 3 of WO01/40491).

Cyanalcohol

1) mandelonitrile

2) right-hydroxylphenylethyl alcohol nitrile

3) acetone cyanohydrin

The phenmethyl derivative

4) Resorcinol

5) phenmethyl alcohol

6) right-hydroxybenzene methyl ethanol

7) M-nitro benzoic acid

8) right-Para Hydroxy Benzoic Acid

9) right-hydroxyl benzaldehyde

10) gentisinic acid

11) coffic acid

12) 2-hydroxy styrenes acid

13) trans-resveratrol (stilbene)

14) Whitfield's ointment

15) right-hydroxy phenyl oxyacetic acid

16) vanilla aldehydic acid

17) Vanillin

18) 2-hydroxyl mehtoxybenzyl ethanol

Flavonoid compound

19) quercetin, quercetin (flavonol)

20) cyanogen element (cyanidin(e))

21) biochanin (isoflavones)

22) naringenin (flavanone)

23) apigenin (flavones)

The hexanol derivative

24) 1-hexanol

25) trans oneself-1-alcohol

26) cis oneself-1-alcohol

27) the 3-methyl oneself-1-alcohol

28) the 3-methyl oneself-1-alcohol

29) indolylacetic acid (plant hormone)

30) Geraniol (monoterpenoid)

31) tomatidine (alkaloid)

32) vernol

33) right-geraniol

Arend, J etc., Biotech.﹠amp; Bioeng (2001) 78:126-131 describes the clone who comes from plant snakewood glycosyltransferase.It has the organic phenose aglucon of the lower molecular weight of enumerating at least below compound glycosylation ability that makes, (referring to table 1):

Resorcinol, Vanillin, salicyl alcohol glucoside, Resorcinol, thymol, phenol, methylvanillin, right-glycoloyl benzene, vanillic acid, right-methoxyphenol, 3,4-syringol, coniferyl, neighbour-coumaric acid, right-coumaric acid.

WO01/59140 describes the glycosyltransferase that comes from the model plant Arabidopis thaliana, and it has the glycosylated ability of enumerating at least below of the organic glycoside compound of lower molecular weight that makes: coffic acid, digicitrine, quercimentin class, catechol, syadinin.

WO02/103022 describes the glycosyltransferase that comes from the model plant Arabidopis thaliana, and it has the glycosylated ability of enumerating at least below of the organic glycoside compound of lower molecular weight that makes: the benzoate substrate material, and especially right-Para Hydroxy Benzoic Acid.

WO03/02035 describes the glycosyltransferase that comes from the model plant Arabidopis thaliana, and it has the glycosylated ability of enumerating at least below of lower molecular weight organic sugar aglucon plant hormone compound that makes: dormin.

What describe below is the suitable experiment that is used to test glycosyl transferase activity.That experiment is described is Transglucosylase (glucosyltransferase).Yet, when sugar is not glucose, should use competent sugar (for example semi-lactosi) to replace glucose.

In test experiments, the test glycosyltransferase may further comprise the steps the embodiment that the aglycone of doubled amount changes into the ability of glucose:

A) cultivate ¹⁴The reaction mixture of C_UDP-glucose, aglycone and UDP glucose: aglycone-glycosyltransferase reacted 2 minutes to 2 hours at 30 ℃;

B) termination reaction, and

C) glucosides of chemical identification and quantification generation.

The volume of typical reaction mixture is 5-2000 μ l, but preferred 20 μ l comprise 10-200mM TrisHCL (pH7.9); 1-5 μ M ¹⁴C_UDP-glucose (about 11.0GBq mmol-1); 0-300 μ MUDP-glucose; The 0-20mM aglycone; 25mM γ-glucono-lactone; 0-2 μ g/ μ lBSA and 0-10ng/ μ lUDP-glucose: aglycone-glycosyltransferase.β-Portugal (grape) glycosidase inhibitor that may suitably be added is different from γ-glucono-lactone and protein stabilizing agent, is different from BSA.May termination reaction by acidified reaction mixture, for example add 10% acetate of 1/10 volume.

The glucosides that can use several different methods chemical identification and quantification to generate in reaction mixture comprises the use that mixes that NMR wave spectrum, TLC analyze, HPLC analyzes or GLC analyzes and multiple other Spectrum Analysis are suitable.

By NIVIR Spectrum Analysis reaction mixture, usually cumulative volume is 0.5-1ml, cultivated 2 hours, the aglycone that contains 0-10mM, for example 2mM right-hydroxyl-mandelonitrile or 6.5mM Geraniol, 3mM UDP-glucose, 2.5 μ g Transglucosylases (gluceryltransferease), 0.5mg BSA.For example use the ethyl acetate extraction glucosides, and freeze-drying before NMR analyzes.

For using the TLC analytical procedure, reaction mixture will offer silicon gel slab (Silica Gel) 60F254 (Merck), dry and cultivation, for example ethyl acetate in solvent: acetone: methylene dichloride: methyl alcohol: H ₂O (40: 30: 12: 10: 8v/v).At ambient temperature, dring silicon gel slab 1 hour is with being exposed to before the PhosphorImager scanning on the storage phosphorus imaging plate.Based on the special radioactivity of the UIDP-glucose of radio-label, the glucosides that reaction generates is quantized.Radioactivity also can be measured (LSC analysis) by liquid scintillometer.In some cases, glycosyl is formed by the hydrophobic aglycone, mandelonitrile for example, and glucosides can be extracted to the ethyl acetate phase, in therefore can never being included in ¹⁴Separate in the C_UDP-glucose.In per 250 μ l acetic acid ethyl acetate extracts, add 2ml flicker conversion fluid, use liquid scintillometer to analyze.In the volume fractionation process, those contain the active fraction of glycosyltransferase (gluceryltransferease) and can use the aglycone substrate material of doubled amount and the ethyl acetate extraction agent of generation glucosides to identify.

Described glycosyltransferase gene is incorporated in the cell, and in order to express allos glycosyltransferase gene, especially a microorganism cells or fibrous fungal cell at cell within a cell, they express an allos glycosyltransferase gene.

Alternate saying, glycosyltransferase gene produce and interior growth in cell naturally.

In addition, introducing makes glycosyltransferase accelerate express or increase the gene of output, for example the inhibitor of the protein of genes encoding regulation and control, proteinase inhibitor, proteinase gene, improve the standard or the gene of precursor, especially relevant NDP-sugar, participate in the metabolic gene of NDP-, permease and other transmission enzyme, reduce metabolic gene of aglycone or the like.

Participate in the gene of biosynthetic means

As mentioned above, according to the present invention, term " participates in biosynthetic means, generates the encoding gene of the product of a lower molecular weight aglycone organic compound " " gene encoding a productinvolved in the biosynthesis pathway leading to a low molecularweight aglycon compound " and is construed as the gene that a coding participates in biosynthetic means, generates the product of lower molecular weight aglycone compound.

This patent has been described a large amount of suitably embodiment of genes, and quantity is the index multiple and increases, because the whole genome of a large amount of different plant and microorganism is constantly coming forth.

Embodiment can reference " Biochemistry ﹠amp; Molecular Biology ofPlants "; edited; ISBN 0-943088-37-2 the 24th chapter by people such as Bob B.Buchanan: " nature product (secondary metabolites) " described and participated in the embodiment that biosynthetic means generates the suitable gene of a large amount of differences of lower molecular weight aglycone compound.

One of them embodiment illustrates in the CYP71E1 of dichromatism chinese sorghum Sorghum plant, from participating in biosynthesizing reaction pair-hydroxy phenyl acetonitrile, generate lower molecular weight aglycone compound right-the hydroxylphenylethyl alcohol nitrile is (referring to Fig. 1 and Tattersall, DB etc., Science (2001) 293:1826-8).

Another embodiment describes and participates in the gene that biosynthetic means generates lower molecular weight aglycone compound Vanillin, and another embodiment is at Szczebara etc., and Nature Biotechnology (2003) describes among the 21:143-149.Present technique has been described has the recombinant yeast cell that generates hydrocortisone from single carbon source.In biosynthetic means, yeast cell comprises the introducing gene of eight reorganization.

As mentioned above, the technician can utilize a large amount of different biosynthetic means genes when handling.On the other hand, he uses known conventional process can be easy to differentiate the gene that is more suitable for biosynthetic means.For example, use the gene order of numerous biosynthetic meanss to prepare suitable substance P CR introduction, clone the gene of the suitable biosynthetic means that makes new advances again.The method includes the steps of:

(a) prepare a cDNA storehouse from a cell (for example plant tissue cell), the gene of the biosynthetic means that described cell expressing is useful,

(b) use the gene order of corresponding known biosynthetic means, preparation suitable substance P CR introduction, with the biosynthetic means gene of the cDNA in amplifier section code cDNA storehouse,

(c) use DNA that step (b) obtains as detector screening DNA storehouse, dna library is to be prepared by the cell of expressing useful biosynthetic means gene, and

(e) determine and purify carrier DNA, comprise the reading frame of an opening, the useful biosynthetic means gene of encoding.

As explained earlier, the described cell that is used in this method comprises, and coding participates in the gene of the product of biosynthetic means.Described cell can comprise the gene that a plurality of codings participate in the product of biosynthetic means.

At Tattersall, DB etc., the suitable embodiment that describes among Science (2001) 2931:826-8 is the cell of transgenosis model plant Arabidopis thaliana.It comprises two biosynthetic means gene C YP79A1 and CYP71E1, therefore from the network propylhomoserin prepare glycoside compound right-hydroxylphenylethyl alcohol nitrile (see figure 1).

Another embodiment is a Bacillus coli cells, and it comprises enough biosynthetic means genes, prepares the aglycone Vanillin by glucose.

The gene that described coding participates in the product of biosynthetic means can be introduced in the cell to prepare a cell, coding of cell expressing participates in the heterologous gene of the product of biosynthetic means in the described cell, especially a microorganism cells or fibrous fungal cell, these cells can be expressed the heterologous gene that a coding participates in the product of biosynthetic means, and are as described herein-in.

Alternate, the gene encoding production that participates in biosynthetic means is generated naturally by cell, and is the gene of interior growth.

The organic glycoside compound of lower molecular weight

As previously mentioned, the molecular weight of lower molecular weight aglycone compound described herein is 50-3000, preferably, the molecular weight of the organic glycoside compound of lower molecular weight is 50-2000, preferred, the molecular weight of the organic glycoside compound of lower molecular weight is 50-1000, and is most preferred, the molecular weight of the organic glycoside compound of lower molecular weight is 50-750, and molecular weight is every mole a quality in the atomic mass unit.

On the other hand, select in the compound that the organic glycoside compound of lower molecular weight is preferentially enumerated from below, they comprise saturated alkyl more or less, cycloalkyl, cycloalkylalkyl, (it contains 7-9 carbon atom to Arallyl-, one or more hydrogen atom links to each other with phenyl ring, carbon atom is contained the alkyl of 1-8 carbon atom at least, the 1-8 alkoxyl group, halogen atom or nitro selectivity replace) and aryl, contain 1-50 carbon atom, 0-20 heteroatoms and by the replacement of selectivity especially contains 1-56 carbon atom and/or 0-20 heteroatoms and by hydroxyl, amino, sulphur, carboxyl or nitro replace; Preferred, select in the compound of enumerating from below, comprise more or less saturated alkyl, cycloalkyl, cycloalkylalkyl, Arallyl-and aryl, contain 1-32 carbon atom, a 0-10 heteroatoms and by the replacement of selectivity, especially contain 1-56 carbon atom and/or 0-20 heteroatoms and replaced by hydroxyl, amino, sulphur, carboxyl or nitro.

One preferred embodiment in, the organic glycoside compound of lower molecular weight is an alcohol, aromatic alcohol especially.Described alcohol should be understood that to relate to the aglycone of glycosylated technical object.Therefore to be defined as the aglycone of alcohol be a compound at this place, and (OH) functional group can make the hydroxyl glycosylation by using described glycosyltransferase wherein to comprise a hydroxyl.The embodiment that the glycoside compound meaning of preferred aromatic alcohol does not limit is VANILLYL ALCOHOL MIN 98 or right-hydroxylphenylethyl alcohol nitrile.

Alcohol for example also comprises some ketone, acetaldehyde and other compounds and alcohol, and for example enol, furanosider, pyrandosider, lactan and lactone etc. reach balance.

As mentioned above, preferred organic glycoside compound is the compound that contains hydroxyl, amino, imido grpup, thiol group, sulfite, sulfuric ester, phosphoric acid ester or phosphonic acid ester or carboxyl functional group, and these functional groups can be by using described glycosyltransferase by glycosylation.Also can contain corresponding boron and seleno group in the compound, group that compound contains and above-mentioned group reach balance.The aglycone of above having discussed that has hydroxyl.

One preferred embodiment in, organic glycoside compound comprises a carboxyl functional group, uses described glycosyltransferase to make the glycosylation of this functional group form an ester glucosides.The infinite embodiment of this glycoside compound is vanillic acid or right-Para Hydroxy Benzoic Acid.

One preferred embodiment in, the organic glycoside compound of lower molecular weight is a chemical intermediate of medical compounds or medical compounds, and suitable medical compounds is normally spontaneous by animal, plant, fibrous fungi or microorganism.

A preferred medical compounds was chosen from a series of comprising budesonide (budesonide), raloxifene (raloxifine), tamoxifen (tamoxifine), Dopamine HCL (dopamine), steroid (steroids) compound.

Further describing of suitably preferred medical compounds referring to US2003/0130205A1 and US2003/011976A1.

One preferred embodiment in, the organic glycoside compound of lower molecular weight is to choose out from a series of glycoside compounds that comprise vitamin b6 usp, amino acid, lipid acid, peptide oligomer, oligose, Nucleotide oligopolymer, PNA, LNA and functional equivalent, for this class glycoside compound, compound molecular weight can be greater than 3000.

Plant is used as the outstanding organic chemist of occurring in nature, and we know by 200,000 different natural products and come from plant that these products make plant stop phytophagous animal and insect, attract the pollina, exchange with other plant and the variation of acclimatization often.As mentioned above, these compound majorities are known as secondary metabolites.

Term " secondary metabolites (secondary metabolite) " relates to plant and microorganism synthetic a large amount of natural materials, especially secondary metabolites, and is varied, but its function is not also understood usually.With the major metabolite contrast (as amino acid, sugar, lipid acid) that relates to for example metabolism of organism basic function, grows, keeps and survive, secondary metabolites for these basic functions not necessarily.According to this patent, described term secondary metabolites is understood according to this standard to describe.

One preferred embodiment in, the organic glycoside compound of lower molecular weight is the secondary metabolism compounds, preferred plant secondary metabolism compounds.

