CN101018862A - Synthesis of long-chain polyunsaturated fatty acids by recombinant cells - Google Patents
Synthesis of long-chain polyunsaturated fatty acids by recombinant cells Download PDFInfo
- Publication number
- CN101018862A CN101018862A CNA2005800206963A CN200580020696A CN101018862A CN 101018862 A CN101018862 A CN 101018862A CN A2005800206963 A CNA2005800206963 A CN A2005800206963A CN 200580020696 A CN200580020696 A CN 200580020696A CN 101018862 A CN101018862 A CN 101018862A
- Authority
- CN
- China
- Prior art keywords
- cell
- seq
- desaturases
- enzyme
- pufa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
- Y02A40/818—Alternative feeds for fish, e.g. in aquacultures
Abstract
The present invention relates to methods of synthesizing long-chain polyunsaturated fatty acids, especially eicosapentaenoic acid, docosapentaenoic acid and docosahexaenoic acid, in recombinant cells such as yeast or plant cells. Also provided are recombinant cells or plants which produce long-chain polyunsaturated fatty acids. Furthermore, the present invention relates to a group of new enzymes which possess desatorase or elongase activity that can be used in methods of synthesizing long-chain polyunsaturated fatty acids.
Description
Technical field
The present invention relates in the reconstitution cell method of synthetic longer chain fatty acid, particularly timnodonic acid, clupanodonic acid and docosahexenoic acid in yeast or the vegetable cell for example.The reconstitution cell or the plant that produce long chain polyunsaturated fatty acids also are provided.In addition, the present invention relates to one group of new desaturase with the method that can be used for synthesis of long-chain polyunsaturated fatty acids (desaturase) or the active enzyme of prolongation enzyme (elongase).
Background technology
ω-3 long chain polyunsaturated fatty acids is acknowledged as the important compound relevant with the mankind and animal health now.Can directly obtain these lipid acid from the diet source, perhaps can obtain these lipid acid by transforming linolic acid (LA, ω-6) or alpha linolenic acid lipid acid such as (ALA, ω-3), these two kinds of lipid acid all are considered to the indispensable fatty acid in the human diet.Though human and multiple other vertebrates can both change into LC-PUFA with LA or the ALA that comes from plant origin, they can only carry out this conversion with low-down efficient.In addition, all there is unbalance diet in most modern societies, and wherein at least 90% polyunsaturated fatty acid is made up of ω-6 lipid acid, rather than 4: 1 or lower ω-6: ω-3 ratio, this ratio is considered to ideal ratio (Trautwein, 2001).The human LC-PUFA for example direct diet of timnodonic acid (EPA, 20: 5) and docosahexenoic acid (DHA, 22: the 6) overwhelming majority that originates comes from fish or fish oil.Therefore the specialty health worker is recommended in and comprises the fish that contains very high-level LC-PUFA in the human diet routinely.The LC-PUFA oil in fish source is incorporated in the food more and more and is used to infant formulas.But, because the whole world and the decline of national fishery, need other sources of the oil of these useful reinforcement health.
For example EPA is relevant with the healthy associated benefits of many kinds with DHA to comprise ω-3 LC-PUFA in human diet.These benefits comprise prevention or reduce coronary artery disease, hypertension, diabetes B, kidney disease, rheumatoid arthritis, ulcerative colitis and chronic obstructive pulmonary disease, and help brain to grow and growth (Simopoulos, 2000).Recently, a plurality of researchs have shown that also ω-3 PUFA can be of value to infant nutrition and growth, and are of value to anti-various mental cases such as schizophrenia, hyperkinetic syndrome and Alzheimer disease.
Opposite with animal, higher plant lacks the ability of synthetic chain length greater than the polyunsaturated fatty acid of 18 carbon.Particularly, farm crop and gardening plant and other angiosperm do not have synthetic source from the long-chain omega-fatty acid of ALA for example EPA, DPA and the required enzyme of DHA.Therefore an important goal of Plant Biotechnology is the crop plants of a large amount of LC-PUFA of genetically engineered product, and oilseeds farm crop particularly provide other sources of these compounds in view of the above.
LC-PUFA synthetic approach
Desaturation reaction by a series of alternative oxygen dependences shown in diagram among Fig. 1 and prolong reaction can be so that generation be from the biosynthesizing to LC-PUFA of linolic acid and alpha linolenic acid lipid acid organism (for example microalgae, liver moss and fungi) body in.A kind of approach (Fig. 1, II) in, by Δ 6, Δ 5 and the reaction of Δ 4 desaturase catalysis desaturations, every kind of enzyme all increases extra two keys to fatty acid carbon chain, and each Δ 6 and Δ 5 prolong reaction and all add one two carbosilane unit, to prolong carbochain.Therefore the ALA in these organisms requires three desaturation reactions and two prolongation reactions to the conversion of DHA.For example cloned microalgae, liver moss and the fungi and be coded in the gene of producing the required enzyme of DHA in this aerobic approach from various microorganisms and lower plant.Comprise the gene (Sayanova and Napier summary, 2004) of isolating coding some of them enzyme (enzyme that comprises the 5th step of catalysis, Δ 5 prolongs enzyme) the Mammals from vertebrates.But it is not to be specific to the reaction of EPA to DPA that the Δ 5 that is separated to from the human cell prolongs enzyme, and it has specificity (Leonard et al., 2002) widely to the lipid acid substrate.
In some organisms, ALA other approach that exist have been demonstrated to two parts of DHA approach.In some protobiont and thraustochytriale (thraustochytrids), prolong combination (the so-called Δ 8 desaturation approach of enzyme and Δ 8 desaturases by Δ 9, see Fig. 1, IV) can realize the conversion of ALA to ETA, as the gene that is separated to encoding such enzymes confirm (Wallisand Browse, 1999; Qi et al., 2002).In Mammals, so-called " Sprecher " approach can change into DHA (Sprecheret al., 1995) with DPA by three reactions that do not rely on Δ 4 desaturases.
Except these desaturases/prolongation enzyme system, by multiple organism for example the anaerobism approach among Shewanella, Mortiella and the Schizhochytrium also can synthesize EPA and DHA (Abbadi et al., 2001).Operon (Morita et al., 2000 of coding these polyketide synthases (PKS) combined enzyme agent from some bacteriums, have been cloned; Metz et al., 2001; Tanaka etal., 1999; Yazawa, 1996; Yu et al., 2000; WO 00/42195).In Synechococcus, expressed the EPA PKS operon that from Shewanella spp, is separated to, so that allow its synthetic EPA (Takeyama et al., 1997).The sequence in the gene of encoding such enzymes is not also reported their expression in transgenic plant on sizable operon.Whether therefore, still need to study anaerobic PKS sample system is the possible alternative system of more classical aerobic desaturase/prolongation enzyme for the synthetic LC-PUFA of transgenosis.
Desaturase
Demonstrated the desaturase that participates in LC-PUFA and all belonged to one group of so-called " front end " desaturase, their characteristics are all to have cytochrome b at every kind of proteic N-terminal
5Structural domain.Cytochrome b
5May be as acceptor (Napier et al., 1999 of the required electronics of desaturation; Sperling and Heinz, 2001).
The more desaturation of Δ 5 desaturase catalysis C20 LC-PUFA causes having produced arachidonic acid (ARA, 20:4 ω 6) and EPA (20:5 ω 3).From multiple organism, isolated the gene of this enzyme of coding, organism comprises algae (thraustochytriale (Thraustochytrium sp.) Qiuet al., 2001), fungi (M.alpine, abnormal female corruption mould (Pythium irregulare), Michaelsonet al., 1998; Hong et al., 2002), Caenorhabditis elegans (Caenorhabditis elegans) and Mammals.Also from zebra fish, identified the gene (Hasting et al., 2001) of difunctional Δ 5/ Δ 6 desaturases of coding.The gene of coding this kind of enzyme may be represented ancestors' form of " front end desaturase ", and it duplicates to go forward side by side and dissolves different functions afterwards.The last desaturation step of producing DHA is catalytic by Δ 4 desaturases, gene (Qiu et al., 2001 of isolating this enzyme of coding from fresh water protobiont species very thin eye worm (Euglenagracilis) and marine species thraustochytriale; Meyer et al., 2003).
Prolong enzyme
Isolated the gene (Sayanova and Napier, 2004) that some coding PUFA prolong enzyme.The intravital prolongation enzyme gene (for example FAE1 of Arabidopsis (Arabidopsis)) that relates to the prolongation of saturated and monounsaturated fatty acids of the member of this gene family and higher plant has nothing to do.The latter's example is the erucic acid (22: 1) in the Btassica (Brassicas).In some primeval life species, by carrying out desaturation (Fig. 1, IV part with Δ 8 desaturases; " Δ 8 desaturations " approach) before, can synthesize LC-PUFA with C2 unit's prolongation linolic acid or alpha linolenic acid.In these species, do not detect Δ 6 desaturases and Δ 6 prolongation enzymic activitys.The substitute is, detected Δ 9 and prolong enzymic activity in these organisms, what support this point is to have isolated C18 Δ 9 recently and prolong enzyme (Qi et al., 2002) from Isochrysis galbana (Isochrysis galbana).
The genetically engineered production of LC-PUFA
Having proposed will be by inserting these genes by the genetically engineered constant source that is the transgenosis oilseeds crop of the main LC-PUFA of production as the important lipid acid of nutrition.But because need may be from the coordinate expression and the activity of five kinds of new enzymes of the coded by said gene of different sources, this makes that always this target is difficult to realize that this proposal is still a kind of supposition so far.
Prolong enzyme and Δ 6 and Δ 5 fatty acid desaturases by coexpression Δ 6 and successfully in yeast, constructed the biosynthetic approach of LC-PUFA oxygen dependence (Fig. 1) that produces EPA, caused by a spot of of the ARA that linolic acid and alpha linolenic acid produced of external source supply and EPA but accumulated (Beaudoin et al., 2000 significantly; Zank et al., 2000).This shows that the gene that is subordinated to the LC-PUFA route of synthesis can play a role in heterologous organism.But the efficient that produces EPA is low-down.For example, three kinds of genes (Beaudoin et al., 2000) in yeast, have been expressed from Caenorhabditis elegans, Borrago officinalis (Boragoofficinalis) and Mortierella alpina (Mortierella alpina).When to transformed yeast supply 18:2 ω-3 (LA) or 18:3 ω-3 (ALA), only produced a spot of 20:4 ω-6 or 20:5 ω-3, transformation efficiency is respectively 0.65% and 0.3%.Other investigators express two kinds of desaturases and a kind of gene that prolongs enzyme by using in yeast, obtained very generation (Domergue et al., the 2003a of inefficient EPA equally; Zank et al., 2002).Therefore, still need to improve the efficient that for example produces EPA organism in the yeast, making to produce individually to provide the C22 of additional enzyme step PUFA.
Having obtained some in exploring the research that aerobic LC-PUFA biosynthetic pathway is incorporated into higher plant (comprising oilseed crops) in improves and (summarizes Sayanova and Napier, 2004; Drexler et al., 2003; Abbadi et al., 2001).In genetically modified tobacco and Arabidopsis, express the gene of coded delta 6 fatty acid desaturases that from the Borrago officinalis, are separated to, make and in transgenic plant, produced GLA (18:3 ω 6) and SDA (18:4 ω 3), they are direct precursor (Sayanova et al., 1997 of LC-PUFA; 1999).But this only provides single first step.
The combination that Domergue etc. (2003a) have used three kinds of coded delta 6-and Δ 5-fatty acid desaturase and Δ 6-to prolong the gene of enzyme in yeast and transgenosis Semen Lini.Delta 8 desaturase genes comes from diatom Phaeodactylum tricornutum (Phaeodactylum tricornutum), and prolongation enzyme gene comes from liver moss small liwan moss (Physcomitrella patens).For the Δ 6-lipid acid that the yeast cell endogenous produces, only obtained lower prolongation productive rate (promptly making up first and second enzyme step), formed main C20 PUFA product is 20:2
Δ 11,14, representing unwanted side reaction.Domergue etc. (2003a) claim that also (not having display data) express the combination of three kinds of genes in transgenosis flax, have produced ARA and EPA subsequently, are inefficient but produce.They think and exist in the seed of higher plant as observed same problem in yeast, and need to solve " bottleneck " that produces LC-PUFA in oilseed crops.
WO 2004/071467 (DuPont) has reported various desaturases and has prolonged the expression of enzyme in soya cells, but do not shown DHA synthesizing in recombinant plant or seed.
Abbadi etc. (2004) have described the trial of expressing desaturase and prolong the combination of enzyme in transgenosis flax, but have only obtained the synthetic of low-level EPA.
Abbadi etc. (2004) show that the generation of their low-level EPA also is because unknown " bottleneck ".
Qi etc. (2004) have realized synthetic in leaf, but are not reported in the result in the seed.This is an important problem, because LC-PUFA synthetic performance can be different between leaf and seed.Particularly, oilseeds seed stored lipid great majority in seed all are TAG, and leaf synthetic lipid great majority all are phosphatidyl fat.In addition, Qi etc. (2004) has only produced AA and EPA.
Therefore, need more in reconstitution cell, to produce the method for long chain polyunsaturated fatty acids (particularly EPA, DPA and DHA).
Summary of the invention
In first aspect, the invention provides the reconstitution cell of energy synthesis of long-chain polyunsaturated fatty acids (LC-PUFA), the polynucleotide that comprise at least two kinds of enzymes of one or more codings, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide operably are connected with one or more promotors that can instruct described polynucleotide at cell inner expression, and wherein said reconstitution cell is derived from the cell that can not synthesize described LC-PUFA.
Aspect second, the invention provides with respect to waiting non-reconstitution cell of gene to have the reconstitution cell of the ability of the synthetic LC-PUFA of enhanced, the polynucleotide that comprise at least two kinds of enzymes of one or more codings, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide operably are connected with feasible one or more promotors that can express described polynucleotide in described reconstitution cell.
In one embodiment, at least a enzyme is that Δ 5 prolongs enzyme.
The present inventor identifies first has the enzyme that prolongs the higher Δ of enzymic activity 5 prolongation enzymic activitys than Δ 6.Therefore, this enzyme provides a kind of effective ways that produce DPA in reconstitution cell, prolongs because the Δ of EPA 5 prolongs the Δ 6 that is better than SDA.Therefore, in one embodiment, it is special relatively that Δ 5 prolongs enzyme, and promptly Δ 5 prolongation enzymes also have Δ 6 prolongation enzymic activitys, and it is more more effective among the synthetic ETA from SDA than it among the synthetic DPA from EPA to prolong enzyme.
In another embodiment, Δ 5 prolongation enzymes comprise:
I) aminoacid sequence that is provided as SEQ ID NO:2;
Ii) have at least 50%, preferred at least 80% even the aminoacid sequence of preferred at least 90% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
In another embodiment, but Δ 5 prolongs the enzyme purifying from algae.
In another embodiment, wherein at least a enzyme is that Δ 9 prolongs enzyme.
The present inventor identifies first has the enzyme that Δ 9 prolongs enzymic activity and Δ 6 prolongation enzymic activitys.When this enzyme when having the cell inner expression of Δ 6 desaturases and Δ 8 desaturases, this enzyme utilizes two kinds of feasible way to produce ETA from ALA, produces DGLA or both (see figure 1)s from LA, has therefore increased the efficient that ETA and/or DGLA produce.Therefore, in one embodiment, Δ 9 prolongs enzyme and also has Δ 6 prolongation enzymic activitys.Preferably, Δ 9 prolongation enzymes are more more effective among the synthetic ETA from SDA than it among the synthetic ETrA from ALA.In addition, in another embodiment, in yeast cell, Δ 9 prolongs enzyme and SDA can be extended for ETA, GLA is extended for DGLA, or both all can.
In another embodiment, Δ 9 prolongation enzymes comprise:
I) aminoacid sequence that is provided as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
Ii) have at least 50%, preferred at least 80% even the aminoacid sequence of preferred at least 90% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii).
Preferably, can from algae or fungi, be purified into Δ 9 and prolong enzyme.
Well known in the artly be, genetically modified number in the organism is many more, the possibility of at least a adaptability parameter of infringement organism is just big more, and described adaptability parameter is for example at least a genetically modified expression level, the speed of growth, oilseeds generation, fecundity etc.Therefore, the genetically modified number in the reconstitution cell need be minimized.Up to now, the present inventor has proposed the multiple strategy that produces LC-PUFA in cell, and these strategies have avoided each step in the relational approach all corresponding to the needs of a gene.
Therefore, in another embodiment, one of them plants enzyme is Δ 5/ Δ, 6 difunctional desaturases or Δ 5/ Δ 6 difunctional prolongation enzymes.Can produce Δ 5/ Δ 6 difunctional desaturases natively with the fresh water fingerling.
In an embodiment, Δ 5/ Δ 6 difunctional desaturases comprise:
I) aminoacid sequence that is provided as SEQ ID NO:15;
Ii) have at least 50%, preferred at least 80% even the aminoacid sequence of preferred at least 90% homogeny with SEQ ID NO:15; Or
Iii) i) or biological active fragment ii).
Preferably, can produce Δ 5/ Δ 6 difunctional desaturases natively with the fresh water fingerling.
Preferably, Δ 5/ Δ 6 difunctional prolongation enzymes comprise:
I) aminoacid sequence that is provided as SEQ ID NO:2 or SEQ ID NO:14;
Ii) have at least 50%, preferred at least 80% even the aminoacid sequence of preferred at least 90% homogeny with SEQ ID NO:2 or SEQ ID NO:14; Or
Iii) i) or biological active fragment ii).
In another embodiment, one of them kind enzyme is Δ 5 desaturases.
In further embodiment, one of them plants enzyme is Δ 8 desaturases.
In another embodiment, LC-PUFA is docosahexenoic acid (DHA).
Preferably, three kinds or four kinds enzymes of the polynucleotide encoding of being introduced, described enzyme are Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzyme or Δ 4 desaturases.More preferably, described enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ 6 difunctional desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme, Δ 6 prolongs enzyme and Δ 4 desaturases; Or
Iii) Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases.
In another embodiment, LC-PUFA is DHA, and five kinds of enzymes of the polynucleotide encoding of being introduced, and wherein enzyme is the arbitrary combination in the following combination:
I) Δ 4 desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 4 desaturases, Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongation enzymes.
In further embodiment, cell is the organism that is suitable for fermenting, and enzyme is that at least a Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzymes, Δ 6 prolongs enzyme and Δ 4 desaturases.
In another embodiment, LC-PUFA is clupanodonic acid (DPA).
Preferably, polynucleotide encoding two or three enzyme of being introduced, described enzyme are Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme or Δ 6 prolongs enzyme.Preferred, enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ, 6 difunctional desaturases and Δ 5/ Δ 6 difunctional prolongation enzymes;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Iii) Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes.
In further embodiment, LC-PUFA is DPA, and four kinds of enzymes of the polynucleotide encoding of being introduced, and wherein enzyme is following arbitrary combination:
I) Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongation enzymes.
In another embodiment, cell is the organism that is suitable for fermenting, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme and Δ 6 prolongs enzyme at least.
In further embodiment, LC-PUFA is timnodonic acid (EPA).
Preferably, polynucleotide encoding Δ 5/ Δ, 6 difunctional desaturases of being introduced and Δ 5/ Δ 6 difunctional prolongation enzymes.
In another embodiment, three kinds of enzymes of the polynucleotide encoding of being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5 desaturases, Δ 6 desaturases and Δ 6 prolong enzyme; Or
Ii) Δ 5 desaturases, Δ 8 desaturases and Δ 9 prolong enzyme.
Up to now the fact shows that expressed desaturase has quite low activity at least some reconstitution cells (particularly yeast).But it may be that desaturase utilizes the function of aliphatic alcohol as the ability of substrate in LC-PUFA is synthetic that the present inventor has identified enzymic activity.To this, the desaturase of also having determined vertebrates source is useful especially for for example producing LC-PUFA in vegetable cell, seed or the yeast at reconstitution cell.Therefore, another preferred embodiment in, reconstitution cell comprises:
I) the intracellular EPA of at least a catalysis changes into the Δ 5 prolongation enzymes of DPA; Or
The ii) at least a desaturase that can act on the aliphatic alcohol substrate; Or
Iii) at least a from vertebrate desaturase or its desaturase variant; Or
Iv) i), ii) or arbitrary combination iii).
In a concrete embodiment, Δ 5 prolongs enzyme and comprises:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
Can act on the aliphatic alcohol substrate or can be Δ 5 desaturases, Δ 6 desaturases or both from vertebrate desaturase.In an embodiment, desaturase comprises:
I) aminoacid sequence that provides as SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22; Or
Iii) i) or biological active fragment ii).
Preferably, at least a desaturase is by the natural generation of vertebrates.
Perhaps, when cell was yeast cell, LC-PUFA was DHA, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme, Δ 6 prolongs enzyme and Δ 4 desaturases at least.
Perhaps, when cell was yeast cell, LC-PUFA was DPA, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme and Δ 6 prolongs enzyme at least.
Although cell can be arbitrary cell type, preferably, the linolic acid (LA) that described cell can produce from endogenous, alpha linolenic acid (ALA) or both produce described LC-PUFA.More preferably, the ALA of endogenous generation and the ratio of LA are 1: 1 at least or are 2: 1 at least.
In one embodiment, cell is the cell in vegetable cell, angiospermous vegetable cell, oilseeds spermatophyte cell or the seed.Preferably, at least a promotor is a seed specific promoters.
In another embodiment, cell is single celled microorganism.Preferentially, single celled microorganism is suitable for fermentation.Preferably, microorganism is a yeast.
In further embodiment, cell is non-human animal's cell or external human body cell.
In further embodiment, reconstitution cell has produced LC-PUFA, and it is integrated in the triacylglycerol of described cell.More preferably, at least 50% the LC-PUFA that is produced in described cell is integrated in the triacylglycerol.
In another embodiment, protein-coding regions a kind of, two or more polynucleotide from the algae gene, have been obtained at least.Preferably, the algae gene is to come from Ba Fuzao (Pavlova) to belong to, for example from Pavlova salina.
In yet another aspect, the invention provides can by lipid acid for example ALA, LA, GLA, ARA, SDA, ETA, EPA or their arbitrary combination or miscellany produce the reconstitution cell of DHA, wherein said reconstitution cell is derived from the cell that can not synthesize DHA.
Further, the invention provides can by lipid acid for example ALA, LA, GLA, ARA, SDA, ETA, EPA or their arbitrary combination or miscellany produce the reconstitution cell of DPA, wherein said reconstitution cell is derived from the cell that can not synthesize DPA.
Still further, the invention provides can by lipid acid for example ALA, LA, GLA, SDA, ETA, EPA or their arbitrary combination or miscellany produce the reconstitution cell of EPA, wherein said reconstitution cell is derived from the cell that can not synthesize EPA.
In yet another aspect, the invention provides can by ALA produce ETrA and by SDA produce ETA and can by lipid acid for example ALA, LA, GLA, SDA, ETA or their arbitrary combination or miscellany produce the reconstitution cell of EPA, wherein said reconstitution cell is derived from not synthesizing ETrA, ETA or both cells.
Further, the invention provides the reconstitution cell of the organism that can be used for fermenting process, wherein said cell can be by LA, ALA, arachidonic acid (ARA), eicosatetraenoic acid (ETA) or their arbitrary combination or the mixed DPA that produces, and wherein said reconstitution cell is derived from the cell that can not synthesize DPA.
In yet another aspect, the invention provides can be by the recombinant plant cell of LA, ALA, EPA or their arbitrary combination or the mixed DPA of generation, and wherein vegetable cell is from angiosperm.
In one embodiment, vegetable cell can also produce DHA.
Still in one aspect of the method, the invention provides the reconstitution cell that can synthesize DGLA, comprise the polynucleotide of one or both polypeptide that coding is following:
A) peptide species, it is that Δ 9 prolongs enzyme, wherein Δ 9 prolongation enzymes are selected from next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 40% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; With
Iii) i) or biological active fragment ii), and/or
B) peptide species, it is Δ 8 desaturases, wherein Δ 8 desaturases are selected from next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:1;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 40% homogeny with SEQ ID NO:1; With
Iii) i) or biological active fragment ii),
Wherein polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell expressing with one or more, and wherein said reconstitution cell is derived from the cell that can not synthesize DGLA.
In one embodiment, cell can change into ARA with DGLA.
In another embodiment, cell also comprises the polynucleotide of coded delta 5 desaturases, wherein the polynucleotide of coded delta 5 desaturases can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein cell can produce ARA.
In concrete embodiment, cell lacks ω 3 desaturase activity, and can not produce ALA.These cells can be naturally occurring, perhaps can produce these cells by the ω 3 desaturase activity that reduce cell with technology well known in the art.
Preferably, cell is the cell of vegetable cell or the organism that is suitable for fermenting.
In further embodiment, reconstitution cell of the present invention has the required enzyme of " Sprecher " approach that enforcement changes into EPA DHA.These enzymes may be natural have or the reorganization generations of cell.These enzymes comprise that at least a kind of Δ 7 prolongs enzymes, Δ 6 desaturases and the beta-oxidation of nisioic acid peroxysome is produced the required enzyme of DHA.
The present inventor has identified one group of new desaturase and has prolonged enzyme.Therefore, further aspect of the present invention relates to these enzymes and their homologue/variant/derivative.
Polypeptide can be a fusion rotein, and it also comprises at least a other peptide sequence.
Described at least a other polypeptide can be the polypeptide that strengthens the stability of polypeptide of the present invention, or helps the polypeptide of purified fusion protein.
Isolating polynucleotide are also provided, its polypeptide of the present invention of encoding.
Further, the invention provides and comprise or the carrier of the polynucleotide of the present invention of encoding.Preferably, polynucleotide operably are connected with seed specific promoters.
In yet another aspect, the invention provides the reconstitution cell that comprises isolating polynucleotide of the present invention.
Further, the invention provides generation and can synthesize the method for the cell of one or more LC-PUFA, described method comprises that the polynucleotide with at least two kinds of enzymes of one or more codings are incorporated in the cell, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzymes, Δ 4 desaturases, Δ 9 prolongation enzyme or Δ 8 desaturases, and wherein said one or more polynucleotide operably are connected in the promotor of cell inner expression with instructing described polynucleotide.
In yet another aspect, the invention provides the reconstitution cell that produces ability with synthetic one or more LC-PUFA of enhanced, method comprises that the polynucleotide with at least two kinds of enzymes of one or more codings are incorporated into first cell, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide can instruct described polynucleotide expression promoter in reconstitution cell operably to be connected with one or more, and wherein said reconstitution cell has the ability of synthetic described one or more LC-PUFA of enhanced with respect to described first cell.
Nature will understand that described herein each embodiment relevant with reconstitution cell of the present invention all is applied to produce the method for described cell functional equivalent.
Further, the cell that the invention provides method of the present invention and produced.
In yet another aspect, the invention provides the transgenic plant that comprise at least a reconstitution cell of the present invention.
Preferably, plant is an angiosperm.More preferably, plant is the oilseeds plants.
In further embodiment, transgenic plant or it comprise that the part of transgenic seed does not comprise the transgenosis of codase, and described enzyme preferentially changes into ω-3LC-PUFA with ω 6 LC-PUFA.
Still further in the embodiment, transgenic plant or it comprise that the part of transgenic seed comprises the transgenosis that coded delta 8 desaturases and/or Δ 9 prolong enzymes.
Further, the invention provides the method that produces oilseeds, described method comprises:
I) under appropriate condition the growth genetically modified oilseeds plant of the present invention and
Ii) collect the seed of plant.
Further, the invention provides the part of transgenic plant of the present invention, wherein with respect to the corresponding part of isogenic non-plant transformed, described part comprises the LC-PUFA that level raises in its lipid acid.
Preferably, described plant part is selected from but the group that is not limited to be made of seed, leaf, stem, flower, pollen, root or special storage organ (for example stem tuber).
Before also do not demonstrated and can produce LC-PUFA in plant seed, these LC-PUFA can not be integrated in vegetables oil for example in the triacylglycerol.
Therefore, in yet another aspect, the invention provides the transgenic seed that comprises LC-PUFA.
Preferably, LC-PUFA is selected from:
i)EPA，
ii)DPA，
iii)DHA，
Iv) EPA and DPA and
V) EPA, DHA and DPA.
More preferably, LC-PUFA is selected from:
i)DPA，
Ii) DHA, or
Iii) DHA and DPA.
Even more preferably, LC-PUFA is EPA, DHA and DPA.
Preferably, self-produced LA of seed source and/or ALA etc. gene non-transgenic seed.More preferably, wait the lipid acid of gene non-transgenic seed to comprise ALA than LA greater concn.Even more preferably, wait the lipid acid of gene non-transgenic seed to comprise at least about 13%ALA or at least about 27%ALA or at least about 50%ALA.
Preferably, the total fatty acids in the seed oil comprises at least 9% C20 lipid acid.
Preferably, seed source is from the oilseeds plant.More preferably, the oilseeds plant is oilseed rape (Brassicanapus), corn (Zea mays), Sunflower Receptacle (Helianthus annuus), soybean (Glycine max), jowar (Sorghum bicolor), flax (Linum usitatissimum), sucrose (Saccharumofficinarum), beet (Beta vulgaris), cotton (Gossypium hirsutum), peanut (Arachishypogaea), opium poppy (Papaver somniferum), leaf mustard (Sinapis alba), castor-oil plant (Ricinuscommunis), sesame (Sesamum indicum), or safflower (Carthamus tinctorius).
Preferably seed has and waits the essentially identical percentage of germination of gene non-transgenic seed.
More preferably the germination of seed is basic identical opportunity with the germination that waits gene non-transgenic seed opportunity.
Preferably, at least 25% or at least 50% or at least 75% LC-PUFA has constituted the part of the triacylglycerol in the seed.
Unexpectedly, the present inventor has been found that the transgenic seed that utilizes method of the present invention to produce has and waits gene essentially identical ALA of non-transgenic seed and LA level.Therefore, preferably, transgenic seed has and waits gene essentially identical ALA of non-transgenic seed and LA level.In addition, find that unexpectedly the transgenic seed that utilizes method of the present invention to produce has reduced the level of monounsaturated fatty acids.Therefore, in preferred embodiment, the transgenic seed ratio waits gene non-transgenic seed to have the monounsaturated fatty acids that has reduced level.
In yet another aspect, the invention provides the method for producing transgenic seed of the present invention, described method comprises:
I) polynucleotide with at least two kinds of enzymes of one or more codings are incorporated in the progenitor cell of seed, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzymes, Δ 4 desaturases, Δ 9 prolongation enzyme or Δ 8 desaturases, wherein said one or more polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, produce the progenitor cell of reorganization in view of the above;
Ii) cultivate described reorganization progenitor cell, so that produce the plant that comprises described transgenic seed; With
Iii) from producing plant, collect seed.
Still further aspect, the invention provides the method for producing transgenic seed, it comprises cultivates the transgenic plant that produce transgenic seed of the present invention, and the described transgenic seed of gathering from plant.
Further, the invention provides the extract of transgenic plant of the present invention or plant part of the present invention or seed of the present invention, wherein with respect to the corresponding extract that waits the non-conversion of gene plant, described extract comprises the LC-PUFA that level raises in its lipid acid.
Preferably, extract is the oil of purifying basically, and it comprises at least 50% triacylglycerol.
Further, the invention provides inhuman transgenic animal, it comprises at least a reconstitution cell of the present invention.
The method that produces LC-PUFA also is provided, and described method is included in and cultivates reconstitution cell of the present invention under the appropriate condition.
In one embodiment, cell is the cell of the organism that is suitable for fermenting, and described method also comprises cellular exposure at least a LC-PUFA precursor.
Preferably, the LC-PUFA precursor is at least a linolic acid or alpha-linolenic acid.In a concrete embodiment, provide LC-PUFA precursor with vegetables oil.
In another embodiment, cell is an alga cells, and method also is included in the alga cells of growing under the appropriate condition, so that produce described LC-PUFA.
Further refusing to obey that, the invention provides the method for one or more LC-PUFA of production, described method is included in and cultivates transgenic plant of the present invention under the appropriate condition.
In yet another aspect, the invention provides the method for producing the oil that comprises at least a LC-PUFA, it comprises acquisition transgenic plant of the present invention or plant part of the present invention or seed of the present invention, and extracts fuel-displaced from described plant, plant part or seed.
Preferably, from seed, extract described oil by squeezing described seed.
In yet another aspect, the invention provides the method that is produced DPA by EPA, described method is included under the appropriate condition and EPA is exposed to polypeptide of the present invention and lipid acid precursor.
In one embodiment, can be in cell implementation method, it utilizes polyketide sample system to produce EPA.
Still aspect another, the invention provides fermenting process, it comprises step:
I) provide the container that contains liquid composition, described liquid composition comprises the synthetic required component of cell of the present invention and fermentation and fatty acid biological; With
Ii) provide the condition of the fermentation that helps liquid composition contained in the described container.
Preferably, the synthetic required component of fermentation and fatty acid biological is LA.
Preferably, cell is a yeast cell.
In yet another aspect, the invention provides and comprise that cell of the present invention or its extract or it comprise the part of LC-PUFA and the composition of suitable carrier.
In yet another aspect, the invention provides and comprise that transgenic plant of the present invention or plant part of the present invention or seed of the present invention or its extract or it comprise the part of LC-PUFA and the composition of suitable carrier.
Still aspect another, the invention provides the product or the product of fermenting process of the present invention or the feed of composition of the present invention that comprise cell of the present invention, plant of the present invention, plant part of the present invention, seed of the present invention, extract of the present invention, method of the present invention.
Preferably, feed comprises DPA at least, wherein carries out at least one DPA enzyme reaction in producing with intracellular recombinase.
In addition, preferably feed comprises DHA at least, wherein carries out at least one DPA enzyme reaction in producing with intracellular recombinase.
Further, the invention provides the method for preparing feed, described method comprises product or the composition of the present invention and the suitable carriers of mixed cell of the present invention, plant of the present invention, plant part of the present invention, seed of the present invention, extract of the present invention, the product of method of the present invention, fermenting process of the present invention.
Preferably, feed is to Mammals or the edible feed of fish.
Further, the invention provides the method that increases the LC-PUFA level in the organism, described method comprises product or composition of the present invention or the feed of the present invention of using cell of the present invention, plant of the present invention, plant part of the present invention, seed of the present invention, extract of the present invention, the product of method of the present invention, fermenting process of the present invention to organism.
Preferably, route of administration is oral.
Preferably, organism is a vertebrates.More preferably, vertebrates is people, fish, pet or livestock animals.
Further, the method of the disease that the invention provides treatment or prevent to benefit from LC-PUFA, described method comprises product or composition of the present invention or the feed of the present invention of using cell of the present invention, plant of the present invention, plant part of the present invention, seed of the present invention, extract of the present invention, the product of method of the present invention, fermenting process of the present invention to object.
Preferably, disease is an arrhythmia, angioplasty, inflammation, asthma, psoriasis, osteoporosis, urinary stone disease, AIDS, multiple sclerosis, rheumatoid arthritis, the Crohn disease, schizophrenia, cancer, fetal alcohol syndrome, attention-deficit hyperactivity disease, cystic fibrosis, pku, unipolar depression, offensiveness hostility (aggressive hostility), adrenoleukodystrophy, coronary artery disease, hypertension, diabetes, obesity, the Alzheimer disease, chronic obstructive pulmonary disease, ulcerative colitis, postangioplasty restenosis, eczema, hypertension, hemocyte is assembled, gastrointestinal hemorrhage, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, confirmed fatigue or eye disease behind the virus infection.
Though provide the LC-PUFA of arbitrary amount all will be of value to object to object, preferably the significant quantity of administering therapeutic disease.
In yet another aspect, the invention provides the product of cell of the present invention, plant of the present invention, plant part of the present invention, seed of the present invention, extract of the present invention, the product of method of the present invention, fermenting process of the present invention or composition of the present invention or feed of the present invention preparation be used for the treatment of or the medicine of the disease preventing from LC-PUFA, to benefit in purposes.
Before expressed Caenorhabditis elegans Δ 6 and prolong enzyme in yeast, it has demonstrated and therapic acid can have been changed into eicosatetraenoic acid.But the present inventor has found unexpectedly that this enzyme also has Δ 5 and prolongs enzymic activity, timnodonic acid can be changed into clupanodonic acid.
In further embodiment, the invention provides the method for producing the unbranched LC-PUFA that comprises 22 carbon atoms, described method comprises LC-PUFA with unbranched 20 carbon atoms with the polypeptide incubation, described polypeptide is selected from next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:2 or SEQ ID NO:14;
Ii) comprise with SEQ ID NO:2 or SEQ ID NO:14 have at least 50% homogeny aminoacid sequence polypeptide and
Iii) i) or biological active fragment ii),
Wherein polypeptide also has Δ 6 prolongation enzymic activitys.
Preferably, comprise that the unbranched LC-PUFA of 22 carbon atoms is DPA, and the LC-PUFA of unbranched 20 carbon atoms is EPA.
Preferably, in reconstitution cell, implement to produce the method for polypeptide and EPA.
Still further aspect, the invention provides antibody purified or its fragment basically, described antibody or its fragment combine with polypeptid specificity of the present invention.
In yet another aspect, the invention provides and identify the reconstitution cell that can synthesize one or more LC-PUFA, the method of tissue or organism, described method comprises that detection is at described cell, whether there are one or more polynucleotide in tissue or the organism, at least two kinds of enzymes of described polynucleotide encoding, described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide and one or more can instruct described polynucleotide at cell, expression promoter operably connects in tissue or the organism.
Preferably, method comprises nucleic acid amplification step, nucleic acid hybridization step, detects the step that whether has genetically modified step in cell, tissue or the organism or determine cell, tissue or biological intravital fatty acid content or composition.
Preferably, organism is animal, plant, angiosperm or microorganism.
In yet another aspect, the invention provides the method that is produced DPA by EPA, described method is included in and under the appropriate condition EPA is exposed to Δ 5 of the present invention and prolongs enzyme and lipid acid precursors.
Preferably, in cell, realize utilizing polyketide sample system to produce the method for EPA.
Reorganization (transgenosis) cell, plant, non-human animal that these new polynucleotide that provide are provided also can produce other prolongation enzyme and/or desaturase natively, and example prolongs enzyme and/or desaturase as defined in this.
It is evident that preferred characteristics of one aspect of the present invention and feature all can be applicable to many other parts of the present invention.
In this specification, word " comprises " or " comprising " all is understood that to comprise the group of given element, integral body or step or element, integral body or step, but does not get rid of any other element, integral body or the step or the group of element, integral body or step.
After this by following non-limiting example and describe the present invention with reference to the accompanying drawings.
Description of drawings
Fig. 1: ω 3 and ω 6 LC-PUFA synthetic may approach.The part that is labeled as I, II, III and IV corresponds respectively to ω 6 (Δ 6), ω 3 (Δ 6), ω 6 (Δ 8) and ω 3 (Δ) approach.Compound in I and the II part is ω 6 compounds, and those compounds in II and the IV part are ω 3 compounds.The catalytic desaturase step of desaturase shown in the warp in " Des " expression approach, and the enzymatic prolongation enzyme of the prolongation step shown in " Elo " expression warp.The step that is used for producing " Sprecher " approach of DHA that the dotted arrow representative is carried out in mammalian cell by DPA.
The distribution of Fig. 2: LC-PUFA in the microalgae guiding principle.Chlorophyceae and Prasinophyceae are described to " green alga "; Eustigmatophyceae is " a yellowish green algae "; Rhodophyceae is diatom and golden brown alga for " red algae " and Bacillariophyceae and Prymnesiophyceae.
Fig. 3: be used for genetic constructs at cell inner expression LC-PUFA biosynthetic pathway.
Fig. 4: the PILEUP of desaturase.D8-atg-Pavlova salina Δ 8 desaturases; Euglena (euglena)-AAD45877 (Δ 8 desaturases; very thin eye worm); Rhizopus (rhizopus)-AAP83964 (Δ 6 desaturases; Rhizopus NK030037); mucor (mucor)-BAB69055 (Δ 6 desaturases; Mucor circinelloides); mortierella-AAL73948 (Δ 6 desaturases; Mortierella isabellina); malpina-BAA85588 (Δ 6 desaturases; Mortierella alpina); physcomitrella-CAA11032 (Δ 6 acyl group fat desaturases; small liwan moss); ceratadon-CAB94992 (Δ 6 fatty acetylene enzymes, angle tooth moss (Ceratodon purpureus)).
Fig. 5: the Southern trace of PCR product and Elo1 or Elo2 probe hybridization.
Fig. 6: the PILEUP that prolongs enzyme.