The embodiment of a concrete class secondary metabolism compounds is as follows:

Terpenoid compound

Alkaloid

The phenylpropionic acid class

Phenyl derivatives

The hexanol derivative

Flavonoid

Tonka bean camphor, stilbene

Cyanalcohol

Vegetalitas Glucosinolates (Glucosinolates)

Sterol

The Saponin/TSM aglycone

Steroid

Hormone

Weedicide

A preferable class secondary metabolism compounds is in above-mentioned a series of compounds:

Terpenoid compound

Alkaloid

The phenylpropionic acid class

Phenyl derivatives

The hexanol derivative

Flavonoid

Tonka bean camphor, stilbene

Cyanalcohol

Vegetalitas Glucosinolates (Glucosinolates)

The embodiment of the preferred independent organic glycoside compound of lower molecular weight chooses in the compound of enumerating from below, comprising:

Mandelonitrile, right-the hydroxylphenylethyl alcohol nitrile, acetone cyanohydrin, Resorcinol, phenmethyl ethanol, right-the hydroxybenzene methyl ethanol, M-nitro benzoic acid, right-Para Hydroxy Benzoic Acid, p-hydroxybenzaldehyde, gentisinic acid, coffic acid, the acid of 2-hydroxy styrenes, 1, the 2-toluylene, Whitfield's ointment, right-the hydroxy phenyl oxyacetic acid, vanillic acid, Vanillin, 2-hydroxyl mehtoxybenzyl ethanol, quercetin, cyanidin(e), biochanin (isoflavones), 4,5,7-tri hydroxy flavanone (flavanone), apigenin (flavones), the 1-hexanol, trans oneself-1-alcohol, cis oneself-1-alcohol, the 3-methyl oneself-1-alcohol, the 3-methyl oneself-1-alcohol, indolylacetic acid (plant hormone), Geraniol (monoterpenoid), tomatidine (alkaloid), vernol, right-geraniol, salicyl alcohol glucoside, Resorcinol, thymol, phenol, methylvanillin, right-glycoloyl benzene, right-methoxyphenol, 3, the 4-syringol, coniferyl, neighbour-coumaric acid, right-coumaric acid, coffic acid, digicitrine, the quercimentin class, catechol, cyadinin, right-Para Hydroxy Benzoic Acid, dormin (plant hormone), 2,4,5-Trichlorophenol (TCP), pentachlorophenol, the 4-nitrophenols, 3,5-two bromo-4-hydrogen phenylformic acid, tsiklomitsin, Protocatechuic Acid, 2-phenylethyl alcohol and 2,2-two-(4-chloro-phenyl-)-acetate.

Grown cell/cell of growth/a kind of cell of growing

As method described herein, cell should be grown under this condition, generates the glycosylation form of aglycone and corresponding aglycone in cell, and an importance that relates to the cell growth is must have sufficient midbody compound in the cell.Embodiment hereto, this just means if cell for example is intestinal bacteria, comprises competent gene in the cell and participates in biosynthetic means, for example generates the glycoside compound Vanillin by glucose, so, intestinal bacteria should exist in cell under the condition of glucose and fermented.

If cell for example is a vegetable cell, comprise competent gene and participate in biosynthetic means, for example generate glycoside compound by the network propylhomoserin, so, vegetable cell should exist in growing plants under the condition of network propylhomoserin of proper amt grows.

Technician's special doubled amount cell of knowing and guarantee how to grow.Generate the method for the organic glycoside compound of lower molecular weight

As mentioned above, the 3rd aspect content of the present invention relates to the method that generates the organic glycoside compound of lower molecular weight, comprises the steps:

A) cell of growth, it contains one and participates in biosynthetic means, generate the encoding gene of the product of a lower molecular weight aglycone organic compound, with an aglycone glycosylation glycosyltransferase gene coding that can make generation, under suitable condition, in cell, generate aglycone and corresponding aglycone glycosylation form;

B) de-glycosylation of the glycosylation form of aglycone; And

C) regain glycoside compound;

(i) wherein the molecular weight of the organic glycoside compound of lower molecular weight is 50-3000

(ii) wherein glycosyltransferase has the ability that sugar is engaged to glycoside compound.

Above described all embodiments embodiment that also is this aspect third aspect content, a requisite step of this method is a step b).This step is further set forth below, wherein comprises some infinite embodiment, proves many technological merits of this de-glycosylation step.

Though glucosides often is the nature product of expectation, but people attempt to use the transgenosis glycosyltransferase to generate glucosides, use them to generate corresponding aglycon and can obtain bigger commercial value (Arend etc. for example, 2001, Biotechnology and Bioengineering76:126-131).An embodiment is a Vanillin, has the natural flavouring agent of important commercial value.Vanillin is to contain phenolic compound, and it accumulates in the fruit of orchid Vanilla, with glycosylation form have the glycosyl Vanillin.For the natural fragrance that obtains expecting, the glycosyl Vanillin must be by de-glycosylation.Can obtain by the fermentation (processing) of fruit, the just so-called vanilla bean of fruit, wherein in the growth β-Portugal (grape) Glycosylase be have active.

The step b) of the method for third aspect present invention content, the glycosylated intermediate of nature product will pass through a de-glycosylation step.According to currently known methods in this patent or by using the enzyme that for example has β-Portugal (grape) glycosidase activity, finish this step by chemical hydrolysis.The technician knows many suitable β-Portugals (grape) Glycosylase, at first obtain by the glycosylation form that regains aglycone, for example by in appropriate solvent, extracting glycosylated intermediate, solvent such as methyl alcohol, perhaps from organism or plant the secretory product and to collect glycosylated intermediate, secondly, glycosylated intermediate is purified and is exposed to β-Portugal's (grape) Glycosylase or passes through sufficient chemical hydrolysis external (exsomatizing).

Alternate; stable glycosylated intermediate exists in the plant materials alone; and in cell or tissue, accumulate; cell and tissue make it avoid the activity of β-Portugal (grape) Glycosylase of interior growth; in this protected space; glycosylated intermediate no longer is exposed to the activity of enzyme, and activity can further produce metabotic change, reaches its deglycosylated balance.Glucosides also is changed, and for example by acetylizing or other method of modifying, avoids being subjected to β-Portugal (grape) Glycosylase effect in this case.And it can be protected timely, if the natural product of expection keeps its glycosylated form to change in plant materials, can cause the significantly reduction of enzymic activity, otherwise will make its de-glycosylation form enter metabolic processes.

For the present invention, preferably make and expect that the glycosylation of aglycone and the reaction of de-glycosylation subsequently are what to separate, because aglycone can pass through further metabolic processes.As mentioned above, this separately can be temporal also can be on the space, on the preferred space.

Final step c in the third aspect present invention content) in, the aglycone of expection is regained.

Relate to the biotechnology production of organic molecule, present method proposes at least three problems.The first, can increase the output of organic molecule, described organic molecule is stable and constitutes the final product of the biosynthetic means out of the ordinary of producing organism (production organism).The second, can increase the output of organic molecule, described organic molecule is not the final product of biosynthetic means out of the ordinary, and can further be produced organism metabolism.The 3rd, can increase producing the output of the deleterious organic molecule of organism.

About toxicity, in embodiment 1 and 2, described, in glycosylated process, the existence of an allos UDPG-Transglucosylase can increase the toxin immunity to Vanillin in the microorganism.Obviously this rule is not limited to Vanillin, but can be used in any deleterious material, and by the effect of allos UDPG-Transglucosylase, toxic substance can be converted to the glucosides of low toxicity, for example Taxus alcohol (taxol).

This method is very helpful in the tolerance that increases for the organic molecule of expecting, described organic molecule is the final product of its biosynthetic means, therefore can run up to certain concentration in producing organism, may limit its generation.Yet this method also can reduce the toxicity of other materials, this material structurally with biosynthesizing on the expection molecule uncorrelated.This material may be the pollutent of the substratum of expection by product of biosynthetic means or growth.

In the ethanol industry fermentation for lignocellulose, report (Delgenes etc., 1996, Enzyme Microb Technol, 19:220) Vanillin is the strongest inhibitor in hydrolysising by-product, when it when concentration is 5g/l in substratum as the strongest growth inhibitor (Pfeifer etc., 1984, biotechnol lett6:541).Therefore, the fermentation of the lignocellulose by an allos UDPG-of microbial expression Transglucosylase can not only increase alcoholic acid output, and can draw a kind of method by potential, regain and the de-glycosylation of nontoxic Vanillin glucosides after, generate the resemblance of the Vanillin that economic worth is arranged simultaneously.

Method as described herein has direct importance for the biotechnology product of many organic molecules, because can increase the output of organic molecule like this, described organic molecule is stable and constitutes the final product of the biosynthetic means out of the ordinary of producing organism (production organism).This appropriate means is described in embodiment 3 and 4, and for example the production with Vanillin is example in microorganism system.Yet, in this article for those technician, these rules are not the products that is defined in the Vanillin that comes from forulic acid, in fact can also be applicable to any biosynthetic means obviously, the organic molecule that generates expection is a final product, resists at least a inhibitor.

When the organic molecule of expection is the finished product of biosynthetic means, in many cases, itself is exactly a limiting factor of formation speed, this be since in biosynthetic means the product inhibition of enzyme, therefore cause reducing formation speed.Yu Qi biosynthetic means hereto, it is not to obtain high-level expection final product, but can generate an intermediate product, perhaps accumulation or directly enter other metabolic processes disappears subsequently.

Present method overcomes product inhibition by introducing additional step in biosynthetic means, so this inhibition product is removed and no longer enzyme is played restraining effect.When biosynthesizing no longer is subjected to the influence of product inhibition, then initial matrix and their transformation: Yu Qi product before this is their glycosylated derivative again, all can increase fully.According to present method, glycosylated derivatives is extracted then, transforms back into the aglycon of expection again, by the activity of for example β-Portugal (grape) Glycosylase.

The organic molecule of expection but, is not necessarily produced the final product of organic biosynthetic means.In these cases, its further metabolism of meeting quilt, and finally can lose the economic recovery meaning.Embodiment 5 and 6 has proved how to succour this intermediate product by present method.In an embodiment, by the glucosylation rescue ethylidenehydroxylamine of an allos UDPG-Transglucosylase, be general for those technician rule herein, it can be used for can be by any intermediate product of glycosylated expection product.The molecule of an expection of mentioning in this embodiment, ethylidenehydroxylamine are not the organic natural products of product, but the organic molecule of expecting in other embodiment also is spontaneous material.

The cytochrome P 450 enzymes compound body CYP79 catalytic amino acid network propylhomoserin of sorghum plant is transformed into ethylidenehydroxylamine, right-the hydroxy phenyl mandelonitrile (Bak etc., 2000, Plant Physiol 123:1437).Attempting sorghum plant CYP79 genetic modification is other plant or microorganism, can generate very small amount of oxime, because it is deleterious, so quilt further metabolism becomes at least two kinds of materials that also do not prove at present, X and Y, they may be derivative (Halkier etc., 1995, the A rchBiochem Biophys322:369 of nitrile and alcohol; Bak etc., 2000, Plant Physiol 123:1437).In plant, for example tobacco and A Bu belong to (Arabidopsis), and through the effect of the UDPG-Transglucosylase of an oximes, oxime is right-hydroxy phenyl-(acetal oxime glucosides, Acetaldoxime glucoside) by glucosylation also.

The glycosylation formal transformation of the organic molecule of expection is the general rule of this area for the final product of producing in the organism.The advantage on output, this rule also has some benefits in the purification or leaching process of expection organic molecule.Confirm that in embodiment 7 the expection molecule is behind glycosylation, variation has taken place in its solubleness.

If molecule separation difficulty from the substratum of producing organic other existing materials or growth of expection then also can be utilized this rule.Glycosylated form is output to another space, rather than the molecule that pollutes, and therefore is easy to purifying treatment.Alternate, it can be secreted out by grown substratum, wherein the molecule of Wu Raning is stayed in the organism alone, and scavenging process can utilize the glycosylation form of expection molecule to have new chemical feature, comprises and is not only solvability but also chromatographic property or the like is arranged.

Select to increase the organic method of transgenosis of biosynthesizing flow

Embodiment 6 has described method how to use the third aspect present invention content, use this method in microorganism, prepare commercial product right-the hydroxy phenyl ethylidenehydroxylamine.By transmitting sorghum plant CYP79 gene and the specific UDPG-Transglucosylase of oximes (referring to Fig. 1) in microorganism.Cause the generation of right-hydroxy phenyl-(acetal oxime glucosides), right-hydroxy phenyl-(acetal oxime glucosides) is stable, nontoxic.In addition, this glucosides can be extracted out, and can be changed into the right-hydroxy phenyl ethylidenehydroxylamine of expection owing to there is it in the activity at external beta-glucosidase.

Use this approach, present method not only can generate the expection molecule, it may be oxime, also allow the selection of transgenic microorganism, transgenic microorganism is the active form of sorghum plant CYP79, because the toxic products of enzyme is removed toxicity by glycosylation process immediately, so have very high gene expression dose.If oximes UDPG-Transglucosylase does not exist, the microorganism that the CYP79 gene is contained in the preferential selection of the selection meeting of nature, described CYP79 gene expression dose is low, and the variant form activity is little.

Embodiment discussed above has described what use is made of present method by selecting to obtain more effective product organism.This rule is not to limit the above embodiments, obviously is applicable to other many biosynthetic meanss and product organism yet.

Therefore, as mentioned above, a fourth aspect of the present invention content relates to the method for selecting a cell, and the glycosylation form that this cell has the organic glycoside compound of the lower molecular weight of making increases, and may further comprise the steps:

A) cell of growth, it contains one and participates in biosynthetic means, generate the encoding gene of the product of a lower molecular weight aglycone organic compound, with a glycosylated glycosyltransferase gene coding of aglycone that can make generation, under suitable condition, in cell, generate aglycone and corresponding aglycone glycosylation form;

B) handle described cell, participate in the expression level that biosynthetic means generates at least one gene of lower molecular weight organic sugar aglucon and/or has the glycosylated glycosyltransferase gene of aglycone of the generation of making by changing, making up a gene cell storehouse with different genes expression level, and

C) select a cell, compare, generate the glycosylation form of the aglycone of higher output yield in step a);

(ii) described glycosyltransferase has the ability that makes sugar change glycoside compound into.

The term here " cell bank (library of cells) " also can be interpreted as " cell mass (population of cells) ", and cell bank comprises at least two kinds of different cells.

Term " different gene expression doses (different expression levels of thegenes) " is a storehouse of containing individual cells, and these cells can increase or reduce gene expression dose.Preferably, this storehouse mainly comprises the individual cells that increases gene expression dose.

Wherein, cell is in plant materials, and the plant storehouse comprises different plants, and preferred, the plant storehouse comprises 10 ²Kind of plant, preferred, the plant storehouse comprises 10 ³Kind of plant, preferred, the plant storehouse comprises 10 ⁵Kind of plant, most preferred, the plant storehouse comprises 10 ⁶Kind of plant.

When cell was a microorganism, cell bank can increase relatively easily, and therefore, cell bank comprises 10 when cell is a microorganism ⁵Individual cell, preferred, comprise 10 ⁷Individual cell, preferred, comprise 10 ⁸Individual cell, most preferred, comprise 10 ⁹Individual cell.

The cell of selecting in this way, it is preferred cell, be used in the generation low molecular weight organic compound in a first aspect of the present invention content, perhaps be used in and generate the organic glycoside compound of lower molecular weight in a third aspect of the present invention content, the relevant embodiment that perhaps is used in these methods prepares low molecular weight organic compound.

Therefore, the method that an embodiment of the invention relate to, as the described content of above-mentioned fourth aspect, at first choose cell, thereafter this cell is used to the method for the generation low molecular weight organic compound of a first aspect of the present invention content description, perhaps be used to the method for the organic glycoside compound of generation lower molecular weight of a third aspect of the present invention content description, perhaps relate to the different embodiments that these methods of use prepare low molecular weight organic compound.

Handle above-mentioned steps b by using a large amount of different schemes) in cell be well known to those skilled in the art.The embodiment that causes sudden change comprises the processing by UV, and chemical treatment fully makes the DNA variation, causes for example specificity promoter of genes involved that suddenlys change at random, and cell reorganization is to set up cell bank of reorganizing cell or the like.

The cell that step c) is selected, preferred, compare with the cell in the step a), can generate the glycosylation form of the aglycone of 1.25 times of amounts; Preferably, the cell that step c) is selected is compared with the cell in the step a), can generate the glycosylation form of the aglycone of 1.5 times of amounts; The cell preferred, that step c) is selected is compared with the cell in the step a), can generate the glycosylation form of the aglycone of 2 times of amounts; The cell most preferred, that step c) is selected is compared with the cell in the step a), can generate the glycosylation form of the aglycone of 3 times of amounts.

Can select with several different methods according to present technique, for example use the microtitration experimental technique, comprise a specific cells sample in the experiment, the quantity of test aglycone glycosylation form, according to general knowledge, the technician can use many other methods.

Embodiment 8 describes how to make and makes the model plant Arabidopis thaliana have the ability of producing bigger output dhurrin from every gram net weight in this way.Initiator cell in the step a) is a model plant Arabidopis thaliana transgenic cell, and at document Tattersall, DB etc. describe among Science (2001) 293:1826-8.As mentioned above, for synthesizing of the glucosides dhurrin of giving birth to cyanogen, model plant Arabidopis thaliana transgenic cell comprises whole synthetic methods, proves that transgenosis model plant arabidopsis thaliana has the ability that generates the 4mg dhurrin from every gram nt wt net weight.Use embodiment 8 described methods, select a model plant Arabidopis thaliana transgenic cell, from every gram net weight, can produce dhurrin greater than 6mg by step c).

Be not limited to theory, believe that this is to provide for the first time a plant, this plant to have the ability that generates the 4mg product from the nt wt net weight of the glycosylation form of the organic glycoside compound of every gram lower molecular weight.

Therefore, relate to a kind of plant as a fifth aspect of the present invention content, this plant has by the ability that generates the 5mg product in the nt wt net weight of the glycosylation form of the organic glycoside compound of every gram lower molecular weight.

(i) molecular weight of the organic glycoside compound of described lower molecular weight is 50-3000.

Preferably, plant has by the ability that generates the 6mg product in the nt wt net weight of the glycosylation form of the organic glycoside compound of every gram lower molecular weight, preferred, plant has by the ability that generates the 8mg product in the nt wt net weight of the glycosylation form of the organic glycoside compound of every gram lower molecular weight.Preferred, plant has by the ability that generates the 5mg-40mg product in the nt wt net weight of the glycosylation form of the organic glycoside compound of every gram lower molecular weight.

Preferably, plant is transgenic plant.

Embodiment:

Common molecular biology method

If above-mentioned DNA does not handle as stated above and transforms, then use molecular biological standard method to implement (Sambrook etc., (1989) Molecular cloning:A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F.M. etc. (eds) " Current protocols in Molecular Biology " .John Wiley and Sons, 1995; Harwood, C.R.and Cutting, S.M. (eds) " Molecular BiologicalMethods for Bacillus " .John Wiley and Sons, 1990).

The use of handling the enzyme of DNA is that the specification sheets according to the supplier carries out.

Embodiment 1: in a UDPG-Transglucosylase of microbial expression process, analyze the toxin immunity that strengthens Vanillin.

Vanillin susceptibility is subjected to a large amount of microbiological manipulation, and microorganism comprises coli strain DH5-α, TOP10, JM109 and KO1418; Pseudomonas fluorescens (Pseudomonas fluorescens) strain DSM 50091, DSM50108 and DSM50124; Bacillus subtilus (Bacillus subitilis strain DSM 704; And coryneform bacteria (Corynebacterium) glutamicum strain DSM 20300.Microorganism also comprises bacterial strain yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), S.uvarum, S.bayamus, S.paradoxus, S.kudriavzevii, S.mikatae, S.cariocanus, S.servazzii, S.castellii, S.kluyverii, Kluyveromyces lactis, Zygosaccharomyces fermentatii, Torulaxporadelbruekii, Debaromyces orientali and Schizosaccharomyces pombe.

The Cmin of Vanillin inhibitor is by two-part serial dilution experiment control (Hufford etc., 1975, J Pharm Sci 4:789), and the concentration of Vanillin must be able to suppress the growth greater than 50%.In case the susceptibility of Vanillin is controlled in different bacterium and yeast strain,, then therefrom choose some different bacteriums and yeast strains for the microorganism strains of the susceptibility that obtains to express the wide region Vanillin.

The bacterial strain of selecting is by the gene transformation of UDPG-Transglucosylase, dichromatism chinese sorghum Sorghum UDPG-Transglucosylase UGT85B1 (Jones etc. for example, 1999, J Biol Chem 274:35483), model plant Arabidopis thaliana UDPG-Transglucosylase UGT89B1 (Lim etc., 2002, JBiol Chem277:586) and snakewood (Rauvolfia serpentina) arbutase synthase (arbutinsynthase) (Arend etc., 2001, Biotechnol Bioeng76:126).

Express for the UDPG-Transglucosylase in the intestinal bacteria, use IPTG-inductive expression vector pSP19g10L, pKK223-3 and pET101D/Topo.In addition, change colibacillary structure, use the coli expression carrier of new construction by using the glycolytic gene promotor of intestinal bacteria.For the expression (P.fluorescens) of Pseudomonas fluorescens, use BHR to express the pYanni3 that carries disease germs.For the expression of the UDPG-Transglucosylase in the yeast, gene be amplify by PCR and be incorporated into pJH259 in the plasmid, wherein, gene by make up but very strong glycolytic TPII promotor express.Alternate, TPII promotor are to be generated by the MET25 promotor exchange that PCR amplifies, and this process can be suppressed by methionine(Met).

As mentioned above, the microorganism that the UDPG-Transglucosylase is expressed in the substratum of growth will carry out the sensitivity analysis to Vanillin.Minimum or can suppress inhibitor concentration control greater than 50% growth and strengthen toxin immunity by the concentration of inhibitor to Vanillin, mean that the Vanillin that the activity of transgenosis UDPG-Transglucosylase makes some or major part provide changes the Vanillin glucosides into, toxicity reduces greatly.

Embodiment 2: the evaluation of glucosides in UDPG-Transglucosylase of microbial expression.

An allos UDPG-of microbial expression Transglucosylase is grown in Vanillin that contains proper concn or vanillal substratum, obtain microorganism, and its glucosides component that comprises is extracted from methyl alcohol or other appropriate solvent.Generating Vanillin glucosides or vanillal glucosides and concentration is quantized.Relatively transgenic microorganism, non-transgenic microorganism and microorganism growth in the substratum that contains Vanillin or vanillal, microorganism growth in the substratum that does not contain Vanillin or vanillal under the situation, the content of Vanillin glucosides and vanillal glucosides.

The microorganism that the UDPG-Transglucosylase is expressed, and microorganism growth Vanillin glucosides content under the condition of the substratum that contains Vanillin or vanillal increases, this explanation aglycone are transformed and by the transgenic organism glucosylation.

Embodiment 3: under the condition of a UDPG-Transglucosylase of microbial expression, increase the absorbed dose and the circulation of forulic acid (feru1ic acid)

The microbial gene that can make forulic acid be converted into Vanillin is changed, and expresses an allos UDPG-Transglucosylase.In these researchs, use actinomycetes Streptomyces setonii strains A TCC39116, because it once was used to the industrial production (Muheim﹠amp that forulic acid changes Vanillin into; Lerch, 1999, Appl Microbiol Biotechnol51:456; Muheim etc., 1998, EP 0885968A1).Alternate uses pseudomonasputida (Pseudomonas putida) strains A N103 (Narbad ﹠amp; Gasson, 1998, Microbiol144:1397; Narbad etc., 1997, WO97/35999), or use Amycolatopsis sp. bacterial strain HR167 (Rabenhorst ﹠amp; Hopp, 1997, EP 0761817A2).In order to express dichromatism chinese sorghum Sorghum UDPG-Transglucosylase UGT85B1, model plant Arabidopis thaliana UDPG-Transglucosylase UGT89B1 or snakewood arbutase synthase, microorganism is converted to and is suitable structure.

The microorganism of hereditary change grows in the substratum that comprises the proper concn forulic acid.The absorption of forulic acid is by it is in the concentration control of substratum subsequently, and the Vanillin in the substratum of microorganism and growth and the concentration analysis of Vanillin glucosides are controlled its metabolic transmutation product.These values with compare in the experiment similar analysis that does not contain under the transgenic microorganism condition.

Increase by microbial expression allos UDPG-Transglucosylase forulic acid absorbed dose, the accumulation of Vanillin glucosides, this has just proved that glycosyltransferase can increase the transformation amount that forulic acid changes Vanillin into, Vanillin changes the Vanillin glycosyl subsequently into.

Embodiment 4: UDPG-Transglucosylase of microbial expression, the glucosylation reaction of going by the Vanillin glucosides that generates increases the output of Vanillin.

Have the microorganism that the forulic acid of making changes Vanillin into, in the presence of a UDPG-Transglucosylase of a genes encoding, transformed, and in the presence of forulic acid, grow.To be absorbed by microorganism and be used for Vanillin synthetic forulic acid quantity in order to remedy, it is fixed to control its concentration weighing apparatus in growth medium.After several days, Vanillin extracts from microorganism and is quantitative.In addition, the Vanillin glucosides is extracted and the activity by external (exsomatizing) β-Portugal (grape) Glycosylase changes Vanillin into, the Vanillin that quantitative analysis regains.

Not containing under the condition that is transformed microorganism, carry out similar experiment, the Vanillin that quantitative analysis regains as the Vanillin of final sintetics and the activity by external (exsomatizing) β-Portugal (grape) Glycosylase.

Extract Vanillin and express the total amount of the Vanillin that regains the microorganism from the UDPG-Transglucosylase, transform microorganism to compare output high a lot of with not containing, this has proved that the existence of an allos UDPG-Transglucosylase can make more forulic acid participate in the synthetic of Vanillin and its glycosylation form, therefrom regains Vanillin then.Therefore by expressing the ultimate production increase that a UDPG-Transglucosylase makes Vanillin.

Embodiment 7: make the purifying of organic molecule easier by glycosylation

The cell of using in the present embodiment is a Bacillus coli cells described in the embodiment 13, can generate the Vanillin glucosides.

In the successive fermenting process, fermentor tank and growth medium inoculation under aerobic conditions begin fermentation.

Initial 12-18 hour is the cell growth phase, after 12-18 hour, in order to generate the Vanillin glucosides, glucose is imported in the fermentor tank.In this fermentation stage speed of growth is linear, can expect that its limiting factor (s) is the solvability of Vanillin glucosides, and the solvability of other relevant glucosides is app.100g/l under the ATP condition as everyone knows, can increase with temperature rising solvability.

After about 30 hours, it is very high that concentration reaches, and begins to generate product, and isolated cell recycles in fermentor tank.

Surfactant suspension product or owing to the deliquescent restriction of Vanillin glucosides concentrates, perhaps directly through a separator column that contains β-Portugal (grape) Glycosylase.The recirculation of surfactant suspension product enters fermentor tank, if there are other products, Vanillin solution will pass through a decontaminating column before recirculation.Can expect that when purification and other products of regeneration, this process need uses row's decontaminating column.

Through the processing of enzyme, product is regained with crystalline form.In order to reduce the amount of recirculation Vanillin, temperature will be lower than the temperature of enzyme treating processes.

Embodiment 9: the Vanillin susceptibility of intestinal bacteria different strains

Three kinds of different coli strain TOP10, JM109 and KO1418, in a series of dilution of the substratum process back of growth (dilution factor 1,1/100,1/10000 and 1/1000000) in suitable substratum, grew 18 hours, the drop of these cell suspension things is put into petri diss, in the solid LB growth medium of the Vanillin that contains different concns is arranged, under suitable growth temperature, cultivate 24 hours (intestinal bacteria), take pictures for them then.According to record, when dilution factor was 1/10000, the per-cent of the Vanillin of growing in known microorganisms (w/v) concentration can not be detected, and when dilution factor was 1/100, concentration also was quite limited.This numerical value constitutes STV (to the susceptibility of Vanillin) standard, for the STV value of different microorganisms referring to table 9.1

The different colibacillary Vanillin susceptibility of table 9.1 in solid growth culture media

Bacterial strain	Genotype	STV
Bacterial strain	Genotype	STV	top10	F-mcrA Delta(mrr-hsdRMS-mcrBC)Phi801acZ Delta-M15 Delta-lacX74 recA1 deoR araD139 Delta(ara-leu)7697 gaIU gaIK rpsL(strR)endA1 nupG	0.12
JM109	FtraD36 lacIq Delta(lacZ)M15 proA+B+/el4-(McrA-)Delta(lac- proAB)thi gyrA96(NalR)endA1 hsdR17(rK-mK-)relA1 supE44 recA1	0.14	top10		0.12
JM109		0.14	KO1418	F-Delta(codB-lacI)3 relA1 bglA677::Tn10 spoT1 bgIB676::Lambda-lacZ bglGo-67 thi-1	0.18

Embodiment 10: the PCR of dichromatism chinese sorghum Sorghum UGT85B1, model plant Arabidopis thaliana UGT89B1 and snakewood myrica synthase (AS) gene amplifies

Roche Pwo polysaccharase and the hot machine circulation device of DNA are used for whole PCR and amplify, and relate to the illustrated in table 10.1 of oligonucleotide of the present invention