Fig. 7: the transgenic constructs that is used for expressing the gene of coding LC-PUFA biosynthetic enzyme at Arabidopsis." EPA construct " pSSP-5/6D.6E (being also referred to as pZebdesatCeloPWvec8 in embodiment 5) (Fig. 7 A) contains bifunctional Δ 5/ Δ, 6 desaturases (D5/D6Des) of zebra fish and the Δ 6 of nematode prolongs enzyme (D6Elo), the napin promotor (Fp1) that the both is blocked drives, and the Totomycin resistance selectable marker gene (hph) that is subjected to CaMV-35S (35SP) promoters driven." DHA construct " pXZP355 (Fig. 7 B) comprises Δ 4 desaturases (D4Des) of the Pavlova salina that the napin promotor (Fp11) of all being blocked drives and the Kans selectable marker gene (nptII) that Δ 5 prolongs enzyme (D5Elo) genes and is subjected to nopaline (nopaline) synthase promoter (NosP) driving.3 ' the distolateral wing of all genes all is a nopaline synthase terminator (NosT).
Fig. 8: A: the gas-chromatography (GLC) that shows the fatty acid profile of Arabidopis thaliana (Arabidopsisthaliana) the strain DO11 that carries EPA and DHA gene construct.B: EPA that from Arabidopis thaliana strain DO11, obtains and the mass spectrum of DHA.
Fig. 9: shown in embodiment 12, under the condition of low severity or high severity, the radiation of the dot blotting hybridization that DNA carried out of using the radiolabeled probe that is made of the P.salina gene coding region shown in the right side and the various microalgae species shown in the top is from video picture figure.
Figure 10: the aminoacid sequence of Δ 6 of higher plant and Δ 8 desaturases is arranged.With PILEUP (GCG, Wisconsin, USA) arrange from E.plantagineum (Ep1D6Des) (SEQ IDNO:64), E.gentianoides (EgeD6Des, accession number AY055117) (SEQ ID NO:65), E.pitardii (EpiD6Des, AY055118) (SEQ ID NO:66), Borrago officinalis (BofD6Des, U79010) (SEQ ID NO:67) Δ 6 desaturases and from Borrago officinalis (BofD8Des, AF133728) (SEQ ID NO:68), Sunflower Receptacle (Helianthus annus) (HanD8Des, S68358) (SEQ ID NO:69), and Arabidopis thaliana (AtD8DesA, AAC62885.1; With AtD8DesB, CAB71088.1) aminoacid sequence of Δ 8 desaturases of (being respectively SEQ ID NO:70 and SEQ ID NO:71).HBI, HBII, HBIII are three conservative Histidine frames.F1 and R1 are used to increase the degenerated primer EpD6Des-F1 of cDNA and the corresponding zone of EpD6Des-R1.The cytochrome b that has also shown N-terminal with conservative HPGG motif
5Structural domain.
Figure 11: variant Ep1D6Des enzyme that is separated to and representational enzymic activity.Has cytochrome b
5, Histidine frame I, II and III Ep1D6Des be shown as b respectively
5, HBI, HBII and HBIII.In the A group, shown the variant that is separated to: wild-type amino acid-site numbering-variant amino acid with following form.Open diamonds represents significantly to reduce the sudden change of enzymic activity, and solid diamond is represented variant that enzymic activity is had no significant effect.B group has shown the GLA in the transgene tobacco leaf of two kinds of variants and the comparison of SDA output and wild-type enzyme.
Figure 12: by other approach of ALA (18: 3) synthetic ω 3 LC-PUFA SDA (18: 4), EPA (20: 5) and DHA (22: 6).Demonstrated desaturase, prolonged enzyme and acyltransferase with filled arrows, hollow arrow and dotted line respectively.The prolongation of chain only on the aliphatic alcohol substrate, occurs, and desaturation can come across acyl group PC (A﹠amp; B) or the aliphatic alcohol substrate.Also do not determine the substrate skewed popularity of final Δ 4 desaturase steps between acyl group PC or aliphatic alcohol.The approach that relates to acyl group PC desaturase needs the PC of acyltransferase mediation and the displacement of shuttling back and forth of the acyl group between the coenzyme A substrate.Group A and B have shown " Δ 6 approach " and " Δ 8 approach " of acyl group PC desaturase approach respectively.Group C has shown approach expressed in this research, wherein zebra fish Δ 6/ Δ 5 difunctional desaturase coding aliphatic alcohol Δ 6 and Δ 5 desaturase activity.Can synthesize for example ARA (20: 4) of ω 6 LC-PUFA by phase reaction on the same group, use LA (18: 2) when just beginning as initial substrate.
Figure 13: Synechococcus 7002 is 22 ℃, 25 ℃, 30 ℃ growth rate.
Figure 14: the linoleic acid plus linolenic acid level of the Synechococcus 7002 under the different growth temperatures.
Sequence list
Δ 8 desaturases of SEQ ID NO:1-Pavlova salina;
The Δ 5 of SEQ ID NO:2-Pavlova salina prolongs enzyme;
The Δ 9 of SEQ ID NO:3-Pavlova salina prolongs enzyme;
The cDNA of the open reading frame of Δ 8 desaturases of SEQ ID NO:5-coding Pavlova salina;
The full-length cDNA of Δ 8 desaturases of SEQ ID NO:6-coding Pavlova salina;
The Δ 5 of SEQ ID NO:7-coding Pavlova salina prolongs the cDNA of the open reading frame of enzyme;
The Δ 5 of SEQ ID NO:8-coding Pavlova salina prolongs the full-length cDNA of enzyme;
The Δ 9 of SEQ ID NO:9-coding Pavlova salina prolongs the cDNA of the open reading frame of enzyme;
The Δ 9 of SEQ ID NO:10-coding Pavlova salina prolongs the full-length cDNA of enzyme;
The Partial cDNA of the N-terminal part of Δ 4 desaturases of SEQ ID NO:11-coding Pavlova salina;
The cDNA of the open reading frame of Δ 4 desaturases of SEQ ID NO:12-coding Pavlova salina;
The full-length cDNA of Δ 4 desaturases of SEQ ID NO:13-coding Pavlova salina;
The Δ 5/ Δ 6 difunctional prolongation enzymes of SEQ ID NO:14-Caenorhabditis elegans;
The Δ 5/ Δ 6 difunctional desaturases of SEQ ID NO:15-zebra fish (Danio rerio);
The SEQ ID NO:16-mankind's Δ 5 desaturases (Genbank accession number No:AAF29378);
The SEQ ID NO:21-mankind's Δ 6 desaturases (Genbank accession number No:AAD20018);
The SEQ ID NO:30-mankind's Δ 5 prolongs enzyme (Genbank accession number No:NP 068586);
The Δ 6 of SEQ ID NO:31-small liwan moss prolongs enzyme (Genbank accession number No:AAL84174);
The Δ 6 of SEQ ID NO:32-Mortierella alpina prolongs enzyme (Genbank accession number No:AAF70417);
The Δ 9 of SEQ ID NO:35-Isochrysis galbana prolongs enzyme (Genbank accession number No:AAL37626);
Δ 8 desaturases (Genbank accession number No:AAD45877) of the very thin eye of SEQ ID NO:36-worm;
The cDNA of the Δ 5/ Δ 6 difunctional prolongation enzymes of SEQ ID NO:37-coding Caenorhabditis elegans;
The cDNA of the Δ 5/ Δ 6 difunctional desaturases of SEQ ID NO:38-coding zebra fish (Danio rerio);
SEQ ID NO:39 to 42,46,47,50,51,53,54,56,57,81,82,83,84 and the 87-Oligonucleolide primers;
SEQ ID NO:43 to 45,48,49 and the conservative motif of the various desaturases of 52-/prolongation enzyme; The Partial cDNA that SEQ ID NO:55-coding Pavlova salina FAE sample prolongs enzyme;
The full-length cDNA of Δ 5 desaturases of SEQ ID NO:58-coding Pavlova salina;
The cDNA of the open reading frame of Δ 5 desaturases of SEQ ID NO:59-coding Pavlova salina;
The fragment of Δ 6 desaturases of SEQ ID NO:61 and 62-Echium pitardii;
The cDNA of the open reading frame of Δ 6 desaturases of SEQ ID NO:63-coding Echium plantagineum;
Δ 8 desaturases of SEQ ID NO:68-Borrago officinalis (Genbank accession number No:AF133728);
Δ 8 desaturases of SEQ ID NO:69-Sunflower Receptacle (Genbank accession number No:S68358);
The Δ 8 desaturase A (Genbank accession number No:AAC62885.1) of SEQ ID NO:70-Arabidopis thaliana;
The Δ 8 desaturase B (Genbank accession number No:CAB71088.1) of SEQ ID NO:71-Arabidopis thaliana;
The conservative motif of SEQ ID NO:72 and 73-Δ 6-and Δ 8-desaturase;
The Δ 6 of SEQ ID NO:74-thraustochytriale prolongs enzyme (Genbank accession number No:AX951565);
The Δ 9 of SEQ ID NO:75-zebra fish prolongs enzyme (Genbank accession number No:NM～199532);
The Δ 9 of SEQ ID NO:76-Pavlova lutheri prolongs enzyme;
The Δ 5 of SEQ ID NO:77-zebra fish prolongs enzyme (Genbank accession number No:AF532782);
The Δ 5 of SEQ ID NO:78-Pavlova lutheri prolongs enzyme;
The portion gene sequence that SEQ ID NO:79-coding prolongs the Heterocapsa niei of enzyme;
There is an intron by SEQ ID NO:79 encoded protein in SEQ ID NO:80-in the existence of the terminator codon explanation SEQ ID NO:79;
The Δ 9 of SEQ ID NO:85-Pavlova salina prolongs enzyme, by the alternative initiator codon coding on the site 31 of SEQ ID NO:9;
The Δ 9 of SEQ ID NO:86-Pavlova salina prolongs enzyme, by the alternative initiator codon coding on the site 85 of SEQ ID NO:9;
The part of SEQ ID NO:88-Melosira (Melosira sp.) prolongs enzyme amino acid sequence;
The cDNA sequence that the part of SEQ ID NO:89-coding Melosira prolongs enzyme.
Detailed Description Of The Invention
General technology and definition
Unless special different definition is arranged, all should have the common identical implication of understanding of personnel as this area (for example cell cultivation, phytobiology, molecular genetics, immunology, immunohistochemistry, albumen chemistry, aliphatic acid synthesize and biochemistry) at these all used technology and scientific terminology.
Except as otherwise noted, used recombinant nucleic acid, recombinant protein, cell cultivation and the immunological technique of the present invention all is to well known to a person skilled in the art standard method. These technology have been described fully and have explained in the literature, J.Perbal for example, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J.Sambrook et al., Molecular Cloning:A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); T.A. Brown (editor), Essential Molecular Biology:A Practical Approach, Volumes 1 and 2, IRL Press (1991); D.M.Glover and B.D.Hames (editors), DNA Cloning:A Practical Approach, Volumes 1-4, IRL Press (1 995 and 1996); With F.M.Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub.Associates and Wiley-Interscience (1988, comprise all nearest renewals); Ed Harlow and David Lane (editors) Antibodies:A Laboratory Manual, Cold Spring Harbour Laboratory, (1988); With J.E.Coligan etal. (editors) Current Protocols in Immunology, John Wiley ﹠ Sons (comprising all nearest renewals), and incorporate it into the application by reference.
Term " long-chain polyunsaturated fatty acid ", " LC-PUFA " or " C20+ polyunsaturated fatty acid " refer to the aliphatic acid that comprises at least 20 carbon atoms and at least three carbon-to-carbon double bonds on its carbochain. Term " very long-chain polyunsaturated fatty acids ", " VLC-PUFA " or " C22+ polyunsaturated fatty acid " referred to herein as the aliphatic acid that comprises at least 22 carbon atoms and at least three carbon-to-carbon double bonds on its carbochain. The carbochain of all right and wrong branch that the number of the carbon atom on the fatty acid carbon chain refers generally to. If carbochain has branch, the number of carbon atom will be except those carbon atom numbers on the group of lateral so. In one embodiment, long-chain polyunsaturated fatty acid is omega-3 fatty acid, namely has the aliphatic acid of unsaturation (carbon-to-carbon double bond) in terminal the 3rd carbon-carbon bond that rises of the methyl of aliphatic acid. In another embodiment, long-chain polyunsaturated fatty acid is ω 6 aliphatic acid, namely has the aliphatic acid of unsaturation (carbon-to-carbon double bond) in terminal the 6th carbon-carbon bond that rises of the methyl of aliphatic acid. In further embodiment, long-chain polyunsaturated fatty acid is selected from by arachidonic acid (ARA, 20:4 Δ 5,8,11,14; ω 6), eicosatetraenoic acid (ETA, 20:4 Δ 8,11,14,17; ω 3), eicosapentaenoic acid (EPA, 20:5 Δ 5,8,11,14,17; ω 3), clupanodonic acid (DPA, 22:5 Δ 7,10,13,16,19; ω 3) or DHA (DHA, 22:6 Δ 4,7,10,13,16,19; ω 3) group that consists of. LC-PUFA also can be dihomo-gamma-linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 20:3 Δ 11,14,17; ω 3). It is evident that the LC-PUFA that the present invention produces can be the mixture of top arbitrary or all aliphatic acid, perhaps can comprise other LC-PUFA or the derivative of arbitrary these LC-PUFA. In preferred embodiment, ω 3 aliphatic acid are EPA, DPA or DHA, even more preferably are DPA or DHA.
In addition, term " long-chain polyunsaturated fatty acid " or " very long-chain polyunsaturated fatty acids " referred to herein as the aliphatic acid of free state or the aliphatic acid of esterification form, for example as triglycerides, glycerine dibasic acid esters, monoglyceride, in conjunction with the form of acyl coenzyme A or other combining form. Aliphatic acid can esterified one-tenth phosphatide, for example phosphoric acid lecithin, phosphatidyl-ethanolamine, phosphatidylserine, phosphatidyl glycerol, phosphatidylinositols or cardiolipin form. Therefore, LC-PUFA can show as mixture or the oil of purifying or the lipid that extracts of lipid within endothelial cells form from cell, tissue or organism. In preferred embodiment, the invention provides the oil that comprises at least 75% or 85% triglycerides, remaining part shows as other forms of lipid, mentioned lipid above those for example, and at least described triglycerides comprises LC-PUFA. Purifying or handling oil for example with the highly basic hydrolysis, in order to discharge free aliphatic acid, or pass through to divide gold-plating, distillation etc. further.
Abbreviation " LC-PUFA " and " VLC-PUFA " can represent aliphatic acid or polytype aliphatic acid of single type at this. For example, the genetically modified plants of the present invention of generation LC-PUFA can produce EPA, DPA and DHA.
The gene that can be used for desaturase of the present invention and extending enzyme albumen and encoding said proteins is arbitrary albumen known in the art and gene or their homologue or derivative. In table 1, enumerated the example of these genes and coded albumen. Demonstrated the biosynthetic desaturase of participation LC-PUFA and all belonged to so-called " front end " desaturase group, the N end that is characterized at each albumen has cytochrome b5The spline structure territory. Cytochrome b5The spline structure territory may be as acceptor (Napier et al., 1999 of the required electronics of desaturation; Sperling and Heinz, 2001).
Table 1: the biosynthetic gene of participation LC-PUFA of cloning.
| Enzyme | The organism type | Species | Accession number | The protein size (aa ' s) | List of references |
| Δ 4-desaturase | Algae | Euglena gracilis | AY278558 | 541 | Meyer et al.， 2003 |
| Pavlova lutherii | AY332747 | 445 | Tonon et al.， 2003 | ||
| Thraustochytrium sp. | AF489589 | 519 | Qiu et al.，2001 | ||
| Thraustochytrium aureum | AF391543- 5 | 515 | (NCBI) | ||
| Δ 5-desaturase | Mammal | Homo sapiens | AF199596 | 444 | Cho et al.，1999b Leonard et al.， 2000b |
| Nematode | Caenorhabditis elegans |
AF11440，
|
447 | Michaelson et al.，1998b；Watts and Browse， 1999b | |
| Fungi | Mortierella alpina | AF067654 | 446 | Michaelson et al.，1998a； Knutzon et al.， 1998 | |
| Pythium irregulare | AF419297 | 456 | Hongetal.， 2002a | ||
| Dictyostelium discoideum | AB022097 | 467 | Saito etal.，2000 | ||
| Saprolegnia diclina | 470 | WO02081668 | |||
| Diatom | Phaeodactylum tricornutum | AY082392 | 469 | Domergue et al.， 2002 | |
| Algae | Thraustochytrium sp | AF489588 | 439 | Qiu et al.，2001 | |
| Thraustochytrium aureum | 439 | WOO2081668 | |||
| Isochrysis galbana | 442 | WO02081668 | |||
| Liver moss | Marchantia polymorpha | AY583465 | 484 | Kajikawa et al.， 2004 |
| Enzyme | The organism type | Species | Accession number | Protein size aa ' s) | List of references |
| Δ 6-desaturase | Mammal | Homo sapiens | NM_013402 | 444 | Cho et al.，1999a； Leonard et al.，2000 |
| Mus musculus | NM_019699 | 444 | Cho et al.，1999a | ||
| Nematode | Caenorhabditis elegans | Z70271 | 443 | Napier et al.，1998 | |
| Plant | Borago officnales | U79010 | 448 | Sayanova et al.， 1997 | |
| Echium | AY055117 AY055118 | Garcia-Maroto et al.，2002 | |||
| Primula vialii | AY234127 | 453 | Sayanova et al.， 2003 | ||
| Anemone leveillei | AF536525 | 446 | Whitney et al.， 2003 | ||
| Liver moss | Ceratodon purpureus | AJ250735 | 520 | Sperling et al.，2000 | |
| Marchantia polymorpha | AY583463 | 481 | Kajikawa et al.. 2004 | ||
| Physcomitrella patens | Girke et al.，1998 | ||||
| Fungi | Mortierella alpina | AF110510 AB020032 | 457 | Huang et al.，1999； Sakuradani et al.， 1999 | |
| Pythium irregulare | AF419296 | 459 | Hong et al.，2002a | ||
| Mucor circinelloides | AB052086 | 467 | NCBI * | ||
| Rhizopus sp. | AY320288 | 458 | Zhang et al.，2004 | ||
| Saprolegnia diclina | 453 | WO02081668 | |||
| Diatom | Phaeodactylum tricornutum | AY082393 | 477 | Domergue et al.， 2002 | |
| Bacterium | Synechocystis | L11421 | 359 | Reddy et al.，1993 | |
| Algae | Thraustochytrium aureum | 456 |
| ||
| Difunctional Δ | |||||
| 5/ |
Fish | Danio rerio | AF309556 | 444 | Hastings et al.， 2001 |
| C20 Δ 8-desaturase | Algae | Euglena gracilis | AF139720 | 419 | Wallis and Browse， 1999 |
| Plant | Borago officinales | AF133728 |
| Enzyme | The organism type | Species | Accession number | The protein size (aa ' s) | List of references | |
| Δ 6-extending enzyme | Nematode | Caenorhabditis elegans | NM_069288 | 288 | Beaudoin et al.， 2000 | |
| Liver moss | Physcomitrella patens | AF428243 | 290 | Zank et al.，2002 | ||
| Marchantia polymorpha | AY583464 | 290 | Kajikawa et al.， 2004 | |||
| Fungi | Mortierella alpina | AF206662 | 318 | Parker-Bames et al.，2000 | ||
| Algae | Pavlova lutheri ** | 501 | WO 03078639 | |||
| Thraustochytrium | AX951565 | 271 | WO 03093482 | |||
| Thraustochytrium sp ** | AX214454 | 271 | WO 0159128 | |||
| The PUFA-extending enzyme | Mammal |
| AF231981 | 299 | Leonard et al.， 2000b； Leonard et al.， 2002 | |
|
| AB071985 | 299 | Inagaki et al.， 2002 | |||
| Rattus norvegicus ** | AB071986 | 267 | Inagaki et al.， 2002 | |||
| Mus musculus | AF170907 | 279 | Tvrdik et al.， 2000 | |||
| Mus musculus | AF170908 | 292 | Tvrdik et al.， 2000 | |||
| Fish | Danio rerio | AF532782 | 291 (282) | Agaba et al.，2004 | ||
| Danio rerio ** | NM_199532 | 266 | Lo et al.，2003 | |||
| Worm | Caenorhabditis elegans | Z68749 | 309 | Abbott et al 1998 Beaudoin et al 2000 | ||
| Algae | Thraustochytrium aureum ** | AX464802 | 272 | WO 0208401-A2 | ||
| Pavlova lutheri ** | ？ | WO 03078639 | ||||
| Δ 9-extending enzyme | Algae | Isochrysis galbana | AF390174 | 263 | Qi et al.，2002 |
*
http://www.ncbi.nlm.nih.gov/
**Function does not confirm/does not verify
By for example express the gene of codase in yeast cells or the plant cell at cell, and determine whether cell has had the generation LC-PUFA that strengthens than the control cells of not expressing enzyme ability, can test the used arbitrary extending enzyme of the present invention or the activity of desaturase.
Unless different explanations is arranged, of the present inventionly relate to cell, plant, seed etc. and produce the method for described cell, plant, seed etc. and mention those embodiments of " two kinds of enzymes " in the tabulation that this provides (or at least " three kinds of enzymes " etc.), " different " enzyme of providing at least two kinds of tabulations of wherein said polynucleotide encoding is provided, rather than identical (perhaps closely similar of two of the same enzyme of basically encoding, only have little difference, so that basically can not change the activity of coded enzyme) ORF.
Unless different explanations is arranged, two of analyzing in this expression of term " substantially the same " or its variation from the sample of separate sources for example two kinds of seeds be substantially the same, as long as they are only had an appointment on the proterties of studying+/-10% difference.
The higher efficient of efficient that term " preferentially changes into ω 6 LC-PUFA the enzyme of ω 3 LC-PUFA " and implements in this expression enzyme can be than its desaturation reaction listed in the approach II of Fig. 1 or III is implemented described conversion.
Although some enzyme is described as " bifunctional " specifically at this, the shortage that lacks this term be not the special enzyme of certain expression do not have other activity beyond the activity of special definition.
Desaturase
" Δ 5/ Δ 6 difunctional desaturases " or " Δ 5/ Δ 6 desaturases " at least can i at this) alpha linolenic acid is changed into parinaric acid, and ii) eicosatetraenoic acid is changed into eicosapentaenoic acid. That is, Δ 5/ Δ 6 bifunctional enzymes are Δ 5 desaturases and Δ 6 desaturases, and Δ 5/ Δ 6 difunctional desaturases can be considered to their a kind of hypotypes of every kind. From zebra fish, identified the gene (Hasting et al., 2001) of coded delta 5/ Δ 6 desaturases. The gene of this enzyme of encoding may represent ancestors' form of " front end desaturase ", copies thereafter and copy to be evolved into different Δ 5 and Δ 6 desaturase functions. In one embodiment, Δ 5/ Δ 6 usefulness Freshwater Fishs produce Δ 5/ Δ 6 difunctional desaturases natively. In a concrete embodiment, Δ 5/ Δ 6 difunctional desaturases comprise:
I) amino acid sequence that provides such as SEQ ID NO:15;
Ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:15; Or
I) or biological active fragment ii) iii).
" Δ 5 desaturases " can change into eicosapentaenoic acid with eicosatetraenoic acid at least at this. In one embodiment, the desaturation of enzyme Δ 5 desaturase catalysis C20 LC-PUFA changes into DGLA arachidonic acid (ARA, 20:4 ω 6) and ETA is changed into EPA (20:5 ω 3). From multiple organism, isolated the gene of this enzyme of coding, described organism comprises algae (thraustochytriale, Qiu et al, 2001), fungi (M.alpine, abnormal female corruption are mould, Phaeodactylum tricornutum, Dictyostelium), Caenorhabditis elegans and mammal (table 1). In another embodiment, Δ 5 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:60; (ii) with SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:60 in arbitrary sequence have the amino acid sequence of at least 50% homogeny; Or (iii) i) or biological active fragment ii). In further embodiment, Δ 5 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20 or SEQ ID NO:60; (ii) with SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20 or SEQ ID NO:60 in arbitrary sequence have the amino acid sequence of at least 90% homogeny; Or (iii) i) or biological active fragment ii). In further embodiment, by listed wherein a kind of Δ 5 delta 8 desaturase genes of table 1 or protein-coding region coded delta 5 desaturases of essentially identical gene with it.
" Δ 6 desaturases " can change into parinaric acid with alpha linolenic acid at least at this. In one embodiment, the desaturation of enzyme Δ 6 desaturase catalysis C18 LC-PUFA changes into LA GLA and ALA is changed into SDA. In another embodiment, Δ 6 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 or SEQ ID NO:67; (ii) with SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 or SEQ ID NO:67 in arbitrary sequence have the amino acid sequence of at least 50% homogeny; I) or biological active fragment ii) (iii). In further embodiment, Δ 6 desaturases comprise with SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66 or SEQ ID NO:67 in arbitrary sequence have the amino acid sequence of at least 90% homogeny. In further embodiment, by listed wherein a kind of Δ 6 delta 8 desaturase genes of table 1 or protein-coding region coded delta 6 desaturases of essentially identical gene with it.
" Δ 4 desaturases " can change into DHA with clupanodonic acid at least at this. In the organism of nonmammalian, Δ 4 desaturase catalysis have been separated to gene (Qiu et al., 2001 of this enzyme of encoding by the desaturation step of DPA generation DHA from Free Li Ving Protozoan of Fresh Water species Euglena gracilis and marine species thraustochytriale; Meyer et al., 2003). In one embodiment, Δ 4 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:4, SEQ ID NO:33 or SEQ ID NO:34; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:4, SEQ ID NO:33 or SEQ ID NO:34; I) or biological active fragment ii) (iii). In further embodiment, by listed wherein a kind of Δ 4 delta 8 desaturase genes of table 1 or protein-coding region coded delta 4 desaturases of essentially identical gene with it.
" Δ 8 desaturases " at least can be with 20:3 at thisΔ11，14，17 ω 3 changes into eicosatetraenoic acid. In one embodiment, Δ 8 desaturases are specific to Δ 8 substrates relatively. That is, it has the activity higher than other substrates at desaturation Δ 8 substrates, particularly for Δ 6 desat substrates. One preferred embodiment in, when expressing in yeast cells, Δ 8 desaturases only have very little or do not have Δ 6 desaturase activity. In another embodiment, Δ 8 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:1, SEQ ID NO:36, SEQ ID NO:68, SFQ ID NO:69, SEQ ID NO:70 or SEQ ID NO:71; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:1, SEQ ID NO:36, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70 or SEQ ID NO:71; Or (iii) i) or biological active fragment ii). In further embodiment, Δ 8 desaturases comprise the amino acid sequence that (i) provides such as SEQ ID NO:1; (ii) has the amino acid sequence of at least 90% homogeny with SEQ ID NO:1; I) or biological active fragment ii) (iii).
" Δ 3 desaturases " can change into LA at least ALA and/or GLA is changed into SDA and/or ARA is changed into EPA at this. The example of Δ 3 desaturases comprises described those Δ 3 desaturases such as Pereira et al. (2004), Horiguchi et al. (1998), Berberich et al. (1998) and Spychalla et al. (1997). In one embodiment, cell of the present invention is the plant cell that lacks Δ 3 desaturase activity. Utilize gene Knockout well known in the art can produce these cells. These cells can be used to produce specifically for example DGLA of a large amount of ω 6 LC-PUFA.
Extending enzyme
Biochemistry evidence explanation fatty acid prolonging is made up of 4 steps: condensation, reduction, dehydration and for the second time reduction. In the context of the present invention, " extending enzyme " refers under suitable physiological condition, when having other compositions that prolong compound, and the polypeptide of catalyzing and condensing step. Show that the prolongation of only having the condensation component (" extending enzyme ") that prolongs albumen composition to express for corresponding acyl chain in intracellular allos or homology is essential. Therefore, the extending enzyme of quoting can successfully recover reduction and the dehydration activity of transformed host, prolongs in order to realize successful acyl. Think that prolonging reacting phase is present in the condensation component for the chain length of aliphatic acid substrate and the specificity of desaturation degree. This component also is considered to prolong the component of the speed restriction in the reaction.
So far two groups of condensing enzymes have been identified. First group relates to prolongation saturated and monounsaturated fatty acids (C18-22), for example the FAE1 gene of arabidopsis. The example of formed product is erucic acid (22: 1) in rape. This group is called as FAE sample enzyme, and does not show effect in the LC-PUFA biosynthesis. The group of other identified fatty acid prolonging enzymes that go out is known as the ELO family of extending enzyme, presses the ELO unnamed gene, and its activity is essential for the over-long chain fatty acid of synthetic sphingolipid in yeast. The apparent likeness in form thing of isolated ELO type extending enzyme has demonstrated the prolongation that relates to LC-PUFA and synthetic from the organism of synthetic LC-PUFA such as algae, liver moss, fungi and nematode. Also isolated the gene (table 1) of some these PUFA extending enzymes of encoding. These genes on nucleotides or amino acid sequence with higher plant in FAE sample extending enzyme gene irrelevant.
" Δ 5/ Δ 6 difunctional extending enzymes " or " Δ 5/ Δ 6 extending enzymes " at least can i at this) parinaric acid is changed into eicosatetraenoic acid; And ii) eicosapentaenoic acid is changed into clupanodonic acid. That is, Δ 5/ Δ 6 difunctional extending enzymes are Δ 5 extending enzymes and Δ 6 extending enzymes, and Δ 5/ Δ 6 difunctional extending enzymes can be considered to a kind of hypotype of every kind of enzyme. In one embodiment, when the EPA source was provided to plant, Δ 5/ Δ 6 difunctional extending enzymes can prolong generation DPA by the interior EPA of catalysis plant cell (for example higher plant cell). Can outer seedbed or preferably in the seedbed EPA is provided. From the invertebrate Caenorhabditis elegans, isolated the gene (Beaudoin et al., 2000) of so a kind of extending enzyme of coding, although before and do not know its can catalysis Δ 5 prolong steps. In one embodiment, Δ 5/ Δ 6 difunctional extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:2 or SEQ ID NO:14; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:2 or SEQ ID NO:14; Or (iii) i) or biological active fragment ii).
" Δ 5 extending enzymes " can change into clupanodonic acid with eicosapentaenoic acid at least at this. In one embodiment, Δ 5 extending enzymes are from invertebrate originate for example algae or originated from fungus. Aspect the specificity of the prolongation that realizes reaction, advantage (for example SEQ ID NO:2 provide Δ 5 extending enzymes) is provided these extending enzymes. One preferred embodiment in, Δ 5 extending enzymes relatively are specific to the C20 substrate, rather than the C22 substrate. For example, when expressing in yeast cells, its activity to the C22 substrate (being extended for C24 aliphatic acid) is hanged down 10 times at least than its activity to corresponding C20 substrate. Preferably, when using C20 A5 desaturation substrate, its activity is high, and for example when expressing in yeast cells, it provides at least 7% the conversion ratio of 20:5 ω 3 to 22:5 ω 3. In another embodiment, Δ 5 extending enzymes are specific to Δ 5 desaturation substrates relatively, rather than Δ 6 desaturation substrates. For example, when expressing in yeast cells, its specific activity to Δ 6 desaturation C18 substrates is hanged down 10 times at least to the activity of Δ 5 desaturation C20 substrates. In further embodiment, Δ 5 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:2, SEQ ID NO:30, SEQ ID NO:77 or SEQ ID NO:78; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:2, SEQ ID NO:30, SEQ ID NO:77 or SEQ ID NO:78; Or (iii) i) or biological active fragment ii). In another embodiment, Δ 5 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:2; (ii) has the amino acid sequence of at least 90% homogeny with SEQ ID NO:2; Or (iii) i) or biological active fragment ii). In further embodiment, by table 1 listed wherein a kind of Δ 5 extending enzyme genes or with it protein-coding region coded delta 5 extending enzymes of essentially identical gene.
" Δ 6 extending enzymes " can change into eicosatetraenoic acid with parinaric acid at least at this. In one embodiment, Δ 6 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:86 or SEQ ID NO:88; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:86 or SEQ ID NO:88; I) or biological active fragment ii) (iii). In another embodiment, Δ 6 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:32, SEQ ID NO:85, SEQ ID NO:86 or SEQ ID NO:88; (ii) has the amino acid sequence of at least 90% homogeny with SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:32, SEQ ID NO:85, SEQ ID NO:86 or SEQ ID NO:88; I) or biological active fragment ii) (iii). In further embodiment, by table 1 listed wherein a kind of Δ 6 extending enzyme genes or with it protein-coding region coded delta 6 extending enzymes of essentially identical gene.
In some protist species, by before using Δ 8 desaturase desaturations, prolong linoleic acid or synthetic LC-PUFA (Fig. 1 IV part of alpha linolenic acid with C2 unit; " Δ 8 desaturations " approach). In these organisms, do not detect Δ 6 desaturases and Δ 6 extending enzymes. The substitute is, detected Δ 9 extending enzymes in these organisms, what support this point is to be separated to C18 Δ 19 extending enzyme genes (Qi et al., 2002) from the ball Isochrysis galbana recently. " Δ 9 extending enzymes " can change into 20:3 with alpha linolenic acid at least at thisΔ11，14，17 In one embodiment, Δ 9 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:3, SEQ ID NO:35, SEQ ID NO:75, SEQ IDNO:76, SEQ ID NO:85 or SEQ ID NO:86; (ii) has the amino acid sequence of at least 50% homogeny with SEQ ID NO:3, SEQ ID NO:35, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:85 or SEQ ID NO:86; Or (iii) i) or biological active fragment ii). In one embodiment, Δ 9 extending enzymes comprise the amino acid sequence that (i) provides such as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; (ii) has the amino acid sequence of at least 90% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or (iii) i) or biological active fragment ii). In further embodiment, by the listed Δ 9 extending enzyme genes of table 1 or protein-coding region coded delta 9 extending enzymes of substantially the same gene with it. In another embodiment, Δ 9 extending enzymes also have Δ 6 extending enzyme activity. Extending enzyme in this embodiment can also change into SDA ETA and/or GLA is changed into DGLA (Δ 6 extending enzyme activity), except ALA being changed into ETrA (Δ 9 extending enzymes). One preferred embodiment in, so a kind of extending enzyme for example clings to husband's Trentepohlia from algae or originated from fungus.
" Δ 4 extending enzymes " can change into 24:6 with DHA at least at thisΔ6，9，12，15，18，21
ω3。
Cell
Suitable cell of the present invention comprises the cell that the polynucleotides of any polypeptide/enzyme described herein that can be encoded transform, and described cell accordingly can be for generation of LC-PUFA. The host cell that can introduce polynucleotides can be no transformed cells or by cell that at least a nucleic acid molecules transformed. These nucleic acid molecules can be synthetic relevant with LC-PUFA, or uncorrelated. Host cell of the present invention can produce albumen of the present invention or only could produce these albumen after being transformed by at least a nucleic acid molecules in endogenous ground (namely natively).
Term " cell of ability with synthesis of long-chain polyunsaturated fatty acids of enhancing " is relative terms, wherein recombinant cell of the present invention is compared with n cell, recombinant cell produces more long-chain polyunsaturated fatty acid than n cell, or the LC-PUFA of higher concentration for example EPA, DPA or DHA (with respect to other aliphatic acid).
Cell can be prokaryotic or eukaryotic. Host cell of the present invention can be any cell that can produce at least a albumen described herein, and it comprises (comprising yeast) bacterium, fungi, parasitic, arthropodan, animal and cell plant. Preferred host cell is yeast and plant cell. One preferred embodiment in, plant cell is seed cell.
In one embodiment, cell is zooblast or alga cells. Zooblast can be the cell of arbitrary type of animal, such as the cell of inhuman zooblast, inhuman vertebrate cells, inhuman mammalian cell or aquatic animal such as fish or crustacean, invertebral zooblast, insect cell etc.
An example that can be used as the bacterial cell of host cell of the present invention is Synechococcus spp (being also referred to as Synechocystis spp.), for example Synechococcus elongatus.
Cell can be the organism that is suitable for fermenting. Term " sweat " referred to herein as any sweat or any process that comprises fermentation step. Sweat comprises without restriction for generation of alcohol (for example ethanol, methyl alcohol, butanols), organic acid (for example citric acid, acetic acid, methylene-succinic acid, lactic acid, gluconic acid), ketone (for example acetone), amino acid (for example glutamic acid), gas (H for example2And CO2), the sweat of antibiotic (for example penicillin and tetracycline), enzyme, vitamin (for example riboflavin, beta carotene) and hormone. Sweat also comprises the sweat for expendable ethanol industry (for example beer and liquor), food industry (for example fermented dairy product), leather industry and tobacco industry. Preferred sweat comprises alcohol fermentation process well known in the art. Preferred sweat is anaerobic fermentation process well known in the art.
Suitable fermentation cell (normally microorganism) can ferment, and sugar (for example glucose or maltose) can be changed into required tunning directly or indirectly. The example of fermentative microorganism comprises for example yeast of fungal organism. " yeast " comprises saccharomyces (Saccharomyces spp.) at this, Saccharomyces cerevisiae (Saccharomyces cerevisiae), Ka Ersibai sugar yeast (Saccharomyces carlbergensis), candida (Candida spp.), Crewe Vickers saccharomyces (Kluveromyces spp.), pichia belongs to (Picha spp.), Hansenula anomala belongs to (Hansenula spp.), trichoderma (Trichoderma spp.), Lipomyces starkeyi (Lipomyces starkey), with Yarrowia lipolytica. Preferred yeast comprises the bacterial strain, particularly Saccharomyces cerevisiae of saccharomyces. Commercial obtainable yeast comprises that for example Red Star/Lesaffre Ethanol Red is (available from RedStar/Lesaffre, USA) FALI is (available from Fleischmann ' s Yeast, a division of Bums Philp Food Inc., USA), SUPERSTART (available from Alltech), GERT STRAND (available from Gert Strand AB, Sweden) and FERMIOL (available from DSM Specialties).
Up to now evidence illustrates that all some desaturases of heterogenous expression in yeast have quite low activity with some extending enzyme combinations the time. But the present inventor has been found that by providing to have the acyl coenzyme A form of utilizing aliphatic acid in LC-PUFA is synthetic and can address this problem as the desaturase of the ability of substrate, and this is considered to have superiority in the recombinant cell of non-yeast. Aspect this, the desaturase of also having determined the vertebrate source is useful especially for producing LC-PUFA. Therefore, in embodiments of the present invention, (i) at least a enzyme is Δ 5 extending enzymes that the intracellular EPA of catalysis changes into DPA; (ii) at least a desaturase can act on the acyl coenzyme A substrate; (iii) at least a desaturase comes from vertebrate or its variant; Or (iv) ii) and combination iii).
In a particularly preferred embodiment, host cell is plant cell, for example at these those plant cells of more describing in detail.
" CFU-GM of seed " is the cell that can divide and/or be divided into the cell of transgenic seed of the present invention at this, and/or can divide and/or be divided into the cell of the genetically modified plants that produce transgenic seed of the present invention.
The level of the LC-PUFA that produces
The level of the LC-PUFA that produces in recombinant cell is important. Level can be represented as the compositions (percentage) in TFA such as ω 3 LC-PUFA or ω 6 LC-PUFA or C22+LC-PUFA such as the special LC-PUFA that can measure with methods known in the art or relevant LC-PUFA group. Level also can be expressed as LC-PUFA content, the percentage of LC-PUFA in comprising the material dry weight of recombinant cell for example, and for example LC-PUFA accounts for the percentage of seed dry weight. Understand, for LC-PUFA content, the LC-PUFA that produces in oilseeds is possibly obviously higher than being not used in the LC-PUFA that vegetables that oilseeds produce or crops produce, but both can have similar LC-PUFA composition, both can be used as the source for the LC-PUFA of human and animal's consumption.
Can determine the LC-PUFA level with either method known in the art. For example, can from cell, tissue or organism, extract TL, and before analyzing with gas chromatography (GC), aliphatic acid has been converted to methyl esters. These technology have been described in embodiment 1. Peak position in the chromatogram can be used to identify every kind of special aliphatic acid, and can integrate the amount that area definition under each peak goes out aliphatic acid. Unless different explanations is arranged, the percentage of the special fatty acid in the sample is confirmed as the percentage that area under the aliphatic acid peak accounts for the gross area of the aliphatic acid in the chromatogram at this. This is mainly corresponding to percentage by weight (w/w). As described in Example 1 such, can determine the homogeny of aliphatic acid with GC-MS.
In some embodiments, wherein recombinant cell can be used for for example yeast cells of sweat, the EPA level of producing can be in the cell TFA at least 0.21%, preferably at least 0.82% or at least 2% and more preferably at least 5%.
In other embodiments, the TFA of recombinant cell can comprise at least 1.5% EPA, preferably at least 2.1% EPA and more preferably at least 2.5%, at least 3.1%, at least 4% or 5.1%EPA at least.
In further embodiment, wherein recombinant cell can be used for sweat or plant cell, and produce DPA, and intracellular TFA can comprise at least 0.1% DPA, preferably at least 0.13% or at least 0.15% and more preferably at least 0.5% or 1%DPA at least.
In further embodiment, the TFA of cell can comprise at least 2%C20 LC-PUFA, preferably at least 3% or 4%C20 LC-PUFA at least, more preferably at least 4.7% or at least 7.9%C20 LC-PUFA and most preferably 10.2%C20 LC-PUFA at least.