The oligonucleotide that table 10.1 research is used

OHgo JH#	Title	Sequence (5 '-3 ')
OHgo JH#	Title	Sequence (5 '-3 ')
1	SB_GT_KK_F	ATTAGAATTCATGGGCAGCAACGCGCCGCCGCCG
1	SB_GT_KK_F	ATTAGAATTCATGGGCAGCAACGCGCCGCCGCCG	2	sB_GT_KK_R	ATTAAAGCTTTTACTGCTTGCCCCCGACCAGCAG
3	SB_GT_pET_F	CACCATGGGCAGCAACGCGCGGCGCCGG	2	sB_GT_KK_R	ATTAAAGCTTTTACTGCTTGCCCCCGACCAGCAG
3	SB_GT_pET_F	CACCATGGGCAGCAACGCGCGGCGCCGG	4	SB_GT_pET_R	TTACTGCTTGCCCCCGACCAGCA
5	SB_GT_S_F1	ATGGGCGGCACGCGCCGCCCT	4	SB_GT_pET_R	TTACTGCTTGCCCCCGACCAGCA
5	SB_GT_S_F1	ATGGGCGGCACGCGCCGCCCT	6	SB_GT_S_F2	CGCAGCTGCCAGGGAGGCCGG
7	SB_GT_S_F3	GCCTCCGCCGGCCTCGCCGCC	6	SB_GT_S_F2	CGCAGCTGCCAGGGAGGCCGG
7	SB_GT_S_F3	GCCTCCGCCGGCCTCGCCGCC	8	SB_GT_S_F4	CAGACCACCAACTGCAGGCAG
9	SB_GT_S_R1	GAGAGGGAGAGGCCGTCGTCG	8	SB_GT_S_F4	CAGACCACCAACTGCAGGCAG
9	SB_GT_S_R1	GAGAGGGAGAGGCCGTCGTCG	10	AT_GT_KK_F	ATTAGAATTCATGAAAGTGAACGAAGAAAACAAC
11	AT_GT_KK_R	ATTAAAGCTTTTATTTGTTTAGTCCTAAACTAACGA C	10	AT_GT_KK_F	ATTAGAATTCATGAAAGTGAACGAAGAAAACAAC
11	AT_GT_KK_R	ATTAAAGCTTTTATTTGTTTAGTCCTAAACTAACGA C	12	AT_GT_pET_F	ATGAAAGTGAACGAAGAAAACAAC
13	AT_GT_pET_R	TTATTTGTTTAGTCCTAAACTAACGAC	12	AT_GT_pET_F	ATGAAAGTGAACGAAGAAAACAAC
13	AT_GT_pET_R	TTATTTGTTTAGTCCTAAACTAACGAC	14	AT_GT_S_F1	ATGAAAGTGAACGAGGAAAAC
15	AT_GT_S_F2	GAATCCCTCGTTTCGATTTCT	14	AT_GT_S_F1	ATGAAAGTGAACGAGGAAAAC
15	AT_GT_S_F2	GAATCCCTCGTTTCGATTTCT	16	AT_GT_S_F3	CTTGACGCACGTGAGGATAAC
17	AT_GT_S_F4	CCTGACACGGTGCCTGACCCG	16	AT_GT_S_F3	CTTGACGCACGTGAGGATAAC
17	AT_GT_S_F4	CCTGACACGGTGCCTGACCCG	18	AT_GT_S_R1	CGGAGGGGATTGAAGGGTGGG
19	AS_GT_EC_KK_F	ATTAGAATTCATGGAACATACCCCGCACATT	18	AT_GT_S_R1	CGGAGGGGATTGAAGGGTGGG
19	AS_GT_EC_KK_F	ATTAGAATTCATGGAACATACCCCGCACATT	20	AS_GT_EC_KK_R	ATTAGAATTCTTATGTACTGGAAATTTTGTTC
21	AS_GT_EC_pET_F	CACCATGGAACATACCCCGCACATT	20	AS_GT_EC_KK_R	ATTAGAATTCTTATGTACTGGAAATTTTGTTC
21	AS_GT_EC_pET_F	CACCATGGAACATACCCCGCACATT	22	AS_GT_EC_pET_R	TTATGTACTGGAAATTTTGTTC
23	AS_TG_S_F1	ATGGAGCATACACCTCACAT	22	AS_GT_EC_pET_R	TTATGTACTGGAAATTTTGTTC
23	AS_TG_S_F1	ATGGAGCATACACCTCACAT	24	AS_GT_S_F2	GACGGCCATGTGCCTGTCTC
25	AS_GT_S_F3	GGGGCAGTCTCCCATAATCA	24	AS_GT_S_F2	GACGGCCATGTGCCTGTCTC
25	AS_GT_S_F3	GGGGCAGTCTCCCATAATCA	26	AS_GT_S_F4	AGGGTCTTAAAGTGGCCCTG
27	AS_GT_S_R1	TACGGGTCTCTATCCTAACA	26	AS_GT_S_F4	AGGGTCTTAAAGTGGCCCTG
27	AS_GT_S_R1	TACGGGTCTCTATCCTAACA	28	Pfba_F	ATTAGAATTCAAAAATCACAGGGCAGGGAAAC
29	Pfba_R	ATTAGGCGCGCCTCTAGAGTCTCTTGTCCTGTATC GTCGGG	28	Pfba_F	ATTAGAATTCAAAAATCACAGGGCAGGGAAAC

30	PpfkA_F	ATTAGAATTCTCAGTATAAAAGAGAGCCAGAC
30	PpfkA_F	ATTAGAATTCTCAGTATAAAAGAGAGCCAGAC	31	PpfkA_R	ATTAGGCGCGCCTCTAGAGACTACCTCTGAACTTT GGAAT
32	PgapA_F	ATTAGAATTCTTGCTCACATCTCACTTTAATC	31	PpfkA_R	ATTAGGCGCGCCTCTAGAGACTACCTCTGAACTTT GGAAT
32	PgapA_F	ATTAGAATTCTTGCTCACATCTCACTTTAATC	33	PgapA_R	ATTAGGCGCGCCTCTAGAATATTCCACCAGCTATT TGTTA
34	PtpiA_F	ATTAGAATTCCAAAAAGCAAAGCCTTTGTGCC	33	PgapA_R	ATTAGGCGCGCCTCTAGAATATTCCACCAGCTATT TGTTA
34	PtpiA_F	ATTAGAATTCCAAAAAGCAAAGCCTTTGTGCC	35	PtpiA_R	ATTAGGCGCGCCTCTAGATTTAATTCTCCACGCTTA TAAG
36	TcysB_F	ATTAGGCGCGCCGGATCCTTTCTTGCGTTATTTTCG GCACC	35	PtpiA_R	ATTAGGCGCGCCTCTAGATTTAATTCTCCACGCTTA TAAG
36	TcysB_F	ATTAGGCGCGCCGGATCCTTTCTTGCGTTATTTTCG GCACC	37	TcysB_R	ATTAAAGCTTGAAAAACCGCCAGCCAGGCTTT
38	SB_GT_EC_NP_F	ATTATCTAGAATGGGCAGCAACGCGCCGCCGCCG	37	TcysB_R	ATTAAAGCTTGAAAAACCGCCAGCCAGGCTTT
38	SB_GT_EC_NP_F	ATTATCTAGAATGGGCAGCAACGCGCCGCCGCCG	39	SB_GT_EC_NP_R	ATTAGGATCCTTACTGCTTGCCCCCGACCAGCAG
40	AT_GT_EC_NP_F	ATTATCTAGAATGAAAGTGAACGAAGAAAACAAC	39	SB_GT_EC_NP_R	ATTAGGATCCTTACTGCTTGCCCCCGACCAGCAG
40	AT_GT_EC_NP_F	ATTATCTAGAATGAAAGTGAACGAAGAAAACAAC	41	AT_GT_EC_NP_R	ATTAGGATCCTTACCACCGTTCTATCTCCATCTTC
42	RS_GT_EC_NP_F	ATTATCTAGAATGGAACATACCCCGCACATT	41	AT_GT_EC_NP_R	ATTAGGATCCTTACCACCGTTCTATCTCCATCTTC
42	RS_GT_EC_NP_F	ATTATCTAGAATGGAACATACCCCGCACATT	43	RS_GT_EC_NP_R	ATTAGGATCCTTATGTACTGGAAATTTTGTTC

Be used for UGT85B1, UGT89B1 and AS that intestinal bacteria IPTG control is expressed.

The amplification of UGT85B1 is used for intestinal bacteria carrier pKK223-3, (Amersham-Pharmacia biotechnology), use oligonucleotide JH#1 and JH#2 (seeing Table 10.1), plasmid pSP19g10L-UGT85B1 (Jones etc., 1999, J Biol Chem274:35483) as reaction template, reaction conditions is: 94 ℃, 2 minutes, 1 circulation, 94 ℃, 30 seconds, gradient 50-60 ℃, 1 minute, 72 ℃, 2 minutes, 30 circulations, be 72 ℃, 7 minutes, 1 circulation subsequently, this reaction comprises 5%DMSO.Reaction product is that expection segment size is the combination of 1.5kb, is used for colligation to pCR-Blunt II-Topo carrier.Comprise that 1.5kb EcoRI introduces the clone of thing by introduction JH#5-9 ordering.Clone with an appropriate dna sequence dna is identified and called after pJH400.UGT85B1 ORF discharges from pJH400 by EcoRI-HindII (comprising these restriction point in 5 ' of introduction-terminal), introduces among the EcoRI-HindII digestion pKK223-3 plasmid.The clone who introduces with an appropriate UGT85B1 is identified, and called after pJH401.

The amplification of UGT85B1 is used for escherichia coli vector pET101-D/Topo, implements the PCR reaction that a quilt is differentiated, only uses introduction JH#3 and 4.Implement identical PCR process, the segment of 1.5kb size is directly introduced among the expression vector pET101-D/Topo just.Using introduction JH#5-9 is several clones' introducing ordering, and appropriate clone's title is pJH402.

The amplification of UGT89B1 is used for escherichia coli vector pKK223-3, uses oligonucleotide JH#10 and JH#11 (seeing Table 10.1), and genome model plant Arabidopis thaliana DNA (var.Columbia Col-0) is as reaction template.Reaction conditions is 94 ℃, 2 minutes, 1 circulation, and 94 ℃, 30 seconds, gradient 50-60 ℃, 1 minute, 72 ℃, 2 minutes, 30 circulations are 72 ℃, 7 minutes, 1 circulation subsequently.Reaction product is that an expection segment size is the combination of 1.4kb, is used for colligation to pCR-Blunt II-Topo carrier.Comprise that 1.4kb EcoRI introduces the clone of thing by introduction JH#14-18 ordering.Clone with an appropriate dna sequence dna is identified and called after pJH462.UGT89B1 ORF discharges from pJH462 by EcoRI-HindII (comprising these restriction point in 5 ' of introduction-terminal), introduces among the EcoRI-HindII digestion pKK223-3 plasmid.The clone who introduces with an appropriate UGT89B1 is identified, and called after pJH463.

The amplification of UGT89B1 is used for escherichia coli vector pET101-D/Topo, implements an identical PCR reaction, only uses introduction JH#12 and 13.Implement identical PCR process, the segment of 1.4kb size is directly introduced among the expression vector pET101-D/Topo just.Using introduction JH#14-18 is several clones' introducing ordering, and appropriate clone's title is pJH406.

The amplification of AS is used for escherichia coli vector pKK223-3, uses oligonucleotide JH#10 and JH#20 (seeing Table 10.1), and plasmid pQE60-AS (Arend etc., 2001, Biotechnol Bioeng76:126) is as reaction template.Reaction conditions is 94 ℃, 2 minutes, 1 circulation, and 94 ℃, 30 seconds, gradient 48-55 ℃, 1 minute, 72 ℃, 2 minutes, 30 circulations are 72 ℃, 7 minutes, 1 circulation subsequently.Reaction product is that an expection segment size is the combination of 1.4kb, is used for colligation to the pCR-BluntII-Topo carrier.Comprise that 1.4kb EcoRI introduces the clone of thing by introduction JH#23-27 ordering.Clone with an appropriate dna sequence dna is identified and called after pJH409.AS ORF discharges from pJH409 by EcoRI (comprising the EcoRI point in 5 '-terminal of two introductions), introduces among the EcoRI digestion pKK223-3 plasmid.The clone who introduces with an appropriate AS is known other, and called after pJH410.

The amplification of AS is used for escherichia coli vector pET101-D/Topo, implements an identical PCR reaction, only uses introduction JH#21 and 22.Implement identical PCR process, the segment of 1.4kb size is directly introduced among the expression vector pET101-D/Topo just.Using introduction JH#23-27 is several clones' introducing ordering, and appropriate clone's title is pJH411.

UGT85B1, UGT89B1 and AS are used to construct colibacillary expression

When glycosyltransferase gene is subjected to one of them control of four glycolytic bacillus coli gene promotor, construct the expression system of a series of UGT85B1 and AS, four gene promotor are: fba (introduction JH#28 and 29), pfkA (JH#30 and 31), tpiA (JH#32 and 33) and gapA (JH#34 and 35) promotor, and all glycosyltransferase is controlled by intestinal bacteria cysB terminator (introduction JH#27 and 28) sequence.Entire infrastructure is all based on following scheme: the promotor segment is amplified by the PCR of intestinal bacteria DN5 α genomic dna, makes

BamHI-AscI (these points exist in introduction) introduces (Olesen etc. among the pKOL30,2000, Yeast16:1035), then, in the structure that generates, AscI-HindIII (having this point in the introduction) introduces the cysB segment, at last, in the structure that generates, the UGT85B1 (introduction JH#38 and 39) that PCR amplifies, UGT89B1 (introduction JH#40 and 41) or AS (introduction JH#42 and 43) are introduced into XbaI-EcoRI, and (these points exist in the AscI point, in 3 '-terminal introduction, the promotor that is used to amplify, in 5 '-terminal introduction, the terminator that is used to amplify also is used for the amplification of UGT and AS gene in the introduction).

The PCR reaction conditions is 94 ℃, 2 minutes, 1 circulation, 94 ℃, 30 seconds, 55 ℃, 1 minute (for promotor and terminator segment, also for the UGT segment) or 48 ℃, 1 minute (for the AS segment), 72 ℃, 2 minutes, 30 circulations then are 72 ℃, 7 minutes, 1 circulation.Amplification for UGT85B1 comprises 5%DMSO.Response sample is the combination that comprises expection segment size, as mentioned above, uses gel purification and is used for cloning experimentation.

The plasmid that generates is pJH430 (fba-UGT85B1), pJH431 (pfkA-UGT85B1), pJH432 (gapAA-UGT85B1), pJH433 (tpiA-UGT85B1), pJH434 (fba-UGT89B1), pJH435 (pfkA-UGT89B1), pJH436 (gapA-UGT89B1), pJH437 (tpiA-UGT89B1), pJH438 (fba-AS), pJH439 (pfkA-AS), pJH440 (gapA-AS) and pJH441 (tpiA-AS).

Embodiment 11: by UGT or the colibacillary expression of AS gene, the toxicity of removing Vanillin is in the standard transition scheme, the conversion of coli strain TOP10, JM109 and KO1418 is by synthetic plasmid pJH401, pJH402, pJH411 and pJH412 and pKK223-3 control, in order to resist Ampicillin Trihydrate (penbritin), select transformant (bacterial cell that has transformed), two transformants of each plasmid of each coli strain participate in the genetic expression experiment.Colibacillary transformant is inoculated, liquid growth medium (LB substratum, Ampicillin Trihydrate concentration 100 μ g/ml) from the culture dish to 2ml, and growth is 20 hours under 37 ℃ of conditions.In substratum, diluted 100 times of pre-culture, 10 ⁴Doubly with 10 ⁶Doubly, 4 μ l drops of these cell suspension things are put into petri diss, solid LB-Ampicillin Trihydrate substratum is arranged in the culture dish, the Vanillin that solid medium contains different concns (as mentioned above, based on controls such as STV), not or (inducible gene expression) 1mM sec.-propyl thioglucoside (IPTG) arranged.After culture dish was cultivated 24 hours under 37 ℃ of conditions, control and be recorded in the growth in the Vanillin of different concns, the result sums up as table 11.1.

E.coli strain％Vanillin	0％	0.08％	0.12％	0.16％	0.2％	IPTG indnction
E.coli strain％Vanillin	0％	0.08％	0.12％	0.16％	0.2％	IPTG indnction	JM109[pKK223-3]	++	++	++	-	-	No
++	++	++	-	-	Yes			++	++	++	-	-	No
++	++	++	-	-	Yes	JMl09[pJH401]		++	++	++	-	-	No
++	++	++	-	-	Yes			++	++	++	-	-	No
++	++	++	-	-	Yes
Coli strain % Vanillin	0％	0.08％	0.12％	0.16％	0.2％	IPTG imports
Coli strain % Vanillin	0％	0.08％	0.12％	0.16％	0.2％	IPTG imports	JM109[pKK223-3]	++	++	++	-	-	Do not have
++	++	++	-	-	Have			++	++	++	-	-	Do not have
++	++	++	-	-	Have	JM109[pJH401]		++	++	++	-	-	Do not have
++	++	++	-	-	Have			++	++	++	-	-	Do not have
++	++	++	-	-	Have

							JM109[pJH402]	++	++	++	+	-	No
++	++	++	++	-	Yes			++	++	++	+	-	No
++	++	++	++	-	Yes	JM109[pJH410]		++	++	++	++	-	No
++	++	++	+	-	Yes			++	++	++	++	-	No
++	++	++	+	-	Yes		KO1418[pKK223-3]	++	++	++	-	-	No

Table 11.1 dichromatism chinese sorghum Sorghum UGT85B1 or the genetic expression of snakewood AS IPTG-inductive influence the toxicity of Vanillin and the relation of three different coli strains ,-: do not grow; +: weak growth; ++: good growth.

From these experiments, sum up, under the condition that the IPTG inductive gene promotor of some coli strains and some types exists, the genetic expression of dichromatism chinese sorghum Sorghum UGT85B1 is possible, obtain having the toxic Vanillin of removal by the AS expression of gene, simultaneously, phosphorus-β-Portugal (grape) Glycosylase coding bgl locus lose activity (bacterial strain KO1418) in coli strain.

Utilization standard conversion scheme, in the experiment of UGT85B1 and the quick synthetic expression of AS, the conversion of coli strain JM109 and KO1418 is by synthetic plasmid pJH430, pJH431, pJH432, pJH433, pJH434, pJH435, pJH436, pJH437, pJH438, pJH439, pJH440, pJH441, pKOL30 control.In order to resist Ampicillin Trihydrate (penbritin), select transformant (bacterial cell that has transformed), two transformants of each plasmid of each coli strain participate in the genetic expression experiment.Colibacillary transformant is inoculated, liquid growth medium (LB substratum, Ampicillin Trihydrate concentration 100 μ g/ml) from the culture dish to 2ml, and growth is 20 hours under 37 ℃ of conditions.In substratum, diluted 100 times of pre-culture, 10 ⁴Doubly with 10 ⁶Doubly, 4 μ l drops of these cell suspension things are put into petri diss, solid LB-Ampicillin Trihydrate substratum is arranged in the culture dish, the Vanillin that solid medium contains different concns (as mentioned above, based on controls such as STV), after culture dish was cultivated 24 hours under 37 ℃ of conditions, control and be recorded in the growth in the Vanillin of different concns, the result sums up as table 11.2.Be subjected to plasmid pJH430, pJH431, pJH432 and the coli strain JM109 of pJH433 control and the result of KO1418, sum up and see Table 11.2.

E.coli strain％Vanillin	0％	0.08％	0.12％	0.16％
E.coli strain％Vanillin	0％	0.08％	0.12％	0.16％	JM109[pKOL30]	+++	+++	++	-
JM109[pJH430]	+++	+++	+++	++	JM109[pKOL30]	+++	+++	++	-
JM109[pJH430]	+++	+++	+++	++	JM109[pJH431]	+++	+++	+++	++
JM109[pJH432]	+++	+++	+++	+	JM109[pJH431]	+++	+++	+++	++
JM109[pJH432]	+++	+++	+++	+	JM109[pJH433]	+++	+++	+++	+
KO1418[pKOL30]	+++	+++	++	+	JM109[pJH433]	+++	+++	+++	+
KO1418[pKOL30]	+++	+++	++	+	KO1418[pJH430]	+++	+++	+++	+++
KO1418[pJH431]	+++	+++	+++	+++	KO1418[pJH430]	+++	+++	+++	+++
KO1418[pJH431]	+++	+++	+++	+++	KO1418[pJH432]	+++	+++	+++	+
KO1418[pJH433]	+++	+++	+++	+++	KO1418[pJH432]	+++	+++	+++	+

Table 11.2 dichromatism chinese sorghum Sorghum UGT85B1 or the genetic expression of snakewood AS synthetic influence the toxicity of Vanillin and the relation of two different coli strains ,-: do not grow; +: weak growth; ++: good growth.

From these experiments, the synthetic genetic expression that we sum up the glycosyltransferase in coli strain JM109 can be removed the toxicity of Vanillin.

Embodiment 12: at UGTT85B1-, and UGT89B1-, or generate Vanillin glucosides (VG) product under the e. coli strains condition of AS-expression

In order in containing the liquid growth medium of sublethal concentrations Vanillin, to obtain the VG product, test multiple coli strain and express UGT85B1 or AS.Test strain is JM109 and KO1418, and they comprise in the following plasmid any one: pKK223-3, pJH401, pJH402, pJH406, pJH463, pJH410, pKOL30, pJH430, pJH431, pJH432, pJH433, pJH434, pJH435, pJH436, pJH437, pJH438, pJH439, pJH440 and pJH441.

Coli strain is inoculated, and comprises in the LB substratum that Ampicillin Trihydrate concentration is 100 μ g/ml at 2ml, grows a night under 37 ℃ of conditions, is diluted to 50ml at identical growth medium (0.1mlo.n. cultivation) then.Growth is 2 hours under 37 ℃ of conditions, for those bacterial strains that contains the plasmid of IPTG-inductive UGT/AS-expression, adds IPTG and makes its concentration reach 1mM (0.5ml100mM raw material).Cultivation is after 1 hour down at 28 ℃ for the cell suspension thing, and the adding Vanillin makes its concentration reach 0.05% (83 μ l30% ethanol raw material), grows 24 hours down at 28 ℃ then.Use centrifugal LC-MS to cultivate, control growing is VG content from the teeth outwards, controls the growth of the lysate of cell granulations simultaneously.

In another group experiment, identical coli strain is grown under the identical condition, but does not contain Vanillin, but adds in the cultivation bacterium of growth ¹⁴After the Vanillin of C-spike, cultivated 1-24 hour under 28 ℃ of conditions.Sample on floating on the surface takes out by rule as cell sample, the founder cell lysate, the product suspension of growth and cell lysate detect through TLC (tlc), as document (Jones etc., 1999, J Biol Chem274:35483) set forth.

Above-mentioned two analyses can detect the existence of Vanillin glucosides from the cell of expressing UGT or AS gene, and can not detect the Vanillin glucosides in the cell of not expressing UGT or AS gene.

Embodiment 13: create a kind of biosynthetic means again, for the Transglucosylase of microbial expression provides Vanillin

Create a kind of microbial process, make the conversion of glucose Vanillin, three kinds of isodynamic enzymes are lived is expressed in the microorganism that the UDPG-Transglucosylase expresses and finishes.

First kind of enzymic activity is a 3-dehydroshikimate dehydratase, i.e. 3-dehydroshikimate, and it handles remote Vanillin presoma from common die aromatischen Aminosaeuren biosynthetic means, it is changed into Protocatechuic Acid.3-dehydroshikimate dehydratase (3DHD) gene can be from neurospora crassa (Neurospora crassa) (Ruthledge, 1984, Gene 32:275), aspergillus (Aspergillus) nidulans (Hawkins etc., 1985, Curr Genet9:305), handle spore Shell bacterium (Podospora pauciseta) (GenBank accession#AL627362) and acinetobacter calcoaceticus (Acinetobacter calcoaceticus) (Elsemore ﹠amp; Ornston, 1995, J Bacteriol 177:5971) middle understanding.Second kind of necessary enzyme is an aromatic carboxylic acid reductase enzyme (ACAR), and it can make Protocatechuic Acid change 3 into, the 4-gentisaldehyde.The ACAR activity of ATP-decision can be found from the following mushroom of mentioning: some actinomycete (Nocardia Nocardia sp.) (uses the ACAR patent of Nocardia to be: Rosazza ﹠amp; Li, 2001, US 6262814B1), neurospora crassa (Neurospora crassa) (Gross ﹠amp; Zenk, 1969, Eur J Biochem 8:413 (uses the patent of ACAR enzyme preparation to be: Frost, 2002; US6372461B1) and some club fungi (basidiomycetes), so-called " white rot " fungi, they are degradation agents (for example thick silk (Trametes) of xylogen, Dichomitus, Bjerkandera and pleurotus (Pleurotus) (oyster mushroom ' Oyster mushroom ') genus (Hage etc., 1999, ApplMicrobiol Biotechnol 52:834).The data of the protein sequence of short chain N-terminated promise cassette Pseudomonas (Nocardia) enzyme are referring to document (Li ﹠amp; Rosazza, 1997, J Bacteriol179:3482), the complete nucleotide sequence of gene is announced in the recent period, referring to document (He etc., 2004, Appl Env Microbiol 70:1874-1881).Last enzymic activity is a 3-neighbour-methylation, this is very important for finally changing Vanillin into, this candidate's enzyme is a strawberry S-adenosylmethionine: furans alcohol O-methyltransferase gene (FaOMT) (Wein etc., 2002, Plant J 31:755), because this enzyme is 3, the 4-gentisaldehyde is in the special form that methylates of 3-adjacent.The alternate methylase comprises white poplar (Bugos etc., 1991, Plant Mol Biol17:1203), apricot (Garcia-Mas etc., 1995, Plant Phys 108:1341) and vanilla vanilla (Pak etc., 2004, Plant Cell Rep:11) OMTs.For fear of the accumulation of poisonous intermediate product, the gene of first expression is a methyl transferase gene in the microorganism strains that a function UGT-expresses.(for example by 3, the 4-gentisaldehyde generates the Vanillin glucosides) then introduces acetaldehyde dehydrogenase when detecting this gene, etc., reach up to beginning intrinsic 3-dehydroshikimate-generation method.

Use Fragraria x ananassa (strawberry) cDNA as template DNA, separate strawberry FaOMT gene by PCR.By using QBiogene Fastprep Pro Green kit, from sophisticated F.ananassa var.Elanta, isolate cDNA, the cDNA for preparing from synthetic RNA is by Invitrogen Superscript II reversed transcriptive enzyme synthetic.The preparation of these cDNA is used to use the amplification of the PCR of FaOMT ORF class introduction and Pwo polysaccharase (Roche Biochemicals).It is separated that synthetic 1.1kb contains the DNA segment of FaOMT, and be incorporated between Xba I and BamHI point among the derivable coli expression carrier pJH-X1 synthetic plasmid pJH-X2.

Coli strain JH1 is equivalent to contain the e. coli jm109 of plasmid pJH430 (expressing UGT85B1 by intestinal bacteria fba promotor), is transformed by plasmid pJH-X2.The intestinal bacteria JH2 that generates grows inducible gene expression adding 3 in the liquid LB growth medium of 4-gentisaldehyde.Part on the cultivation bacterium that grows is floated on the surface detects through LC-MS, and identification Vanillin glucosides means to make 3 that the 4-gentisaldehyde changes into the foundation of the biosynthetic means of Vanillin glucosides.

Influence 3, the 4-gentisaldehyde is converted into an ACAR gene of Vanillin process, separate with following mode: by using Invitrogen Superscript II reversed transcriptive enzyme method, the whole RNA that extract from white-rot fungi flat mushroom (Pleurotus ostreatus) or Trametes gibbosa are used for synthesizing cDNA, by using the cDNA library structure system of Stratagene, make up a cDNA storehouse that contains phasmid.The DNA that selects from these storehouses is used to separate 5 ' of white-rot fungi ACAR gene-district, utilizes the advantage of Nocardia ACAR nucleotide sequence information.Preposition introduction is identical with the carrier sequence, sail against the current immediately in the insertion point of cDNA, opposite introduction and Nocardia ACAR gene allos, the aminoacid sequence that transformed of this gene is compared with the aminoacid sequence that transformed of other putative ACAR genes, Nocardia ACAR gene can reach maximum evolution to be changed, and those putative ACAR genes can obtain (by comparing with Nocardia ACAR) from disclosed sequence library.Manyly contain these introductions of base swing type (for example degraded of introduction) and preposition introduction one is used from the PCR reaction at different IPs thuja acid point, use the cDNA storehouse, from any one selection DNA of foregoing description, and high-fidelity (High Fidelity Plus) polysaccharase (Roche Biocehmicals).