In further embodiment, the TFA of cell can comprise at least 2.5%C20 ω 3 LC-PUFA, preferably at least 4.1% or 5%C20 ω 3 LC-PUFA at least more preferably.
In other embodiments, wherein synthesize EPA and DPA in cell, the EPA level that obtains is at least 1.5%, at least 2.1% or at least 2.5%, and the DPA level is at least 0.13%, at least 0.5% or at least 1.0%.
In each of these embodiments, recombinant cell can be the cell of the organism that is suitable for fermenting, unicellular microorganism for example, and it can be for example yeast of prokaryotes or eucaryote, or plant cell. One preferred embodiment in, cell is the cell of angiosperm (higher plant). In further preferred embodiment, cell is seed cell, for example oilseeds or crops or cereal.
The generation level of LC-PUFA in the recombinant cell also can be expressed as conversion ratio, and namely the amount of formed LC-PUFA accounts for the percentage of one or more substrates PUFA or LC-PUFA. For example for EPA, can be expressed as the ratio of EPA level (accounting for the percentage of TFA) and substrate aliphatic acid (ALA, SDA, ETA or ETrA) level. One preferred embodiment in, transformation efficiency is from ALA to EPA. In a specific embodiment, the conversion ratio that produces EPA in recombinant cell can be at least 0.5%, at least 1% or at least 2%. In another embodiment, ALA is at least 14.6% to the transformation efficiency of EPA. In further embodiment, the conversion ratio by EPA generation DPA in the recombinant cell is at least 5%, at least 7% or at least 10%. In other embodiments, the total omega-3 fatty acid as Δ 6 desaturation products that produces (be the downstream of 18:3 ω 3 (ALA), be calculated as the summation of the percentage of 18:4 ω 3 (SDA), 20:4 ω 3 (ETA), 20:5 ω 3 (DPA)) is at least 4.2%. In a concrete embodiment, prolonging steps through Δ 6 desaturation steps and/or Δ 9 in recombinant cell (preferred plant cell, preferred seed cell) is at least 22% or at least 24% with the conversion ratio that ALA changes into ω 3 products. Other are noted that in the present embodiment (product: ratio ALA) is at least 1: 3.6 for the product of the intracellular ALA of being derived from and ALA.
If select to be used for introducing the parental cell of gene, so that the horizontal optimization of aliphatic acid substrate that produce or that external source provides, just can be so that the content maximization of the LC-PUFA in the recombinant cell. In a specific embodiment, cell produces the ALA that accounts for TFA at least 30%, at least 50% or at least 66% level exogenously. Also the LC-PUFA level can be maximized by growth or cultured cell under optimum condition. Optimum condition for example is the temperature a little lower than the normal temperature of cell, and this temperature is considered to help to accumulate polyunsaturated fatty acid.
The maximum production of required LC-PUFA is had superiority, although the degree of side reaction is minimized. In concrete embodiment, detected seldom or do not detect ETrA (less than 0.1%), and the EPA level is at least 2.1%.
As for genetically modified plants of the present invention, in one embodiment, at least one plant part synthesizes EPA, and wherein the TFA of plant part comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
In another embodiment, at least one plant part synthesizes DPA, and wherein the TFA of plant part comprises at least 0.1%, at least 0.13% or 0.5%DPA at least.
In further embodiment, at least one plant part synthesizes DHA.
In another embodiment, at least one plant part synthesizes DHA, and wherein the TFA of plant part comprises at least 0.1%, at least 0.2% or 0.5%DHA at least.
In another embodiment, at least one plant part synthesizes at least a ω 3 C20 LC-PUFA, and wherein the TFA of plant part comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
Still in another embodiment, at least one plant part synthesizes EPA, and wherein the ALA in plant part is at least 2% or at least 14.6% to the transformation efficiency of EPA.
In further embodiment, at least one plant part synthesizes ω 3 polyunsaturated fatty acids, it is that wherein the ALA in the plant part is at least 22% or at least 24% to the transformation efficiency of described product to the product of Δ 6 desaturations of ALA and/or product that the Δ 9 of ALA is prolonged.
Still in another embodiment, at least one plant part is from the synthetic DPA of EPA, and wherein the EPA in plant part is at least 5% or at least 7% to the transformation efficiency of DPA.
For transgenic seed of the present invention, in one embodiment, synthetic EPA in seed, the TFA of seed comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
In another embodiment, synthetic DPA in seed, the TFA of seed comprise at least 0.1%, at least 0.13% or 0.5%DPA at least.
In further embodiment, synthetic DHA in seed.
In another embodiment, synthetic DHA in seed, and the TFA of seed comprises at least 0.1%, at least 0.2% or 0.5%DHA at least.
Still in further embodiment, in seed, synthesize at least a ω 3 C20 LC-PUFA, and the TFA of seed comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
In further embodiment, synthetic EPA in seed, and the ALA in the seed is at least 2% or at least 14.6% to the transformation efficiency of EPA.
In another embodiment, synthetic ω 3 polyunsaturated fatty acids in seed, it is that the ALA in the seed is at least 22% or at least 24% to the transformation efficiency of described product to the product of Δ 6 desaturations of ALA and/or to the product of the Δ 9 prolongation effects of ALA.
In further embodiment, from the synthetic DPA of EPA, and the EPA in the seed is at least 5% or at least 7% to the transformation efficiency of DPA in seed.
For extract of the present invention, in one embodiment, the total fatty acid content of extract comprises at least 1.5%, at least 2.1% or 2.5%EPA at least.
In another embodiment, the total fatty acid content of extraction comprises at least 0.1%, at least 0.13% or 0.5%DPA at least.
In further embodiment, extract comprises DHA.
In another embodiment, the total fatty acid content of extract comprises at least 0.1%, at least 0.2% or 0.5%DHA at least.
In another embodiment, the total fatty acid content of extract comprises at least 0.25% or at least 4.1% ω 3 C20 LC-PUFA.
Still in another embodiment, extract comprises arbitrary mixture of ARA, EPA, DPA, DHA or their triglycerides.
For the method for generation of LC-PUFA of the present invention, in one embodiment, cell comprises at least a C20 LC-PUFA, and the TFA of cell comprises at least 2%, at least 4.7% or 7.9%C20 LC-PUFA at least.
In another embodiment, cell comprises at least a ω 3 C20 LC-PUFA, and the TFA of cell comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
In further embodiment, cell comprises ω 3 polyunsaturated fatty acids, it is to the product of Δ 6 desaturations of ALA and/or to the product of the Δ 9 prolongation effects of ALA, and intracellular ALA is at least 22% or at least 24% to the transformation efficiency of described product.
Still in another embodiment, cell comprises DPA, and the TFA of cell comprises at least 0.1%, at least 0.13% or 0.5%DPA at least.
In further embodiment, cell comprises DPA, and intracellular EPA is at least 5% or at least 7% to the transformation efficiency of DPA.
In another embodiment, cell comprises EPA, and wherein the TFA of cell comprises at least 1.5%, at least 2% or 2.5%EPA at least.
In further embodiment, cell comprises EPA, and intracellular ALA is at least 2% or at least 14.6% to the transformation efficiency of EPA.
Polypeptide
In one aspect, the invention provides the basically polypeptide of purifying, it is selected from the group that is made up of following polypeptide:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:1;
Ii) comprise the polypeptide that has the amino acid sequence of at least 40% homogeny with SEQ ID NO:1; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 8 desaturase activity.
Preferably, Δ 8 desaturases do not have Δ 6 desaturase activity yet.
In yet another aspect, the invention provides the basically polypeptide of purifying, it is selected from next group:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:2;
Ii) comprise the polypeptide that has the amino acid sequence of at least 60% homogeny with SEQ ID NO:2; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 5 extending enzymes and/or Δ 6 extending enzyme activity.
Preferably, polypeptide has Δ 5 extending enzymes and Δ 6 extending enzyme activity, and wherein polypeptide is more more effective from the synthetic ETA of SDA than it from the synthetic DPA of EPA. More preferably, can from algae, be purified into polypeptide. In addition, when it was expressed in yeast cells, it is more more effective than prolonging C22 LC-PUFA that it prolongs C20 LC-PUFA.
In yet another aspect, the invention provides the basically polypeptide of purifying, it is selected from next group:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
Ii) comprise the polypeptide that has the amino acid sequence of at least 40% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 9 extending enzymes and/or Δ 6 extending enzyme activity.
Preferably, polypeptide has Δ 9 extending enzymes and Δ 6 extending enzyme activity. Preferably, polypeptide is synthesizing ETA on more effective than it from SDA from the synthetic ETrA of ALA. In addition, preferably, from algae or fungi, be purified into polypeptide.
Still in yet another aspect, the invention provides the basically polypeptide of purifying, it is selected from next group:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:4;
Ii) comprise the polypeptide that has the amino acid sequence of at least 70% homogeny with SEQ ID NO:4; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 4 desaturase activity.
In further embodiment, the invention provides the basically polypeptide of purifying, it is selected from next group:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:60;
Ii) comprise the polypeptide that has the amino acid sequence of at least 55% homogeny with SEQ ID NO:60; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 5 desaturase activity.
Still in another embodiment, the invention provides basically purified polypeptide, it is selected from next group:
I) comprise the amino acid sequence polypeptide that provides such as SEQ ID NO:64;
Ii) comprise the polypeptide that has the amino acid sequence of at least 90% homogeny with SEQ ID NO:64; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 6 desaturase activity.
Still in yet another aspect, the invention provides the basically polypeptide of purifying, it is selected from the group that is made of following polypeptide:
I) comprise the polypeptide of the amino acid sequence that provides such as SEQ ID NO:88;
Ii) comprise the polypeptide that has the amino acid sequence of at least 76% homogeny with SEQ ID NO:88; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 6 extending enzyme activity.
Preferably, relevant with the arbitrary part in the upper part is preferably can isolate described polypeptide in the species from be selected from the group that is made of bar husband algae and melosira.
" the basically polypeptide of purifying " expression polypeptide relevant pollution molecular separation of native state of at least part of and lipid, nucleic acid, other polypeptide and other and polypeptide is opened. Preferably, basically the polypeptide at least 60% of purifying, preferably at least 75% and most preferably at least 90% be free on and its natural other components that link to each other. In addition, term " polypeptide " can Alternate at this and term " albumen ".
Analyze the homogeny percentage that (GCG program) determines polypeptide with GAP (Needleman and Wunsch, 1970), wherein breach produces compensation=5, and breach extends compensation=0.3. Unless different explanations is arranged, the length of search sequence is 15 amino acid at least, and GAP analyzes two sequences of arrangement at least 15 amino acid whose zones. More preferably, the length of search sequence is 50 amino acid at least, and GAP analyzes two sequences of arrangement at least 50 amino acid whose zones. Even more preferably, the length of search sequence is 100 amino acid at least, and GAP analyzes two sequences of arrangement at least 100 amino acid whose zones.
For given polypeptide/enzyme, understand than the higher homogeny percentages of the top homogeny percentage that provides and to consist of preferred embodiment. Therefore, in situation about being suitable for, for the homogeny percentages of minimum, polypeptide preferably includes with the SEQ ID NO of relevant name at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 95%, more preferably at least 96%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even the amino acid sequence of at least 99.9% homogeny more preferably.
In further embodiment, the present invention relates to at the substantially the same polypeptide of the those polypeptides of this special description. For polypeptide, term " substantially the same " keeps at least a activity of native protein simultaneously in this expression one or several (for example 2,3 or 4) amino acid whose disappearances, insertion and/or replacement.
Term " biological active fragment " referred to herein as the part of the given polypeptide/enzyme that still keeps desaturase or extending enzyme activity (enzyme that whichever is relevant). Can easily determine these biological active fragments by the activity of full-length proteins being carried out a series of disappearances and testing formed fragment.
Change by in the nucleic acid of coded polypeptide, introducing suitable nucleotides, perhaps can prepare amino acid sequence mutant/variant at this defined polypeptide/enzyme by external synthetic required polypeptide. These mutant comprise disappearance, insertion or the replacement of the residue in the amino acid sequence for example. Can in end-product, realize disappearance, the combination of inserting and replacing, as long as last protein product has required feature eventually.
When design amino acid sequence mutant, the location in mutational site and the character of sudden change will depend on the feature of modifying. Can be individually or order ground modify the site of sudden change, for example at first replace with the conserved amino acid selection by (1), carry out prior selection according to the result who realizes then; (2) disappearance target residue; Or (3) insert other residues at the contiguous position of site-directed.
The scope of sequential amino acid deletion is usually from about 1 to 30 residue, more preferably from about 1 to 10 residue and usually the time from about 1 to 5 continuous residue.
Replacing mutant has removed at least one amino acid residue in the peptide molecule and has inserted different residues in its position. Maximally related site for replacing mutagenesis comprises the site that is accredited as activity or binding site. Other relevant sites are that those special residues that wherein obtain from different bacterial strains or species all are identical sites. These sites may be important for BA. Preferably replace these sites in relatively conservative mode, particularly those sites at least three other sequences in identical conservative site.
Table 2 has shown these conservative replacements.
Table 2: the replacement of example
| Former residue | Exemplary replacement |
| Ala(A) | val；leu；ile；gly |
| Arg(R) | lys |
| Asn(N) | gln；his |
| Asp(D) | glu |
| Cys(C) | ser |
| Gln(Q) | asn；his |
| Glu(E) | asp |
| Gly(G) | pro，ala |
| His(H) | asn；gln |
| Ile(I) | leu；val；ala |
| Leu(L) | ile；val；met；ala；phe |
| Lys(K) | arg |
| Met(M) | leu；phe |
| Phe(F) | leu；vaI；ala |
| Pro(P) | gly |
| Ser(S) | thr |
| Thr(T) | ser |
| Trp(W) | tyr |
| Tyr(Y) | trp；phe |
| Val(V) | ile；leu；met；phe，ala |
In addition, if need, non-natural amino acid or chemical amino acid analogue can be incorporated into as replacement or add in the polypeptide of the present invention. These amino acid comprise, but be not limited to the D isomers of common amino acid, 2,4 DABs, α-aminoacid, 4-Aminobutanoicacid, 2-amino-butyric acid, 6-aminocaprolc acid, the 2-aminoisobutyric acid, the 3-alanine, ornithine, nor-leucine, norvaline, hydroxyproline, methyl amimoacetic acid, citrulling, Homocitrulline, cysteic acid, t-fourth glycine, t-fourth alanine, phenylglycine, CHA, Beta-alanine, fluorine amino acid, design thing amino acid is Beta-methyl amino acid for example, C Alpha-Methyl amino acid, N Alpha-Methyl amino acid, with amino acid analogue commonly used.
In building-up process or after the polypeptide of the present invention differently modified also within the scope of the invention involved, described modification is such as derivatization, protein cleavage degraded by biotinylation, benzyl, glycosylation, acetylation, phosphorylation, amidatioon, known protection/blocking groups, is connected etc. with antibody molecule or other cell ligands. These modifications can be used as stability and/or the biologically active that increases polypeptide of the present invention.
Can produce polypeptide of the present invention with several different methods, described method comprises generation and reclaims native protein, generation and reclaim recombinant protein and chemical synthesis albumen. In one embodiment, by be enough to produce cultivate under the condition of polypeptide can express polypeptide cell, and reclaim polypeptide and produce the polypeptide that separates of the present invention. The preferred cell of cultivating is recombinant cell of the present invention. Effectively condition of culture includes, but are not limited to allow effective culture medium, bioreactor, temperature, pH value and the Oxygen Condition of albumen generation. Effectively culture medium refers to the culture medium that any therein cultured cell produces polypeptide of the present invention. These culture mediums generally include have assimilable carbon, nitrogen and phosphorus source and suitable salt, mineral matter, metal and other nutrients aqueous culture medium of vitamin for example. Can be at traditional fermentation reactor, rock in bottle, test tube, microtitration ware and the petri culture plate and to cultivate cell of the present invention. Can cultivate under the temperature of recombinant cell, pH value and the oxygen content being suitable for. These condition of culture all are in the general personnel's in this area professional knowledge scope.
Polynucleotides
In one aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:5 or SEQ ID NO:6;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 50% homogeny with SEQ ID NO:5 or SEQ ID NO:6; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
In yet another aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:7 or SEQ ID NO:8;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 51% homogeny with SEQ ID NO:7 or SEQ ID NO:8; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
Still in yet another aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:9 or SEQ ID NO:10;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 51% homogeny with SEQ ID NO:9 or SEQ ID NO:10; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
One preferred embodiment in, the sequence of the polypeptide of the present invention of encoding is 31 to 915 nucleotides of SEQ ID NO:9 or 85 to 915 nucleotides of SEQ ID NO:9.
Further, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 70% homogeny with SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
In yet another aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:58 or SEQ ID NO:59;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 55% homogeny with SEQ ID NO:58 or SEQ ID NO:59; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
In yet another aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:63;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 90% homogeny with SEQ ID NO:63; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
In yet another aspect, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:89;
Ii) sequence of coding polypeptide of the present invention;
Iii) has the nucleotide sequence of at least 76% homogeny with SEQ ID NO:89; With
Iv) under the condition of high stringency, with i) to iii) in the sequence of arbitrary sequence hybridization.
The present inventor also has been separated to the polynucleotides of coding ketone-acyl synthase sample fatty acid prolonging enzyme first from non-higher plant.
Therefore, in further embodiment, the invention provides the polynucleotides of the separation that comprises the nucleotide sequence that is selected from the group that is consisted of by following sequence:
I) nucleotide sequence that provides such as SEQ ID NO:55;
Ii) with the nucleotide sequence of SEQ ID NO:55 at least 40% homogeny; With
Iii) under the condition of high stringency, with i) to ii) in the sequence of arbitrary sequence hybridization.
" polynucleotides of separation " comprise DNA, RNA or their composition, strand or double-stranded, the sense or antisense orientation or their combination, dsRNA etc., the polynucleotides that its expression is partly separated with polynucleotide sequence relevant with its native state or that be connected at least.
Preferably, the polynucleotides at least 60% of separation are free, preferably at least 75% free and most preferably at least 90% be free on and natural other components that link to each other of described polynucleotides. In addition, term " polynucleotides " is used interchangeably at this and term " nucleic acid molecules ".
Analyze (GCG program) with GAP (Needleman and Wunsch, 1970) and determine polynucleotides homogeny percentage, wherein breach produces compensation=5, and breach extends compensation=0.3. Unless other explanation is arranged, the length of search sequence is 45 nucleotides at least, and GAP analyzes in the zone of 45 nucleotides arrange two sequences at least. Preferably, the length of search sequence is 150 nucleotides at least, and GAP analyzes in the zone of 150 nucleotides arrange two sequences at least. More preferably, the length of search sequence is 300 nucleotides at least, and GAP analyzes in the zone of 300 nucleotides arrange two sequences at least.
For given polynucleotide, understand than the higher homogeny percentages of the top homogeny per-cent that provides and to constitute preferred embodiment.Therefore, under situation about being suitable for, for the homogeny percentages of minimum, polynucleotide preferably include with the SEQ IDNO of relevant name at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even the nucleotide sequence of at least 99.9% homogeny more preferably.
In further embodiment, the present invention relates to at the substantially the same polynucleotide of those polynucleotide of this special description.For polynucleotide, term " substantially the same " is in the replacement of this expression one or several (for example 2,3 or 4) Nucleotide, kept at least a activity of the coded native protein of Nucleotide simultaneously.In addition, this term comprises the interpolation or the disappearance of Nucleotide, and it has caused coded native protein to increase or has reduced by one or several (for example 2,3 or 4) amino acid, has kept coded natural that the proteic at least a activity of polynucleotide simultaneously.
Oligonucleotide of the present invention can be RNA, DNA or their derivative.The minimum size of these oligonucleotide is to form the stable required size of crossbred between the complementary sequence on oligonucleotide and the nucleic acid molecule of the present invention.Preferably, the length of oligonucleotide is at least 15 Nucleotide, at least 18 Nucleotide more preferably, at least 19 Nucleotide more preferably, at least 20 Nucleotide more preferably, even at least 25 Nucleotide more preferably.The present invention includes and to be used as the probe of for example identifying nucleic acid molecule or the oligonucleotide that produces the primer of nucleic acid molecule.Oligonucleotide as probe of the present invention is puted together mutually with mark usually, and mark for example is radio isotope, enzyme, vitamin H, fluorescence molecule or chemiluminescent molecule.
Polynucleotide of the present invention and oligonucleotide comprise those under stringency with the polynucleotide and the oligonucleotide of the sequence hybridization that is provided as SEQ IDNO:5 to 13.Stringency is the washing that (1) adopts low ionic strength and high-temperature, for example 0.015 M NaCl/0.0015 M Trisodium Citrate/0.1%NaDodSO at this
4, temperature is 50 ℃; (2) during hybridizing, adopt for example methane amide of denaturing agent, for example 50% (volume/volume) methane amide and 0.1% bovine serum albumin, 0.1%Ficoll, 0.1% polyvinylpyrrolidone, 50mM sodium phosphate buffer (pH value 6.5) and 750mMNaCl, 75mM Trisodium Citrate, temperature is 42 ℃; Perhaps (3) adopt salmon sperm dna (50g/ml), 0.1%SDS and 10% T 500 that 50% methane amide, 5xSSC (0.75 M NaCl, 0.075 M Trisodium Citrate), 50mM sodium phosphate (pH value 6.8), 0.1% trisodium phosphate, 5x Denhardt solution, supersound process are crossed, temperature is 42 ℃, in 0.2xSSC and 0.1%SDS.
When with naturally occurring molecular ratio than the time, polynucleotide of the present invention can have one or more sudden changes, described sudden change is the disappearance, insertion of nucleotide residue or replaces.Mutant can be naturally occurring (that is to say, be separated to from natural origin) or synthetic (for example, by nucleic acid being positioned the mutagenesis synthetic).
Also provide antisense and/or catalytic nucleic acid (for example ribozyme), itself and multi-nucleotide hybrid of the present invention, and therefore suppressed the generation of proteins encoded.In addition, provide dsRNA molecule, particularly had the little dsRNA molecule of the double stranded region of about 21 Nucleotide, it can be used to RNA and disturb, so that suppress the generation of intracellular polypeptide of the present invention.The type that can suppress the lipid acid that molecular changes cell (for example zooblast, liver moss or alga cells) produced with these.The generation of these antisenses, catalytic nucleic acid and dsRNA molecule all (is for example seen G.Hartmann and S.Endres, Manual of Antisense Methodology, Kluwer (1999) within those skilled in the art's limit of power; Haseloffand Gerlach, 1988; Perriman et al., 1992; Shippy etal., 1999; Waterhouse et al. (1998); Smith et al. (2000); WO 99/32619, WO 99/53050, WO 99/49029 and WO01/34815).
Gene construct and carrier
An embodiment of the invention comprise recombinant vectors, and it comprises at least a isolating polynucleotide molecule that is coded in this defined polypeptide/enzyme, and described polynucleotide molecule is inserted in the arbitrary carrier that nucleic acid molecule can be transferred in the host cell.This carrier contains allogenic nucleotide sequence, does not promptly find the nucleotide sequence that itself and nucleic acid molecule of the present invention are close natively and preferably is derived from the nucleotide sequence of the species of the species that non-nucleic acid molecule of the present invention originates.Carrier can be RNA or DNA, protokaryon or eukaryotic vector, and normally virus or plasmid.
One type recombinant vectors comprises the nucleic acid molecule of the present invention that operably is connected with expression vector.As implied above, word " operably connects " and refers to so that the mode that can be expressed in nucleic acid molecule is transformed into host cell the time is inserted into nucleic acid molecule in the expression vector.Expression vector at this moment can transformed host cell and is realized the DNA or the RNA carrier of the expression of special nucleic acid molecule.Preferably, expression vector also can duplicate in host cell.Expression vector can be carrier protokaryon or eucaryon, and normally virus or plasmid.Expression vector of the present invention comprises the carrier of arbitrary can play a role (promptly instructing genetic expression) in reconstitution cell of the present invention, reconstitution cell comprises bacterium, fungi, entozoa, arthropods, other animals and vegetable cell.Preferred expression vector of the present invention can instruct yeast, the intracellular genetic expression of animal or plant.
Particularly, expression vector of the present invention contains the adjusting sequence, and for example transcriptional control sequence, translation control sequence, replication orgin and other are can be with host cell compatible and control the adjusting sequence of the expression of nucleic acid molecule of the present invention.Particularly, recombinant molecule of the present invention comprises transcriptional control sequence.Transcriptional control sequence is initial, extension and the terminated sequence that control is transcribed.The transcriptional control sequence of particularly important is the sequence of those control transcription initiations, for example promotor, enhanser, operon and inhibition subsequence.Suitable transcribing in the control perhaps comprises arbitrary transcriptional control sequence that can play a role at least a reconstitution cell of the present invention.The known multiple such transcriptional control sequence of those skilled in the art.
Another embodiment of the invention comprises reconstitution cell, and it comprises through one or more recombinant molecule institute transformed host cells of the present invention.Can finish nucleic acid molecule to intracellular conversion by nucleic acid molecule being inserted into intracellular arbitrary method.Transformation technology includes, but are not limited to transfection, electroporation, microinjection, fat dyes, adsorbs and protoplastis merges.Reconstitution cell can remain single celled or can grow into tissue, organ or multicellular organisms.The nucleic acid molecule that is transformed can remain extrachromosomal or can by the mode of the ability of expression the nucleic acid molecule that is transformed be integrated in intrachromosomal one or more sites of transformant (being reconstitution cell) to keep it.
Transgenic plant and part thereof
Term " plant " is at this noun as the expression whole plants, but also contained, that from plant, obtain as the expression plant, from plant, derive to or the adjective of any material relevant, for example plant organ (for example leaf, stem, root, flower), unicellular (for example pollen), seed, vegetable cell etc. with plant.The plant that provided by the present invention or expection is used for the present invention's practice comprises unifacial leaf and dicotyledons.In preferred embodiment, plant of the present invention is crop plants (for example cereal and beans, corn, wheat, potato, cassava, paddy rice, jowar, millet, cassava, barley or pea) or other beans.Plant can grow into and be used to produce edible, rhizome, leaf, stem, flower or fruit.Plant can be vegetables or ornamental plant.Plant of the present invention can be: corn (Zea mays), rape (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), clover (Medicago sativa), paddy rice (Oryza sativa), rye (Secale cerale), jowar (Sorghum bicolour, Sorghumvulgare), Sunflower Receptacle (Helianthus annus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum), Ipomoea batatas (Lopmoea batatus), cassava (Manihotesculenta), coffee (Cofea spp.), coconut (Cocosnucifera), pineapple (Anana comosus), lemon (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa spp.), junket pears (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidiumguajava), mango (Mangifer indica), olive (Olea europaea), pawpaw (Carica papaya), cashew nut (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond (Prunus amygdalus), beet (Beta vulgaris), oat, or barley.
In one embodiment, plant is the oilseeds plants, preferably the oilseeds crop plants." oilseeds plant " is the plant species that is used for producing from the plant seed commercialization oil at this.The oilseeds plant can be oilseed rape (for example rape), corn, Sunflower Receptacle, soybean, jowar, flax (Semen Lini) or beet.In addition, the oilseeds plant can be other Btassica, cotton, peanut, opium poppy, leaf mustard, Semen Ricini, sesame, safflower or produce the nut plant.Plant can produce high-caliber oil, for example olive, oil palm or coconut in its fruit.The adaptable gardening plant of the present invention is that lettuce, witloof or vegetables rape comprise wild cabbage, asparagus broccoli or Cauliflower.The present invention also can be applied to tobacco, cucurbit, Radix Dauci Sativae, strawberry, tomato or pepper.
When needs produced ω 3 LC-PUFA, endogenic ALA that can be had by the plant transformed species and the ratio of LA preferably at least 1: 1 more preferably was at least 2: 1.The oilseeds plant that example comprises overwhelming majority's (even not being whole) is Semen Lini for example.This makes the amount maximization of the ALA substrate can be used for producing SDA, ETA, ETrA, EPA, DPA and DHA.
The plant that utilizes method of the present invention to produce can be this in detail described those plants transgenic plant and/or by episome institute plant transformed.In one embodiment, transgenic plant of the present invention also produce ω 3 desaturases of reorganization.As pointed in the paragraph formerly, the existence of ω 3 desaturases of reorganization has increased ALA in the plant and the ratio of LA, makes for example generation maximization of SDA, ETA, ETrA, EPA, DPA and DHA of LC-PUFA.
Provide the crop plants of relevant seed to comprise oilseeds plant and leguminous plants.Relevant seed comprises crop seeds for example corn, wheat, barley, paddy rice, jowar, rye etc.Leguminous plants comprises beans and pea.Beans comprises guar-bean (guar), thorn locust bean (locust bean), Semen Trigonellae, soya bean, string bean, cowpea, mung bean, lima bean, broad bean, French beans, garbanzo etc.
Term " extract of plant or part " refers to any part of plant." part " generally refers to special tissue or organ for example seed or root, and " extract " generally includes and destroy cell walls and to the partial purification possibly of formed material.Natively, " extract of plant or part " will comprise at least a LC-PUFA.Utilize the standard technique of this area can prepare extract.
As defined in the context of the invention, transgenic plant comprise plant and the filial generation thereof of using the recombinant technology genetic modification.This generally causes or strengthens at least a albumen/enzyme in this definition of generation in required plant or plant organ.Transgenic plant partly comprise all parts and the cell of described plant, for example tissue of being cultivated, callus, protoplastis.Transform plant and contain the genetic material that they are not contained before conversion.Genetic material preferably stably is integrated in the genome of plant.The genetic material of being introduced can be included in the same species naturally occurring but have the order of rearrangement or the sequence of different element arrangements, for example antisense sequences.These plants are in this is contained in the scope of " transgenic plant "." non-transgenic plant " is the plant that is not also passed through to introduce the genetic material genetic modification with recombinant DNA technology.One preferred embodiment in, each gene (transgenosis) that has been introduced in the transgenic plant all is homozygous, makes their filial generation can not lose required phenotype.
Exist some foreign heredity substance is incorporated into technology in the vegetable cell.These technology comprise that quickening coating directly enters in the cell (see that for example the U.S. 4,945,050 and the U.S. 5,141,131) to the genetic material on the particulate.Can be with edaphic bacillus technical transform plant (see that for example the U.S. 5,177,010, the U.S. 5,104,310, the U.S. 5,004,863, the U.S. 5,159,135).Also transform plant (seeing, for example WO 87/06614, the U.S. 5,472,869,5,384,253, WO 92/09696 and WO 93/21335) with electroporation.Be used to transform the technology of plant except multiple, with the contacted types of organization of alien gene also can be different.These tissues can include but not limited to that the embryo organizes, I type and II type callus tissue, plumular axis, meristematic tissue etc.Utilize appropriate technology described herein growing and/or the nearly all plant tissue of conversion between the differentiation phase.
At for example Pouwels et al., Cloning Vectors:A Laboratory Manual, 1985, supp.1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; And Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers has described a large amount of are applicable to stably transfection of plant cells or are used to set up the carrier of transgenic plant in 1990.Plant expression vector generally includes for example one or more plant gene of transcribing the clone under the control and alternative markers of dominance that are in 5 ' and 3 ' regulating and controlling sequence.These plant expression vectors also can contain promotor regulatory region (for example control induction type or constitutive expression, environment or grow adjustment type expression or the specific expressed regulatory region of cell or tissue), transcription initiation site, ribosome bind site, RNA processing signal, Transcription Termination site and/or polyadenylation signal.
The example of plant promoter comprises, but be not limited to ribulose-1,5-bisphosphate, 6-bisphosphate carboxylase small subunit, β-conglycinin promotor, phaseollin promotor, high molecular weight glutenin (HMW-GS) promotor, starch biosynthesis gene promotor, ADH promotor, heat-shocked promotor and tissue-specific promoter.Promotor also can contain can provide the enhancer sequence of transcribing efficient.Enhanser commonly used includes but not limited to Adh-intron 1 and Adh-intron 6.
Constitutive promoter instruct in all cells type and the free genetic expression (for example, Actin muscle, ubiquitin protein, CaMV35S) that continues.Tissue-specific promoter has caused the genetic expression in specific cell or the types of organization, and for example leaf or seed (for example, zein, oleosin, napin, ACP, globulin etc.) also can use these promotors.Promotor can be activated in certain stage of development of plants also and be activated in plant tissue and organ.That the example of these promotors includes but not limited to is pollen-specific, that the embryo is special, that mealie is special, cotton fiber specific, Gent promotor different, seed endosperm specific etc.
In particularly preferred embodiments, promotor instructs lipid and oily biosynthetic tissue and intraorganic expression wherein takes place, particularly seed cell for example albuminous cell and grow in embryo's intracellular expression.Suitable promotor is oilseed rape napin gene promoter (US5,608,152), broad bean USP promotor (Baumlein et al., 1991), Arabidopis thaliana oleosin promotor (WO 98/45461), (US 5 for Kidney bean phaseolin promotor, 504,200), rape Bce4 promotor (WO 91/13980) or legumin B4 promotor (Baumlein et al., 1992), and cause in the monocotyledons promotor of the seed-specific expression of corn, barley, wheat, rye, paddy rice etc. for example.Famous suitable promotor is barley lpt2 or lpt1 gene promoter (WO95/15389 and WO 95/23230) or in the promotor described in the WO 99/16890 (from the promotor of barley hordein gene, paddy rice glutenin gene, paddy rice oryzin gene, paddy rice prolamin gene, wheat gliadin gene, wheat glutelin gene, corn zein gene, oat glutelin gene, jowar kasirin gene, rye secalin gene).Other promotors comprise (1998) and described those promotors of US20030159173 such as Broun.
In some cases, may need to use inducible promoter.Inducible promoter has caused the genetic expression that responds to special signal, and described special signal is for example physical stimulation (heat shock gene), light (RUBP carboxylase), hormone (Em), metabolite and stress.Also can use other that in plant, play a role required transcribe and translate element.
Except plant promoter, can in vegetable cell, use promotor effectively, so that express alien gene from various sources.For example, for example octopine (octopine) synthase promoter, nopaline synthase promoter, mannopine (mannopine) synthase promoter of the promotor that can use bacterial origin; The promotor of viral source, for example cauliflower mosaic virus (35S and 19S) etc.
It is evident that the transgenic plant that are suitable for producing LC-PUFA described herein (particularly DHA) can directly be eaten, perhaps can be with it as the source of extracting indispensable fatty acid, wherein DHA is a kind of component.
" germination " referred to herein as that the tip of a root is prominent after the imbibition breaks in the seed coat." percentage of germination " refers to after imbibition, the per-cent of seeds germinated in colony in for some time (for example 7 or 10 days).Can in a couple of days, estimate kind of a subgroup every day, so that determine the germination per-cent in for some time.
For seed of the present invention, term " substantially the same percentage of germination " is to wait at least 60%, more preferably at least 80% and even more preferably at least 90% of gene non-transgenic seed at the percentage of germination of this expression transgenic seed.Can calculate percentage of germination with technology known in the art.
Further about seed of the present invention, the term germination of the seed " opportunity be substantially the same " is to wait at least 60%, more preferably at least 80% and even more preferably at least 90% of gene non-transgenic seed in the germination of this expression transgenic seed opportunity.Can calculate germination opportunity with technology known in the art.
The present inventor has been found that at least in some cases, when cell has homozygous transgenosis, has increased the generation of the LC-PUFA in the reconstitution cell.Therefore, preferably reconstitution cell (preferably transgenic plant) has at least a homozygous desaturase and/or prolongation enzyme gene.In one embodiment, cell/plant has Δ 6/ Δ, 5 desaturases of homozygous zebra fish and/or the prolongation enzyme of Caenorhabditis elegans.
Genetically modified non-human animal
The technology that is used to produce transgenic animal is being known in the art.Useful common textbook about this theme is Houdebine, Transgenic animals-Generation and Use (Harwood Academic, 1997).
For example allogenic DNA can be incorporated in the mammalian ovum of being fertilized.For example, can transform all-round or multipotential stem cell with precipitation, liposome fusion, retroviral infection or other modes of microinjection, calcium phosphate mediation, then institute's cell transformed is incorporated in the embryo, fetal development becomes transgenic animal then.In highly preferred method, use and contain the retroviral infection embryonic development of required DNA, and from the embryo who is infected, produce transgenic animal.But, in most preferred method, suitable DNA being co-injected in embryo's (preferably unicellular embryo) the pronucleus or cytoplasm, the embryo is allowed to develop into sophisticated transgenic animal.
The another kind of method that is used to produce transgenic animal comprise with standard method with the nucleic acid microinjection in the ovum in pronucleus stage.Before the uterine tube that is transferred to the false pregnancy acceptor, cultivate the ovum of injecting then.
Also can produce transgenic animal with the consideration convey technology of moving.Utilize this method, with having integrated the plasmid transfection stably of the encoding sequence of regulating relevant land under the sequence control or binding partners inoblast from donor animal.Stable then transformant and non-nucleus egg mother cell merge, and cultivate and it is transferred in the female receptor.
Feed
The present invention includes the composition that can be used as feed.For purpose of the present invention, " feed " comprises the food or the product of any mankind of being used for or animal consumption (comprise enteron aisle and/or intestines consume) outward, in it is ingested body after, it act as (a) nutrition or makes up tissue or supplying energy; And/or (b) keep, store or support enough nutritional statuses or metabolic function.Feed of the present invention comprises baby and/or children's nutritive compositions.
Feed of the present invention for example comprise cell of the present invention, plant of the present invention, vegetable cell of the present invention, seed of the present invention, extract of the present invention, product of the present invention, fermenting process of the present invention product or with suitable carrier composition together.The term " carrier " that broad sense is used comprises anyly can having or can not have the component of nutritive value.Those skilled in the art will understand that carrier must be applicable to feed, make it can not cause deleterious effects to the organism of consumption feed.
Feed of the present invention comprises oil, fatty acid ester or the lipid acid that directly or indirectly produces with method described herein, cell or plant.Composition can be solid form or liquid form.In addition, this composition can comprise edible macronutrient, VITAMIN and/or the mineral substance of special applications aequum.Whether the amount of these components will depend on composition and be intended for use normal individual or be used to have the individuality of special requirement, for example suffer from the individuality of metabolic disease etc.
Example with suitable carrier of nutritive value includes, but are not limited to macronutrient for example edible fat, carbohydrate and albumen.The example of these edible fats includes, but are not limited to Oleum Cocois, borage oil, fungal oil, blackcurrant oil, soybean oil and monoglyceride and triglyceride.These examples of carbohydrates include, but is not limited to: glucose, edible lactose and hydrolyzed starch.In addition, the proteic example that can be used for nutritive compositions of the present invention includes, but is not limited to soybean protein, electrodialytic whey, electrodialytic skimmed milk, whey or these proteic hydrolysates.
For VITAMIN and mineral substance, following VITAMIN and mineral substance can be added in the feed composition of the present invention: calcium, phosphorus, potassium, sodium, chlorine, magnesium, manganese, iron, copper, zinc, selenium, iodine and vitamin A, E, D, C and B mixture.Also can add other VITAMIN and mineral substance.
Component utilized can be the source of half purifying or purifying in feed composition of the present invention.The material for preparing has been synthesized in expression semipurified or purifying by the purifying natural material or by original position.
Also feed composition of the present invention can be joined in the food, even when not needing dietary supplement.For example, this composition can be joined in the food of any kind, it includes, but is not limited to: oleomargarine, modification butter, cheese, milk, sour milk, chocolate, candy, dessert, salad oil, cooking oil, cooking fat, meat, fish and beverage.
Saccharomyces is used to the preparation of beer and wine, also is used as the material of baking (bread specifically).Yeast is the main ingredient of vegetable extract.Yeast also is used as the additive of animal rearing.It is evident that, can provide genetics finished yeast strain, it is suitable for synthetic LC-PUFA described herein.These yeast strains can be used for the preparation of food and wine and beer then, so that the product with the fatty acid content (DHA content specifically) that has increased is provided.
In addition, the LC-PUFA that the present invention produced or contain and the transformant of expressing target gene also can be used for animal food additive so that change animal tissues or butterfat acid is formed, makes it more meet the demand of human body or animal.The example of these animals comprises sheep, ox, horse etc.
In addition, feed of the present invention can be used and aquaculture, so that increase the LC-PUFA level of the fish that is used for human or animal's consumption.
In Mammals, so-called " Sprecher " approach changes into DHA by three kinds of reactions with DPA, and it is independent of Δ 7 and prolongs enzyme, Δ 4 desaturases and beta-oxidation step (Sprecher et al., 1995) (Fig. 1).Therefore, at the feed that is used for Mammals consumption (preparation that for example is used for human infant consumption), mammalian object may only must provide the DPA that utilizes the present invention to produce, because by utilizing " Sprecher " approach that DPA is changed into DHA, should satisfy its demand to DHA.Therefore, in an embodiment of the invention, the feed that is used for Mammals consumption described herein comprises DPA at least, wherein realizes enzyme reaction at least a DPA production with intracellular recombinase.
Composition
The present invention also comprises composition, particularly pharmaceutical composition, and it comprises lipid acid and/or formed oil that one or more produce with method of the present invention.