Select best annealing temperature and magnesium ion concentration, extract the PCR segment of about 0.8kb.By subclone (offspring of the mutant cell that produces in the clone) and nucleotide sequence analysis, the segment of P.ostreatus or T.gibbosa ACAR is encoded to 5 '-district.The sequence information that obtains is used for explanation and includes the preposition oligonucleotide introduction of ACAR, in order to amplify 3 '-terminal of flat mushroom (P.ostreatus) or T.gibbosa ACAR gene, this preposition introduction is used from the inset that end is the cDNA of 3 '-terminal with the introduction one that is inverted, and the described introduction that is inverted is identical with carrier sequence in the database.Gene segment ordering back is separated, is defined as ACAT gene 3 '-terminal one class oligonucleotide introduction, in final PCR reaction, uses with 5 '-terminal, one class introduction, obtains long-chain flat mushroom (P.ostreatus) or T.gibbosa ACAR.The introducing of cDNA will be analyzed through the DNA ordering among this clone, after determining the ACAR gene order, gene just can be introduced in one influences 3, the 4-gentisaldehyde is to the ACAR gene of the conversion of Vanillin, isolated genes in such a way: by using Invitrogen Superscript II reversed transcriptive enzyme method, the whole RNA that extract from white-rot fungi flat mushroom (Pleurotusostreatus) or Trametes gibbosa are used for synthetic cDNA.Use a phasmid cDNA of the cDNA library structure system construction storehouse of Stratagene.The DNA that selects from these storehouses is used to separate 5 ' of white-rot fungi ACAR gene-district, utilizes the advantage of Nocardia ACAR nucleotide sequence information.Preposition introduction is identical with the carrier sequence, sail against the current immediately in the insertion point of cDNA, opposite introduction and Nocardia ACAR dna homolog, the aminoacid sequence that transformed of this gene is compared with the aminoacid sequence that transformed of other putative ACAR genes, Nocardia ACAR gene can reach maximum evolution to be changed, and those putative ACAR genes can obtain (by comparing with Nocardia ACAR) from disclosed sequence library.Manyly contain these introductions of base swing type (for example degraded of introduction) and preposition introduction one is used from the PCR reaction at different IPs thuja acid point, use the cDNA storehouse, select DNA from above-mentioned any one, and high-fidelity (High Fidelity Plus) polysaccharase (Roche Biocehmicals).Select best annealing temperature and magnesium ion concentration, extract the PCR segment of about 0.8kb.By subclone and nucleotide sequence analysis, the segment of flat mushroom (P.ostreatus) or T.gibbosa ACAR is encoded to 5 '-district.The sequence information that obtains is used for explanation and includes the preposition oligonucleotide introduction of ACAR, in order to amplify 3 '-terminal of flat mushroom (P.ostreatus) or T.gibbosaACAR gene, this preposition introduction is used from the inset that end is the cDNA of 3 '-terminal with the introduction one that is inverted, and the described introduction that is inverted is identical with carrier sequence in the database.Gene segment ordering back is separated, is defined as ACAT gene 3 '-terminal one class oligonucleotide introduction, in final PCR reaction, uses with 5 '-terminal, one class introduction, obtains long-chain flat mushroom (P.ostreatus) or T.gibbosa ACAR.The introducing of cDNA will be analyzed through DNA ordering among this clone, determine the ACAR gene order after, gene is introduced in the carrier pJH413 that yeast saccharomyces cerevisiae is expressed, synthetic plasmid pJH413-X1 is incorporated into intestinal bacteria carrier pJH-X2, synthetic plasmid pJH-X3.

By plasmid pJH-X3 effect transformed into escherichia coli bacterial strain JH1 (expressing UGT85B1), the coli strain JH3 of generation is grown in the liquid LB growth medium that adds Protocatechuic Acid, inducible gene expression.The cultivation bacterium suspended substance that grows detects through LC-MS, and identification Vanillin glucosides means the foundation that can make Protocatechuic Acid change into the biosynthetic means of Vanillin glucosides.

From handle spore Shell bacterium (Podospora pauciseta), separate a 3DHD gene, method is as follows: use QBiogene Fastprep DNA system to make genomic dna separate from handle spore Shell bacterium (P.pauciseta), use this genomic dna to amplify the 3DHD gene as template by PCR, this dna profiling is that the reaction by handle spore Shell bacterium (P.pauciseta) 3DHD one class introduction and Pwo polysaccharase (Roche Biochemicals) generates.The 1.1kb 3DHD gene segment that generates is introduced between the BamHI and XbaI position of escherichia coli expression carrier pJH-X3, generates plasmid pJH-Van.Coli strain JH1 (expressing UGT85B1) transforms under the effect of plasmid pJH-Van.

The coli strain JH4 that generates is grown in the liquid LB growth medium inducible gene expression.The cultivation bacterium suspended substance that grows detects through LC-MS, identifies the Vanillin glucosides, means that can make conversion of glucose is the establishment of the biosynthetic means of Vanillin glucosides.

By plasmid pJH-Van effect transformed into escherichia coli bacterial strain JM109, it is the biosynthetic means of Vanillin product by conversion of glucose that the bacterial strain JH5 that generates comprises one, and bacterial strain JH4 comprises a biosynthetic means that generates Vanillin, in addition, also has glycosyltransferase coding UGT85B1 gene.Bacterial strain JH4 and JH5 are grown in the liquid LB growth medium, inducible gene expression.As mentioned above, by this method, can be relatively at Vanillin that generates under the JH5 bacterial strain condition and the Vanillin glucosides that under JH4 bacterial strain condition, generates.

Find that coli strain comprises a biosynthetic means that generates Vanillin, in addition, also have a glycosyltransferase gene (bacterial strain JH4), compare with corresponding Vanillin aglycon, it can generate the Vanillin glucosides (is benchmark with 1molar) of higher output yield.

Embodiment 14: under the yeast saccharomyces cerevisiae existence condition, create a kind of biosynthetic means of Vanillin again

Create a kind of microbial process, make conversion of glucose become Vanillin, obtain three kinds of isodynamic enzymes by the molecular gene technology and live, and under the condition that yeast saccharomyces cerevisiae exists, express.

First kind of enzymic activity is a 3-dehydroshikimate dehydratase, i.e. 3-dehydroshikimate, and it handles remote Vanillin presoma from common die aromatischen Aminosaeuren biosynthetic means, it is changed into Protocatechuic Acid.3-dehydroshikimate dehydratase (3DHD) gene can be from neurospora crassa (Neurospora crassa) (Ruthledge, 1984, Gene32:275), aspergillus (Aspergillus) nidulans (Hawkins etc., 1985, Curr Genet9:305), Podospora pauciseta (GenBank accession # AL627362) and acinetobacter calcoaceticus (Acinetobacter calcoaceticus) (Elsemore ﹠amp; Ornston, 1995, J Bacteriol177:5971) middle understanding.Second kind of necessary enzyme is an aromatic carboxylic acid reductase enzyme (ACAR), and it can make Protocatechuic Acid change 3 into, the 4-gentisaldehyde.The ACAR activity of ATP-decision can below find in the mushroom mentioned: some actinomycete (Nocardia) (uses the ACAR patent of Nocardia to be: Rosazza ﹠amp; Li, 2001, US 6262814B1), neurospora crassa (Neurospora crassa) (Gross ﹠amp; Zenk, 1969, Eur J Biochem 8:413 (uses the patent of ACAR enzyme preparation to be: Frost, 2002; US6372461B1) and some club fungi, so-called " white rot " fungi, they are degradation agents (for example thick silk (Trametes) of xylogen, Dichomitus, Bjerkandera and pleurotus (Pleurotus) (oyster mushroom ' Oyster mushroom ') genus (Hage etc., 1999, Appl Microbiol Biotechnol 52:834).The data of the protein sequence of short chain N-terminated promise cassette Pseudomonas (Nocardia) enzyme are referring to document (Li ﹠amp; Rosazza, 1997, J Bacteriol 179:3482), the complete nucleotide sequence of gene has been announced in the recent period, referring to document (He etc., 2004, Appl Env Microbiol70:1874-1881).Last enzymic activity is a 3-neighbour-methide, this is very important for finally changing Vanillin into, this candidate's enzyme is a strawberry S-adenosylmethionine: furans alcohol O-methyltransferase gene (FaOMT) (Wein etc., 2002, Plant J31:755), because this enzyme is 3, the 4-gentisaldehyde is in the special form that methylates of 3-adjacent.The alternate methylase comprises white poplar (Bugos etc., 1991, Plant Mol Biol17:1203), apricot (Garcia-Mas etc., 1995, Plant Phys108:1341) and vanilla planifoid (Pak etc., 2004, Plant Cell Rep:11) OMTs.

Use Fragraria x ananassa (strawberry) cDNA as template DNA, separate strawberry FaOMT gene by PCR.By using QBiogene Fastprep Pro Green kit, from sophisticated F.ananassa var.Elanta, isolate cDNA, the cDNA for preparing from synthetic RNA is by Invit rogen Superscript II reversed transcriptive enzyme synthetic.By using introduction #1 and #2 (table 14.1) and Pwo polysaccharase, the preparation of this cDNA is used for PCR and amplifies.It is separated and be incorporated into yeast saccharomyces cerevisiae and express between the XbaI and BamHI position of carrier pJH413 that the 1.1kb that generates contains the DNA segment of FaOMT, generates bacterial strain pJH471.NotI-NotI in the expression cassette of pJH471 (Ptpil-FaOMT-Ttpil) is transferred to (Hansen etc., 2003, FEMSYeast Res 4:323-327) among the yeast combined belt thalline pYC050, generates plasmid pJH494.Restrictive diges-tion by PsiI makes 10 μ g plasmid pJH494 linearizings, and resultant is used to make Wine brewing yeast strain JH1 to have anti-nourseothricin (nourseothricin) property, generates yeast strain FSC58.

From Podospora pauciseta, separate a 3DHD gene, method is as follows: use QBiogene Fastprep DNA system to make genomic dna separate from P.pauciseta, use this genomic dna to amplify the 3DHD gene by PCR as template, this dna profiling is that the reaction by P.pauciseta3DHD one class introduction #3 and #4 (table 14.1) and Pwo polysaccharase (RocheBiochemicals) generates.The 1.1kb 3DHD gene segment that generates is introduced in yeast saccharomyces cerevisiae and expresses between the BamHI and XbaI position of carrier pJH413, generates plasmid pJH485.NotI-NotI in the expression band (Ptpil-FaOMT-Ttpil) of pJH485 is transferred to (Hansen etc., 2003, FEMS Yeast Res4:323-327) among the yeast combined belt thalline pYC070, generates plasmid pJH500.Restrictive diges-tion by Bsu36I makes 10 μ g plasmid pJH500 linearizings, and resultant is used to make Wine brewing yeast strain FSC58 to have anti-aureobasidin A (microbiotic of medium antimicrobial spectrum) property, generates yeast strain FSC67.

Whole yeast culture bases of synthetic (50ml is placed in the 250ml Ehrlenmeyer flask) and the 50 μ l Wine brewing yeast strain FSC67 inoculation of cultivating more than the night are grown in identical substratum, and the culture temperature that is suitable for growing is 30 ℃, and 150rpm rotates.After 24 hours, obtain the 1ml sample, the suspended substance of 500 μ l free cells growth is come out by 100% methanol extraction of equal volume.The suspended substance that generates is analyzed through HPLC in the serial HPLC of Agilent 1100 system, uses a ZorbaxSB-C18 chromatographic column (3.5 μ m), and the elution overview is as follows: at the gradient H that is 0-40% ₂(pH value 2.3 contains H to O ₂SO ₄Handled in the)-acetonitrile solution 3 minutes, and handled 1 minute in 40% acetonitrile solution, gradient is to handle 2 minutes in the acetonitrile solution of 40-80%, and gradient is to handle 1 minute in the acetonitrile solution of 80-90%, handles 1 minute in 90% acetonitrile solution subsequently.Protocatechuic Acid and vanilla aldehydic acid are detected by row's diode detector under 250nm and 210nm condition, and the ensuing elution time is: Protocatechuic Acid, 5.3 minutes; Vanilla aldehydic acid, 5.9 minutes.Result of experiment shows, except glucose and do not have under the condition of other presomas, bacterial strain FSC67 can produce the Protocatechuic Acid of 0.3g/l and the vanilla aldehydic acid of 0.01g/l.Can expect that the FaOMT methyltransgerase is for 3, the effect of the effect comparison substrate material Protocatechuic Acid of 4-gentisaldehyde substrate material is more effective, therefore will generate the more Protocatechuic Acid of high conversion in conjunction with the enzyme among the bacterial strain FSC67 of carboxylate reductase (ACAR), also can regain more Vanillin by glucose.

Influence 3, the 4-gentisaldehyde is converted into an ACAR gene of Vanillin process, separate with following mode: by using Invitrogen SuperscriptII reversed transcriptive enzyme method, the whole RNA that extract from white-rot fungi Pleurotus ostreatus or Trametes gibbosa are used for synthesizing cDNA, by using the cDNA library structure system of Stratagene, utilize the advantage of Nocardia ACAR nucleotide sequence information, make up a cDNA storehouse that contains phasmid, the introduction of front is identical with the carrier sequence, sail against the current immediately in the insertion point of cDNA, opposite introduction and Nocardia ACAR gene allos, the aminoacid sequence that transformed of this gene is compared with the aminoacid sequence that transformed of other putative ACAR genes, Nocardia ACAR gene can reach maximum evolution to be changed, and those putative ACAR genes can obtain (by comparing with NocardiaACAR) from disclosed sequence library.Manyly contain these introductions of base swing type (for example degraded of introduction) and preposition introduction one is used from the PCR reaction at different IPs thuja acid point, use the cDNA storehouse, from any one selection DNA of foregoing description, and high-fidelity (High Fidelity Plus) polysaccharase (RocheBiocehmicals).Select best annealing temperature and magnesium ion concentration, extract the PCR segment of about 0.8kb.By subclone and nucleotide sequence analysis, the fragment coding of P.ostreatus or T.gibbosa ACAR is 5 '-district.The sequence information that obtains is used to illustrate the oligonucleotide introduction that includes the ACAR front, in order to amplify 3 '-terminal of P.ostreatus or T.gibbosa ACAR gene, this introduction is used from the inset that end is the cDNA of 3 '-terminal with the introduction one that is inverted, and the introduction that is inverted is identical with carrier sequence in the database.Gene segment ordering back is separated, is defined as ACAT gene 3 '-terminal one class oligonucleotide introduction, in final PCR reaction, uses with 5 '-terminal, one class introduction, obtains long-chain P.ostreatus or T.gibbosa ACAR.The introducing of cDNA will be analyzed through DNA ordering among this clone, determine the ACAR gene order after, gene is introduced into the carrier pJH413 that yeast saccharomyces cerevisiae is expressed, and generates plasmid pJH413-X1.The genonema that NotI-NotI expresses is converted into plasmid pYC040 (Hansen etc., 2003, FEMS Yeast Res4:323-327), therefore generate plasmid pJH413-X2, use suitable restriction enzyme to make 10 μ g plasmid linearizations, resultant is used to make Wine brewing yeast strain FSC67 to have moisture resistance mycin (hygromycin) B, generates yeast strain FSC67-X1.

At last, whole substratum of synthetic (50ml is placed in the 250ml Ehrlenmeyer flask) and the 50 μ l Wine brewing yeast strain FSC67-X1 inoculation of cultivating more than the night are grown in identical substratum, the culture temperature that is suitable for growing is 30 ℃, and 150rpm rotates.After 0 hour, 24 hours, 48 hours, obtain the 1ml sample respectively, the suspended substance of 500 μ l free cells growths is come out by 100% methanol extraction of equal volume.The suspended substance that generates is analyzed through HPLC.The experiment discovery as presoma, can generate a large amount of Vanillin by yeast strain FSC67-X1 by glucose, has therefore obtained a biosynthetic means that regains Vanillin.

Oligonucleotide ide	5 '-3 ' sequence
Oligonucleotide ide	5 '-3 ' sequence	#1	ATTATCTAGAATGGGTTCCACCGGCGAGACTCAG
#2	ATTAGGATCCTCAGATCTTCTTAAGAAACTCAATG	#1	ATTATCTAGAATGGGTTCCACCGGCGAGACTCAG
#2	ATTAGGATCCTCAGATCTTCTTAAGAAACTCAATG	#3	ATTATCTAGAATGCCTTCCAAACTCGCCATCACTTC
#4	ATTAGGATCCTTACAAAGCCGCTGACAGCGACAG	#3	ATTATCTAGAATGCCTTCCAAACTCGCCATCACTTC

The oligonucleotide of using among table 14.1 embodiment 14

Embodiment 15: use yeast saccharomyces cerevisiae to generate the live body product of Vanillin glucosides

Test the VG product among the AS that Wine brewing yeast strain expresses, this product is grown by supplying with in batches in 2 liters of fermentor tanks, contains the Vanillin of sublethal concentrations in the liquid growth medium.Test contains the bacterial strain JH6 (adh6 adh7) of plasmid pJH413 (JH6[pJH413]).

Plasmid pJH413 generates by the following method: utilize oligonucleotide introduction #1 and #2 (table 15.1), amplify (AS) gene of red bayberry synthase (arbutin synthase), plasmid pQE60-AS (Arend etc., 2001, Biotechnol Bioeng76:126) is as reaction template.Reaction conditions is 94 ℃, 2 minutes, 1 circulation, and 94 ℃, 30 seconds, thermograde 48-55 ℃, 1 minute, 72 ℃, 2 minutes, 30 circulations are 72 ℃ subsequently, 7 minutes, and 1 circulation.Reaction product is that to contain desired size be 1.4kb segmental combination, is used for colligation to pCR-Blunt II-Topo carrier.Comprise that 1.5kb EcoRI introduces the clone of thing by introduction JH#23-27 ordering (table 10.1 among the embodiment 10).The clone of an appropriate dna sequence dna is identified, and from this plasmid, discharge AS ORF, discharge XbaI and BamHI (5 '-terminal of the introduction that amplifies at PCR comprises these positions), and be introduced in the Yeast expression carrier pJH259 (derivative of plasmid pJH235; Hansen etc., 2003, FEMS Yeast Res 2:137-149) corresponding position.The clone who introduces an appropriate AS is identified, and called after pJH413.

The bacterial strain JH6 that uses plasmid pJH413 and transform is in the substratum that contains 2ml SC-ura, inoculation is 48 hours under 30 ℃ of conditions, then in identical substratum, this is cultivated the whole dilutions of bacterium is 1.8 liters, cultivate the growth of bacterium oxide treatment after 24 hours, add more glucose (20g/l), add the 5mM Vanillin simultaneously.When the time is 48 hours, add the glucose of another part 10g/l and the Vanillin of 5mM, when the time is 72 hours, take out the 10ml product, extraction using alcohol cell and extracellular Vanillin and derivative thereof with heat, the product that extracts concentrates 10 times under vacuum condition, and spissated cultivation fungus extract is analyzed through LC-MS.The spissated cultivation bacterium product of a part uses apricot fruit beta-glucosidase to handle, and analyzes through LC-MS then.The cultivation bacterium that comprises Vanillin β-glucosides, vanilla aldehydic acid and vanilla aldehyde alcohol is analyzed by LC-Ms.

Experiment conclusion is, under the condition that yeast saccharomyces cerevisiae exists, the glycosylation by Vanillin can form the Vanillin glucosides by live body.For microbial organisms, because the toxicity of Vanillin glucosides is littler than the toxicity of aglycone Vanillin, then sum up, under the condition that yeast exists, suitably the expression of UDP-glucosyltransferase can improve the output of Vanillin.

Oligonucleotide	5 '-3 ' sequence
Oligonucleotide	5 '-3 ' sequence	#1	ATTATCTAGAATGGAACATACACCTCACATT
#2	ATTAGGATCCTTATGTACTGGAAATTTTGTTC	#1	ATTATCTAGAATGGAACATACACCTCACATT

The oligonucleotide that table 15.1 embodiment 15 uses

Embodiment 16: under the condition that yeast saccharomyces cerevisiae exists, the expression by model plant Arabidopis thaliana (Arabidaopsis thaliana) UGT89B1 glycosyltransferase generates excessive Protocatechuic Acid

Because the expression of handle spore Shell bacterium (Podospora pauciseta) 3-dehydroshikimate dehydratase (3DSD), can construct the structure of the Wine brewing yeast strain that generates Protocatechuic Acid, because the expression of model plant Arabidopis thaliana (Arabidaopsis thaliana) UGT89B1 glycosyltransferase, the Protocatechuic Acid that Wine brewing yeast strain can overproduction.

In order to obtain superfluous handle spore Shell bacterium (P.pauciseta) 3-dehydroshikimate dehydratase of expressing, the linearized plasmid pJH500 of Wine brewing yeast strain JH1 (such as embodiment 14 elaborations) conversion, method is as described in the embodiment 14.The yeast strain that generates is marked as FSC59, and this bacterial strain is used to the conversion of the plasmid pJH468 of UGT89B1 yeast expression.

Plasmid pJH468 generates by the following method: utilize oligonucleotide introduction #1 and #2 (table 16.1), PCR amplifies the UGT89B1 gene, and genome model plant Arabidopis thaliana (Arabidaopsisthaliana) DNA (Var.Columbia Col-0) is as reaction template.Reaction conditions is 94 ℃, 2 minutes, 1 circulation, and 94 ℃, 30 seconds, thermograde 50-60 ℃, 1 minute, 72 ℃, 2 minutes, 30 circulations are 72 ℃, 7 minutes, 1 circulation subsequently.Reaction product is that to contain desired size be 1.4kb segmental combination, is used for colligation to pCR-Blunt II-Topo carrier.Comprise that 1.4kb EcoRI introduces the clone of thing by introduction JH#14-18 ordering (table 10.1 among the embodiment 10).Use the clone of an appropriate dna sequence dna to be identified, and called after pJH407.From pJH407, discharge UGT89B1ORF, discharge XbaI-BamHI (position that comprises these qualifications in 5 ' of introduction-terminal), and be introduced in the pJH259 plasmid that is digested by XbaI-BamHI.The clone of an appropriate UGT89B1 introducing is identified, and called after pJH408.The exchange of the URA3 selective marker of this plasmid and G418R selective marker (come from plasmid pYC030, referring to Olesen etc., 2000, Yeast16:1035), yeast in " initial duplicate field " is removed by the determinate absorption of FseI, is removed then, therefore generates yeast in conjunction with plasmid pJH468.

Restrictive diges-tion by PsiI makes 10 μ g plasmid pJH468 linearizings, and resultant is used to make Wine brewing yeast strain JFSC59 to have anti-nourseothricin, generates yeast strain FSC60.

The whole yeast culture base of synthetic (50ml, be placed in the 250ml Ehrlenmeyer flask) inoculate with 50 μ l Wine brewing yeast strain JH1, the FSC59 and the FSC60 that cultivate more than the night, grow in identical substratum, the culture temperature that is suitable for growing is 30 ℃, and 150rpm rotates.After 48 hours, obtain the 1ml sample, the suspended substance of 500 μ l free cells growth is come out by 100% methanol extraction of equal volume.The suspended substance that generates is analyzed through HPLC in the Agilent1100 series HPLC system, uses a Zorbax SB-C18 chromatographic column (3.5 μ m), and the elution overview is as follows: at the gradient H that is 0-40% ₂(pH value 2.3 contains H to O ₂SO ₄Handled in the)-acetonitrile solution 3 minutes, and handled 1 minute in the solution of 40% acetonitrile, gradient is to handle 2 minutes in the acetonitrile solution of 40-80%, and gradient is to handle 1 minute in the acetonitrile solution of 80-90%, subsequently with processing in 90% the acetonitrile solution 1 minute.Protocatechuic Acid (PA) and Protocatechuic Acid-β-D-glucosides (PAG) detects by row's diode detector under 250nm and 210nm condition, and next the elution time is: protocatechnic acid, 5.4 minutes; Protocatechuic Acid-β-D-glucosides, 4.7 minutes.Identify PAG with the LC-MS analysis.

Result of experiment shows that bacterial strain FSC59 can produce the PA of 0.43g/l, and bacterial strain FSC60 can produce the PA of 0.28g/l and the PAG of 0.69g/l.After the product that is generated by bacterial strain FSC60 is handled through apricot fruit beta-glucosidase, the content that can increase PA reaches 0.62g/l, compare with the PA in the FSC59 bacterial strain under the condition that does not wherein contain the UGT89B1 glycosyltransferase of being expressed, the PA growing amount in the corresponding FSC60 bacterial strain surpasses 40%.

Sum up thus, under the condition that yeast exists, the expression by model plant Arabidopis thaliana (A.thaliana) UGT89B1 glycosyltransferase can generate excessive Protocatechuic Acid

Oligonucleotide	5 '-3 ' sequence
Oligonucleotide	5 '-3 ' sequence	#1	ATTATCTAGAATGAAAGTTAACGAAGAAAACAAC
#2	ATTAGGATCCTTACCACCGTTCTATCTCCATCTTC	#1	ATTATCTAGAATGAAAGTTAACGAAGAAAACAAC

The oligonucleotide that table 16.1 embodiment 16 uses

Embodiment 17: the structure that contains the yeast saccharomyces cerevisiae expression vector of double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1

In order to make the carrier of the easier generation yeast expression of appropriate subclone, use introduction to amplify three genes by PDR, this introduction has the DNA segmental annexation that comprises suitable restriction site.Use introduction that SbC79F1S and SbC79R1E are amplified CYP79A1 (using plasmid CYP79A1 PRT101 as template), use introduction that SbC71F1S and SbC71R1E are amplified CYP71E1 (using plasmid CYP71E1 pcDNAII as template), at last, use introduction that SbUDPF1S and SbUDPR1E are amplified UGT85B1 (using plasmid pcDNAI I-UGT85B1 as template), the oligonucleotide introduction sees Table 17.1.

Following method is followed in the PCR reaction: 10ng template DNA (volume 50 μ l) is used in each reaction, when ultimate density is 1 μ M, uses introduction and dNTPs, works as MgSO ₄When ultimate density is 2mM, amplify three genes by 5Upfu polysaccharase (Stratagen), next, the PCR reaction conditions that is used to amplify gene is as follows: initial 95 ℃, and 5 minutes, thereafter 95 ℃, 45 seconds, 35 circulations, temperature is Tm, 30 seconds and 72 ℃, 90 seconds, last 72 ℃, 10 minutes.The Tm of CYP79A1 is 62 ℃, and the Tm of CYP71E1 is 65 ℃, and the Tm of UGT85B1 is 64 ℃.

The gene of three amplifications is cloned into pCR-Blunt II-Topo (gene exsomatizes) at first, be converted into coli strain DN5 α then, with QIAGEN system (QIAGEN) separation quality grain, the dna sequence dna that generates by the introduction that uses suitable ordering is examined the integrity of three genes.

According to the description of product, three above-mentioned genes are before subclone arrives the carrier of yeast expression, by using limiting enzyme EcoRI and SpeI to discharge, regain DNA through sepharose-electrophoresis and use QIAeX system (Qiagen) then from the TOPO carrier.Similarly, Yeast expression carrier is cut away by EcoRI and SpeI, and handles through SPA, uses the QIAeX system to regain DNA equally.

According to the description of product, surpass a night down at 16 ℃, generate normalized thyroxine dna ligase (NewEngland Biolabs) knot, next is converted into coli strain DH5 α, use QIAGEN system separation quality grain, cut away and gel-electrophoresis process is examined the integrity of yeast expression structure by suitable qualification enzyme.

CYP79A1 be cloned in the following plasmid vector (Mumberg etc., 1995, Gene156:119-122): p416-GPD (generating p#33A), p426-GPD (generating p#34A), p416-TEF (generating p#41A), p426-TEF (generating p#42A).CYP71E1 is cloned in the following carrier: p413-GPD (generating p#27A), p423-GPD (generating p#28A), p413-TEF (generating p#35A), p413-ADH (generating p#43A).UGT85B1 is cloned among the carrier p415-GPD (generating p#S31B).

The oligonucleotide sequence of the introduction that table 17.1 is used to clone

Title	The introduction sequence
Title	The introduction sequence	SbC79F1S	5’-agcactagtatggcgacaatggaggtagaggcc-3’
SbC79R1E	5’-agcgaattctcagatggagatggacgggtagagg-3’	SbC79F1S	5’-agcactagtatggcgacaatggaggtagaggcc-3’
SbC79R1E	5’-agcgaattctcagatggagatggacgggtagagg-3’	SbC71F1S	5’-agcactagtatggccaccaccgccaccccgcagctcc-3’

SbC71R1E	5’-agcgaattcctaggcggcgcggcggttcttgtatttgg-3’
SbC71R1E	5’-agcgaattcctaggcggcgcggcggttcttgtatttgg-3’	SbUDPR1E	5′-agcgaattctcactgcttgcccccgaccagcagc-3’
SbUDPF1S	5′-agcactagtatgggcagcaacgcgccgcctcc-3’	SbUDPR1E	5′-agcgaattctcactgcttgcccccgaccagcagc-3’

Embodiment 18: Wine brewing yeast strain is expressed double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1 and is comprised the structure of the bacterial strain of copying plasmid

By electrophoresis (Becker and Guarente, 1991, Methods in Enzymology194:182-187) process, carry out yeast strain BY4741 standard zymic and transform (mata his3D1 leu2D0met15D0 ura 3D0) (EUROSCARG).

By mentioning the conversion of plasmid in above setting forth, select SC-His, Ura, the yeast strain (expressing three double-colored chinese sorghum Sorghum genes) below the Leu substratum generates.

By containing plasmid p#27A, the BY4741 of p#33A and p#S31B transforms and forms Y0109.

By containing plasmid p#28A, the BY4741 of p#34A and p#S31B transforms and forms Y0113.

By containing plasmid p#35A, the BY4741 of p#41A and p#S31B transforms and forms Y0117.

By containing plasmid p#43A, the BY4741 of p#42A and p#S31B transforms and forms Y0121.

By mentioning the conversion of plasmid in above setting forth, select SC-His, Ura, the yeast strain below the Leu substratum generates (contain and copy plasmid).

By containing plasmid p413-GPD, the BY4741 of p416-GPD and p415-GPD transforms and forms Y0084.

By containing plasmid p423-GPD, the BY4741 of p426-GPD and p415-GPD transforms and forms Y0085.

By containing plasmid p413-TEF, the BY4741 of p416-TEF and p415-GPD transforms and forms Y0086.

By containing plasmid p413-ADH, the BY4741 of p426-TEF and p415-GPD transforms and forms Y0087.

By mentioning the conversion of plasmid in above setting forth, select SC-His, Ura, the Leu substratum generates bottom yeast bacterial strain (expressing two double-colored chinese sorghum Sorghum gene C YP79A1 and CYP71E1).

Transform formation Y0091 by the BY4741 that contains plasmid p#27A and p#33A.

Transform formation Y0092 by the BY4741 that contains plasmid p#28A and p#34A.