Pharmaceutical composition can comprise one or more LC-PUFA and/or oil, its with standard, that know, nontoxic pharmaceutically acceptable carrier, adjuvant or inert matter (for example phosphate-buffered salt, water, ethanol, polyvalent alcohol, vegetables oil), wetting agent or emulsifying agent for example water/oil-emulsion be used in combination.Composition can be the liquid or solid form.For example, but composition can be the ointment or the cream forms of tablet, capsule, fluid-absorbing or form of powder, injectable forms or topical application.For disperse phase, by keeping required granular size and can keeping suitable flowability by the use tensio-active agent.Comprise that for example sugar, sodium-chlor etc. also may be needs to isotonic agent.Except these inert diluents, this composition also can comprise adjuvant, for example wetting agent, emulsifying agent and suspension agent, sweeting agent, seasonings and perfume compound.
Except active composition, suspension can comprise for example miscellany of isooctadecanol, polyoxyethylene sorbitol and sorbitan ester, Microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar-agar and tragakanta or these materials of ethoxylation of suspension agent.
Utilize technology well known in the art can prepare solid dosage form for example tablet and capsule.For example, with traditional tablet matrix (for example lactose, sucrose and W-Gum) associating wedding agent (for example gum arabic, W-Gum or gelatin), lubricant (for example stearic acid or Magnesium Stearate) can be with the LC-PUFA tableted that the present invention produced.By being integrated in the gel capsule with relevant LC-PUFA together with antioxidant, these vehicle can prepare capsule.
Use for intravenously, the PUFA or derivatives thereof that the present invention produced can be integrated in the commercialization formulation.
The common dose of special fatty acid is from 0.1mg to 20g, take every day 1 to 5 time (being up to 100g every day), scope preferably be from every day about 10mg to about 1,2,5 or 10g (one or many dosage is taken).As known in the art, the minimum of Xu Yaoing is to make an appointment with 300mgLC-PUFA every day.But, understand that the LC-PUFA of any amount will be of value to object.
The possible approach of using pharmaceutical composition of the present invention comprises for example intestines interior (for example oral and rectum) and the outer approach of intestines.For example, can oral or rectal administration liquid preparation.In addition, the homogeneous miscellany can fully be dispersed in the water, be mixed formation sprays or inhalation with physiology acceptable diluent, sanitas, buffer reagent or propelling agent under aseptic condition.
The general personnel of this area can determine the dosage of the composition that is administered to the patient, and this will depend on multiple factor, for example immunological status of patient's body weight, patient's age, patient's general health, patient's past medical history, patient etc.
In addition, composition of the present invention can be used to cosmetic purpose.It can be added to the feasible miscellany that forms in the cosmetic compositions that is pre-existing in, and the LC-PUFA that perhaps the present invention produced can be as unique " activity " component in the cosmetic compositions.
Medical science, animal doctor, agricultural or water industry purposes
The present invention also comprises with medicine described herein and/or feed composition treatment various diseases.Particularly, composition of the present invention can be used to treat the restenosis of postangioplasty.In addition, also can treat inflammation, rheumatoid arthritis, asthma and psoriasic symptom with composition of the present invention (comprising feed).The fact shows that also LC-PUFA can relate to calcium metabolism, and therefore, composition of the present invention can be used to treatment or preventing osteoporosis disease and kidney or urinary tract stone.
In addition, composition of the present invention also can be used for the treatment of cancer.Malignant cell has demonstrated and can change the lipid acid composition.Adding lipid acid has demonstrated the growth that can slow down malignant cell, has caused necrocytosis and increase their susceptibility to chemotherapeutics.In addition, composition of the present invention also can be used for the treatment of the cachexy relevant with cancer.
Composition of the present invention also can be used for the treatment of diabetes, and therefore verified in diabetic animal have altered fatty acid metabolism and a composition.
In addition, the composition of the present invention that comprises the LC-PUFA that the application by cell of the present invention directly or indirectly produces also can be used for the treatment of eczema and bring high blood pressure down.In addition, composition of the present invention can be used to suppress hemocyte and assemble, the induction of vascular expansion, reduce cholesterol levels, suppress the propagation of vessel wall muscle and fibrous tissue, reduce or prevent other side effects (U.S. 4 of gastrointestinal hemorrhage and non-steroidal anti-inflammatory drugs, 666,701), prevention or the treatment endometriosis and the premenstrual syndrome (U.S. 4,758,592), and the confirmed fatigue (U.S. 5,116,871) behind treatment myalgic encephalomyelitis and the virus infection.
Further purposes of the present invention comprises, but be not limited to, be used for the treatment of or prevent irregular pulse, angioplasty, AIDS, multiple sclerosis, Crohn disease, schizophrenia, fetal alcohol syndrome, attention-deficit hyperactivity disease, cystic fibrosis, pku, unipolar depression, offensive hostility, adrenoleukodystrophy, coronary artery disease, hypertension, obesity, Alzheimer disease, chronic obstructive pulmonary disease, ulcerative colitis or the eye disease of heart, and be used to keep general health.
In addition, above-mentioned medicine and nutritive compositions can be used for animal (be domestic or non-domestic animal, comprise Mammals, bird, Reptilia, lizard) and people, because animal has many and human identical needs and disease.For example, oil of the present invention or lipid acid can be used for animal rearing additive, animal rearing substituent, animal VITAMIN or animal part ointment.
Composition feed for example of the present invention also can be used for agricultural, so that increase the intravital LC-PUFA level of fish of human or animal's consumption.
The LC-PUFA of any amount will be of value to object.But, preferably, give " the treatment significant quantity " of object administering therapeutic relative disease.The dosage that can effectively treat disease (will benefit) from use LC-PUFA is that those skilled in the art are known.For example, at least several weeks (more preferably longer) every day at least 300mg LC-PUFA dosage will be applicable to multiple situation.
Antibody
The present invention also provides and at least a polypeptide of the present invention or the monoclonal and/or polyclonal antibody of its fragments specific bonded.Therefore, the present invention also provides the method that is used to produce at the mono-clonal or the polyclonal antibody of polypeptide of the present invention.
Term " specificity in conjunction with " refer to resist in reconstitution cell of the present invention (particularly recombinant plant cell) in protein binding at least a of the present invention, and not with intracellular other protein bound abilities.
Term " epi-position " referred to herein as antibody institute bonded proteic zone of the present invention.Can use epi-position to animal, to produce the antibody of anti-described epi-position, still, antibody of the present invention preferably combines with epitope regions specificity in the whole albumen.
Polyclonal antibody is used the selected Mammals of immunogenic polypeptide immunization (for example, mouse, rabbit, goat, horse etc.) if desired.Collect and handle the serum of immunized animal with known method.Contain other antigenic antibody if contain the serum of polyclonal antibody, can use immunoaffinity chromatography purifying polyclonal antibody.The technology that is used to produce and process polyclonal antiserum is known in this area.In order to produce these antibody, the present invention also provides and has been used as the immunogenic by the polypeptide of the present invention of other polypeptide haptenizations or its fragment of animal or human's body.
Those skilled in the art also can easily produce the monoclonal antibody at polypeptide of the present invention.The common method for preparing the mono-clonal monoclonal antibody with hybridoma is known.For example transform bone-marrow-derived lymphocyte or also can produce the cell strain of permanent product antibody with the Epstein-Barr virus transfection by cytogamy with by other technologies with the carinogenicity dna direct.Can screen the various performances of the monoclonal antibody group that is produced, i.e. isotype and epi-position avidity.
Another kind of technology relates to the screening phage display library, and wherein for example phage is expressed the scFv fragment with multiple complementary determining region (CDR) on the surface of its tunicle.This technology is being known in the art.
For purpose of the present invention, unless different explanations is arranged, term " antibody " comprises the fragment of whole antibody, and it is active with combining of target antigen that it has kept whole antibody.These fragments comprise Fv, F (ab ') and F (ab ')
2And single-chain antibody (scFv).In addition, antibody and its fragment can be humanized antibodies, for example at the antibody described in the EP-A-239400.
Antibody of the present invention can combine with solid support, and/or is packaged into test kit in the suitable vessel with suitable reagent, contrast, specification sheets etc.
Preferably, antibody of the present invention can be detected ground mark.The detectable label of allowing the example of direct mensuration antibody comprises radio-labeling, fluorophore, dyestuff, magnetic bead, chemiluminescent substance, micelle etc.The mark example of allowing the indirect measurement bonding force comprises enzyme, and wherein substrate can provide product that can develop the color or fluorescence.The detectable label of other examples can provide the covalently bound enzyme that can detect the product signal after being included in and adding suitable substrates.The example that is used for the suitable enzyme of conjugate comprises horseradish peroxidase, alkaline phosphatase, malate dehydrogenase (malic acid dehydrogenase) etc.Although can not commercialization obtain, can at random produce these antibody-enzyme conjugate with technology well known by persons skilled in the art.The visible mark note of more example (for example comprises vitamin H (it combines with avidin or streptavidin with high-affinity), fluorescence dye, phycobiliprotein, phycoerythrin and allophycocyanin, luciferin and Texas are red, and it can be used for fluorescence activated cell sorter), haptens etc.Preferably, detectable label is allowed in flat-plate luminous meter and is directly measured the biological example element.Can use these traget antibodies in the proteic technology of detection the present invention known in the art.
Embodiment
Embodiment 1: material and method
Cultivate Pavlova salina
Under the type culture condition, cultivate the Pavlova salina strain isolated (http://www.marine.csiro.au/microalgae) that comprises from the bacterial strain CS-49 of CSIRO Collection of LivingMicroalgae.Subculture, is transferred in the 10L PC demijohn by transferring to the 1L Erlenmeyer flask continuously then from the original seed culture at preservation center, increased in the dilution at 1: 10.Substratum is f/2, contain the Guillard of half intensity nutrition and the modifier of Ryther ' s (1962) f substratum, and growth temperature is 20 ± 1 ℃.Other culture temperature comprise that light intensity is 100 μ mol. photon PAR.m
-2.s
-1, bright: half-light is 12: 12 hours according to the cycle, and with 200 mL.L
-1.min
-1Speed charge into 1%CO
2Air.
Cultivate and feed yeast with precursor lipid acid
By heat-shocked plasmid is incorporated in the yeast, on yeast minimum medium (YMM) plate that contains as 2% raffinose of sole carbon source, selects transformant.In the liquid YMM that contains as 2% raffinose of sole carbon source, set up clone's inoculation culture thing.Test culture wherein is inoculated among the YMM+1%NP-40, makes initial OD
600Be 0.3.Rock (60rpm) at 30 ℃ and cultivate culture down, up to DO
600Near 1.0.At this moment, the adding final concentration is 2% semi-lactosi, and the adding final concentration is the precursor lipid acid of 0.5mM.Before centrifugal collection, 20 ℃ are rocked to descend to hatch culture once more 48 hours.With 1%NP-40,0.5%NP-40 and water washing cell precipitation thing, so that from any unconjugated lipid acid of the surface removal of cell.
The gas-chromatography of lipid acid (GC) is analyzed
The lipid acid preparation
In the glass test tube that is equipped with screw cap, by using MeOH-CHCl with Teflon strain line
3-HCl (10: 1: 1, v/v/v) the transesterification effect through centrifugal yeast sedimentation thing or Arabidopis thaliana seed is produced fatty acid methyl ester (FAME) 90-100 ℃ of following heating 2 hours.With FAME extract hexane-methylene dichloride (4: 1, v/v) in, and analyze with GC and GC-MS.
Capillary liquid chromatography method (GC)
Analyze FAME with 5890GC of Hewlett-Packard that is respectively fitted with HP 7673A or 6980 serial automatic injection devices and flame ionization detector (FID) or Agilent6890 gas chromatograph.The temperature of syringe and detector is respectively 290 ℃ and 310 ℃.Under 50 ℃, the FAME sample is expelled to capillary column (HP-5, the 50m * 0.32mm i.d. of nonpolar crosslinked methyl silicone consolidation; 0.17 μ m film thickness).After 1 minute, furnace temp is with 30 ℃ of .min
-1Speed rise to 210 ℃, then with 3 ℃ of .min
-1Speed reach 280 ℃ of outlet temperatures, keeping this temperature 5 minutes.Helium is carrier gas, and the outlet pressure of control stick is 65KPa, and valve was opened in injection in back 2 minutes.According to the evaluation of relatively carrying out the peak of the relative residence time data of standard FAME, utilize mass spectroscopy to confirm.Integrate peak area with carrying out quantitative Empower software (Waters) or Chemstation (Agilent).
Gas chromatography-mass spectrography (GC-MS)
Under 4 ℃, carry out GC-MS with the Finnigan GCQ Plus GC-MS ion collector that the column cap injection device is installed.Utilizing the AS2000 autopipette that sample is expelled to HP-5 surpasses in the delay breach of 2 bonding phase columns (50m * 0.32mm i.d.x0.17m film thickness).Kept 45 ℃ of initial temperatures 1 minute, subsequently with 30 ℃ of .min
-1Speed temperature is elevated to 140 ℃, then with 3 ℃ of .min
-1Speed be elevated to 310 ℃, and kept 12 minutes.Helium is used as carrier gas.The mass spectrograph operational condition is: the electron-bombardment energy is 70eV; Transmitter current is 250amp; Line of transference is 310 ℃; The radioactive source temperature is 240 ℃; Sweep velocity is 0.8scans.s
-1And the mass spectrum scope is 40-650 dalton.Use Xcalibu
TMSoftware obtains and handles mass spectrum.
The structure in P.salina cDNA library
For the construction cDNA library, profit is isolated mRNA in the following method from the P.salina cell: in liquid nitrogen, with 2g (weight in wet base) P.salina cell powderization, and it is sprinkled into containing in the beaker that 20ml extracts damping fluid by constant agitation lentamente with mortar and pestle.Toward wherein adding 5% insoluble polyvinylpyrrolidone, 90mM 2 mercapto ethanol and 10mM dithiothreitol (DTT), be transferred to Corex
TMBefore in the pipe, restir miscellany 10 minutes.Add 18.4ml 3M ammonium acetate, and mixed well.Then at 6000xg, 4 ℃ centrifugal sample 20 minutes down.Supernatant liquor is transferred in vitro new, be settled out nucleic acid by the 3M NaAc (pH value 5.2) and the cold isopropanol of 0.5 volume that adds 0.1 volume.After under-20 ℃, hatching 1 hour, with sample in swing rotor under the 6000xg centrifugal 30 minutes.Throw out is resuspended in the 1ml water, and extracts with phenol/chloroform.Water is transferred in vitro new, and be settled out nucleic acid at this 3M NaAc (pH value 5.2) and cold isopropanol of 2.5 volumes that adds 0.1 volume.Throw out is resuspended in the water, determines the concentration of nucleic acid, and isolate mRNA with Oligotex mRNA system (Qiagen).
(oligo dT primer that (Stratagene-cat#200400) provided and reversed transcriptive enzyme SuperscriptIII (Invitrogen) synthesize article one cDNA to utilize ZAP-cDNA synthetic agent box.Double-stranded cDNA is connected with the EcoRI/XhoI joint, and, therefrom constructs the library with ZAP-cDNA synthetic agent box as described in the incidental specification sheets handbook (Stratagene-cat#200400).The titre in elementary library is 2.5 * 10
5Plaque forming unit (pfu)/ml, the titre in amplification library is 2.5 * 10
9Pfu/ml.The average inset size of the cDNA inset in the library is 1.3 kilobasas, and the recombinant chou per-cent in the library is 74%.
Embodiment 2: little algae and polyunsaturated fat content thereof
The CSIRO preservation center of the little algae of live body
CSIRO has set up and has kept the little algae preservation of a live body center of containing little algae of 800 strains that surpass 140 kinds, and it represents most marine micro-algae and some freshwater microalgae classes (obtainable little algae strain can download to) from http://www.marine.csiro.au.Some small heterotrophism algae strains have also been kept.
This preservation center is the maximum and the abundantest little algae culture collection center of Australia.CLM focuses on the strain isolated from Australian waters, strain isolated above 80% is from different positions and climatic zone, northern to Australian antarctic zone from the Australia in the torrid zone, is separated to from the ocean, inshore, seashore, the bay, the tidal zone and fresh water environment.In addition, focus on representing the distinct group of single species, surpass a kind of algae strain usually.Culture collection in all algae strains all be unialgal and most of all be clone property.Algae strain hypotype is aseptic.Another collects institute is that the NIES that Japan keeps collects institute's (National Institute for Environmental Studies, environment is affixed one's name to).
Known little algae has the common point on the morphology species level, has only demonstrated low-down regionalism.But this morphologic common point can be hidden the diversity widely on the level in the species.For example outbreeding, isozyme, growth rate and a large amount of molecular engineering have been studied the genetics diversity of different microalgae widely to utilize method.The diversity scope that these institutes identify is to (Gallagher, 1980 between the colony and in the colony from big zone and global level (Chinain et al., 1997); Medlin et al., 1996; Bolch et al., 1999a, b).Algae strain that utilization is separated to from environment and that cultivate in the laboratory mostly just can identify the variation on the level in the kind between little algae of morphology undistinguishable.
It is essential having that identified and stable genotype in culture collection in the heart.Though the change of the pathognomonic feature that records or the example of losing (Coleman, 1977) are arranged in extended culture, cultivate the genetic continuity and the stability that generally can guarantee special algae strain.The profound hypothermia conversation strategy also can be used to limit the possibility of heredity skew.
Little algae and the purposes in water industry thereof
Because chemistry/nutritive compositions of little algae comprises PUFA, little algae is used as the living feed of various marine organisms in water industry.This slightly algae must be to be beneficial to be ingested and by the suitable dimension of readily digested.They must have growth rate fast, can form the bulk culture, and the fluctuating along with temperature, illumination and nutrient substance also is stable in culture, because these can appear in the system of hatching.The algae strain that meets these conditions helps and is widely used in water industry, and it comprises for example (T.ISO) CS-177, Pavlovalutheri CS-182, Chaetoceros calcitrans CS-178, Chaetoceros muelleri (Chaetocerosmuelleri) CS-176, middle Skeletonemacostatum (Skeletonema costatum) CS-181, false miniature hailian seaweed (Thalassiosira pseudonana) CS-173, Tetraselmis suecica CS-187 and Nannochloropsis oculata CS-189 of Isochrysis galbana (Isochrysis sp.) of Northern Hemisphere algae strain.Used Australian algae strain comprises Pavlovapinguis CS-375, Skeletonema (Skeletonema sp.) CS-252, Nannochloropsis sp.CS-246, Rhodomonas salina CS-24 and Navicula jeffreyi CS-46.The cell that the biochemistry evaluation that (maybe may use) used in water industry surpassed the little algae of 50 strains finds to grow into logarithmic growth late period contains 30 to 40% albumen, 10 to 20% lipids and 5 to 15% carbohydrate (Brown et al., 1997) usually.
The lipid composition that comprises the PUFA content of little algae
For containing the important long chain polyunsaturated fatty acids of high-load nutrition (LC-PUFA) (EPA (timnodonic acid specifically, 20:5 (ω 3)) and DHA (docosahexenoic acid, 22:6 (ω 3)) little algae is interesting relatively, because these lipid acid all are the healthy necessary lipid acid of human and aquatic animal.Though can obtain these PUFA from fish oil, little algae is the main producer of EPA and DHA.
Lipid composition of a large amount of little algaes (46 strain) and ratio and the content of the important PUFA in little algae lipid have been guaranteed out.The C18-C22 PUFA composition of little algae strain of different algae guiding principles has significant difference between phototrophy algae guiding principle (table 3, Fig. 2 also see Dunstan et.al., 1994; Volkmanet al., 1989; Mansour et al. .1999a).Diatom and Eustigmatophytes are rich in EPA, and produce a spot of more rare PUFA, ARA and DHA that can the amount of ignoring.In addition, diatom produces rare C16 PUFA for example 16:4 (ω 1) and 16:3 (ω 4).On the contrary, dinoflagellate has the DHA of high density, and in to a high proportion of EPA and precursor C18 PUFA (18:5 (ω 3) and 18:4 (ω 3) SDA, therapic acid).Chrysophyceae also contains EPA and DHA, and wherein EPA is dominant PUFA.Cryptomonad is the abundant source of C18 PUFA18:3 (ω 3) (ALA, alpha-linolenic acid) and SDA and EPA and DHA.Green alga (Chlorophytes for example, as Dunaliella spp. and Chlorella (Chlorella spp.)) considerably lack C20 and C22 PUFA, although some species have a spot of EPA (at most to 3%), usually contain abundant ALA and 18:2 (ω 6), also can produce 16:4 (ω 3).(for example 18:5 (ω 3) and biochemistry STA) or nutrition importance are also unclear for rare C16 PUFA (for example 16:4 (ω 3), 16:4 (ω 1), 16:3 (ω 4)) and C18 PUFA.But, being interested in for example SDA of C18 PUFA now, it just gradually by the precursor of understanding for useful EPA and DHA, does not resemble ALA and only is confined to be converted to EPA and DHA now.
Isolated the new strain of Australian thraustochytriale.When being examined, these thraustochytriales all show great morphology diversity from unicellular to cell cluster, complicated network and motion stage.Thraustochytriale is one group and produces the high oil and the unicellular organism body of LC-PUFA content.They are considered to original fungi at first, and ((Chromista, Heterokonta), this arranges itself and other heterokont (for example diatom and brown alga) more tight although be classified into thraustochytriale subclass recently.Under cultivating, the biomass productive rate that thraustochytriale can be significantly higher than other little algae acquisition (＞20g/L).In addition, thraustochytriale can be grown in the fermentor tank that is added with organic carbon source, so it has represented source that have a great attraction, renewable and free of contamination, ω-3 oil.
Table 3: selected PUFA and the LC-PUFA distribution in little algae and other groups and Application Areas.
| Group | Belong to/kind | PUPA | Use |
| The Eustigmatophytes diatom | Nannochloropsis Chaetoceros | EPA | Water industry |
| Dinoflagellates Thraustochytrids | Crypthecodinium?cohnii Schizochytrium | DHA | Water industry, healthcare products, infant formulas |
| Red algae Thraustochytrids fungi | The unfiled Mortiella of Phorphyridium | ARA | Water industry, infant formulas pharmacy industry (prostaglandin(PG) precursor) |
| Blue-green algae | Spirulina | GLA | Healthcare products |
Abbreviation: gamma-linolenic acid, GLA, 18:3 ω 6:20:5 ω 3, timnodonic acid, EPA, 20:5 ω 3: docosahexenoic acid, DHA, 22:6 ω 3; Arachidonic acid, ARA, 20:4 ω 6.
Table 4 has shown the representational fatty acid profile of selected Australian thraustochytriale.The O strain is attracting especially, because it contains very high-load DHA (61%).Every kind of content of other PUFA is all less than 5%.The thraustochytriale that contains high DHA also usually contains a high proportion of 22:5 ω 6 (clupanodonic acid), as seeing in A, C and the H strain.Under the culture condition that is adopted, DPA only is the less component in the O strain, makes that this strain is to make us interested especially.The A strain contains DHA (28%) and the EPA (16%) as main LC-PUFA.C strain and H strain are different from other strain, and wherein ARA (10-13%) is also as main LC-PUFA.Exist the LC-PUFA of a large amount of other in the thraustochytriale, it comprises DPA (3) and 22:4 ω 6 and other component.
Table 4: the fatty acid component of thraustochytriale strain (accounting for the per-cent of total amount)
| Lipid acid | The component percentages bacterial strain | |||
| A | C | H | O | |
| 16:0 | 18.0 | 16.4 | 13.5 | 22.1 |
| 20:4ω6?ARA | 4.0 | 10.5 | 13.4?0.7 | |
| 20:5ω3?EPA | 15.8 | 7.7 | 5.2 | 4.1 |
| 22:5ω6?DPA(6) | 16.6 | 9.3 | 12.7 | 3.4 |
| 22:6ω3?DHA | 28.2 | 21.6 | 19.2 | 61.0 |
Can be used for separating the little algae and the thraustochytriale strain isolated that relate to the synthetic gene of LC-PUFA is following genus or kind:
Diatomacae (diatom)
Attheya septentrionalis, Aulacoseira sp., narrow crack Chaetoceros (Chaetocerosaffinis), Chaetoceros calcitrans, Chaetoceros calcitrans f.pumilum, Chaetoceros cf.mitra, Peru's Chaetoceros (Chaetoceros cf.peruvianus), radiation Chaetoceros (Chaetoceros cf.radians), two prominent Chaetoceros (Chaetoceros didymus), Chaetoceros difficile, Chaetoceros gracilis, Chaetoceros muelleri (Chaetocerosmuelleri), Chaetoceros simplex, consor Chaetoceros (Chaetoceros socialis), Chaetoceros belongs to (Chaetoceros sp.), Chaetoceros cf.minus, Chaetoceros cf.tenuissimus, Wei Shi rotary strainer algae (Coscinodiscus wailesii), other Coscinodiscus spp., Dactyliosolenfragilissimus, Detonula pumila, the two tail algaes (Ditylum brightwellii) of Bu Shi, Eucampiazodiacus, Extubocellulus spinifera, ring grain labor moral algae (Lauderia annulata), Denmark buttress shaft algae (Leptocylindrus danicus), beads melosira (Melosira moniliformis), Melosira (Melosira sp.), shallow bid algae (Minidiscus trioculatus), multiform aesthetes algae (Minutocellus polymorphus), Odontella aurita, Odontella mobiliensis, Odontella regia, Odontella rhombus, Odontella sp., Papiliocellulus simplex, ball float Trentepohlia (Planktosphaerium sp.), Proboscia alata, cover a watt root pipe algae (Rhizosoleniaimbricate), bristle root pipe algae (Rhizosolenia setigera), root pipe algae (Rhizosolenia sp.), middle Skeletonemacostatum (Skeletonema costatum), Skeletonema pseudocostatum, Skeletonema (Skeletonema sp.), torrid zone Skeletonema Greville (Skeletonema tropicum), other Skeletonema Grevilles, turriform official hats and canopies algae (Stephanopyxis turris), Oedogonium (Streptotheca sp.), Streptothecatamesis, Oedogonium, striped Trentepohlia (Striatella sp.), exquisite hailian seaweed (Thalassiosiradelicatula), centrifugal row hailian seaweed (Thalassiosira eccentrica), Thalassiosiramediterranea, Thalassiosira oceanica, E Shi hailian seaweed Thalassiosira oestrupiI), abstruse hailian seaweed (Thalassiosira profunda), false miniature hailian seaweed (Thalassiosirapseudonana), Thalassiosira rotula Meunier (Thalassiosira rotula), Thalassiosira stellaris, other hailian seaweeds, beautiful bent shell algae (Achnanthes cf.amoena), wing cocoon shape algae (Amphiprora cf.alata), Amphiprora hyalina, two eyebrow algaes (Amphora spp.), glacial epoch star bar algae (Asterionella glacialis), Asterionellopsis glacialis, Biddulphia (Biddulphiasp.), Cocceneis (Cocconeis sp.), crescent buttress shaft algae (Cylindrotheca closterium), Cylindrotheca fusiformis, groove Trentepohlia (Delphineis sp.), double-walled algae (Diploneis sp.), Entomoneis sp., Fallacia carpentariae, ocean spot bar algae (Grammatophoraoceanica), Haslea ostrearia, wedge shape Trentepohlia (Licmophora sp.), Manguinea sp., Navicula cf.jeffreyi, Navicula jeffreyi, other boat-shaped algaes (Navicula spp.), Nitzschiacf.bilobata, the rhombus algae (Nitzschia cf.constricta) that contracts of hanging, Nitzschia cf.cylindrus, fragment rhombus algae (Nitzschia cf.frustulum), shovel shape rhombus algae (Nitzschia cf paleacea), Nitzschia closterium, Nitzschia fraudulenta, fragment rhombus algae (Nitzschiafrustulum), Nitzschia (Nitzschia sp.), Phaeodactylum tricornutum, weak twill algae (Pleurosigmadelicatulum), other twill algaes (Pleurosigmaspp.), Pseudonitzschia australis, graceful pseudo-rhombus algae (Pseudonitzschia delicates sima), Pseudonitzschiafraudulenta, Pseudonitzschia pseudodelicatissima, Pseudonitzschia pungens, pseudo nitzschia (Pseudonitzschia sp.), Pseudostaurosira shiloi, rhombus sea line algae (Thalassionema nitzschioides), or Thalassiothrix heteromorpha.
Chrysophyceae
Chrysolepidomonas cf.marina, Hibberdia spp., Denmark's Ochromonas (Ochromonas danica), Pelagococcus subviridis, Phaeoplaca spp., Synurashagnicola or other Chrysophyte spp..
Cryptophyceae
Chroomonas placoidea, Chroomonas sp., Geminigera cryophila, Hemiselmis simplex, Hemiselmis sp., Rhodomonas baltica, Rhodomonasmaculata, Rhodomonas salina, Rhodomonas sp. or other Cryptomonad spp..
Dinophyceae (dinoflagellate)
Alexandrium affine, Alexandrium catenella, Alexandrium margalefi, Alexandrium minutum, Alexandrium protogonyaulax, Alexandriumtamarense, Amphidinium carterae, Amphidinium cfbritannicum, Amphidiniumklebsii, Amphidinium sp., Amphidinium steinii, Amylaxtricantha, Ciyptothecodinium cohnii, Ensiculifera sp., Fragilidium spp., Gambierdiscustoxicus, Gymnodinium catenatum, Gymnodinium galathaneum, Gymnodiniumgalatheanum, Gymnodinium nolleri, Gymnodinium sanguineum, or other Gymnodinium spp., Gyrodinium pulchellum, or other Gyrodinium spp., Heterocapsa niei, Heterocapsa rotundata, Katodinium cf.rotundatum, Kryptoperidinium foliaceum, Peridinium balticim, Prorocentrum gracile, Prorocentrum mexicanum, Prorocentrum micans (Prorocentrum micans), Protoceratiumreticulatum, Pyrodinium bahamense, Scrippsiella cf.precaria, or other Scrippsiella spp., Symbiodinium microadriaticum, or Woloszynskia sp..
Euglenophyceae
Very thin eye worm.
Green branch algae guiding principle (Prasinophyceae)
Pycrnococcus sp., Mantoniella squamata, Micromonas pusilla, Nephroselmis minuta, Nephroselmis pyriformes, Nephroselmis rotunda, Nephroselmis (Nephroselmis spp.), or other Prasinophyte spp., Pseudoscourfieldiamarina, Pycnococcus provasolii, Pyramimonas cordata, Pyramimonasgelidicola, Pyramimonas grossii, Pyramimonas oltmansii, Pyraminionaspropulsa, other Pyramimonas spp., Tetraselmis antarctica, Tetraselmis chuii, Tetraselmis sp., Tetraselmis suecica, or other Tetraselmis spp..
Decide whip Chrysophyceae (Prymnesiophyceae)
Chrysochromulina acantha, Chrysochromulina apheles, Chrysochromulina brevifilum, Chrysochromulina camella, Chrysochromulinahirta, the golden algae (Chrysochromulina kapps) of hat, Chrysochromulina minor, Chrysochromulina pienaar, Chrysochromulina simplex, Chrysochromulinasp., Chrysochromulina spinifera, Chrysochromulina strobilus, with other Chrysophyte spp., Chrysotila lamellosa, Cricosphaera carterae, Ctystallolithus hyalinus, Diacronema vlkianuni, Dicrateria inornata, Dicraterias sp., Emiliania huxleyi, Gephyrocapsa oceanica, Imantoniarotunda, with other equilateral chrysophyceae (Isochrysis spp.), Ochrosphaera neapolitana, Pavlova cf.pinguis, Pavlova gyrans, Pavlova lutheri, Pavlova pinguis, Pavlova salina, Pavlova sp., Phaeocystis cf.pouchetii, Phaeocystis globosa, Phaeocystis pouchetii, other globosa belong to (Phaeocystis spp.), Pleurochrysis aff.Carterae, for a short time, decide whip chrysophyceae (Prymnesium parvum), Prynznesium patelliferum, other Prymnesium spp., or Pseudoisochrysis paradoxa.
The Raphidophyceae guiding principle
Chattonella antiqua, other card Dun Shi Trentepohlias (Chattonella spp.), Fibrocapsajaponica, other Fibrocapsa spp., Heterosigmaakashiwo, Heterosigmacarterae or other Heterosigma spp..
The Thraustochytridae guiding principle
Schizochytrium spp., Thraustochytrium aureum, Thraustochytriumroseum or other thraustochytriales.
Eustigmatophytae guiding principle as the gene source that is used for the EPA generation
Eustigmatos vischeri, Monodus subterraneus, Nannochloropsis oculata, Nannochloropsis salina, Vischeria helvetica, Vischeria punctata, Chloridellaneglecta, simple little green alga (Chloridella simplex), neat green grapes algae (Chlorobotrysregularis), Ellipsoidon parvum, Ellipsoidon solitare, Eustigmatos magnus, Eustigmatos polyphem, line muscle angle green alga (Goniochloris sculpta), Monodussubterraneus, Monodus unipapilla, Nannochloropsis gaditana, Nannochloropsis granulata, Nannochloropsis limnetica, Pseudocharaciopsis, ovalis, Pseudocharaciopsis texensis, Pseudostaurastrum limneticum, or Vischeria stellata.
Embodiment 3: separate zebra fish Δ 5/6 desaturase with and function in yeast characterize
The same with little algae, some other organism also has by precursor alpha-linolenic acid (18:3, ALA) the ability (see figure 1) of synthetic LC-PUFA, and isolated some and act on this synthetic gene (seeing Sayanova and Napier, 2004) for example.From various organisms (comprising algae, fungi, liver moss, plant, nematode and Mammals), isolated and related to the biosynthetic gene of ω-3 C20+PUFA.To relating to the understanding of ω-3 C20+PUFA synthetic gene, EPA synthetic needs to shift the gene that at least two kinds of desaturases of coding and a kind of PUFA prolong enzyme in the plant according at present.Need to shift in addition more a kind of desaturase and more a kind of prolongation enzyme (Sayanova and Napier, 2004) from the synthetic DHA of EPA in the plant.These enzymes are: for synthesizing of EPA, and the order activity that needs Δ 6 desaturases, Δ 6 to prolong enzymes and Δ 5 desaturases.According to another the steerable approach in some algae, also can synthesize EPA (Wallis and Browse, 1999 by the order activity that Δ 9 prolongs enzyme, Δ 8 desaturases and Δ 5 desaturases; Qi et al., 2002).For the further conversion of the EPA in the plant, need further to shift Δ 5 and prolong enzyme and Δ 4 desaturases (Sayanova and Napier, 2004) to DHA.
Hasting etc. (2001) are separated to the gene of coded delta 5/ Δ 6 difunctional desaturases from zebra fish (Daniorerio), if and demonstrate in yeast when expressing described enzyme, this desaturase can catalysis Δ 6 (GLA and SDA) and the synthesizing of Δ 5 (20:4 and EPA) lipid acid.Therefore this desaturase can act on ω 6 and ω 3 substrates.
The separation of zebra fish Δ 5/ Δ 6 desaturases
According to product description (Qiagen), with extracting RNA the zebra fish liver of RNAeasy system under new separation.According to reported sequence (Hastings et al.2001), designed zebra fish Δ 5/6 ORF 5 ' and 3 ' end adopted primer (5 '-CCCAAGCTTACTATGGGTGGCGGAGGACAGC-3 ') (SEQ ID NO:39) and antisense primer (5 '-CCGCTGGAGTTATTTGTTGAGATACGC-3 ') (SEQ IDNO:40) arranged, and it is used for a step reverse transcription PCR (RT-PCR with the RNA that extracted, Promega), the buffer conditions of utilizing product man to be recommended.Obtain the amplified material of single 1335bp size, and be connected in the pGEM-Teasy (Promega), determined this sequence and reported sequence is identical.
Cutting contains the fragment of complete coding region (SEQ ID NO:38) down, and be connected in the yeast shuttle vector pYES2 (Invitrogen).Carrier pYES2 has the URA3 gene, and this gene is allowed according to uridylic prototroph screening yeast conversion body.The coding region of being inserted is under the control of polyadenylation signal of induction type GAL1 promotor and pYES2.Formed plasmid is called pYES2-zf Δ 5/6, is used for being changed in the yeast (Saccharomyces cerevisiae) and therein expressing.
The expression of zebra fish Δ 5/ Δ, 6 desaturases in yeast
Gene construct pYES2-zf Δ 5/6 is incorporated in the yeast strains S288.Because some reasons, yeast are to be used to analyze the allogenic potential LC-PUFA biosynthesis gene good host of (comprise desaturase and prolong enzyme).It is transformed easily.Itself can not synthesize LC-PUFA, therefore detects any new PUFA easily, because without any background problems.In addition, yeast cell is integrated in the lipid acid in the growth medium in the lipid of cell easily, allows in view of the above to the transformant of the gene that contains the new enzyme of encoding and presents suitable precursor, allows their enzymic activity of checking.
Biochemical analysis
Be grown in the YMM substratum through pYES2-zf Δ 5/6 transformed yeast cells, add semi-lactosi and induce.Lipid acid 18:3 ω 3 (ALA, 0.5mM) or 20:4 ω 3 (ETA 0.5mM) joins in the aforesaid substratum.After hatching 48 hours, collecting cell is also used as analyzing lipid acid at the kapillary gas liquid chromatography (GC) described in the embodiment 1.Analyze to show that 18:4 ω 3 (1.9% total fatty acidss) are formed by 18:3 ω 3, and 20:5 ω 3 (0.24% lipid acid) forms by 20:4 ω 3, confirmed Δ 6 desaturases activity and Δ 5 desaturase activity respectively.
Summarize these data in the table 5, and verified the result (2001) of Hastings etc.
Embodiment 4: separate the clone that Caenorhabditis elegans prolongs enzyme and the sign of the function in yeast Caenorhabditis elegans prolongation enzyme gene thereof
Beaudin etc. have isolated the gene (Beaudoin et al., 2000) of coding ELO type fatty acid prolonging enzyme, this gene of following separation from the nematode Caenorhabditis elegans.According to 5 ' and the 3 ' sequence of holding that prolongs the enzyme coding region, design and synthesize have sequence 5 '-Oligonucleolide primers of GCGGGTACCATGGCTCAGCATCCGCTC-3 ' (SEQ ID NO:41) (sense orientation) and 5 '-GCGGGATCCTTAGTTGTTCTTCTTCTT-3 ' (SEQ ID NO:42) (antisense orientation).These primers are used to the PCR reaction, so that amplify the coding region of 867 base pairs from the mixed phase gene library of Caenorhabditis elegans, it is 1 minute with the extension time that annealing temperature is 58 ℃.Carry out 30 circulations of pcr amplification.Amplified production has been inserted into carrier pGEM
TMIn the T-easy (Promega), and verified nucleotide sequence (SEQ ID NO:37).Cutting comprises down the fragment of whole coding region, and is inserted into the EcoRI/BglII site of pSEC-TRP (Stratagene), has produced the pSEC-Ceelo that is used for introducing and expresses at yeast.PSEC-TRP contains TRP1 gene (allowing with the transformant in the tryptophane prototroph screening yeast) and GALL promotor (when containing semi-lactosi in growth medium, this promotor is controlled the expression of mosaic gene in the inductive mode).
Enzymic activity in table 5 yeast and the Arabidopis thaliana.
| The clone | Precursor PUFA | Synthetic PUFA | Account for the % of total FA | Observed activity |
| PYES2-zf Δ 5/6 pYES2-zf Δ 5/6 pYES2zf Δ 5/6, pSEC-Ceelo pYES2-ps Δ 8 pYES2-ps Δs 8 pYES2-psELO1 pYES2-psELO1 pYES2-psELO1 pYES2-psELO1 pYES2-psELO1 pYES-psELO2 pYES-psELO2 pYES-psELO2 pYES-psELO2 pYES-psELO2 arabidopsis+zf Δ 5/6 ﹠ Ceelo (plant #1) | 18:3ω3 20:4ω3 18:3ω3 18:3ω3 20:3ω3 18:2ω6 18:3ω3 20:3ω3 20:4ω3 20:5ω3 18:2ω6 18:3ω3 20:3ω3 20:4ω3 20:5ω3 - - - - - - - - - - | 18:4ω3 20:5ω3 18:4ω3 20:3ω3 20:4ω3 18:4ω3 20:4ω3 20:2ω6 22:3ω3 22:4ω3 22:5ω3 20:2ω6 20:3ω3 22:3ω3 22:4ω3 22:5ω3 18:3ω6 18:4ω3 20:4ω6 20:5ω3 20:3ω6 20:4ω3 20:2ω6 20:3ω3 22:4ω6 22:5ω3 22:3ω6 | 1.9 0.24 0.82 0.20 0.02 - 0.12 - - - - 0.82 0.12 0.20 - - - 0.32 1.1 1.1 2.1 1.1 0.40 3.2 TR 0.06 0.13 0.03 | Δ 6 desaturase Δs 5 desaturase Δs 6 desaturase Δs 9 desaturase Δs 6 extending enzyme NOT Δs 6 extending enzyme Δs 8 desaturase Δs 5 extending enzyme Δs 9 extending enzyme Δs 9 extending enzyme Δs 5/6 desaturase Δ 5/6/9 extending enzyme |
TR, trace is not accurately measured.