Transform formation Y0093 by the BY4741 that contains plasmid p#35A and p#41A.

Transform formation Y0094 by the BY4741 that contains plasmid p#43A and p#42A.

Transform formation Y0071 by the BY4741 that contains plasmid p413-GPD and p416-GPD.

Transform formation Y0072 by the BY4741 that contains plasmid p423-GPD and p426-GPD.

Transform formation Y0073 by the BY4741 that contains plasmid p413-TEF and p416-TEF.

Transform formation Y0074 by the BY4741 that contains plasmid p413-ADH and p426-TEF.

By mentioning the conversion of plasmid in above setting forth, select SC-His, Ura, the Leu substratum generates bottom yeast bacterial strain (expressing two double-colored chinese sorghum Sorghum gene C YP79A1 and UGT85B1).

Transform formation Y0103 by the BY4741 that contains plasmid p#33A and p#S31B.

Transform formation Y0104 by the BY4741 that contains plasmid p#34A and p#S31B.

Transform formation Y0105 by the BY4741 that contains plasmid p#41A and p#S31B.

Transform formation Y0106 by the BY4741 that contains plasmid p#32A and p#S31B.

By mentioning the conversion of plasmid in above setting forth, select SC-His, Ura, the yeast strain below the Leu substratum generates (contain and copy plasmid):

Transform formation Y0078 by the BY4741 that contains plasmid p416-GPD and p415-GPD.

Transform formation Y0079 by the BY4741 that contains plasmid p426-GPD and p415-GPD.

Transform formation Y0080 by the BY4741 that contains plasmid p416-TEF and p415-GPD.

Transform formation Y0081 by the BY4741 that contains plasmid p426-TEF and p415-GPD.

Embodiment 19: Wine brewing yeast strain is expressed double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1 and is comprised the breeding of copying the plasmid bacterial strain

Above-mentioned yeast strain breeds under suitable synthetically grown environment, ignores to lack in the growing environment to be used for the same seed amino acid selected by transformant.Cell is 28 ℃ of growths down, and volume 3ml rotates with 175RPM, up to generating stable phase.In the 15ml culture test tube, carry out the liquid state breeding.

Before glucose fermentation, the cell that grows the cultivation bacterium is by centrifuging (4000RPM, 10 minutes) regain, from ineffective substratum, separate, wash, synthetic glucose touch the bottom (SD+) in substratum, regain by centrifuging again, be suspended in again in the suitable SD+ substratum of 3ml at last.

At first use SC-His, Ura, the bacterial strain that Leu selects is suspended among the SD+Lys again, uses SC-His at first, the Met. bacterial strain that Ura selects is suspended in SD+Lys again, among the Met, uses SC-Ura at first, the Leu. bacterial strain that Leu selects is suspended in SD+Lys again, and Met is among the His.

After cell was suspended in the SD+ substratum again, liquid cultivation bacterium kept 28 ℃, and 175RPM collects product, and is as described below, next analyzes with LC-MS.

Embodiment 20: Wine brewing yeast strain is expressed double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1 and is comprised the metabolite analysis of copying the plasmid bacterial strain

In order to analyze the composition of the secondary metabolites that generates by above-mentioned yeast strain, collected the 0.5ml sample after in the SD+ substratum, suspending again 24 hours, 48 hours, 72 hours and 92 hours, if the analysis dhurrin then only needed 24 hours and 48 hours collection samples.

The total content (by glycosylated amount with not by the glycosylation molecule) of a specific secondary metabolites in using the LC-MS analytic sample before, sample will pass through the processing of beta-glucosidase (Fluka).

Separate from substratum by centrifuging (4000RPM, 10 minutes) cell, separate 333 μ l liquid phases from each sample, vacuum-drying then is suspended in the methyl alcohol (MeOH) of 50 μ l50% again.Methanol suspension through 15000RPM, 10 minutes centrifuging after, 25 μ l samples are used for LC-MS assay products feature, use LC-MS to analyze before sample-20 ℃ of storages.

By in dose known amounts, add 0.5ml substratum (sample preparation after in the SD+ substratum, suspending 48 hours) the suitable reference coupon of preparation in the specific reference compound, reference compound is added substratum after, reference coupon is handled immediately according to the method described above.In order to prepare the corresponding reference coupon of triplication, change the concentration (0.1 μ g/ml, 1 μ g/ml, 10 μ g/ml) of reference coupon to specific secondary metabolites quantitative analysis.At last, for every kind of detected molecule,, prepare a reference coupon (in 50% methyl alcohol, concentration is 1 μ g/ml) that only contains specific compound for unique definite retention time.

Use Agilent 1100 serial LC (Agilent Technologies, Germany) and Bruker Esquire3000+ ion massspectrum (Bruker Daltonics, Bremen, Germany) Lian He LC-MS analyzes, and uses XTerra MS C18 chromatographic column (Waters, Milford, MA, 3.5 μ M, 2.1x100mm), flow velocity 0.2ml/min.Moving phase is: A, 0.1% (v/v) HCOOH and 50 μ MNaCl; B, 0.1% (v/v) HCOOH and 80% (v/v) MeCN.The process gradient is: 0-3 minute, and average 3% (v/v) B; 2-30 minute, linear gradient 3-50%B; 30-35 minute, linear gradient 50%-100% (v/v) B; 35-40 minute, average 100%B.Mass spectrum is configured to electrospray ionization (ESI) positive charged ions pattern, and every kind whole ionic currents of [M+Na]+adducts and ion trajectory are used for the compound location.Detecting under the situation of aglycone, mass spectrum is configured to the positively charged pattern of barometric point chemical ioni zation (APCI), use Bruker Daltonics Dataanalysisv.3.1 software carry out spectroscopic analysis (Bruker Daltonik, GmBH).

To the quantitative analysis of a specific secondary metabolites (aglycone or its glycosylation form),, and relatively be worth and the peak value of the corresponding reference coupon typical curve of three kinds of known quantities of this sample by the integration of mass spectrum volume peak area (LC-MS).

Embodiment 21: express the glucose fermentation of double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1 by Wine brewing yeast strain, generate right-hydroxylphenylethyl alcohol nitrile-β-D-glucosides (dhurrin)

Use following time point, detect, Y0113, the content of the dhurrin that Y0117 and Y0121 generate by fermentation strain Y0109.According to formula [dhurrin (ng/ml)]=6E-17I ^2.5218(R=0.92) return, calculate dhurrin content, wherein I is the mass spectra peak area, and this formula comes from the peak value of three samples, as mentioned above.

Table 21.1 Wine brewing yeast strain is expressed the dhurrin that generates among double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and the UGR85B1

The retention time of dhurrin (m/z=334) is 13.6 minutes

By using the network propylhomoserin tracking test of radioactivity-mark, proof dhurrin (right-the hydroxylphenylethyl alcohol nitrile) aglycon does not exist, this is consistent with previous technical knowledge, once there was document to set forth dhurrin aglycon very unstable (Halkier and Moller in the aqueous solution, 1989, Plant Journal90:1552-1559).Carry out glycosylation by UGT85B1, causing in fact, the surplus of the indefinite of this unsettled aromatic nitrile generates.In m/z=334, retention time is not have the peak at 13.6 o'clock, has yeast strain (bacterial strain Y0084, Y0085, Y0086 and Y0087) under the situation of copying plasmid, finds that the peak exceeds background interference.Have at bacterial strain (Y0094, Y0095, Y0096 and Y0097) under the situation of the plasmid that CYP79A1 and CYP71E1 express, m/z=334, retention time are not have the peak at 13.6 o'clock, and we find to exceed at any time 10ng/ml.Therefore, using the bacterial strain Y0113 of fermentation after 48 hours, the another name for Sichuan Province of 945ng/ml belongs to glycosides and reaches 94 times excess quantity, and this is the result that glycosyltransferase UGT85B1 expresses.

Embodiment 22: by the expression of double-colored chinese sorghum Sorghum CYP79A1, CYP71E1 and UGR85B1, generate compound with the dhurrin biosynthetic means

The mass spectrum of sample shows, come from the dhurrin biosynthesizing and react the existence of the glycosylation molecular product of the intermediate that generates, sample is under the gene prod condition of different mole numbers, and bacterial strain is expressed double-colored chinese sorghum Sorghum CYP79A1, CYP7 1E1 and UGR85B1.Therefore, can believe the glycosylation intermediary by glycosyltransferase (for example UGT85B1), can cause the continuous transfer of the intermediate of biosynthesizing reaction generation, therefore specific aglycone is superfluous to be generated.In table 22.1, enumerated the numerical value of the glycosylated compound of pass through the generation of dhurrin biosynthetic means that different sorts generally acknowledges.Quantization method is identical with the measuring method of the dhurrin of above setting forth, and uses identical equation.

Table 22.1 glycosylated compound is different from double-colored chinese sorghum Sorghum CYP79A1, the CYP71E1 of Wine brewing yeast strain expression and the dhurrin that UGR85B1 generates.

A) alternate, the m/z=323 ion is right accordingly-and glucosyloxy-M-nitro benzoic acid or glycosyl be right-the Para Hydroxy Benzoic Acid ester.The retention time of right-glucosyloxy-phenylethyl alcohol is 14.4 minutes, and the retention time of right-glucosyloxy-phenylacetonitrile is 14.4 minutes, and the retention time of right-glucosyloxy-phenyl aldehyde is 19.7 minutes.

Embodiment 23: the intermediate that the dhurrin biosynthetic means by the expression of double-colored chinese sorghum Sorghum gene C YP79A1, CYP71E1 and UGR85B1 in the yeast saccharomyces cerevisiae produces, excessive production compound

Right by using-glucosyloxy-phenylethyl alcohol, right-glucosyloxy-M-nitro benzoic acid, glycosyl is right-the authoritative standard of Para Hydroxy Benzoic Acid ester, right-glucosyloxy-phenylacetonitrile and right-glucosyloxy-phenyl aldehyde, differentiate dhurrin, as mentioned above, clearly differentiate the above-mentioned sugar that obtains with identical method.

The discriminating of aglycone molecule is carried out as follows with quantitative analysis: at one time with identical aforesaid method, collection contains the growth medium of expressing dhurrin biosynthesis gene bacterial strain, perhaps collect to contain and carry the growth medium of copying the plasmid bacterial strain, thereafter, the substratum that no longer works is handled (in order to discharge aglycone from their glucosides form) with beta-glucosidase, in addition, in order to determine the content of specific aglycone, the corresponding reference sample of preparation triplication only changes concentration (the 0.1 μ g/ml of reference coupon, 1 μ g/ml, 10 μ g/ml).At last, for every kind of detected molecule,, prepare a reference coupon (in 50% methyl alcohol, concentration is 1 μ g/ml) that only contains specific compound for unique definite retention time.

Can superfluously generate in order to prove by glycosylation, the output and the output that contains the specific aglycon of only expressing CYP79A1 (also can be CYP71E1 under some situation) bacterial strain that must relatively contain the specific aglycon (handling the back through beta-glucosidase) of expressing UGT85B1 and CYP79A1 bacterial strain, this process proof are 1.5 times excessive production at least.

Reference

Following reference chooses from numerous reference, and is the most relevant with the present invention.

Paquette, S. etc., Phytochemistry62 (2003) 399-413

WO01/07631

WO01/40491

Arend, J etc., Biotech.﹠amp; Bioeng (2001) 78:126-131

Tattersall, DB etc., Science (2001) 293:1826-8

Moehs, CP etc., Plant Journal (1997) 11:227-236

US6372461

Claims

1, a kind of method that generates the organic glycoside compound of lower molecular weight may further comprise the steps:

A) a kind of microorganism cells of fermentation in the substratum that suitable microorganism is fit to grow, microorganism cells comprises one and participates in biosynthetic means, generate the encoding gene of the product of a lower molecular weight aglycone organic compound, glycosyltransferase with a glycosyltransferase gene coding with aglycone glycosylation ability of the generation of making, under suitable condition, cell wherein produces the glycosylation form of aglycone and corresponding aglycone

B) de-glycosylation of the glycosylation form of aglycone, and

C) regain glycoside compound

(i) molecular weight of described lower molecular weight aglycone compound is 50-3000, and

(ii) described glycosyltransferase can make sugar be connected on the glycoside compound molecule.

2, method according to claim 1, the described microorganism cells of glycosyltransferase that contains in the cultivation and fermentation process is compared with not containing the same microorganism cells of glycosyltransferase, can generate the glycosylation form of more aglycone.

3, method according to claim 2, described microorganism cells are a kind of yeast cell.

4, method according to claim 3, described yeast cell is from by yeast belong (Saccharomyces spp.), as yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), and Pichia (Picha spp.) formed cell bank in choose.

5, method according to claim 2, described microorganism cells are a kind of prokaryotic cell prokaryocytes.

6, method according to claim 5, described prokaryotic cell prokaryocyte are a kind of intestinal bacteria (E.coli) cells.

7. according to above-mentioned any claim, described glycosyltransferase gene is a kind of allogenic glycosyltransferase gene.

8, according to above-mentioned any claim, described glycosyltransferase is a kind of UDPG-glycosyltransferase, preferably a kind of UDPG-Transglucosylase.

9, according to above-mentioned any claim, comprise a kind of organic glycoside compound that has hydroxyl, amino, sulphur or carboxyl functional group in the organic glycoside compound of described lower molecular weight, these functional groups can be by the described glycosyltransferase glycosylation of above-mentioned any claim.

10, method according to claim 9 comprises a kind of compound that has hydroxy functional group (for example alcohol) in the organic glycoside compound of described lower molecular weight, this functional group can be by the described glycosyltransferase glycosylation of above-mentioned any claim.

11, according to claim 9 or 10 described methods, the molecular weight of described glycoside compound is 50-1000.

12, method according to claim 11, described glycoside compound is a secondary metabolic compounds.

13, method according to claim 12, described secondary metabolic compounds are the plant secondary metabolic compounds, choose from following:

Terpenoid compound

Alkaloid

The phenylpropionic acid class

Phenyl derivatives

The hexanol derivative

Flavonoid

Tonka bean camphor, stilbene

Cyanalcohol

Vegetalitas Glucosinolates (Glucosinolates)

14, method according to claim 13, the organic glycoside compound of described plant secondary metabolites is a Vanillin.

15, method according to claim 14, described microorganism cells are a kind of yeast cell.

16, method according to claim 15, described yeast cell is from by yeast belong (Saccharomyces spp.), as yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), and Pichia (Picha spp.) formed cell bank in choose.

17, method according to claim 14, described microorganism cells are a kind of prokaryotic cell prokaryocytes.

18, method according to claim 17, described prokaryotic cell prokaryocyte are a kind of intestinal bacteria (E.coli) cells.

19, according to above-mentioned any claim, the described step b) de-glycosylation of described claim 1 is reflected at the extracellular of grown cell and carries out, and the glycosylation form of the aglycone that step a) generates by secretion or extract after carry out, wherein glycosylation is by an enzymatic process of beta-glucoside.