Caenorhabditis elegans prolongs the function of enzyme gene in yeast and characterizes
Be used in the method described in the embodiment 1, with carrier pYES2-zf Δ 5/6 and pSEC-Ceelo transformed yeast strain S288, with the YMM substratum screening dual conversion body that lacks tryptophane and uridylic.Transformant can both be grown in minimum medium and enrichment medium well, and this is with to carry S288 strain transformant pSEC-Ceelo, that do not contain pYES2-zf Δ 5/6 separately opposite, and it is poor that it grows quite.The dual conversion bulk-growth and is induced by adding semi-lactosi in the YMM substratum.Add in the substratum lipid acid 18:3 ω 3 (ALA, 0.5mM), after hatching 48 hours, collecting cell, and carry out fatty acid analysis with embodiment 1 described kapillary gas liquid chromatography (GC).Analysis demonstrates 18:4 ω 3 (0.82% total fatty acids) and 20:3 ω 3 (0.20%) and is formed by 18:3 ω 3, and 20:4 ω 3 (0.02% lipid acid) forms by any lipid acid in two kinds, confirmed the synergy of the prolongation enzymic activity the active and Δ 5 desaturase activity except Δ 6 desaturases of zebra fish desaturase (table 5).Before also do not report difunctional Δ 5/6 delta 8 desaturase genes and prolonged the enzyme gene synergism.Particularly, if this enzyme demonstrates identical activity in vegetable cell, the application of bifunctional enzyme will reduce the number of the gene that need be introduced into and express.Before do not reported this point yet.
Embodiment 5: fatty acid desaturase and the coordinate expression of prolongation enzyme in plant
Be used for genetic constructs at vegetable cell coexpression zebra fish Δ 6/ Δ, 5 desaturases and Caenorhabditis elegans prolongation enzyme
Beaudoin and colleague (2000) show that when expressing Caenorhabditis elegans Δ 6 prolongation zymoproteins in yeast, this prolongation enzyme can prolong C18 Δ 6 desat lipid acid GLA and SDA, and promptly its Δ 6 with C18 substrate prolongs enzymic activitys.They show that also albumen does not have Δ 5 to the C20 substrate in the yeast and prolongs enzymic activity.Therefore we checked this prolongation enzyme whether can prolong Δ 6 desaturation lipid acid GLA and SDA in the Arabidopis thaliana seed.The Arabidopis thaliana seed demonstrated contain ω-6 (18:2, LA) and ω-3 (18:3, ALA) lipid acid (Singh et al, 2001).The existence of 18:3 makes the Arabidopis thaliana seed become fabulous research especially can cause synthetic ω-3 C
20The system of the genetic expression of+PUFA (as EPA and DHA).
For the detection of the prolongation enzymic activity in the Arabidopis thaliana need be in seed coordinate expression Δ 6 desaturases so that at first synthetic GLA or SDA.We select to express with zebra fish delta 8 desaturase genes bonded recited above and prolong the enzyme gene.Previous not about in vegetable cell (individually or jointly) express the report that zebra fish Δ 6/ Δ, 5 desaturases and Caenorhabditis elegans prolong the enzyme gene.
Under the control that independently gene is positioned over-309 napin promoter fragments (being called Fpl), obtained the seed-specific coexpression (Stalberg et al., 1993) that zebra fish Δ 6/ Δ, 5 desaturases and Caenorhabditis elegans prolong the enzyme gene.For Plant Transformation, gene is inserted into and comprises as in the binary vector pWvec8 of the reinforcement Totomycin drug resistant gene of selectable marker (Wang et al., 1997).In order to realize this point, the Caenorhabditis elegans that inserts embodiment 4 prolongs the enzyme coding region, as the Fp1 of binary vector pWvec8 and the blunt end fragment between Nos 3 ' polyadenylic acidization/terminator fragment, has formed pCeloPWvec8.Initial zebra fish Δ 5/ Δ 6 desaturase coding regions of inserting embodiment 3, as the blunt end fragment between Fp1 and Nos 3 ' the terminator sequence, and between the HindIII of pBluescript cloning vector (Stratagene) and ApaI cloning site, assemble out this expression cassette.Subsequently, the complete vector that will contain the desaturase expression cassette is inserted into the HindIII site of pCeloPWvec8, has formed pZebdesatCeloPWvec8.By being transformed into Arabidopis thaliana (the Columbia ecotype) electroporation before, will be incorporated into (Valvekens et al., 1988) in the edaphic bacillus strain AGLI as institute's diagrammatic construct in Fig. 3.Construct is also referred to as " DO " construct, transforms resulting plant with prefix " DO " expression through this construct.
Plant Transformation and analysis
Carry out Plant Transformation (Clough and Bent, 1998) with the flower dip method.To Totomycin (20mg/l) selective medium, screening institute plant transformed, and it is transferred in the soil is so that set up the T1 plant with seed (T1 seed) bed board of the plant (TO plant) of handling.From first screening, reclaim a Totomycin resistance plant, and it is based upon in the soil.Repeat conversion test, reclaimed and in soil, set up 24 T1 transgenic plant through confirming.Estimate that most these T1 plants all have the transgenosis of being introduced of heterozygote.
In the ripening stage, collect the T2 seed of 25 transgenic plant, and analyze its lipid acid and form.As institute in the table 6 is generalized, unconverted Arabidopis thaliana (the Columbia ecotype) contains the ω 6 and the ω 3 of significant quantity, C18 lipid acid precursor LA and ALA, but do not contain any Δ 6 desat C18 (18:3 ω 6 or 18:4 ω 3), Δ 6 desat C20 PUFA or the desat C20PUFA of Δ 3-.On the contrary, comprise that zebra fish Δ 5/ Δ, 6 desaturases and Caenorhabditis elegans prolong ω 6-and ω 3-C20 PUFA that lipid acid in the seed oil of conversion plant of enzyme gene construct contains 18:3 ω 6,18:4 ω 3 and complete series.This all is because desaturase and the order effect of prolongation enzyme to corresponding C18 precursor.Most important and the most mysteriously be that transgenic seed contains 20:5 ω 3 (EPA) (reached the total fatty acids in the seed oil at least 2.3%) and 22:5 ω 3 (DPA) (reached seed oil lipid acid at least 0.3%).The total C20 lipid acid that is produced in the transgenic seed oil has reached at least 9.0%.The total omega-3 fatty acid that is produced be Δ 6 desaturationizations product (promptly, the downstream product of 18:3 ω 3 (ALA)), be calculated as the summation of the per-cent of 18:4 ω 3 (SDA), 20:4 ω 3 (ETA), 20:5 ω 3 (EPA) and 22:5 ω 3 (DPA)), it has reached at least 4.2%.These levels have been represented through Δ 6 desaturation steps and have been converted into the transformation efficiency (being at least 28%) of ω 3 products by ALA, and its level at the seed oil of the wild-type arabidopsis thaliana that is used for transforming is about 13-15%.Other are noted that (product: ratio ALA) is 1: 3.6 at least for ALA product in the seed oil and ALA.Be the ALA that the seed oil of Arabidopis thaliana has relative less amount than other commercialization oilseeds farm crop especially significantly.
Table 6: the lipid acid in the transgenic seed is formed (the total fatty acids per-cent in the seed oil) lipid acid
| The plant numbering | GLA 18:3ω6 | SDA 18:4ω3 | ARA 20:4ω6 | EPA 20:5ω3 | DGLA 20:3ω6 | ETA 20:4ω3 | EDA 20:2ω6 | ETrA 20:3ω3 | 22:4ω6 | DPA 22:5ω3 | 22:3ω6 |
| Wt | - | - | - | - | - | - | - | - | - | - | - |
| DO1 | 0.32 | 1.10 | 1.10 | 2.10 | 1.10 | 0.40 | 3.20 | TR | 0.06 | 0.13 | 0.03 |
| DO2 | 0.20 | 0.70 | 0.60 | 1.20 | 0.80 | 0.40 | 1.60 | - | 0.10 | TR | - |
| DO3 | 0.20 | 0.50 | 0.40 | 0.80 | 0.60 | 0.30 | 1.90 | - | TR | TR | - |
| DO4 | 0.30 | 0.90 | 0.80 | 1.30 | 1.10 | 0.50 | 1.90 | - | - | 0.10 | - |
| DO5 | 0.10 | 0.50 | 0.20 | 0.40 | 0.40 | - | 0.30 | - | TR | TR | - |
| DO6 | 0.30 | 1.00 | 1.00 | 1.70 | 1.20 | 0.50 | 2.50 | - | 0.10 | 0.10 | - |
| DO7 | 0.10 | 0.40 | 0.40 | 0.70 | 0.70 | 0.30 | 1.60 | - | TR | TR | - |
| DO8 | 0.30 | 1.20 | 1.10 | 2.10 | 1.40 | 0.60 | 2.80 | - | 0.10 | 0.10 | - |
| DO9 | 0.30 | 1.30 | 0.90 | 2.20 | 1.30 | 0.60 | 3.10 | - | 0.10 | 0.10 | - |
| DO10 | 0.10 | 0.40 | 0.30 | 0.70 | 0.50 | 0.30 | 0.10 | - | TR | TR | - |
| DO11 | 0.30 | 1.00 | 1.40 | 2.30 | 1.50 | 0.60 | 3.20 | - | 0.10 | 0.20 | - |
| DO12 | 0.40 | 1.40 | 1.10 | 1.90 | 1.20 | 0.60 | 2.30 | - | 0.10 | 0.10 | - |
| DO13 | 0.20 | 0.60 | 0.60 | 0.90 | 0.80 | 0.40 | 0.40 | - | TR | 0.10 | - |
| DO14 | 0.30 | 1.00 | 0.70 | 1.70 | 1.10 | 0.60 | 2.50 | - | TR | TR | - |
| DO15 | 0.30 | 1.30 | 1.00 | 2.30 | 1.50 | 0.60 | 2.60 | - | 0.10 | 0.10 | - |
| DO17 | 0.20 | 0.40 | 0.40 | 0.70 | 0.70 | 0.30 | 1.80 | - | TR | TR | - |
| DO18 | 0.20 | 0.60 | 0.50 | 0.90 | 0.80 | 0.40 | 1.70 | - | TR | TR | - |
| DO19 | 0.20 | 0.40 | 0.40 | 0.80 | 0.70 | 0.30 | 2.00 | - | TR | 0.10 | - |
| DO20 | 0.30 | 1.00 | 0.50 | 0.90 | 0.70 | 0.30 | 1.60 | - | TR | TR | - |
| DO21 | 0.30 | 1.20 | 0.90 | 2.00 | 1.30 | 0.60 | 2.50 | - | - | 0.10 | - |
| DO22 | 0.30 | 0.90 | 0.70 | 1.20 | 1.00 | 0.40 | 0.30 | - | TR | TR | - |
| DO23 | - | - | - | - | 0.10 | 0.10 | 1.80 | - | - | - | - |
| DO24 | 0.30 | 1.10 | 0.70 | 1.50 | 1.10 | 0.50 | 2.90 | - | TR | 0.10 | - |
| DO25 | 0.10 | 0.50 | 0.30 | 0.70 | 0.50 | 0.20 | 1.60 | - | TR | 0.10 | - |
The unconverted Arabidopis thaliana of Wt=(Columbia).The TR representative is lower than 0.05%.Strigula (-) is represented undetermined.
T2 described herein comprises that the genetically modified T2 with homozygote and heterozygote is.In order to distinguish the genetically modified homozygote or the heterozygote of expressing highest level, set up the T2 plant from the T2 seed that 5 strains that contain the highest EPA level are, utilize the selection on the MS substratum that contains Totomycin (15mg/L) to determine genetically modified existence.For example, use the T2 seed of the T1 plant of the DO11 that calls oneself, it contains 2.3% EPA, and demonstrates resistance filial generation on 3: 1 the Totomycin substratum to the separation rate of responsive filial generation, illustrates that DO11 contains the transgenosis on the single genetic locus.Identify homozygote strain system.For example, as shown in the Totomycin resistance of the homogeneous of its T3 filial generation, T2 progeny plant DO11-5 is a homozygote.The Totomycin marker of other T2 plant is a heterozygote.
Analyze the fatty acid profile of T3 seed heap of other T2 filial generations of DO11-5 and DO11, and be displayed in Table 7 data.As was expected, and the EPA content back has mirrored the separation of DO construct.EPA level in the lipid acid of the seed oil that is obtained from T3 system can be told three groups: (the no DO construct) that can omit, 1.6-2.3% scope interior (DO construct heterozygote) and reached at least 3.1% (DO construct homozygote).The level that obtains in homozygote is higher than heterozygote, and dosage effect of gene has been described.The T3 seed of DO11-5 has synthesized 9.6% new ω 3 and ω 6PUFA altogether, comprises 3.2% EPA, 1.6%ARA, 0.1% DPA, 0.6%SDA and 1.8%GLA (table 7).The synthetic level of EPA in this seed exceeds 4 times (Abbadi et al., 2004) than 0.8% level that is before obtained in Semen Lini.Also consider to be used for EPA synthetic ALA level less than 1/3rd of ALA level that Semen Lini had in the Arabidopis thaliana seed, explanation can be implemented the LC-PUFA approach that comprises the desaturase that can utilize the aliphatic alcohol substrate recited above with the efficient obviously higher than acyl expressed in Semen Lini-PC dependent pathway.
Table 7: the lipid acid in the transgenic seed is formed (the total fatty acids per-cent in the seed oil).
| Lipid acid | Wild-type | DO 11-5 | DO 11-6 | DO11-7 | DO11-8 | DO11-10 | DO11-11 | DO11-12 | DO11-13 | DO11-16 | DO11-18 | DO11-19 | DO11-20 | DO11-21 |
| 14:0 | 0.3 | 0.0 | 0.1 | 0.1 | 0.1 | 0.1 | 0.0 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
| 15:0 | 0.0 | 0.0 | 0.2 | 0.2 | 0.2 | 0.1 | 0.0 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.2 | 0.1 |
| 16:1ω7 | 0.5 | 0.4 | 0.6 | 0.7 | 0.6 | 0.5 | 0.4 | 0.6 | 0.5 | 0.6 | 0.4 | 0.4 | 0.7 | 0.5 |
| 16:0 | 8.1 | 7.1 | 7.9 | 7.8 | 7.6 | 7.0 | 7.1 | 7.8 | 7.7 | 7.6 | 6.8 | 6.7 | 7.6 | 7.3 |
| 17:1ω8 | 0.0 | 0.0 | 0.0 | 0.1 | 0.1 | 0.1 | 0.0 | 0.1 | 0.1 | 0.0 | 0.1 | 0.1 | 0.0 | 0.1 |
| 17:0 | 0.3 | 0.1 | 0.0 | 0.1 | 0.1 | 0.1 | 0.0 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.0 | 0.1 |
| 18:3ω6 GLA | 0.0 | 0.6 | 0.0 | 0.0 | 0.0 | 0.3 | 0.3 | 0.0 | 0.4 | 0.0 | 0.2 | 0.3 | 0.0 | 0.4 |
| 18:4ω3 SDA | 0.0 | 1.8 | 0.0 | 0.0 | 0.0 | 1.0 | 1.1 | 0.0 | 1.3 | 0.0 | 0.7 | 1.1 | 0.0 | 1.2 |
| 18:2ω6 LA | 26.6 | 25.8 | 29.8 | 28.6 | 28.8 | 25.6 | 25.4 | 28.6 | 25.6 | 29.0 | 25.7 | 25.2 | 29.4 | 27.3 |
| 18:1ω9 | 17.9 | 18.7 | 15.6 | 19.6 | 18.2 | 22.0 | 18.6 | 18.6 | 20.4 | 15.5 | 20.1 | 19.8 | 16.6 | 14.8 |
| 18:1ω7/?ALA 18:3ω3 | 16.0 | 11.5 | 15.3 | 14.7 | 15.9 | 10.6 | 11.6 | 14.5 | 11.1 | 16.0 | 13.7 | 13.6 | 14.8 | 13.1 |
| 18:0 | 3.4 | 4.2 | 2.9 | 2.7 | 2.8 | 3.5 | 3.9 | 2.8 | 3.9 | 2.9 | 3.3 | 3.4 | 2.9 | 3.7 |
| 19:0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.1 | 0.0 | 0.1 | 0.1 | 0.0 | 0.1 |
| 20:4ω6 ARA | 0.0 | 1.6 | 0.0 | 0.0 | 0.0 | 0.9 | 0.9 | 0.0 | 1.3 | 0.0 | 0.4 | 0.8 | 0.0 | 1.3 |
| 20:5ω3 EPA | 0.0 | 3.2 | 0.0 | 0.1 | 0.0 | 1.6 | 2.1 | 0.0 | 2.1 | 0.0 | 1.1 | 1.8 | 0.0 | 2.3 |
| 20:3ω6 DGLA | 0.0 | 1.9 | 0.0 | 0.0 | 0.0 | 1.2 | 1.5 | 0.0 | 1.4 | 0.0 | 0.7 | 1.0 | 0.0 | 1.5 |
| 20:4ω3 ETA | 0.0 | 0.4 | 0.0 | 0.0 | 0.0 | 0.4 | 0.6 | 0.0 | 0.2 | 0.0 | 0.3 | 0.4 | 0.0 | 0.5 |
| 20:2ω6 | 0.0 | 3.4 | 0.2 | 0.1 | 0.2 | 2.2 | 3.1 | 0.1 | 2.4 | 0.2 | 1.7 | 2.1 | 0.1 | 2.8 |
| 20:1ω9/ ω11 | 17.4 | 10.9 | 17.8 | 18.1 | 17.3 | 14.8 | 12.5 | 18.2 | 13.2 | 18.0 | 15.4 | 14.0 | 18.6 | 12.4 |
| 20:1ω7 | 1.9 | 2.7 | 2.2 | 1.9 | 2.2 | 2.2 | 2.3 | 2.0 | 2.0 | 2.3 | 2.2 | 2.2 | 2.3 | 2.7 |
| 20:0 | 1.8 | 1.8 | 2.1 | 1.8 | 2.0 | 2.0 | 2.0 | 2.0 | 1.9 | 2.2 | 2.0 | 2.0 | 2.3 | 2.1 |
| 22.4ω6 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.1 | 0.0 | 0.0 | 0.1 | 0.0 | 0.0 | 0.0 | 0.0 | 0.1 |
| 22:5ω3 DPA | 0.0 | 0.1 | 0.0 | 0.0 | 0.0 | 0.1 | 0.1 | 0.0 | 0.1 | 0.0 | 0.1 | 0.1 | 0.0 | 0.2 |
| 22:1ω11/ ω13 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| 22:1ω9 | 1.3 | 0.8 | 1.9 | 1.7 | 1.7 | 1.5 | 1.1 | 1.7 | 1.1 | 2.0 | 1.6 | 1.4 | 2.1 | 1.5 |
| 22:1ω7 | 0.0 | 0.0 | 0.2 | 0.1 | 0.2 | 0.1 | 0.0 | 0.1 | 0.0 | 0.2 | 0.1 | 0.1 | 0.2 | 0.2 |
| 22:0 | 0.2 | 0.3 | 0.3 | 0.3 | 0.3 | 0.3 | 0.4 | 0.3 | 0.3 | 0.4 | 0.3 | 0.3 | 0.4 | 0.4 |
| 24:1ω9 | 0.6 | 0.4 | 0.2 | 0.2 | 0.3 | 0.2 | 0.2 | 0.2 | 0.2 | 0.3 | 0.2 | 0.2 | 0.2 | 0.3 |
| 24:1ω7 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
| 24:0 | 0.0 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.3 |
Wild-type referred to herein as unconverted Arabidopis thaliana, the Columbia ecotype.
Can estimate the relative efficiency of the coded single enzyme step of EPA construct by substrate lipid acid to the conversion percentages of product lipid acid (derivative after comprising) by checking among the DO11-5.Zebra fish Δ 5/ Δ 6 desaturases show strong Δ 5 desaturation, wherein 89% 20:4 ω 3 has changed into EPA and DPA, and 45% 20:3 ω 6 has changed into ARA, this and previous this enzyme of reporting preferentially transform ω 3 PUFA, rather than conversion ω 6 PUFA substrates consistent (Hastingset al., 2001).Comparable with it, with remarkable lower level generation Δ 6 desaturation, wherein 32% ALA and 14% LA have changed into Δ 6 desat PUFA.In view of studies show that this enzyme, previous yeast has the Δ 6 desaturase activity higher really than Δ 5 desaturase activity, the lower Δ 6 desaturation levels that obtained in the Arabidopis thaliana seed can reflect limited obtainable ALA and LA substrate (Singh etc. wait to deliver) in the aliphatic alcohol pond.Realize highly effectively that Δ 6 prolongs the effect of enzymes, wherein prolonged 86% GLA and 67% SDA, illustrate that this enzyme may a little preferentially prolong ω 6-PUFA substrate.
In MS substratum and soil, estimated the germinating power of T2 (isolating) and T3 seed (subgroup of isozygotying).The strain that contains EPA and DPA is that the seed of DO11 and DO11-5 demonstrates germination opportunity and the frequency identical with wild type seeds, and T2 and T3 plant are without any obvious unusual morphological feature.The quality of the seed that does not also influence the plant-growth rate in external or the soil and from plant, obtained.The T1 seed that has comprised the DO11 that is obtained germinates, and has therefore observed the normal germination of the seed of triple-substituted DO11 strain.In addition, also observe other and contained the normal seedling and the opportunity of EPA and DPA seed.These characteristics are important, and are unpredictable, because higher plant can not produce EPA or DPA natively, and therefore their seed had not before always contained these LC-PUFA.Germination requires the stored seed oil of metabolism, and is used for growth, and as the energy supply.Viewed normal percentage of germination demonstration plant seed can be implemented the process that these utilize EPA and DPA, and these compounds are nontoxic.
Reported that Δ 4 desaturases coded by said gene and that express that are separated to from thraustochytriale can change into the DPA of external source supply DHA (Qiu et al., 2001) leaf mustard (Brassicajuncea).The DPA that is produced in the plant seed described herein can be used as the precursor that DHA produces.Can in vegetable cell, realize the conversion (embodiment 11) of DPA by Δ 4 delta 8 desaturase genes being incorporated in the vegetable cell that produces DPA to DHA.
Discuss
Caenorhabditis elegans in the existence explanation vegetable cell of 22:5 ω 3 in the Arabidopis thaliana seed oil prolongs the enzyme gene and not only has Δ 6 prolongation enzymic activitys, also has Δ 5 and prolongs enzymic activitys.Lack Δ 5 prolongation enzymic activitys in view of this gene has been proved in yeast, this result is the most unexpected.In addition, this only confirms that two genes can be used to synthetic to DPA of ALA in the vegetable cell.Before do not report also that the DPA in the higher plant was synthetic.In addition, the ALA of at least 28% in the seed is surprising to the transformation efficiency of its ω 3 products (comprise EPA, DPA or both).
With the order effect that synthetic LC-PUFA (for example EPA and DHA) requires the PUFA desaturase and prolongs enzyme in plant (for example vegetable cell) of Δ 6 desaturation approach.In an approach, required desaturase has Δ 6, Δ 5 and Δ 4 desaturation activity, and by this order, required PUFA prolongs enzyme Δ 6 and Δ 5 substrates are all had the activity of prolongation.In algae, liver moss, fungi, diatom, nematode and some fresh-water fishes, all carry out this classical pathway (Sayanova and Napier, 2004).The PUFA desaturase that is selected from algae, fungi, liver moss and worm can be used for the desaturation of esterification in the lipid acid in the sn-2 site of phosphoric acid Yelkin TTS (PC), and PUFA prolongs the lipid acid that enzyme acts on the aliphatic alcohol substrate form in the aliphatic alcohol pond of tissue simultaneously.On the contrary, vertebrate Δ 6 desaturases demonstrated can desaturation the aliphatic alcohol substrate (Domergueet al., 2003a).
Want in vegetable cell and other cells, to rebuild the LC-PUFA approach, must consider to the different of the action site of desaturase and prolongation enzyme with to the needs of substrate.For example, it is membrane-bound that PUFA prolongs enzyme, even may be complete membranin, and its utilization comes across the aliphatic alcohol in the special pond of endoplasmic reticulum (ER).Therefore the PC component that is different from ER on this aliphatic alcohol pond physiology, for by the PUFA lipid acid of order desaturation and prolongation, it must shift between the PC of ER and aliphatic alcohol pond mutually.Therefore, previously reported with low wait and the desaturase of higher plant, fungi and worm and prolongation enzyme to make up the biosynthetic trial of LC-PUFA in yeast be invalid.In addition, the approach of being rebuild has caused only synthetic C20 PUFA for example ARA and EPA.Previous also not about synthetic C22 PUFA in yeast for example the report of DPA and DHA (Beaudoin et al., 2000, Domergue et al., 2003a).
Above-described strategy has utilized the vertebrates desaturase, in this embodiment, to prolong the advantage that enzymes have be two kinds of desaturases to the Δ 6 of Δ 5/ Δ, 6 desaturases of zebra fish and Caenorhabditis elegans and prolong enzyme the aliphatic alcohol substrate in the aliphatic alcohol pond is all had activity.This strategy of this possible explanation is more efficiently reason on synthetic LC-PUFA.In addition, utilize to demonstrate the active difunctional desaturase of dual Δ 5/ Δ 6 desaturases and allow by the synthetic EPA of effect of 2 genes only, rather than used 3 genes (Beaudoin et al., 2000 of other investigators; Domergue et al., 2003a).Difunctional Δ 5/ Δ 6 prolongs the application of enzyme in vegetable cell and also allows by only inserting three genes (prolongs enzyme and two desaturases) or for example only inserting two genes (difunctional prolongation enzyme and difunctional desaturase) cause ALA and form DPA.These aspects all are unexpected and mysterious.
The biological chemistry evidence shows that fatty acid prolonging is made up of 4 steps, comprises condensation, reduction, dehydration and reduction for the second time.So far two groups of condensing enzymes have been identified.First group relates to synthetic saturated and single saturated lipid acid (C18-22).These enzymes are FAE sample enzymes, and do not demonstrate effect in the LC-PUFA biosynthesizing.The other types that identified prolong enzyme and belong to ELO family prolongation enzyme (pressing the name of ELO gene family), and the over-long chain fatty acid of synthetic sphingomyelin needs the activity of these enzymes in yeast.Demonstrated the prolongation that relates to LC-PUFA and synthetic from the organism of the synthetic LC-PUFA apparent likeness in form thing that for example isolated ELO type prolongs enzyme algae, liver moss, fungi and the nematode.Shown that prolonging corresponding acyl chain only need express the contained component that prolongs enzyme.Therefore, the condensation component of the prolongation enzyme of being introduced can successfully be raised reduction and dehydration activity from transformed host, prolongs so that realize successful acyl.Therefore, prolong enzyme has confirmed C16 and C18 PUFA in yeast successful prolongation by heterogenous expression ELO type.Aspect this, when expression Caenorhabditis elegans recited above prolonged enzyme in yeast, it can not prolong C20PUFA (Beaudoin et al, 2000).We confirm, when expressing Caenorhabditis elegans when prolonging enzyme in plant, it can prolong C20:5 lipid acid EPA, as producing in the Arabidopis thaliana seed DPA proves, and at this moment new and a mysterious result.Prolong enzyme about Caenorhabditis elegans and why can in plant, prolong C20 PUFA, and a kind of explanation that can not prolong in yeast may be successfully to have disturbed combining and effect of other components and C20 substrate in the prolongation process of plant because of it.
This embodiment shows that the ELO type prolongation enzyme of non-vertebrate organism body can prolong the C20 PUFA in the vegetable cell.Leonard etc. (2002) report, when expressing the ELO type prolongation enzyme gene that is separated to from the mankind in yeast, it can be extended for DPA with EPA, but is in nonselective mode.
Embodiment 6: from P.salina, separate Δ 8 delta 8 desaturase genes with and function in yeast characterize.
Not relating to the biosynthetic Δ 8 sphingolipid desaturases of LC-PUFA in higher plant,, little algae is that unique being in the news contained the organism of Δ 8 desaturases.From very thin eye worm, isolated the gene (Wallis and Browse, 1999) of coded delta 8 desaturases.Can predict in Isochrysis galbana, to exist Δ 8 desaturases that prolong enzyme (Qi etal., 2002) because it contains Δ 9, the product 20:3n-3 that Δ 9 prolongs enzyme is the precursor (see figure 1) of Δ 8 desaturases.But the fatty acid profile of little algae can not be individually for identifying which little algae contains Δ 8 delta 8 desaturase genes effective basis is provided, because number of ways can produce LC-PUFA.
The segmental separation of Δ 8 delta 8 desaturase genes
By arranging Δ 6 desaturase aminoacid sequences and identifying common aminoacid sequence chunk DHPGGS (SEQ ID NO:43), WWKDKHN (SEQ ID NO:44) and QIEHHLF (SEQ ID NO:45) from the aminoacid sequence of following Genbank accession number AF465283, AF007561, AAC15586, two the sequence chunks in back correspond respectively to amino acid sites 204-210 and the 394-400 of AF465283.DHPGSS is corresponding to " cytochrome b5 structural domain " chunk (Mitchell and Martin, 1995) that has before identified.WWKDKHN is previous common chunk that also do not identified or that be used to relate to the primer that separates delta 8 desaturase genes.QIEHHLF chunk or its variant are corresponding to the required motif that contains Histidine, and it is guarded in desaturase.Identified before it and be used as design and produced " the 3rd His frame " (Michaelson et al., 1998) that are used for the isolating oligonucleotide of delta 8 desaturase genes.The combination of previous also this chunk of no use separates delta 8 desaturase genes.
According to second and the 3rd conserved amino acid chunk, synthesized degenerated primer 5 '-TGGTGGAARCAYAARCAYAAY-3 ' (SEQ ID NO:46) and 5 '-GCGAGGGATCCAAGGRAANARRTGRTGYTC-3 ' (SEQ ID NO:47).Utilize DNAeasy system (Qiagen) to isolate the genomic dna of P.salina.Carry out pcr amplification in the reaction volume of 20 μ L, it utilizes every kind of primer of 20pmol, 200ng P.salina genomic dna and Hostar Taq archaeal dna polymerase (Qiagen) and specified damping fluid and Nucleotide component.Cycling condition is: 95 ℃ of 1 round-robin 15 minutes; 95 ℃ 1 minute, 38 ℃ 1 minute, 72 ℃ of 5 round-robin 1 minute; 72 ℃ of 95 ℃ 35 seconds, 52 ℃ 30 seconds, 72 ℃ of 35 round-robin 1 minute and last 1 round-robin are 10 minutes afterwards.Produced the amplicon of 515 base pairs, it is connected in the pGEM-T easy (Promega), and order-checking also is used as the probe that screens P.salina cDNA library.
The cDNA that from P.salina, separates coded delta 8 desaturases
In lambda particles phage, construct P.salinacDNA library (seeing embodiment 1) with Zap-cDNA synthetic agent box (Stratagene).With the concentration bed board library of every plate～50,000 plaque, take out with Hybond N+ film and to take thing, and handle (Ausubel et al., 1988, on seeing) with standard method.With
32The 515bp desaturase fragment that the p-dCTP radio-labeling produces with PCR, take thing with described labeled fragment detection under the high stringency below: rock the hybridization of in 6 X SSC, spending the night under 65 ℃ down, with 2 X SSC/0.1%SDS washing 5 minutes, use 0.2 XSSC/0.1%SDS washed twice 10 minutes subsequently.
Screened the 515bp segmental hybridization of 15 elementary library plates (150mm) with institute's mark.Identify the plaque of 40 strong hybridization, wherein 10 plaques carry out programmed screening.According to producing tame scheme (Stratagene), with the cutting of ExAssist helper phage down with 5 secondary plaques of 515bp probe hybridization in plasmid.Identify the nucleotide sequence of inset with ABI Prism Big Dye Terminator test kit (PEApplied Biosystems).Identify institute's eclipsed nucleotide sequence, illustrate that all 5 insets are all from same gene.In 5 insets one of them demonstrates and contains whole coding region, shows that below it is from Δ 8 delta 8 desaturase genes.This sequence is called as SEQ ID NO:6.
Analyze according to BLAST, full length amino acid sequence (SEQ ID NO:1) is found Δ 6 or Δ 8 desaturases that isolating cDNA coding is inferred.Therefore this desaturase of two types is very similar at its amino acid levels, the coded activity of forecasting sequence individually.Maximal phase same sex degree between P.salina desaturase and other desaturases (BLASTX) is 27-30%, allows that the total amino acid homogeny of maximum of whole coding region that the analysis of inserting the GAP program of " breach " in arrangement demonstrates the AAD45877 of P.salina desaturase and very thin eye worm is 45% though utilize.Fig. 4 provides the Pileup figure of other sequences similar to the P.salina desaturase.
To be inserted in the pYES2 (Invitrogen) whole coding region of this contained clone in the EcoRI/XhoI fragment, and produce pYES2-ps Δ 8, its importing and function that is used in the yeast characterizes.Described as embodiment 1, with the cell of pYES2-ps Δ 8 transformed yeast strain S288, and on the substratum of no uridylic, select transformant.The yeast cell growth that will contain pYES2-ps Δ 8 is induced with semi-lactosi in substratum then.After in substratum, adding 18:3 ω 3 or 20:3 ω 3 (0.5mM) and under 30 ℃, cultivating 48 hours again, analyzed the lipid acid in the cytolipin as embodiment 1 is described.When in substratum, adding 18:3 ω 3 (Δ 9,12,15), do not detect 18:4 ω 3 ( Δ 6,9,12,15).But, when in substratum, adding 20:3 ω 3 (Δ 11,14,17), detect and in the cytolipin of yeast conversion body, exist 20:4 ω 3 (Δ 8,11,14,17) (0.12%).Conclusion is, transgenosis is encoded in yeast cell and had Δ 8 but do not have the active polypeptide of Δ 6 desaturases.
The previous separation that does not also have report coding not to be had yet the gene of active Δ 8 fatty acid desaturases of Δ 6 desaturases.The desaturationization (Wallis andBrowse, 1999) of the gene of the unique previous coded delta of reporting 8 desaturases that are separated to (from very thin eye worm) energy catalysis 18:3 ω 3 and 20:3 ω 3.In addition, before also do not report the expression of gene in higher plant of coded delta 8 desaturases.
As shown in Figure 1, Δ 8 desaturases and Δ 9 coordinate expression that prolongs enzymes (gene one of the ELO2 that for example encodes as follows) and Δ 5 desaturases (for example zebra fish Δ 5/ Δ, 6 genes or from the genes of equal value of P.salina or other little algaes) will cause synthesize EPA in plant.
In cell is provided, produce another approach of EPA, what associating Δ 8 desaturases used that Δ 9 prolongs enzymes roughly also can provide an advantage, promptly prolong (coming across combining of lipid acid and coenzyme A) prior to desaturation (coming across the set of lipid acid and PC), therefore guarantee to obtain the C20 PUFA of the new prolongation on the used PC of the desaturationization of Δ 8 and Δ 5 desaturases subsequently, this may cause more efficiently EPA synthetic.That is to say that the order of reaction (prolongs the reaction back followed by two desaturation reactions) will reduce the number of times that the substrate that need take place connects conversion.The specific increase that P.salina Δ 8 desaturases are provided also is another advantage.
Embodiment 7: the ELO1 and the ELO2 fatty acid prolonging enzyme that separate P.salina
For example identify ELO type PUFA prolongation enzyme nematode, fungi and the liver moss according to EST or gene order-checking strategy from organism.Utilize the PCR method of degenerated primer from Isochrysis galbana, to isolate coding 18:3 ω 3 (ALA) is had the gene that active Δ 9 prolongs enzymes, described Δ 9 prolongation enzymes demonstrate in the yeast cell that is supplied with exogenous 18:2 ω 6 (LA) or 18:3 ω 3 (ALA) has activity, has formed C20 lipid acid 20:2 ω 6 and 20:3 ω 3 respectively.The coding region coding of gene IgASE1 has 263 amino acid whose albumen that the expection molecular weight is about 30kDa, and itself and other prolongation albumen has limited homology (being 27% homogeny to the maximum).
From P.salina, separate and prolong the enzyme gene fragment.
A plurality of aminoacid sequences according to the fatty acid prolonging enzyme are arranged, identify common amino acid chunk FLHXYH (SEQ ID NO:48) and MYXYYF (SEQ ID NO:49), and synthesized corresponding degenerated primer 5 '-CAGGATCCTTYYTNCATNNNTAYCA-3 ' (SEQ ID NO:50) (justice is arranged) and 5 ' GATCTAGARAARTARTANNNRTACAT-3 ' (SEQ ID NO:51) (antisense).Previous also do not describe for the primer of motif FLHXYH with and with the combined utilization of MYXYYF primer.Use these primers in the pcr amplification of 20 μ L reaction volumes, it utilizes every kind of primer of 20pmol, 200ng P.salina genomic dna and Hostar Taq archaeal dna polymerase (Qiagen) and produces tame specified damping fluid and Nucleotide component.React following circulation: 95 ℃ of 1 round-robin 15 minutes; 95 ℃ 1 minute, 38 ℃ 1 minute, 72 ℃ of 5 round-robin 1 minute; 95 ℃ 35 seconds, 52 ℃ 30 seconds, 72 ℃ of 35 round-robin are 1 minute afterwards; 72 ℃ of 1 round-robin 10 minutes.Produced the fragment of nearly 150 base pairs, it is connected in the pGEM-T easy (Promega), is used for sequential analysis.
In 35 clones that are separated to, two clones have Nucleotide or the aminoacid sequence similar to known prolongation enzyme.They are known as Elo1 and Elo2.With two kinds of gene fragments of P-dCTP radio-labeling, and be used for surveying P.salina cDNA library under below the high stringency hybridization condition: rock down the hybridization of under 65 ℃ of 6 X SSC, spending the night, with 2 X SSC/0.1%SDS washing 5 minutes, use 0.2 X SSC/0.1%SDS washed twice 10 minutes subsequently.With Elo1 or Elo2 probe screening 10 elementary library plates (150mm).Several plaques on Elo1 and each plate are hybridized by force, and Elo2 only with 10 library plates that screened in 3 plaque hybridizations.From the plate of single library, choose and take out all Elo1 hybridization plaques, and it is carried out the secondary screening, simultaneously all 3 Elo2 hybridization plaques are carried out the secondary screening.Then each secondary plaque is used as pcr template, described PCR utilizes the lateral forward direction and the reverse primer of a plurality of cloning sites in the pBluescript phagemid, electrophoresis PCR product in the 1%TAR gel.After electrophoresis, with the gel trace to Hybond N+ film, film with
32The Elo1 of p mark and Elo2 probe hybridization spend the night.Strictness and Elo1/2 probe hybridization (Fig. 5) in increased Elo1 time level plaque 6 and the El02 time grade of plaque being increased.
According to the hybridization of itself and Elo1 and Elo2 probe, in P.salina cDNA library, identified two groups and prolonged enzyme sample sequences.Cut following phagemid of all hybridizing by force with ExAssist helper phage (Stratagene), and check order with ABI Prism Big Dye Terminator test kit (PEApplied Biosystems) with every kind of labeled fragment.All 5 all show from identical gene with the inset of Elo1 probe hybridization.To demonstrating them from identical gene with the similar dna sequencing of 2 insets of Elo2 probe hybridization.Elo1 clone's cDNA sequence is the sequence that provides as SEQ IDNO:8, and proteins encoded is the sequence that provides as SEQ ID NO:2, wherein Elo2 clone's cDNA sequence is the sequence that provides as SEQ ID NO:10, and coded albumen such as SEQ ID NO:3, SEQ ID NO:85 and SEQ ID NO:86 have used three possible initial methionines.
Utilize PILEUP software (NCBI) that other known PUFA prolongation enzymes of Elo1 and Elo2 and database are compared, and in Fig. 6, shown the result.
Elo1 cDNA is 1234 length of nucleotides, and the proteic open reading frame with 302 amino-acid residues of coding.Analyze according to PILEUP, Elo1 comprises the relevant Elo type sequence cluster of the PUFA of Δ 6 desaturation lipid acid gather together (Fig. 6) with other with prolongation.Elol albumen and the homogeny (33%) that on whole coding region, has top from the prolongation enzyme of liver moss, small liwan moss (accession number AF428243).Elo1 albumen also has the conserved amino acid motif of being found in every other Elo type prolongation enzyme.
Elo2 cDNA is 1246 length of nucleotides, and the proteic open reading frame with 304 amino-acid residues of coding.Analyze Elo2 and other the Elo type sequence (comprise those to Δ 6 or Δ 9 PUFAs have active sequence) relevant bunch gather together (Fig. 6) with prolongation PUFA according to PILEUP.Elo2 is arranged in the Δ 9 that is separated to from Isochrysis galbana and prolongs the identical inferior branch of enzyme (AX571775).Elo2 and Isochrysis galbana gene demonstrate 31% homogeny on its whole coding region.Elo2 ORF also has the conserved amino acid motif of being found in every other Elo type prolongation enzyme.
Embodiment 8: the function of Δ 5 fatty acid prolonging enzymes in yeast and vegetable cell characterizes yeast
The whole coding region of P.salina Elo1 gene is connected in the pYES2, produces pYES2-psELO1, be used for studying its sign at yeast.This genetic constructs is incorporated in the yeast strains, and by testing its activity in the growth that contains just like in the substratum of external source lipid acid listed in the table 8.The yeast cell that contains pYES2-psELO1 can change into 22:5 ω 3 with 20:5 ω 3, has confirmed the Δ 5 of C20 substrate is prolonged enzymic activity.7% the rate that goes back to has illustrated the high reactivity to this substrate.Identical yeast cell is with 18:4 ω 3 (Δ 6,9,12,15) changed into 20:4 ω 3 and 18:3 ω 6 (Δ 6,9,12) changed into 20:3 ω 6, illustrate that this prolongation enzyme also has Δ 6 and prolongs enzymic activity in yeast cell, but transformation efficiency is than the former low nearly 10 times (table 8).This explanation Elo gene encode special in yeast cell or Δ 5 prolongation enzymes optionally.This is first report about specificity Δ 5 prolongation enzymes, and promptly enzyme has the Δ 5 prolongation enzymic activitys higher than Δ 6 prolongation enzymic activitys.This molecule also is that first Δ that is separated to from alga-derived 5 prolongs enzyme.This enzyme is crucial enzyme (Fig. 1) in the conversion of DPA at EPA.
Plant
In plant, express from Ba Fuzao, being separated to Δ 5 prolongation enzyme Elo1, with the ability of verifying that it plays a role in plant.At first, prepared the expression of plants construct that is used for constitutive expression Elo1.To this, the Elo1 sequence is placed under the control of the 35S promoter among the plant binary vector pBI121 (Clontech).Utilize colored dip method recited above that this construct is incorporated in the Arabidopis thaliana.The specificity of the lipid acid that the Elo1 sequence prolonged is determined in utilization to the analysis of leaf lipid.In another approach, Elo1 construct and zebra fish Δ 5/ Δ 6 desaturases/Caenorhabditis elegans prolong the enzyme construct and the coexpression of Δ 4 desaturases that are separated to from Ba Fuzao has caused synthetic to DHA of ALA in the Arabidopis thaliana seed, have confirmed that Δ 5 prolongs enzymes and produce purposes among the DHA in cell.In a further method, can with Δ 6 desaturases and Δ 5 delta 8 desaturase genes or Δ 6/ Δ 5 difunctional delta 8 desaturase genes coexpression Elo1 so that in cell (particularly vegetable cell), produce DPA by ALA.In another method, the PKS gene of the Schewanella of combination producing EPA (Takeyama et al., 1997), Δ 5 prolong enzyme and Δ 4 prolongation enzyme genes are used to synthetic DHA in plant.
Table 8: the conversion of the lipid acid in the genetic constructs transformed yeast cells through expressing Elo1 or Elo2
| The clone | Lipid acid precursor (accounting for the % of total FA) | The lipid acid (accounting for the % of total FA) that forms | Transform ratio (%) |
| pYES2- psELO1 | ?20：5n-3/3％ | 22：5n-3/0.21％ | 7％ |
| pYES2- psELO1 | ?18：4n-3/16.9％ | 20：4n-3/0.15％ | 0.89％ |
| pYES2- psELO1 | ?18：3n-6/19.8％ | 20：3n-6/0.14％ | 0.71％ |
| pYES2- psELO2 | ?20：5n-3/2.3％ | 22：5n-3/tr | |
| pYES2- psELO2 | ?18：4n-3/32.5％ | 20：4n-3/0.38％ | 1.2％ |
| pYES2- psELO2 | ?18：3n-6/12.9％ | 20：3n-6/0.08％ | 0.62％ |
| pYES2- psELO2 | ?18：2n-6/30.3％ | 20：2n-6/0.12％ | 0.40％ |
| pYES2- psELO2 | ?18：3n-3/42.9％ | 18：3n-3/0.20％ | 0.47％ |
Tr: detect road trace (＜0.02%).
Embodiment 9: the function of Δ fatty acid prolonging enzyme in yeast and vegetable cell is characterized in the yeast cell to be expressed
To the encode whole coding region of P.salina Elo2 gene of 304 amino acid (SEQ ID NO:3) is connected in the pYES2, has produced pYES2-psELO2, is used for studying its sign at yeast.This genetic constructs is incorporated in the yeast strains, and tests its activity by the growth in the substratum that contains external source lipid acid.The yeast cell that contains pYES2-psELO2 can change into 18:2 ω 6 20:2 ω 6 (0.12% total fatty acids), and 18:3 ω 3 has been changed into 20:3 ω 3 (0.20%), has confirmed that its Δ 9 to the C18 substrate prolongs enzymic activity (table 8).These cells also can change into 20:3 ω 6 with 18:3 ω 6, and 18:4 ω 3 has been changed into 20:4 ω 3, have confirmed that its Δ 6 to the C18 substrate in yeast prolongs enzymic activity.But, because 18:3 ω 6 and 18:4 ω 3 substrates also have desaturation on its Δ 9 sites, so the Elo2 enzyme is specific to Δ 9 desat lipid acid, no matter whether they have Δ 6 desaturations.Cell can change into 20:5 ω 3 22:5 product D PA.This is that first is about also having the report that prolongs the Δ 9 prolongation enzymes of enzymic activity from the Δ 6 in non-vertebrates source (particularly from fungi or alga-derived).
Because three possible ATG initiator codons (corresponding to the site 1,11 (SEQ ID NO:85) of SEQ ID NO:3 and methionine(Met) (Met) amino acid on 29 (the SEQ ID NO:86)) are contained in the coding region, also can be activated possibilities so tested the polypeptide that starts from amino acid sites 11 or 29.Utilization is carried out the pcr amplification of coding region corresponding to 5 ' oligonucleotide (justice is arranged) primer of these regional nucleotide sequences, digests formed product with EcoRI.Fragment cloning in pYES2, pYES2-psELO2-11 and pYES2-psELO2-29 have been formed.Two kinds of plasmids demonstrate the Δ 9 prolongation enzymes of energy expression activity in yeast.Also can for example express this three peptide species in the vegetable cell and verify activity at Synechococcus or other cells.
In vegetable cell, express
In plant, express the Δ 9 that from Ba Fuzao, is separated to and prolong enzyme gene Elo2, with the ability of confirming that it plays a role in plant.At first, prepared the expression of plants construct that is used for constitutive expression Elo2.To this, the Elo2 encoding sequence that will start from the amino acid sites 1 of SEQ ID NO:3 is placed under the control of the 35S promoter among the plant binary vector pBi121 (Clontech).Utilize colored dip method recited above that this construct is incorporated in the Arabidopis thaliana.The specificity of the lipid acid that the Elo2 sequence is prolonged is understood in utilization to the analytical table of leaf lipid.
P.salina Δ 8 desaturases and Δ 9 are prolonged enzyme clone in single binary vector, and each all is under the control of composing type 35S promoter and no terminator.In this gene construct, with the pBI121 that contains Δ 8 desaturase sequences under HindIII and ClaI (blunt endization) cutting, to discharge the fragment that contains 35S promoter and Δ 8 delta 8 desaturase genes, the pXZP143/ Δ 9 that is connected to then through HindIII+SacI (blunt endization) cutting prolongs in the enzyme carrier, so that produce intermediate pJRP013.Open this intermediate with HindIII then, and be connected in the pWvec8/ Δ 9 prolongation enzyme binary vectors (also opening) through HindIII, so that form construct pJRP014, it contains two genes between left side and T-DNA limit, right side, and the Totomycin selected marker who is appropriate to Plant Transformation.
Utilize the transformation technology of the Arabidopis thaliana mediation of standard, with this dual-gene construct transformation of tobacco.After in construct being incorporated into Arabidopis thaliana strain AGL1, inoculating the 20mLLB substratum with the clone of single conversion, and rocked following 28 ℃ of incubations 48 hours.Centrifugation cell (1000g 10 minutes) removes supernatant liquor, and precipitation is resuspended in the aseptic MS substratum of 20mL.Before in the tobacco leaf (1 square centimeter) of the W38 kind of fresh cutting, adding this Arabidopis thaliana solution, repeat this step.After slight mixing, tobacco leaf piece and Arabidopis thaliana solution were at room temperature placed 10 minutes.The leaf piece is transferred in the MS plate, sealing, and 24 ℃ of following incubations (cultivate altogether) 2 days.In containing the substratum of Totomycin, screen transformant, and produce tender shoots.Cut off tender shoots, it is transferred in the MS root substratum basin, carry out root growth, transfer in the soil at last.Divide the leaf of a little these plants and the existence of the 20:2 ω 6 in the seed lipid, 20:3 ω 6,20:3 ω 3 and 20:4 omega-3 fatty acid, verified the coexpression of two genes.
Discuss
Biological chemistry confirms to show that fatty acid prolonging is made up of 4 steps: condensation, reduction, dehydration and reduce for the second time, and with four proteic mixture catalyzed reactions, wherein first kind of albumen catalyzing and condensing step, and so-called prolongation enzyme.So far two groups of condensing enzymes have been identified.First kind relates to synthetic saturated and single saturated lipid acid (C18-22).They are FAE sample enzymes, and do not play any effect in the LC-PUFA biosynthesizing.Its alloytype that is identified prolongs enzyme and belongs to ELO family prolongation enzyme (pressing the name of ELO gene family), and the super LC lipid acid of synthetic sphingolipid needs the activity of these enzymes in yeast.The apparent likeness in form thing of the ELO type prolongation enzyme that is separated to from LC-PUFA synthesising biological body such as algae, liver moss, fungi and nematode has also demonstrated the prolongation that relates to LC-PUFA and has synthesized.The prolongation that has demonstrated corresponding acyl chain only needs to express the condensation component that prolongs enzyme.Therefore, the condensation component of the prolongation enzyme of being introduced can successfully be raised reduction and dehydration activity from transformed host, prolongs to implement successful acyl.This prolongs enzyme for P.salina Δ 9 also is correct.
Embodiment 10: the gene of isolating coded delta 4 desaturases from P.salina.
With the non-vertebrate organism of Δ 4 desaturase catalysis of in Δ 4 sites of the carbochain of lipid acid, introducing two keys (for example microorganism, lower plant comprise algae, liver moss, fungi and may lower animal) in the aerobic approach of DHA synthetic in end last step.Utilize diverse ways from Euglena, Ba Fuzao and from thraustochytriale, isolate the coding this kind of enzyme gene.For example use random sequencing (EST method, Meyer et al., 2003 to clone EST; Tonon et al., 2003) from Pavlova lutheri and very thin eye worm, isolated Δ 4 delta 8 desaturase genes, and with utilizing corresponding to cytochrome b
5The RT-PCR of the primer in HPGG structural domain and Histidine frame III district has isolated Δ 4 delta 8 desaturase genes (Qiu et al., 2001) from thraustochytriale ATCC21685.The Δ 4 delta 8 desaturase genes coding front end desaturase of being cloned into, its member's feature is the cytochrome b that has N-terminal
5Spline structure territory (Napier et al., 1999; Sayanova and Napier, 2004).The separation of the gene fragment of Δ 4 delta 8 desaturase genes of P.salina
Some conservative motifs of relatively discovery to Δ 4 desaturases of known liver moss and little algae comprise HPGG motif (SEQ ID NO:52), wherein expect cytochrome b
5Spline structure territory and three Histidine frame motifs are active required motifs.For the P.salina delta 8 desaturase genes that increases (particularly Δ 4 delta 8 desaturase genes), designed new degenerate pcr primer PavD4Des-F3 (5 '-AGCACGACGSSARCCACGGCG-3 ') (SEQ ID NO:53) and PavD4Des-R3 (5 '-GTGGTGCAYCABCACGTGCT-3 ') (SEQ ID NO:54), its correspond respectively to Histidine frame I conserved amino acid sequence and with the nucleotide sequence complementation of the aminoacid sequence of encoding histidine frame II.The previous purposes of also not reporting corresponding to the degenerate pcr primer in the Histidine frame I of Δ 4 desaturases and Histidine frame II district.
Utilizing the pcr amplification reaction of these primers, circulation with the first chain cDNA of P.salina as template is 95 ℃ of 1 round-robin 5 minutes; 94 ℃ 30 seconds, 57 ℃ 30 seconds, 72 ℃ of 35 round-robin 30 seconds; With 72 ℃ of 1 round-robin 5 minutes.The PCR product cloning is arrived in pGEM-T-easy (Promega) carrier, and utilize the reverse primer of pGEM-Teasy carrier, determine nucleotide sequence with ABi3730 automatization sequenator.In 14 clones that checked order, 3 clones demonstrate and Δ 4 delta 8 desaturase genes homologies.On a primer end, block two clones among three clones.The nucleotide sequence of the 3rd clone's 1803 cDNA inset is known as SEQ IDNO:11.
Utilize BLASTX software, with the coded aminoacid sequence search NCBI protein sequence database of SEQ ID NO:11.The result shows this sequence and known Δ 4 desaturase homologies.The amino acid preface of P.salina gene fragment demonstrates respectively has 65%, 49%, 46% and 46% homogeny with P.lutheri, thraustochytriale ATCC21685, Thraustochytrium aureum and very thin eye worm.
Separate total length Δ 4 delta 8 desaturase genes
Cutting is clone 1803 inset down, and with it as the probe that separates corresponding to the segmental full-length cDNA of Δ 4 delta 8 desaturase genes of inferring.The screening of high severity ground is about 750,000pfu P.salinacDNA library.Under 60 ℃, spend the night and hybridize, use 2xSSC/0.1%SDS to wash 30 minutes down for 65 ℃, washed 30 minutes down for 65 ℃ with 0.2x SSC/0.1%SDS then.Isolate 18 hybridization clones, and under identical hybridization conditions, carry out secondary screens 6 clones.From secondary screens, isolate single plaque to these 6 clones.From 5 single plaques, cut plasmid down, and determine the nucleotide sequence of inset with the reverse and forward direction primer of ABI 3730 automatization sequenators and carrier.Sequencing result shows 4 clones, and each all contains the Δ 4 desaturase cDNA that length is nearly 1.7kb, and each clone has identical encoding sequence and each encoding sequence obviously all is a full length sequence.They 5 ' with 3 ' UTR on have slight different, although they all contain identical protein-coding region.The cDNA sequence of the longest P.salina Δ 4 desaturase cDNA is known as SEQID NO:13, and encoded protein is known as SEQ ID NO:4.
The length of full-length cDNA is 1687 Nucleotide, and has 447 amino acid whose coding regions of coding.Pavlova salina Δ 4 desaturases all demonstrate the conservative motif of the classics of " front end desaturase ", comprise the cytochrome b of N-terminal
5Spline structure territory and 3 conservative motifs that are rich in Histidine.By demonstrating the homology that itself and P.lutheri Δ 4 desaturases (accession number AY332747) have top with other Δ 4 delta 8 desaturase genes comparison Nucleotide and aminoacid sequence, its nucleotides sequence is listed in has 69.4% homogeny on the protein-coding region, and aminoacid sequence has 67.2% homogeny.
Confirm the enzymic activity of Pavlova salina Δ 4 delta 8 desaturase genes
The dna fragmentation that will comprise Pavlova salina Δ 4 desaturase cDNA coding regions is cut into EcoRI-SalI cDNA fragment, and is inserted in the pYES2 Yeast expression carrier that utilizes EcoRI and XhoI site.Formed plasmid is transformed in the yeast cell.For the range of substrate that confirms that enzymic activity and expressing gene can affact, transformant is grown in the YMM substratum, and when having (external source) ω 6 added and omega-3 fatty acid, adds the semi-lactosi induced gene.Add individually in the substratum every kind of lipid acid 22:5 ω 3 (DPA, 1.0mM), 20:4n-3 (ETA, 1.0mM), 22:4 ω 6 (DTAG, 1.0mM) and 20:4 ω 6 (ARA, 1.0mM).After incubation 72 hours, collecting cell, and with carrying out fatty acid analysis as embodiment 1 described capillary gas chromatography (GC).Table 9 has shown the data that obtained.
Table 9: the active yeast PUFA that demonstrates Δ 4 delta 8 desaturase genes feeds
| Join the external lipid acid in the substratum | ||
| Fatty acid component (accounting for the % of total fatty acids) | 22:4ω6 | 22:5ω3 |
| ?14:0 | 0.63 | 0.35 |
| ?15:0 | 0.06 | 0.06 |
| ?16:1ω7c | 43.45 | 40.52 |
| ?16:1ω5 | 0.20 | 0.1?3 |
| ?16:0 | 18.06 | 15.42 |
| ?17:1ω8 | 0.08 | 0.09 |
| ?17:0 | 0.08 | |
| ?18:1ω9 | 26.73 | 30.07 |
| ?18:1ω7(major)& ?18:3ω3 | 1.43 | 1.61 |
| ?18:1ω5c | 0.02 | tr |
| ?18:0 | 7.25 | 8.87 |
| ?20:5ω3 | 0.40 | 0.62 |
| ?20:1ω9/ω11 | 0.03 | tr |
| ?20:0 | 0.08 | 0.09 |
| ?22:5ω6 | 0.03 | 0.00 |
| ?22:6ω3 | - | 0.04 |
| ?22:4ω6 | 0.97 | - |
| ?22:5ω3 | 0.00 | 1.66 |
| ?22:0 | 0.06 | 0.06 |
| ?24:1ω7 | 0.31 | 0.37 |
| ?24:0 | 0.12 | 0.04 |
| ?Sum | 100.00％ | 100.00％ |
This show the gene of coded delta 4 desaturases cloned can be on Δ 4 sites desaturation C22:4 ω 6 (3.0% changes into 22:5 ω 6) and C22:5 ω 3 (2.4% changes into 22:6 ω 3).When feeding C20:3 ω 6 or C20:4 ω 3 for the yeast conversion body, enzyme does not demonstrate any Δ 5 desaturation activity.
The expression of embodiment 11:P.salina Δ 4 delta 8 desaturase genes in vegetable cell and the generation of DHA
In order to confirm the activity of Δ 4 delta 8 desaturase genes in vegetable cell, can express the coding region dividually change into DHA so that allow DPA, perhaps with other the LC-PUFA synthetic gene for example Δ 5 prolong enzyme genes one and be used from EPA is changed into DHA.In order to express as separating gene, Δ 4 desaturase coding regions can be cut into the BamHI-SalI fragment, and be inserted into (Lee et al. between the seed specific promoters and polyadenylic acidization/transcription termination sequence of carrier pGNAP for example, 1998), make it under the control of seed specific promoters, express.Expression cassette can be inserted in the binary vector then, and be introduced in the vegetable cell.Be used for the plant transformed material and can be unconverted plant or contain expressing the conversion plant (embodiment 5) that zebra fish Δ 5/ Δ, 6 dual delta 8 desaturase genes and Caenorhabditis elegans prolong enzyme gene (each gene all is under the control of seed specific promoters).The transgenic arabidopsis that contains back one dual gene construct has successfully produced EPA and DPA in seed, and will allow that with the combination of Δ 4 delta 8 desaturase genes the DPA in the vegetable cell changes into DHA, as following the confirmation.
In order to confirm Δ 5 prolongation enzyme genes and Δ 4 delta 8 desaturase genes coexpression at reconstitution cell (particularly in the vegetable cell), and allow generation DHA, following Δ 4 desaturases and Δ 5 prolongation enzyme genes (embodiment 8) with P.salina are combined in the binary vector.Two coding regions all are placed under the control of seed-specific (napin) promotor and nos3 ' terminator, and the binary vector construct has the kantlex drug resistant gene, and it is used as the selected marker thing that vegetable cell is selected.The coding region of Δ 5 prolongation enzyme genes under the cutting as the PstI-SacII fragment, and is inserted between the promotor and terminator of middle interstitial granules (pXZP143) from its cDNA clone, has formed plasmid pXZP144.The coding region of Δ 4 delta 8 desaturase genes under the cutting as the BamHI-SalI fragment, and is inserted between the promotor and nos3 ' transcription terminator of plasmid pXZP143 from its cDNA clone, has formed plasmid pXZP150.Be inserted into by the HindIII-ApaI fragment with pXZP144 (comprising promotor-Elo1-nos3 ') between the StuI and ApaI site of pXZP150, these two expression cassettes are incorporated in the carrier, have formed plasmid pXZP191.HindIII-StuI fragment cloning (derivative of pBI121) in binary vector pXZP330 from the pXZP191 that contains two expression cassettes has formed plant expression vector pXZP355.Fig. 7 has diagrammatically shown this carrier.
Plant Transformation
Contaminate conversion method by agrobacterium-mediated flower 5 prolongation enzymes of the Δ on the pXZP355 and Δ 4 delta 8 desaturase genes are incorporated in the arabidopsis thaliana (embodiment 5) that is called DO11, described DO11 has been the transgenic plant of zebra fish Δ 5/ Δ, 6 difunctional desaturases and Caenorhabditis elegans Δ 5/ Δ 6 difunctional prolongation enzyme genes.Because those transgenosiss all are connected with Totomycin drug resistant gene as the selected marker, carry out secondary conversion with the pXZP355 that utilizes the kantlex resistance to select, therefore can distinguish two groups of transgenosiss.Obtain 5 strain transgenic plant, be called " DW " plant.Because DO11 can separate zebra fish Δ 5/ Δ, 6 difunctional desaturases and Caenorhabditis elegans Δ 5/ Δ 6 difunctional prolongation enzyme genes, expect that therefore some transform plant is the heterozygote of these genes.Analyzed the seed (T2 seed) that 5 strains transform plant, and demonstrated and in its seed oil, contain up to few 0.1% DPA and 0.5%DHA at most at least.Table 10 has shown the data of two strain plants.With mass spectroscopy (GC-MS) to the analytical proof that in GC analyzes, is accredited as the lipid acid in EPA and the DHA peak they are real EPA and DHA (Fig. 8).
The fatty acid analysis of T2 seed oil is confirmed the remarkable conversion of EPA to DHA taken place in DW2 and DW5 strain, have 0.2% and 0.5%DHA respectively.The inspection of the enzyme efficient among the plant DW5 that contains higher level DHA is demonstrated 17% the EPA that is produced in its seed prolonged enzymes by P.salina Δ 5 and prolong, and surpass 80% this DPA and changed into DHA by P.salina Δ 4 desaturases for DPA.Because Δ 5 prolongs enzymes and Δ 4 delta 8 desaturase genes are separable in the T2 seed, naked, the heterozygote of these genes that lipid acid is formed data represented to be gathered and homozygous genotypic mean value.The DHA level of estimating to have in the seed of DW5 filial generation strain of these genes that evenly isozygoty will be higher.
Table 10: from Arabidopis thaliana (the Columbia ecotype) and carry EPA and the lipid acid of the seed oil of the derivative of DHA gene construct is formed the synthetic of EPA, DPA in (total fatty acids per-cent)-transgenic seed and DHA
| Lipid acid | Wild-type | The DO11+DHA construct | |||
| Columbia | DW2 | DW5 | |||
| Common fats acid | Always | Always | TAG | PL | |
| ?16:0 | 7.2 | 6.7 | 6.1 | 5.5 | 12.5 |
| ?18:0 | 2.9 | 3.8 | 4.4 | 4.3 | 4.5 |
| ?18:1Δ 9 | 20.0 | 20.6 | 16.6 | 18.9 | 13.7 |
| ?18:2Δ 9，12(LA) | 27.5 | 26.0 | 25.9 | 25.5 | 33.1 |
| ?18:3Δ 9，12，15(ALA) | 15.1 | 13.2 | 15.0 | 13.6 | 15.1 |
| ?20.0 | 2.2 | 2.1 | 1.8 | 1.9 | 0.6 |
| ?20:1Δ 11 | 19.8 | 14.8 | 10.5 | 10.5 | 3.2 |
| ?20:1Δ 13 | 2.2 | 3.0 | 4.2 | 4.8 | 1.4 |
| ?20:2Δ 11，14 | 0.1 | 1.7 | 3.5 | 3.8 | 3.7 |
| ?22:1Δ 13 | 1.5 | 1.4 | 1.0 | 0.3 | 0.4 |
| Other are a small amount of | 1.5 | 2.9 | 2.7 | 2.4 | 3.8 |
| Amount to | 100.0 | 96.0 | 91.7 | 91.5 | 92.0 |
| New ω 6-PUFA | |||||
| ?18:3Δ 6，9，12(GLA) | 0 | 0.2 | 0.4 | 0.4 | 0.2 |
| ?20:3Δ 8，11，14 | 0 | 0.8 | 1.5 | 1.5 | 1.7 |
| ?20:4Δ 5，8，11，14(ARA) | 0 | 0.4 | 1.0 | 1.1 | 1.2 |
| ?22:4Δ 7，10，13，16 | 0 | 0 | 0 | 0 | 0.2 |
| ?22:5Δ 4，7，10，13，16 | 0 | 0 | 0.1 | 0.1 | 0.1 |
| 0 | 1.4 | 3.0 | 3.1 | 3.4 | |
| New ω 3-PUFA | |||||
| ?18:4Δ 6，9，12，15(SDA) | 0 | 0.7 | 1.5 | 1.6 | 0.5 |
| ?20:4Δ 8，11，14，17 | 0 | 0.5 | 0.8 | 0.7 | 0.9 |
| ?20:5Δ 5，8，11，14，17(EPA) | 0 | 1.1 | 2.4 | 2.5 | 2.3 |
| ?22:5Δ 7，10，13，16，19(DPA) | 0 | 0.1 | 0.1 | 0.2 | 0.7 |
| ?22:6Δ 4，7，10，13，16，19(DHA) | 0 | 0.2 | 0.5 | 0.4 | 0.2 |
| Amount to | 0 | 2.6 | 5.3 | 5.4 | 4.6 |
| Total fatty acids | 100.0 | 100.0 | 100.0 | 100.0 | 100.0 |
| ?Total?MUFA a | 41.3 | 36.8 | 28.1 | 29.7 | 17.3 |
| ?Total?C 18-PUFA b | 42.6 | 39.2 | 40.9 | 39.1 | 48.2 |
| ?Total?new?PUFA c | 0 | 4.0 | 8.3 | 8.5 | 8.0 |
aThe 18:1 Δ
9Summation (=18:1 Δ with deutero-LC-MUFA
9+ 20:1 Δ
11+ 22:1 Δ
13)
b?18:2+18:3
cThe summation of all new ω 6 and ω 3-PUFA
Go out DW5 T1 plant the germination year ten of 50 T2 seeds in containing the Totomycin substratum of each DW2 and DW5 and have (50/50) Δ 5/ Δ, 6 difunctional desaturases and the Δ 5/ Δ 6 difunctional prolongation enzymes that isozygoty, and the DW2 seed was in 3: 1 ratio (resistances: sensitivity) separate these genes, so DW2 is a heterozygote.This is with more consistent than observed higher levels of EPA in the DW2 seed in the DW5 seed, and explained in the seed of these gene pure, produced increase level DHA.This has also confirmed the demand property to the seed with the proterties of isozygotying.
We have also noticed the synthetic influence to the spectrum of the total fatty acids in these seeds of LC-PUFA.Although we observe new ω 6 and ω 3 PUFA (being the product of Δ 6 desaturation) the accumulating in the DW5 seed that surpasses 8% level, these seeds have and wild type seeds precursor lipid acid LA and ALA much at one.Though do not remove LA and ALA, reduced monounsaturated fatty acids C18:1 significantly
Δ 9And prolongation derivative (20:1
Δ 11And 22:1
Δ 13) level.Therefore, this shows C
18The increase that-PUFA has caused 18:1 to transform to LA and ALA to the conversion of LC-PUFA, and the minimizing that is used to the 18:1 that prolongs accordingly.
The plant expression vector pXZP355 that contains Δ 4 desaturases and Δ 5 prolongation enzyme genes also is used to gene is incorporated in the homology strain DO11-5 plant, has obtained the genetically modified T1 plant of 20 strains.DHA in the seed of these plants is similar to observed level in the DW5 seed with the DPA level.In these seeds, also observed the minimizing of monounsaturated fatty acids level.
The branch gold-plating of total seed lipid of DW5 seed is found that they are made up of 89%TAG and 11% polar lipid (mainly being made up of phosphatide).In addition, the fatty acid analysis of the TAG of DW5 seed part is shown that make new advances synthetic EPA and DHA just are integrated in the seed oil, and EPA and the DHA ratio level (table 10) that mainly reflected TAG part of the lipid acid of total seed lipid in forming.
Embodiment 12: the homogenic separation in other sources
By with the hybridization of the label probe that is derived from gene (particularly being derived from part or all of coding region), for example can easily detect the desaturase described herein in other little algaes or other sources and prolong for example homologue of P.salina gene of enzyme by Southern blot hybridization or dot blotting hybridization method.Can from the genome or cDNA library of these organisms, perhaps isolate homologous gene corresponding to the pcr amplification of the primer of conservative region by utilization.Similarly, can isolate with aliphatic alcohol with the similarity method of probe that utilizes zebra fish Δ 5/ Δ 6 desaturases and have the vertebrates desaturase of high-affinity and/or the homologue of the difunctional desaturase of fresh-water fishes.
Dot blotting hybridization
According to product description, (Qiagen) isolates the genomic dna of 6 kinds of little algae species with the DNAeasy test kit, and uses it for the dot blotting hybridization analysis, so that identify the LC-PUFA synthetic homologous gene that relates in these species.This also allows the sequence divergence that these genes of evaluation are compared with those genes that are separated to from Pavlovasalina.Little algae species of being checked in this is analyzed are to belong to from melosira, Rhodomonas, Heterosigma, Nannochloropsis, Heterocapsa and Tetraselmis.According to Hasle, G.R.﹠amp; Syvertsen, E.E.1996Dinoflagellates.In:Tomas, C.R. (ed.) Marine Phytoplankton.Academic Press, San Diego, CA.pp 531-532 identifies these species.When vitro culture (embodiment 2), according to EPA, DHA or both existence, this analysis comprises these little algaes.
The genomic dna that will be separated to from each little algae (near 100g) stigma is to Hybond N+ film bar (Amersham).After air dries, each film bar all is positioned over one deck through 0.4MNaOH saturated last 20 minute of 3MM filter paper, so that denatured DNA simply washes then in 2x SSC solution.Film bar air is dried, DNA under ultraviolet ray with the film cross connection.The preparation warp
32P Nucleotide mark and by not containing a large amount of crust husband algaes probe that the coding region in untranslated district of gene constitutes of deriving, it comprises that Δ 8, Δ 5 and Δ 4 desaturases and Δ 9 and Δ 5 prolong enzymes, and with itself and each film bar/DNA dot blotting hybridization.In the damping fluid that contains the smart DNA of 50mM Tris-HCl (pH7.5), 1M NaCl, 50% methane amide, 10x Denhardt solution, 10% T 500,1%SDS, 0.1% trisodium phosphate and 0.1mg/ml Pacific herring, film bar and every kind of probe hybridization under 42 ℃ are spent the night, then in the solution that contains 2x SSC, 0.5%SDS, 50 ℃ of down washings 3 times, each 15 minutes the washing of severity (in this test be low) or in 0.2x SSC, 0.5%SDS, 65 ℃ of washings 3 times down, each 20 minutes.
The severity of having recognized the wash conditions that is adopted in southern blotting technique/hybridization can disclose the useful information about the sequence affinity of gene.Therefore, when carrying out to keep hybridization when high severity is washed, high-caliber sequence affinity (for example the Nucleotide homogeny more than 80% on 100-200 Nucleotide) at least is described, and the DNA conservative property (for example Nucleotide homogeny more than 60% at least 200 Nucleotide) of the relative low degree between two genes of hybridization explanation that only in low severity washing process, kept.
The dot blotting of being hybridized is exposed to BioMax X-ray sheet (Kodak), and Fig. 9 has shown autoradiogram(ARGM).Autoradiogram(ARGM) has disclosed the homologue that exists with P.salina LC-PUFA gene in these species, also disclosed the scope of homology according to the hybridization of the different levels of being seen under high and low stringency.And show that some checked little algae species have the LC-PUFA gene of the gene that is different from basically among the P.salina, and the sequence of other genes is more relevant.For example, according to the intensity of hybridization, the gene of Tetraselmis sp shows similar with Δ 5 desaturases and Δ 5 prolongation enzyme height to the Δ 4 from Pavlova salina.On the contrary, all LC-PUFA genes that identified in Melosira all show and the P.salina gene similarity of low degree more.The LC-PUFA of Heterocapsa sp. prolongs the separation of enzyme gene
Heterocapsa spp. for example CSIRO collect in Heterocapsa niei (embodiment 2) be dinoflagellate, it is accredited as the producer that LC-PUFA comprises EPA and DHA.Separation from the LC-PUFA synthetic gene of these dinoflagellates is described for example, the cell of the Heterocapsa niei strain that the Port of Australian NSW Hacking is separated to, was purified into DNA at first from 1977.According to the description of product, (Qiagen) isolates DNA with the DNAeasy test kit.A plurality of aminoacid sequences according to the fatty acid prolonging enzyme of having delivered are arranged (Qi et al., 2002; Parker-Barnes et al., 2000), identify common amino acid chunk FLHXYH (SEQ IDNO:48) and MYXYYF (SEQ ID NO:49), and synthesized these sequences 5 of respective coding '-CAGGATCCTTYYTNCATNNNTAYCA-3 ' (SEQ ID NO:50) (justice is arranged) or with these sequences 5 '-GATCTAGARAARTARTANNNRTACAT-3 ' (SEQ ID NO:51) complementary (antisense) degenerated primer.Carry out pcr amplification reaction in the reaction volume of 20 μ L, it utilizes every kind of primer of 20pmol, 200ng Heterocapsa sp. genomic dna and Hostar TaqDNA polysaccharase (Qiagen) and produces family specified damping fluid and Nucleotide component.Following circulating reaction: 95 ℃ of 1 round-robin 15 minutes; 95 ℃ 1 minute, 38 ℃ 1 minute, 72 ℃ of 5 round-robin 1 minute; 72 ℃ of 95 ℃ 35 seconds, 52 ℃ 30 seconds, 72 ℃ of 35 round-robin 1 minute and 1 round-robin 10 minutes.Produce the fragment of nearly 350bp, and be connected in the pGEM-Teasy, be used for sequential analysis.
In 8 clones that are separated to, two identical clones have and the regional similar Nucleotide of known prolongation enzyme and coded aminoacid sequence.They are known as Het350Elo, and Nucleotide and aminoacid sequence all are respectively referred to as SEQ ID NO:79 and SEQ ID NO:80.The existence of terminator codon all illustrates and exist an intron between approximate site 33 and 211 in BLAST analysis and the skeleton.
What mate the most with aminoacid sequence is that animal prolongs enzyme sequence, sees for example Meyer et al. (2004), illustrates that the Heterocapsa gene order that is separated to may relate to the prolongation of C18 and C20 lipid acid substrate.
Can easily isolate the full-length clone that prolongs enzyme by screening Heterocapsa cDNA library or by well known in the art 5 ' and 3 ' RACE technology.
The structure in Melosira cDNA library and EST order-checking
The sharp mRNA that is used for the construction cDNA library that from the Melosira cell, isolates in the following method.In liquid nitrogen, use mortar and pestle with 2g (weight in wet base) Melosira cell powderization, and it is sprinkled into lentamente by in the beaker that contains 20ml extraction damping fluid of constant agitation.Toward wherein adding 5% insoluble polyvinylpyrrolidone, 90mM 2 mercapto ethanol and 10mM dithiothreitol (DTT), be transferred to Corex
TMBefore in the pipe, restir miscellany 10 minutes.Add the 18.4ml3M ammonium acetate, and mixed well.Then at 6000xg, 4 ℃ centrifugal sample 20 minutes down.Supernatant liquor is transferred in vitro new, be settled out nucleic acid by the 3M NaAc (pH value 5.2) and the cold isopropanol of 0.5 volume that adds 0.1 volume.After-20 ℃ of following incubations 1 hour, with sample in swing rotor under the 6000xg centrifugal 30 minutes.Throw out is resuspended in the 1ml water, and extracts with phenol/chloroform.Water is transferred in vitro new, and the 3M NaAc (pH value 5.2) and the cold isopropanol of 2.5 volumes that add 0.1 volume once more are settled out nucleic acid.Throw out is resuspended in the water, determines the concentration of nucleic acid, and isolate mRNA with Oligotex mRNA system (Qiagen).
(few dT connexon primer that (Stratagene-cat#200400) provided and reversed transcriptive enzyme SuperscriptIII (Invitrogen) synthesize article one cDNA to utilize ZAP-cDNA synthetic agent box.Double-stranded cDNA is connected with the EcoRI joint, and, therefrom constructs the library with ZAP-cDNA synthetic agent box as described in the incidental specification sheets handbook (Stratagene-cat#200400).Obtained 1.6 * 10
6The elementary library of plaque forming unit (pfu).Be dependent on 47 data of plaque at random, the average inset size of the cDNA inset in the library is 0.9 kilobasa, and the recombinant chou per-cent in the library is 99%.
Utilize ABI BigDye system, carry out single to 8684 expressed sequence marks (EST) by (pass) nucleotide sequencing with SK primer (5 '-CGCTCTAGAACTAGTGGATC-3 ') (SEQ ID NO:87).The length of 6570EST sequence has surpassed 400 Nucleotide, and demonstrating inset is this size at least.Gone out to demonstrate and some fatty acid desaturases and a PUFA prolongation enzyme homologous EST with the BlastX Analysis and Identification.
The coded aminoacid sequence (part) (SEQ ID NO:88) of cDNA clone Mm301461 demonstrates with false miniature hailian seaweed fatty acid prolonging enzyme 1 (accession number AY591337) 75% homogeny.The nucleotide sequence of EST clone Mm301461 is called SEQ ID NO:89.Make that with the height homogeny of known prolongation enzyme Mm301461 coding melosira fatty acid prolonging enzyme is very possible.Can easily isolate the full-length clone that coding prolongs enzyme with the RACE technology.
The FAE sample of embodiment 13:P.salina prolongs the separation of enzyme gene fragment
With the checked order random cdna clone in P.salina cDNA library of EST method.In the order-checking of junior one wheel, 73 clones have checked order.Analyze according to BLASTX, a clone who is known as 11.B1 is accredited as the albumen (partial sequence) that coding has the sequence similar to known β ketoacyl synthase sample fatty acid prolonging enzyme.Nucleotide sequence from 3 ' terminal 11.B1 is called SEQ IDNO:55.
These plants prolong enzymes and are different from the ELO type and prolong enzyme, wherein known they relate to C16 to the prolongation of C18 lipid acid and the prolongation that also relates to the saturated and monounsaturated fatty acids of overlength chain.Clone 11.B1 represent the non-higher plant gene of isolating first kind of the type.
Embodiment 14: the separation of the gene fragment of Δ 5 delta 8 desaturase genes of the separation P.salina of the gene of Δ 5 desaturases of coding P.salina
For Δ 5 delta 8 desaturase genes of isolating P.salina, designed the oligonucleotide of the conserved regions of desaturase.The oligonucleotide that is called d5A and d5B shown in below preparing, it is corresponding to the short dna sequence of Δ 5 delta 8 desaturase genes of Pavlova lutheri.Few d5A:5 '-TGGGTTGAGTACTCGGCCAACCACACGACCAACTGCGCGCCCTCGTGGTGGTGCGA CTGGTGGATGTCTTACCTCAACTACCAGATCGAGCATCATCTGT-3 ' (the 115-214 position Nucleotide of the International Patent Application WO 03078639-A2 that has delivered, Fig. 4 is (SEQ ID NO:56) a), and few d5B:5 ' ATAGTGCAGCCCGTGCTTCTCGAAGAGCGCCTTGACGCGCGGCGCGATCGTCGGGT GGCGGAATTGCGGCATGGACGGGAACAGATGATGCTCGATCTGG-3 ' (corresponding to the complementary sequence of the 195-294 position Nucleotide of WO03078639-A2, Fig. 4 is (SEQ ID NO:57) a).Annealing and prolong these oligonucleotide in PCR reaction.The PCR product has been inserted in the pGEM-T Easy carrier, and has verified nucleotide sequence.
The fragment that mark is cloned, and with its hybridization probe as screening Pavlovasalina cDNA library under medium stringency, in the SSC hybridization solution, 55 ℃ down hybridization spend the night, and wash traces 3 times, each 10 minutes at 60 ℃ with 2xSSC/0.1%SDS.Isolate 60 plaques from the screening to about 500,000 plaques, each has at least all provided weak hybridization signal.In 13 clones that checked order, a clone who is called p1918 contains partial-length cDNA, its coding and known Δ 5 delta 8 desaturase genes homologous aminoacid sequences.For example the amino-acid residue 210-430 in the C-terminal district of aminoacid sequence and thraustochytriale Δ 5 delta 8 desaturase genes (accession number AF489588) has 53% homogeny.
The separation of total length Δ 5 delta 8 desaturase genes
Partial-length sequences Design with p1918 goes out the pair of sequences Auele Specific Primer, uses it for then in top mentioned 60 PCR screenings that separate plaques.In 60 10 are positive, have identical or similar cDNA sequence.One of them clone who demonstrates strong hybridization signal (with the partial-length sequence as probe) is used to determine to be called the full length sequence of SEQ ID NO:58 and the coded aminoacid sequence that is called SEQ ID NO:60 (425 amino acid lengths).
Utilize BLASTX software, with aminoacid sequence search NCBI protein sequence database.The result shows this sequence and known Δ 5 desaturase homologies.The proteic aminoacid sequence of P.salina demonstrate with WO03/078639-A2 in no clear and definite active P.lutheri sequence 81% homogeny is arranged, and 50% homogeny is arranged with Δ 5 desaturases of thraustochytriale (accession number AF489588).Δ 5 desaturases of Pavlova salina demonstrate " front end desaturase " peculiar all conservative motifs, and it comprises the cytochrome b of N-terminal
5Spline structure territory and 3 are rich in the Histidine motif.
Following Δ 5 delta 8 desaturase genes and the Δ 9 realized in cell prolongs the coexpression of enzyme (Elo2, embodiment 7) and Δ 8 delta 8 desaturase genes (embodiment 6).Made up plant expression vector pXZP354, it contains 3 genes, and each gene is all from P.salina, and each all is expressed in seed-specific napin promotor.At first the P.salina Δ 8 desaturase coding regions with cDNA clone (top) are inserted between the seed-specific napin promotor and Nos terminator of pXZP143 as the BamHI-NcoI fragment, have formed plasmid pXZP146.To prolong the enzyme gene from its cDNA clone's P.salina Δ 9 similarly and be inserted in the pXZP143, form plasmid pXZP143-Elo2 as PstI-XhoI.Also will be inserted in the pXZP143 as the PstI-BssHII fragment, formed plasmid pXZP147 from its cDNA clone's P.salina Δ 5 delta 8 desaturase genes.Then, the HindIII-ApaI fragment that will contain the Δ 9 prolongation expression of enzymes boxes of pXZP143-Elo2 is inserted into the downstream of the Δ 8 desaturase expression cassettes among the pXZP146, has formed plasmid pXZP148.The HindIII-ApaI fragment that will contain the Δ 5 desaturase expression cassettes of pXZP147 is inserted into the downstream that Δ 8 desaturases among the pXZP148 and Δ 9 prolong the expression of enzymes boxes, has formed plasmid pXZP149.Then, in the step in the end, the HindIII-ApaI fragment that will contain 3 genes of pXZP149 is inserted in the derivative of binary vector pART27, and it contains Totomycin drug resistant gene selectable marker, has formed plant expression plasmid pXZP354.
Or exist at the same time or do not exist when containing P.salina Δ 5 and prolonging the expression plasmid pXZP355 (embodiment 11) of enzymes and Δ 4 delta 8 desaturase genes, with agrobacterium-mediated colored dip method plasmid pXZP354 is incorporated in the Arabidopis thaliana.Can obtain the cotransformation of carrier, because they contain different selected markers.In one situation of back, screen transgenic plant (being called " DR " plant) with Totomycin as selective agent, and in the previous case, with Totomycin and kantlex screening plant (" DU " plant).
21 strain DR plants (T1 plant) have been obtained.Fatty acid analysis from the seed oil of the T2 seeds of 10 these plants of strain demonstrated exist low-level 20:2 ω (EDA), 20:3 ω 6 (DGLA) and 20:4 ω 6 (ARA), comprise 0.4%ARA at most.The fatty acid analysis of the seed oil of the T2 seeds of 7 strain DU plants is demonstrated these lipid acid of similar level.
From the relative proportion of these lipid acid, can reach a conclusion: Δ 6 desaturases and Δ 8 desaturases can play a role in the seed that transforms through pXZP354 effectively, but the activity that Δ 9 prolongs the enzyme gene is not good enough.The coding region of shortening N-terminal is possible, so that begin translation from the amino acid sites 11 or 29 (seeing SEQ ID NO:85 and 86) of SEQ IDNO:3 (embodiment 9), this will improve the activity level that Δ 9 prolongs the enzyme gene.By seed specific promoters rather than one or both genes of napin promoter expression, make not all by these genes of napin promoter expression, estimate that this also will improve Δ 9 and prolong enzyme expression of gene level.
The separation of the gene of coded delta 6 desaturases among the embodiment 15:Echium plantagineum
Some plant species for example Echium kind of root of Redsepal Eveningprimrose (root of Redsepal Eveningprimrose), common Borrago officinalis, Ribes nigrum L. (Ribes nigrum L.) and some term Boraginaceaes all contain ω-6 and the unsaturated C18 lipid acid of ω-3, gamma linolenic acid (18:3 ω 6 in its leaf lipid and seed TAG kind, GLA) and therapic acid (18:4 ω 3, SDA) (Guil-Guerrero et al., 2000).GLA and SDA are considered to the beneficial fatty acids of human health.First step of synthetic LC-PUFA is Δ 6 desaturation.With the synthetic GLA of Δ 6 desaturases, described enzyme is incorporated into two keys in Δ 6 sites of LA.Identical enzyme also can be incorporated into two keys Δ 6 sites of ALA, produces SDA.From Boraginaceae member such as Borrago officinalis (Sayanova et al., 1997) and two blueweed species (Garcia-Maroto et al., 2002), Δ 6 delta 8 desaturase genes have been cloned.
Echium plantagineum is the yearly plant in winter in Europe and north African.Its vegetables oil is unusual, wherein it has the unique ω 3 and the ratio of ω 6 lipid acid, and contain a large amount of GLA (9.2%) and SDA (12.9%) (Guil-Guerrero et al., 2000), the Δ 6 desaturase activity that exist the desaturationization that relates to ω 3 and ω 6 lipid acid in the seed of plant are described.
The clone of E.platangineum Ep1D6Des gene
Utilize and proofread and correct archaeal dna polymerase Pfu Turbo_ (Stratagene), carry out RT-PCR amplification with the degenerated primer that contains XbaI or SacI restriction site to the Δ 6 desaturase sequences of E.platangineum corresponding to the N of Δ 6 desaturases of known Echium pitardii and Echium gentianoides (Garcia-Maroto et al., 2002) and C-terminal aminoacid sequence MANAIKKY (SEQ ID NO:61) and EALNTHG (SEQ ID NO:62).XbaI and SacI site with the 1.35kbPCR amplified production has inserted pBluescript SK (+) have produced plasmid pXZP106.Determined the nucleotide sequence (SEQ ID NO:63) of inset.It comprises the open reading frame of the polypeptide (SEQ ID NO:64) of 438 amino-acid residues of encoding, and the Δ 6 and Δ 8 desaturases of itself and other E.gentianoides (SEQ ID NO:65), E.pitardii (SEQ ID NO:66), Borrago officinalis (SEQ ID NO:67 and 68), Helianthus annuus (SEQ ID NO:69) and the Arabidopis thaliana (SEQ ID NO:70 and SEQ ID NO:71) reported have high homology (Figure 10).The same with Δ 8 desaturases (Sayanova et al.1997 with other Δs 6 of being reported; Napier et al.1999), its N-terminal also has cytochrome b
5Structural domain, described structural domain contain HPGG (SEQ ID NO:72) motif in the heme land.In addition, E.platangineum Δ 6 desaturases contain 3 conservative Histidine frames, comprise and contain the 3rd the Histidine frame (Figure 10) (Napier et al., 1999) that is called QXXHH (SEQ ID NO:73) motif that is had in overwhelming majority's " front end " desaturase.The cluster analysis that comprises the representative member of Δ 6 and Δ 8 desaturases demonstrates the gene that is cloned and clearly is grouped in other Δ 6 desaturases (particularly those Δ 6 desaturases of blueweed species).
The heterogenous expression of E.platangineum Δ 6 delta 8 desaturase genes in yeast
Carry out the expression test in the yeast, so that E.platangineum genes encoding Δ 6 desaturases that checking is cloned.Gene fragment is inserted in the SmaI-SacI site of the Yeast expression carrier pSOS (Stratagene) that contains composing type ADHI promotor as the XbaI-SacI fragment, has formed plasmid pXZP271.With the heat-shocked method it is transformed in the yeast strains S288C, by the screening of the bed board on minimum medium plate transformant clone.For the analysis of enzymic activity, with 2mL yeast clone culture in containing the yeast minimum medium of 0.1%NP-40,30 ℃ grow into O.D. under rocking
600Value is 1.0.Add precursor free fatty acids (as the linolic acid or the linolenic acid of 25mM ethanol storage liquid), make that the final concentration of lipid acid is 0.5mM.Culture is transferred to 20 ℃, and rocking growth down 2-3 days.By centrifugal collection yeast cell repeatedly, at first with the 0.1%NP-40 washing, then with 0.05%NP-40 and wash with water at last.Extract lipid acid and analysis.Confirm the peak identity of lipid acid with GC-MS.
The transgenic yeast cell of expressing Echium Ep1D6Des can change into GLA and SDA with LA and ALA respectively.About 2.9%LA has been converted to GLA, and 2.3%ALA changed into SDA, has confirmed the Δ 6 desaturase activity of institute's clone gene coding.
The functional expression of E.platangineum Δ 6 delta 8 desaturase genes in transgene tobacco
In transgenic plant, synthesize Δ 6 unsaturated fatty acidss, expressing gene in tobacco plant in order to verify that the Ep1D6Des gene can make.For this reason, the following gene fragment of cutting from Pxzp106 as the XbaI-SacI fragment, and is cloned into it on XbaI and SacI site of plant expression vector pBI121 (Clonetech), be under the control of composing type 35S CaMV promotor, produced plant expression plasmid pXZP341.Be introduced in the Agrobacterium tumefaciems AGL1, and be used for transformation of tobacco W38 plant tissue, select with kantlex.
Carry out being introduced expression of gene to detect to transforming the Northern blot hybridization analysis of plant, and the total fatty acids in the leaf lipid of the tobacco plant of aforesaid analysis wild-type tobacco W38 and conversion.The LA (21% total fatty acids) and the ALA (37% total fatty acids) that contain ponderable amount in the leaf lipid of unconverted plant.As expected, in unconverted leaf, all do not detect GLA or SDA (products of Δ 6 desaturation).In addition, the rotaring gene tobacco plant that transforms through the pBI121 carrier has similar leaf lipid acid composition to unconverted W38 plant.On the contrary, the leaf of the rotaring gene tobacco plant of expression Ep1D6Des gene demonstrates and exists the additional peak that has corresponding to the residence time of GLA and SDA.Confirmed the identity at GLA and SDA peak with GC-MS.Leaf lipid acid that it should be noted that the plant of expressing the Ep1D6Des gene all contains the GLA than the high 2 times of concentration of SDA consistently, even when the amount maximum of total Δ 6 unsaturated fatty acidss in its leaf lipid has reached 30% total fatty acids (Figure 11).
Table 11: the lipid acid in the lipid of transgene tobacco leaf is formed
| Plant | ?16:0 | ?18:0 | 18:1 | ?18:2 | ?GLA | ?18:3 | ?SDA | Total |
| ?W38 | ?21.78 | ?5.50 | 2.44 | ?21.21 | ?- | ?37.62 | ?- | ?- |
| ?ET27-1 | ?20.33 | ?1.98 | 1.25 | ?10.23 | ?10.22 | ?41.10 | ?6.35 | ?16.57 |
| ?ET27-2 | ?18.03 | ?1.79 | 1.58 | ?14.42 | ?1.47 | ?53.85 | ?0.48 | ?1.95 |
| ?ET27-4 | ?19.87 | ?1.90 | 1.35 | ?7.60 | ?20.68 | ?29.38 | ?9.38 | ?30.07 |
| ?ET27-5 | ?15.43 | ?2.38 | 3.24 | ?11.00 | ?0.84 | ?49.60 | ?0.51 | ?1.35 |
| ?ET27-6 | ?19.85 | ?2.05 | 1.35 | ?11.12 | ?4.54 | ?50.45 | ?2.19 | ?6.73 |
| ?ET27-8 | ?19.87 | ?2.86 | 2.55 | ?11.71 | ?17.02 | ?27.76 | ?7.76 | ?24.78 |
| ?ET27-11 | ?17.78 | ?3.40 | 2.24 | ?12.62 | ?1.11 | ?51.56 | ?0.21 | ?1.32 |
| ?ET27-12 | ?16.84 | ?2.16 | 1.75 | ?13.49 | ?2.71 | ?50.80 | ?1.15 | ?3.86 |
Northern to the strain of a plurality of independently transgene tobacco analyzes the Ep1D6Des transcript that demonstrates different levels, and it is general relevant with the level of the unsaturated product of institute's synthetic Δ in the plant.For example, only synthetic Δ 6 unsaturated fatty acidss that account for total leaf lipid of 1.95% of the transgenic plant ET27-2 that contains low-level Ep1D6Des transcript.On the other hand, transgenic plant ET27-4 contains remarkable higher levels of Ep1D6Des transcript, and the Δ unsaturated fatty acids that also contains more at high proportion (30%) in its leaf lipid.
Analysis to single tobacco plant shows the GLA that exists bar none than SDA greater concn, although contain the ALA than LA greater concn in unconverted plant.On the contrary, the expression of Ep1D6Des in yeast caused LA to GLA and the ALA intimate identical level of conversion to SDA.On the other hand, Echium plantagineum seed contains the higher levels of SDA than GLA.Ep1D6Des may realize in the body in Echiurm plantagineum seed that it has become the LA of phosphatidylcholine (PC) and the desaturation (Jones andHarwood 1980) of ALA to esterification.In tobacco leaf detected, the enzyme most probable had become esterification the LA and the ALA desaturationization (Browse and Slack, 1981) of chloroplast(id) lipid monogalactosyldiglyceride (MGDG).In yeast detection, the lipid acid precursor LA and the ALA most probable that add in the substratum enter the aliphatic alcohol pond, and can be used for being played a role with this form by Ep1D6Des.
The functional expression of E.platangineum Δ 6 delta 8 desaturase genes in transgenic seed
In order to show the seed-specific expression of Echium Δ 6 delta 8 desaturase genes, following the coding region is inserted in the seed-specific expression box.The NcoI-SacI fragment that will comprise Δ 6 desaturase coding regions has been inserted in the pXZP6 (the pBluescriptSK derivative that contains the Nos terminator), has formed plasmid pXZP157.The SmaI-ApaI fragment that will contain coding region and terminator Ep1D6Des-NosT has been inserted in the downstream of Fp1 promotor of pWVec8-Fp1, has formed plasmid pXZP345.Transform wild-type arabidopsis thaliana (the Columbia ecotype) with plasmid pXZP345, and select transgenic plant with hygromycin B.Be called " DP " plant through this gene institute transgenic plant transformed.
The fatty acid compositional analysis of the seed oil of the T2 seed of the 11 strain T1 plants that the construct of hanging oneself is transformed is presented at and all exists GLA and SDA in all plant strains, and the level of Δ 6 desaturation products has reached at least 11% (table 12).This has verified effective Δ 6 desaturation to LA in the seed and ALA.
Table 12: the lipid acid of the transgenic arabidopsis seed of Δ 6 desaturases of expression Echium is formed
| Plant | Lipid acid (%) | |
||||||||
| 16:0 | 18:0 | 18:1 Δ9 | 18:2 Δ9，12 (LA) | 18:3 Δ6，9，12 (GLA) | 18:3 Δ9，12，15 (ALA) | 18:4 Δ6，9，12，15 (SDA) | 20:0 | 20:1 | ||
| Columbia | ||||||||||
| DP-2 | 8.0 | 2.8 | 22.9 | 27.3 | 2.5 | 11.3 | 0.7 | 1.6 | 15.8 | 3.2 |
| DP-3 | 7.8 | 2.7 | 20.6 | 25.9 | 3.0 | 12.1 | 0.8 | 1.7 | 17.8 | 3.8 |
| DP-4 | 7.8 | 2.8 | 20.4 | 28.5 | 1.2 | 13.7 | 0.4 | 1.7 | 16.1 | 1.5 |
| DP-5 | 8.2 | 3.2 | 17.4 | 29.3 | 1.2 | 14.2 | 0.3 | 2.1 | 15.6 | 1.6 |
| DP-7 | 8.2 | 2.9 | 18.4 | 26.7 | 5.0 | 12.7 | 1.4 | 1.7 | 15.2 | 6.4 |
| DP-11 | 9.0 | 3.5 | 17.8 | 28.4 | 3.0 | 13.4 | 0.9 | 2.1 | 13.9 | 3.8 |
| DP-12 | 8.6 | 3.0 | 18.9 | 27.8 | 3.3 | 12.6 | 1.0 | 1.8 | 15.4 | 4.3 |
| DP-13 | 8.7 | 2.9 | 14.4 | 27.3 | 8.5 | 13.7 | 2.6 | 1.7 | 12.4 | 11.1 |
| DP-14 | 9.3 | 2.9 | 14.2 | 32.3 | 2.1 | 15.4 | 0.7 | 1.8 | 12.8 | 2.8 |
| DP-15 | 8.2 | 2.9 | 17.8 | 30.1 | 0.3 | 15.3 | 0.2 | 1.9 | 15.5 | 0.5 |
| DP-16 | 8.0 | 2.8 | 19.5 | 29.2 | 2.7 | 13.1 | 0.8 | 1.7 | 14.2 | 3.5 |
Embodiment 16: to the mutagenesis of E.platangineum Ep1D6Des gene
In order whether variability to be incorporated in Δ 6 delta 8 desaturase genes and still to keep the desaturase activity, described as Zhou and Christie (1997), when having dITP, with the Δ 6 desaturase cDNA of the PCR random mutagenesis E.platangineum that utilizes Taq polysaccharase and EPD6DesF1 and EPD6DesR1 primer.Clone PCR products as the XbaI of pBluescript SK (+) and the XbaI-SacI fragment on the SacI site, and is determined the clone's of selection sequence at random.Screening has the random variants that amino acid changes, and with its as the XbaI-SacI fragment cloning in pBI121, and the aforesaid method that is used for wild type gene characterizes out the expressed proteic enzymic activity of these variant transgene tobacco leaves.
Figure 11 A represents the activity when the Ep1D6Des sequence variants is expressed in tobacco plant.Variant can be divided into two major types according to its ability that realizes Δ 6 desaturation.The sudden change of representing with hollow square demonstrates the active remarkable attenuating of Δ 6 desaturations, and the sudden change of representing with closed square to coded Δ 6 desaturase activity have only seldom or not influence.Figure 11 B represents that Ep1D6Des transgenation selection is to the active quantitative effect of Δ 6 desaturases.The cytochrome b of Ep1D6Des
5L14P sudden change in the structural domain and the S301P sudden change between Histidine frame II and the Histidine frame III have caused the active remarkable attenuating of its Δ 6 desaturases, and the wild-type enzyme comparison with in the W38 plant has caused total Δ 6 unsaturated fatty acids accounts to reduce 3 to 5 times.On the contrary, institute is illustrational as the S205N sudden change, and the most variants that detected are to the active not influence of Δ 6 desaturations of Ep1D6Des gene.
Embodiment 17: the aliphatic alcohol and the acyl PC substrate dependency desaturase that are used for generation LC-PUFA in cell compare
As mentioned above, with for example EPA and the DHA order effect that needs the PUFA desaturase and prolong enzyme of synthetic LC-PUFA in cell of traditional Δ 6 desaturation approach, as explanation illustrated in Figure 12 A part.This classical pathway in algae, liver moss, fungi, diatom, nematode and some fresh-water fishes, play a role (Sayanova and Napier, 2004).From the PUFA desaturase of algae, fungi, liver moss and worm optionally with the lipid acid of esterification in the sn-2 site of phosphatidylcholine (PC), and PUFA prolongs the lipid acid that enzyme acts on the aliphatic alcohol substrate form that is had in the aliphatic alcohol pond in the endoplasmic reticulum (ER), and the PC component with ER on its physiology is separated.Therefore, to the order desaturation of lipid acid substrate and prolong reaction needed lipid acid in the acyl PC of ER and the mutual transfer between the aliphatic alcohol pond.This needs to regulate the acyl transferring enzyme of LC-PUFA substrate.This " substrate conversion " needs to have caused observed poor efficiency (Beaudoin et al., 2000 arrived in the biosynthetic trial of having reported in early days of reconstruction LC-PUFA; Domergue et al., 2003a).Another kind of Δ 8 desaturation approach (Figure 12 B part) have the identical shortcoming that needs " substrate conversion ".
Shown in embodiment 5, utilize the strategy of the vertebrates desaturase of energy desaturation aliphatic alcohol substrate to provide the quite effectively LC-PUFA in the vegetable cell (comprising seed) to produce.In embodiment 5, the advantage that the combination that Δ 5/ Δ, 6 desaturases of zebra fish and the Δ of Caenorhabditis elegans 6 prolong enzyme has is that desaturase and prolongation enzyme all have activity to the aliphatic alcohol substrate in the aliphatic alcohol pond.This can explain that this strategy can more effectively synthesize LC-PUFA.In order to provide the comparison of the suitable efficient of using aliphatic alcohol substrate dependency desaturase and acyl PC substrate dependency desaturase, the test below we have carried out.Echium Δ 6 desaturases (embodiment 15) and P.salina Δ 5 desaturases (embodiment 14) (two kinds of enzymes all use acyl PC substrate) and zebra fish Δ 6/ Δ 5 desaturases (it uses the aliphatic alcohol substrate) (embodiment 5) have been compared in this test.
Prepare construct, it contains two kinds of acyl PC dependency desaturases that are called Echium Δ 6 desaturases and P.salina Δ 5 desaturases combining with Caenorhabditis elegans Δ 6 prolongation enzymes.Echium Δ 6 desaturases on the NcoI-SacI fragment have been inserted in the pXZP143 (embodiment 15), have formed pXZP192.Caenorhabditis elegans Δ on the HindIII-ApaI fragment (embodiment 5) of pCeloPWVec8 6 is prolonged enzyme gene (Fp1-CeElo-NosT expression cassette) be inserted in the StuI-ApaI site of pXZP147 (embodiment 14), formed pXZP193.The HindIII-ApaI fragment that will contain the pXZP193 of gene (Fp1-PsD5Des-NosT and Fp1-CeElo-NosT) has been inserted in the ApaI-StuI site of pXZP192, has formed the plasmid pXZP194 that contains 3 expression cassettes.The XbaI-ApaI fragment of pXZP194 has been inserted in the pWvec8 derivative, has formed pXZP357.
By agrobacterium-mediated colored dip method, transform the environmental plant of wild-type Arabidopis thaliana Columbia with plasmid pXZP357, after selecting, hygromycin B (20mg/L) obtained 6 strain transgenic plant.Genetically modified T1 plant is called " DT " plant.The drug-fast conversion of Totomycin plant has been transferred in the soil, and oneself's fertilization.Collect the T2 seed, and analyze the seed lipid acid composition of two strain DT1 and DT2.The seed lipid acid of DT1 and DT2 all contains low-level 18:3 ω 6 and 18:4 ω 4 (be respectively 0.9 and 0.8%GLA, 0.3% and 0.1%SDA, table 13).In addition, DT1 and DT2 kind cotyledon contain 0.3% and 0.1%20:4 ω 6 (ARA).But, in the strain of T2 seed, all there be not the synthetic of tangible omega-3 fatty acid EPA, this may reflect that Echium Δ 6 desaturases have higher desaturation activity to ω 6 substrate LA comparison ω 3 substrate A LA (embodiment 15).
The lipid acid of the seed oil of the T2 seed of table 13:DT1 and DT2 is formed, and fatty acid value is a total fatty acids per-cent
| Lipid acid | Contrast | DT1 | DT2 |
| 16:0 | 7.2 | 6.5 | 6.5 |
| 18:0 | 2.9 | 3.6 | 3.3 |
| 18:1ω9 | 20.0 | 23.2 | 22.3 |
| 18:2ω6 | 27.5 | 23.6 | 24.4 |
| 18:3ω3 | 15.1 | 15.4 | 16.1 |
| 20:0 | 2.2 | 2.0 | 1.9 |
| 20:1ω9/ω11 | 19.9 | 19.4 | 19.5 |
| 20:1ω7 | 2.2 | 3.4 | 3.0 |
| 20:2ω6 | 0.1 | 0.0 | 0.0 |
| 22:1ω7 | 0.0 | 0.0 | 0.0 |
| Other are a small amount of | 2.8 | 1.5 | 1.9 |
| Amount to | 100.0 | 98.6 | 98.9 |
| New ω 6-PUFA | |||
| 18:3ω6 | 0.0 | 0.9 | 0.8 |
| 20:3ω6 | 0.0 | 0.0 | 0.0 |
| 20:4ω6 | 0.0 | 0.3 | 0.1 |
| Amount to | 0.0 | 1.2 | 0.9 |
| New ω 3-PUFA | |||
| 18:4ω3 | 0.0 | 0.3 | 0.2 |
| 20:4ω3 | 0.0 | 0.0 | 0.0 |
| 20:5ω3 | 0.0 | 0.0 | 0.0 |
| Amount to | 0.0 | 0.3 | 0.2 |
| Total fatty acids | 100.0 | 100.0 | 100.0 |
These data are obviously opposite with the result of top embodiment 5, and wherein the aliphatic alcohol dependency desaturase of zebra fish and Δ 6 combination that prolongs enzymes causes the 1.1%ARA at least that produced T2 seed lipid acid and 2.3% EPA.Therefore, this shows that the LC-PUFA of acyl PC dependency desaturase in driving vegetable cell is more more invalid than aliphatic alcohol dependency desaturase aspect synthetic.
The expression of embodiment 18:LC-PUFA gene in Synechococcus
(bacterium, cyanobacteria, Chroococcales, Synechococcus kind be Synechococcus elongatus for example for Synechococcus spp., also be called Synechocystis spp.) be the bacterium of single celled, photosynthetic, marine products or fresh water successively, cyanobacteria utilizes the chlorophyll a in the daylighting equipment.Species comprise the important primary producer in the ocean environment.A kind of special biochemical characteristics of Synechococcus are to have phycoerythrin, and it is a kind of fluorescent orange compound that can be detected when the excitation wavelength of 540nm, and this can be used to identify Synechococcus.The member of marine products Synechococcus group is closely related in 16s rRNA level.They are that the ocean is exclusive, and Na+, Cl-, Mg2+ and Ca2+ are had the growth requirement that has improved, but can easily grow in natural and artificial seawater liquid nutrient medium and the culture plate (Waterbury etal.1988).Because they have the growth rate of heterotrophic fast or autotrophy, contain lipid acid precursor for example LA and ALA, and relatively easy the conversion, so they are applicable to the functional study that relates to the LC-PUFA synthetic gene or be used for producing in the fermented type production system LC-PUFA.Bacterial strain is Synechococcus sp. bacterial strain WH8102, PCC7002 (7002 for example, marine products) or PCC7942 (fresh water) can easily grow, and can carry out biochemical and genetic processing treatment (Carr, N.G., and N.H.Mann.1994.The oceanic cyanobacterial picoplankton, p.27-48.In D.A.Bryant (ed.), the Molecular biology of cyanobacteria.KluwerAcademic publishers, Boston).For example, Synechococcus can be as the heterologous expression system (Domergue 2003b) of desaturase.
Wild-type Synechococcus7002 fatty acid profile and growth rate
In order to show that cyanobacteria Synechococcus 7002 is a kind of suitable host that transform the lipid acid synthetic gene, and this expression system can detect the function and the specificity of lipid acid synthetic gene apace, at first analyze the growths of wild type strains 7002 22 ℃, 25 ℃ and 30 ℃, and with gc analysis at 22 ℃ and the 30 ℃ times formed fatty acid profiles of bacterial strain (table 14) of growing.
The fatty acid profile (per-cent of total fatty acids) of table 14: wild-type Synechococcus 7002 under 22 ℃ and 30 ℃ of growth temperatures
| Temperature | Tetradecanoic acid | Palmitinic acid | Zoomeric acid | Stearic acid | Oleic acid | ?18:1iso | Linolic acid | ?GLA | Linolenic acid |
| ?22℃ | ?0.79 | ?42.5 | ?10.6 | ?0.92 | ?8.4 | ?1.5 | ?7.5 | ?0.54 | ?27.1 |
| ?30℃ | ?0.76 | ?47.1 | ?10.9 | ?0.67 | ?17.0 | ?0.34 | ?20.4 | ?2.9 |
In 30 ℃ of faster than 22 ℃ of growths, 25 ℃ the speed of growth (Figure 13) placed in the middle.Find that cell contains linolic acid (LA, 18:2 ω 6) and linolenic acid (ALA, 18:3 ω 3), it can be used as LC-PUFA synthetic precursor.Although produced some preferred precursor ALA at 30 ℃, obtained higher level at 22 ℃.Also test to confirm whether whether cell can obtain behind the abundant biomass heated culture temperature to be reduced to 22 ℃ subsequently 30 ℃ of growths, can cause the linolenic skew (Figure 14) to higher output yield so that determine this.In this test, the ALA that is obtained is greater than 5%.In further testing, 25 ℃ of preferred temperature as bacterial strain 7002 provide the enough speed of growth and suitable precursor fatty acid profiles.
Transform strategy
Replicating plasmid vector and non-replicating homologous recombination vector before be used to transform various cyanobacteria species, comprised Synechococcus7002 (Williams and Szalay, 1983; Ikedaet al., 2002; Akiyama et al., 1998a).Recombinant vectors can be preferred in some applications, and has been used to the deactivation gene rather than has produced express strain.
Make up recombinant vectors, make it be applicable to one or more lipid acid synthetic genes are incorporated into the Synechococcus strain for example in the karyomit(e) of 7002 strains.This carrier contains Synechococcus7002 sul2 gene in pBluescript plasmid skeleton, it provides the Ampicillin Trihydrate gene as selectable marker, and allow species for example the bacterium in the intestinal bacteria duplicate.Genetically engineered carrier makes it contain the colibacillary plac promotor that merges with the downstream multiple clone site, and approximate two elements that are inserted into the sul2 gene center.The sulfuric acid of the Sul2 genes encoding low-affinity of Synechococcus, it is also nonessential under the normal growth condition.Can screen the outer arbitrary gene (preferably dispensable gene) of Sul2, be used to be integrated in the recombinant vectors.
According to approximately uniform sequence, with in the PCC6803 strain, increase sul2 gene (the Genbank accession number NC_000911 of Synechococcus7002 genomic dna of gene-specific primer, from Nucleotide 2902831 to 2904501), and be inserted in the carrier pGEM-T.With primer 5 '-the plac promotor of gctacgcccggggatcctcgaggctggcgcaacgcaattaatgtga-3 ' (SEQ IDNO:81) (justice is arranged) and 5 '-cacaggaaacagcttgacatcgattaccggcaattgtacggcggccgctacggata tcctcgctcgagctcgcccggggtagct-3 ' (SEQ ID NO:82) (antisense) amplification pBluescript, this also introduces a plurality of restriction sites toward promoter sequence is terminal.Digest the fragment that is increased with SmaI then, and it is connected with the big PvuII fragment of the pBluescript that comprises the beta lactamase gene.Digest this intermediate carrier with EcoRV and SacI then, and it is connected to SacI fragment (being called sul2b) with the HpaI of sul2 gene.With the formed plasmid of BamHI digestion process, handle filling end with dna polymerase i (Klenow fragment), and be connected to HpaI fragment (being called sul2a) with the SmaI of sul2 gene.By from this carrier, removing too much restriction site,, and connect again then with T4 archaeal dna polymerase passivation end with SacI and SpeI digestion.At last, by being connected to the NotI fragment with the NotI digested vector and with the ClaI of pBluescript with ClaI, multiple clone site is incorporated into the downstream of plac promotor, has produced recombinant vectors, be called pJRP3.2.
Synthesize relevant gene with LC-PUFA, ribosome bind site (RBS) sequence that makes it comprise lateral restriction site and be applicable to expression in prokaryotic cell prokaryocyte (Synechococcus) with the PCR method transformation is various.For example, with primer 5 '-Δ 6 desaturases (embodiment 15) of AGCACATCGATGAAGGAGATATACCCatggctaatgcaatcaagaa-3 ' (SEQ IDNO:83) (justice is arranged) and 5 '-ACGATGCGGCCGCTCAACCATGAGTATTAAGAGCTT-3 ' (SEQ IDNO:84) (antisense) amplification Echium plantagineum.
The product that is increased with ClaI and NotI digestion, and with its ClaI of being cloned into pJRP3.2 in the NotI site.The selectable marker gene that comprises E.C. 2.3.1.28 coding region (CAT) (catB3 gene, accession number AAC53634) in pbsA promotor (pbsA-CAT) downstream is inserted in the XhoI site of pJRP3.2, has produced carrier pJRP3.3.The selectable marker gene has been inserted in the sulB gene, has made and after being incorporated into recombinant vectors in the Synechococcus, can screen the homologous recombination incident expediently.
Following at logarithmic phase, the DNA picked-up is taking place during, realized conversion by mixed carrier DNA and cell to Synechococcus7002.Join 900 μ L and grow in the mid-log phase cell in the BG-11 meat soup being resuspended in nearly 1g recombinant vectors DNA among the 100 μ L 10mMTris-HCl.In 30 ℃ of following incubation cells 90 minutes, adding optical density(OD) in the 2mL BG-11 meat soup then was 20 μ mol photon .m
-2.s
-1250 μ L parts, itself and 2mL fusing agar (1.5%) is mixed, and it is poured into contains on the BG-11 agarose culture plate that is useful on the 50 μ g/mL paraxin (Cm) of selecting reconstitution cell.Before can being clear that Cm resistance clone, with culture plate incubation 10 to 14 days under identical temperature/illumination condition.Then these clones are scrawled several on the fresh BG-11/Cm50 plate again.After selecting to scrawle the number wheel on the culture plate again, with liquid nutrient medium with single clone's incubation, with the culture incubation at 25 ℃.
Contain through recombinant vectors be inserted into sulB intragenic and demonstrated by the Synechococcus7002 cell of Echium Δ 6 delta 8 desaturase genes that plac promotor control expresses can be respectively from endogenous linolic acid (LA) and linolenic acid (ALA) generation GLA (18:3 as substrate, Δ 6,9,12) and SDA (18:4, Δ 6,9,12,15).
Episomal vector also can be used for Synechococcus, rather than recited above integrated/recombinant vectors.The Synechococcus species have and are applied to the natural plasmid that transforms, pAQ-EX1 for example, wherein the fragment of natural plasmid pAQ1 (accession number NC_005025) and escherichia coli plasmid merge, shuttle vectors (Ikeda et al., 2002 have been formed with intestinal bacteria and Synechococcus replication orgin; Akiyama et al., 1998b).
Only it will be understood by those skilled in the art that otherwise break away from broadly described the spirit or scope of the present invention, can be to as carrying out various variations and/or modification in the present invention as shown in the special embodiment.Therefore, in all parts, it is illustrational that present embodiment all is considered to, rather than restrictive.
Incorporate all documents discussed above into the application by reference at this.
Any discussion to file, technology, material, device, article etc. that has been included in the specification sheets of the present invention all is used to the purpose that the invention provides background by oneself.This can not be considered to admit, because its right of priority of each claim that is present in the application is before the date, and arbitrary in these contents or all just constituted the part on prior art basis or the general knowledge commonly used in field related to the present invention.
Reference
Abbadi，A.et?al.，(2001)Eur.J.Lipid.Sci.Techno1.103：106-113.
Abbadi，A.，et?al.(2004)Plant?Cell?16：2734-2748.
Abbott?et?al.，(1998)Science?282：2012-2018.
Agaba，M.et?al.，(2004)Marine?Biotechnol(NY)6：251-261.
Akiyama，H.et?al.(1998a)DNA?Res.5：327-334.
Akiyama，H.et?al.(1998b)DNARes.5：127-129.
Baumlein，H.et?al.，(1991)Mol.Gen.Genet.225：459-467.
Baumlein，H.et?al.，(1992)Plant?J.2：233-239.
Beaudoin，F.et?al.，(2000)Proc.Natl.Acad.Sci?U.S.A.97：6421-6426.
Berberich，T.et?al.，(1998)Plant?Mol.Biol.36：297-306.
Bolch，C.J.et?al.，(1999a)J.Phycology?35：339-355.
Bolch，C.J.et?al.，(1999b)J.Phycology?35：356-367.
Broun，P.et?al.，(1998)Plant?J.13：201-210.
Brown，M.R.et?al.，(1997)Aquaculture?151：315-331.
Browse，J.A.and?Slack，C.R.(1981)FEBS?Letters?131：111-114.
Chinain，M.et?al.，(1997)J.Phycology?33：36-43.
Cho，H.P.et?al.，(1999a)J.Biol.Chem.274：471-477.
Cho，H.P.et?al.，(1999b)J.Biol?Chem?274：37335-37339.
Clough，S.J.and?Bent，A.F.(1998)Plant?J.16：735-43.
Coleman，A.W.(1977)Am.J.Bot.64：361-368.
Domergue，F.et?al.，(2002)Eur.J.Biochem.269：4105-4113.
Domergue，F.et?al.，(2003a)J.Biol.Chem.278：35115-35126.
Domergue，F.et?al.，(2003b)Plant?Physiol.131：1648-1660.
Drexler，H.et?al.，(2003)J.Plant?Physiol.160：779-802.
Dunstan，G.A.et?al.，(1994)Phytochemistry?35：155-161.
Gallagher，J.C.(1980)J.Phycology?16：464-474.
Garcia-Maroto，F.et?al.，(2002)Lipids?37：417-426.
Girke，T.et?al.，(1998)Plant?J.15：39-48.
Guil-Guerrero，J.L.et?al.，(2000).Phytochemistry?53：451-456.
Haseloff，J.and?Gerlach，W.L.(1988)Nature?334：585-591.
Hastings，N.et?al.，(2001)Proc.Natl.Acad.Sci.U.S.A.98：14304-14309.
Hong，H.et?al.，(2002)Lipids?37：863-868.
Hong，H.et?al.，(2002a)Lipids?37：863-868.
Horigulchi，G.et?al.，(1998)Plant?Cell?Physiol.39：540-544.
Huang，Y.S.et?al.，(1999)Lipids?34：649-659.
Ikeda，K.et?al.(2002)World?J.Microbiol.Biotech.18：55-56.
Inagaki，K.et?al.，(2002)Biosci?Biotechnol?Biochem?66：613-621.
Jores，A.V.and?Harwood，J.L(1980)Biochem?J.190：851-854.
Kajikawa，M.et?al.，(2004)Plant?Mol?Biol?54：335-52.
Knutzon，D.S.et?al.，(1998)J.Biol?Chem.273：29360-6.
Lee，M.et?al.，(1998)Science?280：915-918.
Leonard，A.E.et?al.，(2000)Biochem.J.347：719-724.
Leonard，A.E.et?al.，(2000b)Biochem.J.350：765-770.
Leonard，A.E.et?al.，(2002)Lipids?37：733-740.
Lo，J.et?al.，(2003)Genome?Res.13：455-466.
Mansour，M.P.et?al.，(1999a)J.Phycol.35：710-720.
Medlin，L.K.et?al.，(1996)J.Marine?Systems?9：13-31.
Metz，J.G.et?al.，(2001)Science?293：290-293.
Meyer，A.et?al.，(2003)Biochemistry?42：9779-9788.
Meyer，A.et?al.，(2004)Lipid?Res?45：1899-1909.
Michaelson，L.V.et?al.，(1998a)J.Biol.Chem.273：19055-19059.
Michaelson，L.V.et?al.，(1998b)FEBS?Lett.439：215-218.
Mitchell，A.G.and?Martin，C.E.(1995)J.Biol.Chem.270：29766-29772.
Morita，N.et?al.，(2000)Biochem.Soc.Trans.28：872-879.
Napier，J.A.et?al.，(1998)Biochem?J.330：611-614.
Napier，J.A.et?al.，(1999)Trends?in?Plant?Sci?4：2-4.
Napier，J.A.et?al.，(1999)Curr.Op.Plant?Biol.2：123-127.
Needleman，S.B.and?Wunsch，C.D.(1970)J.Mol.Biol.48：443-453.
Parker-Bames，J.F.et?al.，(2000)Proc?Natl?Acad?Sci?USA97：8284-8289.
Pereira，S.L.et?al.，(2004)Biochem.J.378：665-671.
Perriman，R.et?al.，(1992)Gene?113：157-163.
Qi，B.et?al.，(2002)FEBS?Lett.510：159-165.
Qiu，X.et?al.，(2001)J.Biol.Chem.276：31561-31566.
Reddy，A.S.et?al.，(1993)Plant?Mol.Biol.22：293-300.
Saito，T.et?al.，(2000)Eur.J.Biochem.267：1813-1818.
Sakuradani，E.et?al.，(1999)Gene?238：445-453.
Sayanova，O.V.et?al.，(1997)Proc.Natl.Acad.Sci.U.S.A.94：4211-4216.
Sayanova，O.V.et?al.，(1999)Plant?Physiol.121：641-646.
Sayanova，O.V.et?al.，(2003)FEBS?Lett.542：100-104.
Sayanova，O.V.and?Napier，J.A.(2004)Phytochemistry?65：147-158.
Shippy，R.et?al.，(1999)Mol.Biotech.12：117-129.
Simopoulos，A.P.(2000)Poultry?Science?79：961-970.
Singh，S.et?al.，(2001)Planta?212：872-879.
Smith，N.A.et?al.，(2000)Nature?407：319-320.
Sperling，P.et?al.，(2000)Eur.J.Biochem.267：3801-3811.
Sperling，P.and?Heinz，E.(2001)Eur.J.Lipid?Sci.Technol?103：158-180.
Sprecher，H.et?al.，(1995)J.Lipid?Res.36：2471-2477.
Spychalla，P.J.et?al.，(1997)Proc.Natl.Acad.Sci.U.S.A.94：1142-1147.
Stalberg，K.et?al.，(1993)Plant.Mol.Biol.23：671-683.
Takeyama，H.et?al.，(1997)Microbiology?143：2725-2731.
Tanaka，M.et?al.，(1999)Biotechnol.Lett.2：939-945.
Tonon，T.et?al.，(2003)FEBS?Lett.553：440-444.
Trautwein，E.A.(2001)Eur.J.Lipid?Sci.Technol.103：45-55.
Tvrdik，P.(2000)J.Cell?Biol.149：707-718.
Valvekens，D.et?al.，(1988)ProG.Natl.Acad.Sci.USA.85：5536-5540.
Volkman，J.K.et?al.，(1989)J.Exp.Mar.Biol.Ecol.128：219-240.
Wallis，J.G.and?Browse，J.(1999)Arch.Biochem.Biophys.365：307-316.
Wang，M.B.et?al.，(1997)J.Gen.Breed.51：325-334.
Waterbury，J.B.et?al.(1988)Methods?Enzymol.167：100-105.
Waterhouse，P.M.et?al.，(1998)Proc.Natl.Acad.Sci.USA?95：13959-13964.
Watts，J.L.and?Browse，J.(1999b)Arch?Biochem?Biophys?362：175-182.
Williams，J.G.and?Szalay，A.A.(1983)Gene?24：37-51.
Whitney，H.M.et?al.，(2003).Planta?217：983-992.
Yazawa，K.(1996)Lipids?31：S297-S300.
Yu，R.et?al.，(2000)Lipids?35：1061-1064.
Zank，T.K.et?al.，(2000)Plant?J.31：255-268.
Zank，T.K.et?al.，(2002)Plant?J.31：255-268.
Zhang，Q.et?al.，(2004)FEBS?Lett.556：81-85.
Zhou，X.R.and?Christie，P.J.(1997)J?Bacteriol?179：5835-5842.
Sequence table
＜110〉Federal Scientific and Technological Research Organization
＜120〉use the reconstitution cell synthesis of long-chain polyunsaturated fatty acids
<130>503364
<160>89
<170>PatentIn?version?3.3
<210>1
<211>427
<212>PRT
<213>Pavlova?salina
<400>1
Met?Gly?Arg?Gly?Gly?Asp?Ser?Ser?Gly?Gln?Ala?His?Pro?Ala?Ala?Glu
1 5 10 15
Leu?Ala?Val?Pro?Ser?Asp?Arg?Ala?Glu?Val?Ser?Asn?Ala?Asp?Ser?Lys
20 25 30
Ala?Leu?His?Ile?Val?Leu?Tyr?Gly?Lys?Arg?Val?Asp?Val?Thr?Lys?Phe
35 40 45
Gln?Arg?Thr?His?Pro?Gly?Gly?Ser?Lys?Val?Phe?Arg?Ile?Phe?Gln?Asp
50 55 60
Arg?Asp?Ala?Thr?Glu?Gln?Phe?Glu?Ser?Tyr?His?Ser?Lys?Arg?Ala?Ile
65 70 75 80
Lys?Met?Met?Glu?Gly?Met?Leu?Lys?Lys?Ser?Glu?Asp?Ala?Pro?Ala?Asp
85 90 95
Thr?Pro?Leu?Pro?Ser?Gln?Ser?Pro?Met?Gly?Lys?Asp?Phe?Lys?Ala?Met
100 105 110
Ile?Glu?Arg?His?Val?Ala?Ala?Gly?Tyr?Tyr?Asp?Pro?Cys?Pro?Leu?Asp
115 120 125
Glu?Leu?Phe?Lys?Leu?Ser?Leu?Val?Leu?Leu?Pro?Thr?Phe?Ala?Gly?Met
130 135 140
Tyr?Met?Leu?Lys?Ala?Gly?Val?Gly?Ser?Pro?Leu?Cys?Gly?Ala?Leu?Met
145 150 155 160
Val?Ser?Phe?Gly?Trp?Tyr?Leu?Asp?Gly?Trp?Leu?Ala?His?Asp?Tyr?Leu
165 170 175
His?His?Ser?Val?Phe?Lys?Gly?Ser?Val?Ala?Arg?Thr?Val?Gly?Trp?Asn
180 185 190
Asn?Ala?Ala?Gly?Tyr?Phe?Leu?Gly?Phe?Val?Gln?Gly?Tyr?Ala?Val?Glu
195 200 205
Trp?Trp?Arg?Ala?Arg?His?Asn?Thr?His?His?Val?Cys?Thr?Asn?Glu?Asp
210 215 220
Gly?Ser?Asp?Pro?Asp?Ile?Lys?Thr?Ala?Pro?Leu?Leu?Ile?Tyr?Val?Arg
225 230 235 240
Asn?Lys?Pro?Ser?Ile?Ala?Lys?Arg?Leu?Asn?Ala?Phe?Gln?Arg?Tyr?Gln
245 250 255
Gln?Tyr?Tyr?Tyr?Val?Pro?Val?Met?Ala?Ile?Leu?Asp?Leu?Tyr?Trp?Arg
260 265 270
Leu?Glu?Ser?Ile?Ala?Tyr?Val?Ala?Met?Arg?Leu?Pro?Lys?Met?Leu?Pro
275 280 285
Gln?Ala?Leu?Ala?Leu?Val?Ala?His?Tyr?Ala?Ile?Val?Ala?Trp?Val?Phe
290 295 300
Ala?Gly?Asn?Tyr?His?Leu?Leu?Pro?Leu?Val?Thr?Val?Leu?Arg?Gly?Phe
305 310 315 320
Gly?Thr?Gly?Ile?Thr?Val?Phe?Ala?Thr?His?Tyr?Gly?Glu?Asp?Ile?Leu
325 330 335
Asp?Ala?Asp?Gln?Val?Arg?His?Met?Thr?Leu?Val?Glu?Gln?Thr?Ala?Leu
340 345 350
Thr?Ser?Arg?Asn?Ile?Ser?Gly?Gly?Trp?Leu?Val?Asn?Val?Leu?Thr?Gly
355 360 365
Phe?Ile?Ser?Leu?Gln?Thr?Glu?His?His?Leu?Phe?Pro?Met?Met?Pro?Thr
370 375 380
Gly?Asn?Leu?Met?Thr?Ile?Gln?Pro?Glu?Val?Arg?Ala?Phe?Phe?Lys?Lys
385 390 395 400
His?Gly?Leu?Glu?Tyr?Arg?Glu?Gly?Asn?Leu?Ile?Glu?Cys?Val?Arg?Gln
405 410 415
Asn?Ile?Arg?Ala?Leu?Ala?Phe?Glu?His?Leu?Leu
420 425
<210>2
<211>302
<212>PRT
<213>Pavlova?salina
<400>2
Met?Lys?Ala?Ala?Ala?Gly?Lys?Val?Gln?Gln?Glu?Ala?Glu?Arg?Leu?Thr
1 5 10 15
Ala?Gly?Leu?Trp?Leu?Pro?Met?Met?Leu?Ala?Ala?Gly?Tyr?Leu?Leu?Val
20 25 30
Leu?Ser?Ala?Asn?Arg?Ala?Ser?Phe?Tyr?Glu?Asn?Ile?Asn?Asn?Glu?Lys
35 40 45
Gly?Ala?Tyr?Ser?Thr?Ser?Trp?Phe?Ser?Leu?Pro?Cys?Val?Met?Thr?Ala
50 55 60
Val?Tyr?Leu?Gly?Gly?Val?Phe?Gly?Leu?Thr?Lys?Tyr?Phe?Glu?Gly?Arg
65 70 75 80
Lys?Pro?Met?Gln?Gly?Leu?Lys?Asp?Tyr?Met?Phe?Thr?Tyr?Asn?Leu?Tyr
85 90 95
Gln?Val?Ile?Ile?Asn?Val?Trp?Cys?Ile?Ala?Ala?Phe?Val?Val?Glu?Val
100 105 110
Arg?Arg?Ala?Gly?Met?Ser?Ala?Val?Gly?Asn?Lys?Val?Asp?Leu?Gly?Pro
115 120 125
Asn?Ser?Phe?Arg?Leu?Gly?Phe?Val?Thr?Trp?Val?His?Tyr?Asn?Asn?Lys
130 135 140
Tyr?Val?Glu?Leu?Leu?Asp?Thr?Leu?Trp?Met?Val?Leu?Arg?Lys?Lys?Thr
145 150 155 160
Gln?Gln?Val?Ser?Phe?Leu?His?Val?Tyr?His?His?Val?Leu?Leu?Ile?Trp
165 170 175
Ala?Trp?Phe?Cys?Val?Val?Lys?Phe?Cys?Asn?Gly?Gly?Asp?Ala?Tyr?Phe
180 185 190
Gly?Gly?Met?Leu?Asn?Ser?Ile?Ile?His?Val?Met?Met?Tyr?Ser?Tyr?Tyr
195 200 205
Thr?Met?Ala?Leu?Leu?Gly?Trp?Ser?Cys?Pro?Trp?Lys?Arg?Tyr?Leu?Thr
210 215 220
Gln?Ala?Gln?Leu?Val?Gln?Phe?Cys?Ile?Cys?Leu?Ala?His?Ala?Thr?Trp
225 230 235 240
Ala?Ala?Ala?Thr?Gly?Val?Tyr?Pro?Phe?His?Ile?Cys?Leu?Val?Glu?Ile
245 250 255
Trp?Val?Met?Val?Ser?Met?Leu?Tyr?Leu?Phe?Thr?Lys?Phe?Tyr?Asn?Ser
260 265 270
Ala?Tyr?Lys?Gly?Ala?Ala?Lys?Gly?Ala?Ala?Ala?Ser?Ser?Asn?Gly?Ala
275 280 285
Ala?Ala?Pro?Ser?Gly?Ala?Lys?Pro?Lys?Ser?Ile?Lys?Ala?Asn
290 295 300
<210>3
<211>304
<212>PRT
<213>Pavlova?salina
<400>3
Met?Gly?Pro?Leu?Ser?Thr?Leu?Leu?Ala?Trp?Met?Pro?Thr?Trp?Gly?Glu
1 5 10 15
Phe?Val?Ala?Gly?Leu?Thr?Tyr?Val?Glu?Arg?Gln?Gln?Met?Ser?Glu?Glu
20 25 30
Leu?Val?Arg?Ala?Asn?Lys?Leu?Pro?Leu?Ser?Leu?Ile?Pro?Glu?Val?Asp
35 40 45
Phe?Phe?Thr?Ile?Ala?Ser?Val?Tyr?Val?Gly?Asp?His?Trp?Arg?Ile?Pro
50 55 60
Phe?Thr?Ala?Ile?Ser?Ala?Tyr?Leu?Val?Leu?Ile?Thr?Leu?Gly?Pro?Gln
65 70 75 80
Leu?Met?Ala?Arg?Arg?Pro?Pro?Leu?Pro?Ile?Asn?Thr?Leu?Ala?Cys?Leu
85 90 95
Trp?Asn?Phe?Ala?Leu?Ser?Leu?Phe?Ser?Phe?Val?Gly?Met?Ile?Val?Thr
100 105 110
Trp?Thr?Thr?Ile?Gly?Glu?Arg?Leu?Trp?Lys?Asn?Gly?Ile?Glu?Asp?Thr
115 120 125
Val?Cys?Gly?His?Pro?Ile?Phe?Met?Gly?Tyr?Gly?Trp?Ile?Gly?Tyr?Val
130 135 140
Met?Leu?Ala?Phe?Ile?Trp?Ser?Lys?Leu?Phe?Glu?Leu?Ile?Asp?Thr?Val
145 150 155 160
Phe?Leu?Val?Ala?Lys?Lys?Ala?Asp?Val?Ile?Phe?Leu?His?Trp?Tyr?His
165 170 175
His?Val?Thr?Val?Leu?Leu?Tyr?Cys?Trp?His?Ser?Tyr?Ala?Val?Arg?Ile
180 185 190
Pro?Ser?Gly?Ile?Trp?Phe?Ala?Ala?Met?Asn?Tyr?Phe?Val?His?Ala?Ile
195 200 205
Met?Tyr?Ala?Tyr?Phe?Gly?Met?Thr?Gln?Ile?Gly?Pro?Arg?Gln?Arg?Lys
210 215 220
Leu?Val?Arg?Pro?Tyr?Ala?Arg?Leu?Ile?Thr?Thr?Phe?Gln?Leu?Ser?Gln
225 230 235 240
Met?Gly?Val?Gly?Leu?Ala?Val?Asn?Gly?Leu?Ile?Ile?Arg?Tyr?Pro?Ser
245 250 255
Ile?Gly?His?His?Cys?His?Ser?Asn?Lys?Thr?Asn?Thr?Ile?Leu?Ser?Trp
260 265 270
Ile?Met?Tyr?Ala?Ser?Tyr?Phe?Val?Leu?Phe?Ala?Ala?Leu?Tyr?Val?Lys
275 280 285
Asn?Tyr?Ile?Phe?Ser?Lys?Leu?Lys?Ser?Pro?Lys?Arg?Lys?Lys?Val?Glu
290 295 300
<210>4
<211>447
<212>PRT
<213>Pavlova?salina
<400>4
Met?Pro?Pro?Ser?Ala?Ala?Lys?Gln?Met?Gly?Ala?Ser?Thr?Gly?Val?His
1 5 10 15
Ala?Gly?Val?Thr?Asp?Ser?Ser?Ala?Phe?Thr?Arg?Lys?Asp?Val?Ala?Asp
20 25 30
Arg?Pro?Asp?Leu?Thr?Ile?Val?Gly?Asp?Ser?Val?Tyr?Asp?Ala?Lys?Ala
35 40 45
Phe?Arg?Ser?Glu?His?Pro?Gly?Gly?Ala?His?Phe?Val?Ser?Leu?Phe?Gly
50 55 60
Gly?Arg?Asp?Ala?Thr?Glu?Ala?Phe?Met?Glu?Tyr?His?Arg?Arg?Ala?Trp
65 70 75 80
Pro?Lys?Ser?Arg?Met?Ser?Arg?Phe?His?Val?Gly?Ser?Leu?Ala?Ser?Thr
85 90 95
Glu?Glu?Pro?Val?Ala?Ala?Asp?Glu?Gly?Tyr?Leu?Gln?Leu?Cys?Ala?Arg
100 105 110
Ile?Ala?Lys?Met?Val?Pro?Ser?Val?Ser?Ser?Gly?Phe?Ala?Pro?Ala?Ser
115 120 125
Tyr?Trp?Val?Lys?Ala?Gly?Leu?Ile?Leu?Gly?Ser?Ala?Ile?Ala?Leu?Glu
130 135 140
Ala?Tyr?Met?Leu?Tyr?Ala?Gly?Lys?Arg?Leu?Leu?Pro?Ser?Ile?Val?Leu
145 150 155 160
Gly?Trp?Leu?Phe?Ala?Leu?Ile?Gly?Leu?Asn?Ile?Gln?His?Asp?Ala?Asn
165 170 175
His?Gly?Ala?Leu?Ser?Lys?Ser?Ala?Ser?Val?Asn?Leu?Ala?Leu?Gly?Leu
180 185 190
Cys?Gln?Asp?Trp?Ile?Gly?Gly?Ser?Met?Ile?Leu?Trp?Leu?Gln?Glu?His
195 200 205
Val?Val?Met?His?His?Leu?His?Thr?Asn?Asp?Val?Asp?Lys?Asp?Pro?Asp
210 215 220
Gln?Lys?Ala?His?Gly?Ala?Leu?Arg?Leu?Lys?Pro?Thr?Asp?Ala?Trp?Ser
225 230 235 240
Pro?Met?His?Trp?Leu?Gln?His?Leu?Tyr?Leu?Leu?Pro?Gly?Glu?Thr?Met
245 250 255
Tyr?Ala?Phe?Lys?Leu?Leu?Phe?Leu?Asp?Ile?Ser?Glu?Leu?Val?Met?Trp
260 265 270
Arg?Trp?Glu?Gly?Glu?Pro?Ile?Ser?Lys?Leu?Ala?Gly?Tyr?Leu?Phe?Met
275 280 285
Pro?Ser?Leu?Leu?Leu?Lys?Leu?Thr?Phe?Trp?Ala?Arg?Phe?Val?Ala?Leu
290 295 300
Pro?Leu?Tyr?Leu?Ala?Pro?Ser?Val?His?Thr?Ala?Val?Cys?Ile?Ala?Ala
305 310 315 320
Thr?Val?Met?Thr?Gly?Ser?Phe?Tyr?Leu?Ala?Phe?Phe?Phe?Phe?Ile?Ser
325 330 335
His?Asn?Phe?Glu?Gly?Val?Ala?Ser?Val?Gly?Pro?Asp?Gly?Ser?Ile?Thr
340 345 350
Ser?Met?Thr?Arg?Gly?Ala?Ser?Phe?Leu?Lys?Arg?Gln?Ala?Glu?Thr?Ser
355 360 365
Ser?Asn?Val?Gly?Gly?Pro?Leu?Leu?Ala?Thr?Leu?Asn?Gly?Gly?Leu?Asn
370 375 380
Tyr?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Arg?Val?His?His?Gly?Phe?Tyr
385 390 395 400
Pro?Arg?Leu?Ala?Pro?Leu?Val?Lys?Ala?Glu?Leu?Glu?Ala?Arg?Gly?Ile
405 410 415
Glu?Tyr?Lys?His?Tyr?Pro?Thr?Ile?Trp?Ser?Asn?Leu?Ala?Ser?Thr?Leu
420 425 430
Arg?His?Met?Tyr?Ala?Leu?Gly?Arg?Arg?Pro?Arg?Ser?Lys?Ala?Glu
435 440 445
<210>5
<211>1235
<212>DNA
<213>Pavlova?salina
<400>5
atgggacgcg?gcggagacag?cagtgggcag?gcgcatccgg?cggcggagct?ggcggtcccg 60
agcgaccgcg?cggaggtgag?caacgctgac?agcaaagcgc?tgcacatcgt?gctgtatggc 120
aagcgcgtgg?atgtgaccaa?gttccaacgc?acgcacccgg?gtggtagcaa?ggtcttccgg 180
atcttccagg?accgcgatgc?gacggagcag?ttcgagtcct?accactcgaa?gcgcgcgatc 240
aagatgatgg?agggcatgct?caagaagtct?gaggatgctc?ccgccgacac?gcccttgccc 300
tcccagtcac?cgatggggaa?ggacttcaag?gcgatgatcg?agcggcacgt?tgcagcgggt 360
tactacgatc?catgcccgct?cgatgagctg?ttcaagctca?gcctcgtgct?cctcccgacc 420
tttgcgggca?tgtacatgct?caaggcgggc?gtcggctccc?cgctctgcgg?cgccctcatg 480
gtgagctttg?gctggtacct?cgatggctgg?ctcgcgcacg?actatctgca?ccactccgtc 540
ttcaaggggt?ccgtcgcacg?caccgtcggg?tggaacaacg?cggcgggcta?cttcctcggc 600
ttcgtgcagg?ggtatgcggt?cgagtggtgg?cgcgcgcggc?ataacacgca?ccacgtgtgc 660
accaatgagg?acggctcgga?ccccgacatc?aaaacggcgc?cgctgctcat?atacgtgcgc 720
aacaagccga?gcatcgccaa?gcgcctgaac?gccttccagc?gctaccagca?gtactactat 780
gtgccggtga?tggcaatcct?cgacctgtac?tggcggctcg?agtcgatcgc?ctacgtcgcg 840
atgcgcctgc?cgaagatgct?gccgcaggcc?ctcgcactcg?tcgcgcacta?cgccatcgtc 900
gcgtgggtct?ttgcgggcaa?ctaccacctg?ctcccgctcg?tgacggttct?gcgcgggttt 960
ggcactggga?tcaccgtttt?cgcgacgcac?tacggtgagg?acattctcga?cgcggaccag 1020
gtgcgtcaca?tgacgctcgt?cgagcagacg?gcactcacct?cgcgcaacat?ctcgggcggc 1080
tggctcgtga?acgtgctcac?cggcttcatc?tcactgcaga?cggagcacca?cctgttcccg 1140
atgatgccaa?ccggcaacct?catgactatc?cagcccgagg?tgcgcgcctt?cttcaagaag 1200
cacggacttg?agtaccgcga?gggcaacctc?attga 1235
<210>6
<2l1>1700
<212>DNA
<213>Pavlova?salina
<400>6
ggcacgaggc?agctggccgc?cgtcgagaga?acgccagggg?ggtcatggga?cgcggcggag 60
acagcagtgg?gcaggcgcat?ccggcggcgg?agctggcggt?cccgagcgac?cgcgcggagg 120
tgagcaacgc?tgacagcaaa?gcgctgcaca?tcgtgctgta?tggcaagcgc?gtggatgtga 180
ccaagttcca?acgcacgcac?ccgggtggta?gcaaggtctt?ccggatcttc?caggaccgcg 240
atgcgacgga?gcagttcgag?tcctaccact?cgaagcgcgc?gatcaagatg?atggagggca 300
tgctcaagaa?gtctgaggat?gctcccgccg?acacgccctt?gccctcccag?tcaccgatgg 360
ggaaggactt?caaggcgatg?atcgagcggc?acgttgcagc?gggttactac?gatccatgcc 420
cgctcgatga?gctgttcaag?ctcagcctcg?tgctcctccc?gacctttgcg?ggcatgtaca 480
tgctcaaggc?gggcgtcggc?tccccgctct?gcggcgccct?catggtgagc?tttggctggt 540
acctcgatgg?ctggctcgcg?cacgactatc?tgcaccactc?cgtcttcaag?gggtccgtcg 600
cacgcaccgt?cgggtggaac?aacgcggcgg?gctacttcct?cggcttcgtg?caggggtatg 660
cggtcgagtg?gtggcgcgcg?cggcataaca?cgcaccacgt?gtgcaccaat?gaggacggct 720
cggaccccga?catcaaaacg?gcgccgctgc?tcatatacgt?gcgcaacaag?ccgagcatcg 780
ccaagcgcct?gaacgccttc?cagcgctacc?agcagtacta?ctatgtgccg?gtgatggcaa 840
tcctcgacct?gtactggcgg?ctcgagtcga?tcgcctacgt?cgcgatgcgc?ctgccgaaga 900
tgctgccgca?ggccctcgca?ctcgtcgcgc?actacgccat?cgtcgcgtgg?gtctttgcgg 960
gcaactacca?cctgctcccg?ctcgtgacgg?ttctgcgcgg?gtttggcact?gggatcaccg 1020
ttttcgcgac?gcactacggt?gaggacattc?tcgacgcgga?ccaggtgcgt?cacatgacgc 1080
tcgtcgagca?gacggcactc?acctcgcgca?acatctcggg?cggctggctc?gtgaacgtgc 1140
tcaccggctt?catctcactg?cagacggagc?accacctgtt?cccgatgatg?ccaaccggca 1200
acctcatgac?tatccagccc?gaggtgcgcg?ccttcttcaa?gaagcacgga?cttgagtacc 1260
gcgagggcaa?cctcattgag?tgcgtgcggc?agaacatccg?tgcgcttgca?ttcgagcacc 1320
tgctttgagc?gctctccgct?tccaagggcg?ggatcggcgc?atccgttggt?gctgcggcac 1380
caacgcttcc?gctctcgagc?gcagatgttg?gttgcatcac?gcatcacacc?cacccccagc 1440
cggatcaccc?agctcccgat?gcttggcgta?cctagccgcg?tcctcccagc?atgcactgca 1500
actcattcac?cacctgctac?agtttcggcc?taatccatgg?cccgactgct?tgccgccttg 1560
cacaccgacg?agtacgccga?ctcggtccaa?tgcctcggcg?taatctgctg?gcgtgctgcg 1620
gcactgtgat?tcattcattg?atcgcacagt?tcacagcatg?ttcgctgaca?caacgtttgc 1680
tgacctcata?gacagtagaa 1700
<210>7
<211>909
<212>DNA
<213>Pavlova?salina
<400>7
atgaaagctg?cggcaggcaa?ggtgcagcag?gaggcggagc?gcctcacggc?gggcctctgg 60
ctgccgatga?tgcttgcggc?cggttatctg?ctggttctct?ctgcaaaccg?cgcgagcttc 120
tacgagaaca?tcaacaacga?gaagggcgcc?tactcgacgt?cgtggttctc?gctgccgtgc 180
gtcatgacgg?ctgtgtacct?gggcggtgtg?tttggcttga?ccaagtactt?tgagggtcgc 240
aagccgatgc?agggcctgaa?ggattacatg?tttacgtaca?acctgtacca?ggtgatcatc 300
aacgtgtggt?gcatcgcggc?tttcgtcgtg?gaggtgaggc?gcgcgggcat?gagcgcggtg 360
ggcaacaagg?tcgacctcgg?ccccaactcc?ttcaggctcg?gctttgtgac?gtgggtgcac 420
tacaacaaca?agtacgtcga?gctgctcgac?acgctgtgga?tggtgctgcg?caagaagacg 480
cagcaggtct?ccttcctgca?cgtgtaccac?cacgtgctgc?tcatctgggc?gtggttctgc 540
gtagtcaaat?tctgcaacgg?cggcgacgcc?tactttggcg?gcatgctcaa?ctcgatcatc 600
cacgtgatga?tgtactcgta?ctacacgatg?gcgctgctcg?gctggagttg?tccatggaag 660
cgatacctca?ctcaggcgca?gctcgtgcag?ttctgcattt?gcctcgcgca?cgcgacgtgg 720
gcggccgcga?cgggcgtgta?ccccttccac?atttgcctcg?tcgagatctg?ggtgatggtg 780
tcgatgctgt?acctgttcac?caagttctac?aactctgcgt?acaagggcgc?agcaaagggc 840
gcagcagcga?gcagcaacgg?tgcggcggcg?ccgagcggag?ccaagcctaa?gagcatcaag 900
gccaactga 909
<210>8
<211>1216
<212>DNA
<213>Pavlova?salina
<400>8
gaattcggca?cgaggtcttc?ttccagctgt?ggtcgtcatg?aaagctgcgg?caggcaaggt 60
gcagcaggag?gcggagcgcc?tcacggcggg?cctctggctg?ccgatgatgc?ttgcggccgg 120
ttatctgctg?gttctctctg?caaaccgcgc?gagcttctac?gagaacatca?acaacgagaa 180
gggcgcctac?tcgacgtcgt?ggttctcgct?gccgtgcgtc?atgacggctg?tgtacctggg 240
cggtgtgttt?ggcttgacca?agtactttga?gggtcgcaag?ccgatgcagg?gcctgaagga 300
ttacatgttt?acgtacaacc?tgtaccaggt?gatcatcaac?gtgtggtgca?tcgcggcttt 360
cgtcgtggag?gtgaggcgcg?cgggcatgag?cgcggtgggc?aacaaggtcg?acctcggccc 420
caactccttc?aggctcggct?ttgtgacgtg?ggtgcactac?aacaacaagt?acgtcgagct 480
gctcgacacg?ctgtggatgg?tgctgcgcaa?gaagacgcag?caggtctcct?tcctgcacgt 540
gtaccaccac?gtgctgctca?tctgggcgtg?gttctgcgta?gtcaaattct?gcaacggcgg 600
cgacgcctac?tttggcggca?tgctcaactc?gatcatccac?gtgatgatgt?actcgtacta 660
cacgatggcg?ctgctcggct?ggagttgtcc?atggaagcga?tacctcactc?aggcgcagct 720
cgtgcagttc?tgcatttgcc?tcgcgcacgc?gacgtgggcg?gccgcgacgg?gcgtgtaccc 780
cttccacatt?tgcctcgtcg?agatctgggt?gatggtgtcg?atgctgtacc?tgttcaccaa 840
gttctacaac?tctgcgtaca?agggcgcagc?aaagggcgca?gcagcgagca?gcaacggtgc 900
ggcggcgccg?agcggagcca?agcctaagag?catcaaggcc?aactgaggcc?tggcacgcgg 960
gcgaggccgc?ggcacgccgc?gcagttccgg?tcggcgcaac?gtcgcggctg?cgccgcgcta 1020
cgcaccacgc?aggcagtggt?tcaggtggcg?aagtgtgcag?cctgtctgtc?gcctgcacac 1080
ccattgattg?gtcccgctcg?cgctactctg?cgcactgcca?agtcgccaag?acctgtacgt 1140
gtatgatctg?actgataccg?catacggatg?tcccgtatgc?gacgactgcc?atacgtgctg 1200
cacacgttgt?ccaacc 1216
<210>9
<211>915
<212>DNA
<213>Pavlova?salina
<400>9
atggggccgt?tgagcacgct?gctagcgtgg?atgcccacct?ggggcgagtt?tgtcgccggg 60
ctgacctatg?tcgagcgcca?gcagatgtca?gaggagctcg?tgcgcgcaaa?taagctcccg 120
ctgtcgctca?tcccggaggt?ggacttcttc?acgatcgcgt?cagtctacgt?gggcgaccat 180
tggcggatcc?cattcacggc?catctcggct?tatctggtct?tgatcacgct?cgggccgcag 240
ctcatggcca?ggcggccgcc?attgccaatc?aacaccttgg?cgtgcctctg?gaatttcgcg 300
ctgtcgctct?ttagttttgt?cggcatgatt?gttacgtgga?cgaccatcgg?cgagcgcctg 360
tggaaaaatg?gtatcgagga?cacagtgtgc?ggccatccga?tattcatggg?gtacggctgg 420
atcggatatg?ttatgcttgc?cttcatctgg?tcgaagctct?tcgagctgat?cgacaccgta 480
ttcctcgtcg?cgaagaaggc?cgacgtcatc?ttcctgcact?ggtaccacca?cgtgacggtg 540
ctgctatact?gctggcattc?gtacgctgtt?cgtatcccgt?ccggcatctg?gtttgccgcg 600
atgaattatt?tcgtacacgc?catcatgtac?gcctactttg?gcatgacaca?gattgggccg 660
aggcagcgca?agctcgtgcg?accgtacgca?cggctcatca?ccacgttcca?gctgtcgcag 720
atgggcgtcg?gtctggccgt?caatggcctt?atcatccgct?acccgtcgat?aggccatcat 780
tgccactcga?acaagacgaa?caccattttg?agctggatca?tgtacgcgag?ctactttgtg 840
cttttcgccg?cactatacgt?gaagaactac?atcttctcca?agctgaagtc?gcccaagagg 900
aagaaggtgg?aatga 915
<210>10
<211>1219
<212>DNA
<213>Pavlova?salina
<400>10
gaattcggca?cgaggtgcag?ccttgagcct?tacgcaggcc?gactcgcccg?tggctagcac 60
gcagcgcgcc?caaccccatg?gggccgttga?gcacgctgct?agcgtggatg?cccacctggg 120
gcgagtttgt?cgccgggctg?acctatgtcg?agcgccagca?gatgtcagag?gagctcgtgc 180
gcgcaaataa?gctcccgctg?tcgctcatcc?cggaggtgga?cttcttcacg?atcgcgtcag 240
tctacgtggg?cgaccattgg?cggatcccat?tcacggccat?ctcggcttat?ctggtcttga 300
tcacgctcgg?gccgcagctc?atggccaggc?ggccgccatt?gccaatcaac?accttggcgt 360
gcctctggaa?tttcgcgctg?tcgctcttta?gttttgtcgg?catgattgtt?acgtggacga 420
ccatcggcga?gcgcctgtgg?aaaaatggta?tcgaggacac?agtgtgcggc?catccgatat 480
tcatggggta?cggctggatc?ggatatgtta?tgcttgcctt?catctggtcg?aagctcttcg 540
agctgatcga?caccgtattc?ctcgtcgcga?agaaggccga?cgtcatcttc?ctgcactggt 600
accaccacgt?gacggtgctg?ctatactgct?ggcattcgta?cgctgttcgt?atcccgtccg 660
gcatctggtt?tgccgcgatg?aattatttcg?tacacgccat?catgtacgcc?tactttggca 720
tgacacagat?tgggccgagg?cagcgcaagc?tcgtgcgacc?gtacgcacgg?ctcatcacca 780
cgttccagct?gtcgcagatg?ggcgtcggtc?tggccgtcaa?tggccttatc?atccgctacc 840
cgtcgatagg?ccatcattgc?cactcgaaca?agacgaacac?cattttgagc?tggatcatgt 900
acgcgagcta?ctttgtgctt?ttcgccgcac?tatacgtgaa?gaactacatc?ttctccaagc 960
tgaagtcgcc?caagaggaag?aaggtggaat?gattgactcg?agctcgtgtt?tccgccatct 1020
gtcattttac?ggctcctcct?gatgcggacg?gcagctctga?tctttgccac?aggaccgatg 1080
acggccgatg?gtgtctggtt?ccagctggct?ctgtcattcg?cggctcatgg?gcacccgggt 1140
gggagcacca?gctgtcagac?cggactcgat?gagatagcgg?tgacagacgg?accgtgacca 1200
cgagtctcat?catctgttg 1219
<210>11
<211>125
<212>DNA
<213>Pavlova?salina
<400>11
agcacgacgg?gaaccacggc?gcgctctcca?agtcggcctc?ggtcaacctg?gcgctcgggt 60
tgtgccagca?ctggatcggc?gggagcatga?tcctctggct?gcaggagcac?gtgatgatgc 120
accac 125
<210>12
<211>1344
<212>DNA
<213>Pavlova?salina
<400>12
atgcctccga?gcgcggcgaa?gcagatgggc?gcgagcacgg?gcgtgcatgc?gggcgtcaca 60
gattcgtcgg?ccttcacgcg?caaggatgtc?gccgacaggc?cggacctcac?gatcgtgggt 120
gacagcgtgt?acgatgcgaa?ggcgttccgc?tccgagcatc?cgggtggcgc?gcactttgtg 180
tcgctgttcg?gcgggcgcga?tgccacggag?gcgttcatgg?agtaccaccg?gcgcgcctgg 240
cccaagtcgc?gcatgtcgcg?cttccacgtc?ggctctctgg?catcgaccga?ggagcccgtc 300
gccgccgatg?agggctacct?ccagctgtgc?gctcgcatcg?ccaagatggt?gccgtcggtc 360
agcagcgggt?tcgcgccggc?gtcgtactgg?gtgaaggccg?ggctgatcct?cggctccgcg 420
atcgcgctcg?aggcgtacat?gctgtacgcg?ggcaagcgcc?tgctcccgtc?gatcgtgctc 480
gggtggctgt?ttgcgctgat?tggcctgaac?atccagcacg?atgccaacca?cggcgcgctc 540
tccaagtcgg?cctcggtcaa?cctggcgctc?gggttgtgcc?aggactggat?cggcgggagc 600
atgatcctct?ggctgcagga?gcacgttgtc?atgcaccact?tgcacaccaa?cgacgttgac 660
aaggacccgg?accagaaggc?gcacggcgcc?ctgcggctca?agccgaccga?cgcgtggagc 720
ccgatgcact?ggctgcagca?cctctacctg?ctgcctgggg?agacgatgta?cgccttcaag 780
ctgctgtttc?tcgacatcag?cgagctggtg?atgtggcggt?gggagggcga?gcccatcagc 840
aagctggccg?ggtacctctt?catgccctcg?ctgctcctca?agctcacctt?ctgggcgcgc 900
tttgtcgcgc?tgccgctgta?cctcgcgccc?agcgtgcaca?cggcggtgtg?catcgcggcg 960
acggtaatga?cggggagctt?ctacctcgcc?ttcttcttct?tcatctcgca?caacttcgag 1020
ggcgtggcga?gcgtcggacc?ggacggcagc?atcaccagca?tgacgcgcgg?cgcatccttc 1080
ctcaagcggc?aggccgagac?ctcgtccaac?gtgggcggcc?cgctgctcgc?cacgctcaac 1140
ggcggcctca?actaccaaat?cgagcaccac?ctcttcccca?gggtgcacca?cggcttctac 1200
cctcgcctcg?cgccgttggt?caaggcggag?ctcgaggcgc?gcggcattga?gtacaagcac 1260
taccccacca?tatggagcaa?cctggcatcc?acgctgaggc?acatgtacgc?gctcggccgc 1320
aggccgcgca?gcaaggcgga?gtga 1344
<210>13
<211>1687
<212>DNA
<213>Pavlova?salina
<400>13
ctcctgtgag?accgcgttgc?gccagcgcaa?ggaccgacct?gcacgcgcga?tgcctccgag 60
cgcggcgaag?cagatgggcg?cgagcacggg?cgtgcatgcg?ggcgtcacag?attcgtcggc 120
cttcacgcgc?aaggatgtcg?ccgacaggcc?ggacctcacg?atcgtgggtg?acagcgtgta 180
cgatgcgaag?gcgttccgct?ccgagcatcc?gggtggcgcg?cactttgtgt?cgctgttcgg 240
cgggcgcgat?gccacggagg?cgttcatgga?gtaccaccgg?cgcgcctggc?ccaagtcgcg 300
catgtcgcgc?ttccacgtcg?gctctctggc?atcgaccgag?gagcccgtcg?ccgccgatga 360
gggctacctc?cagctgtgcg?ctcgcatcgc?caagatggtg?ccgtcggtca?gcagcgggtt 420
cgcgccggcg?tcgtactggg?tgaaggccgg?gctgatcctc?ggctccgcga?tcgcgctcga 480
ggcgtacatg?ctgtacgcgg?gcaagcgcct?gctcccgtcg?atcgtgctcg?ggtggctgtt 540
tgcgctgatt?ggcctgaaca?tccagcacga?tgccaaccac?ggcgcgctct?ccaagtcggc 600
ctcggtcaac?ctggcgctcg?ggttgtgcca?ggactggatc?ggcgggagca?tgatcctctg 660
gctgcaggag?cacgttgtca?tgcaccactt?gcacaccaac?gacgttgaca?aggacccgga 720
ccagaaggcg?cacggcgccc?tgcggctcaa?gccgaccgac?gcgtggagcc?cgatgcactg 780
gctgcagcac?ctctacctgc?tgcctgggga?gacgatgtac?gccttcaagc?tgctgtttct 840
cgacatcagc?gagctggtga?tgtggcggtg?ggagggcgag?cccatcagca?agctggccgg 900
gtacctcttc?atgccctcgc?tgctcctcaa?gctcaccttc?tgggcgcgct?ttgtcgcgct 960
gccgctgtac?ctcgcgccca?gcgtgcacac?ggcggtgtgc?atcgcggcga?cggtaatgac 1020
ggggagcttc?tacctcgcct?tcttcttctt?catctcgcac?aacttcgagg?gcgtggcgag 1080
cgtcggaccg?gacggcagca?tcaccagcat?gacgcgcggc?gcatccttcc?tcaagcggca 1140
ggccgagacc?tcgtccaacg?tgggcggccc?gctgctcgcc?acgctcaacg?gcggcctcaa 1200
ctaccaaatc?gagcaccacc?tcttccccag?ggtgcaccac?ggcttctacc?ctcgcctcgc 1260
gccgttggtc?aaggcggagc?tcgaggcgcg?cggcattgag?tacaagcact?accccaccat 1320
atggagcaac?ctggcatcca?cgctgaggca?catgtacgcg?ctcggccgca?ggccgcgcag 1380
caaggcggag?tgacgagcct?cccaatcggc?tgcccaggct?gctggcagct?tgggtcgacc 1440
atcggcatcg?actcggcgac?gccgacgcca?gccgtggtcg?cacaaacggc?tcggcgttgg 1500
ttcttcggct?accgcgccgg?aaccggggca?cgcacctgac?tcggtgacga?ttgcggtcgc 1560
accagcagaa?gcgctcaccc?ccgcccccgc?tcggatcggg?cggcatagag?catacatcta 1620
gcgcgttctt?actatatgcc?actgtgtaga?ctagtcttct?agcgccggaa?aatctgctat 1680
caacaat 1687
<210>14
<211>288
<212>PRT
<213>Caenorhabditis?elegans
<400>14
Met?Ala?Gln?His?Pro?Leu?Val?Gln?Arg?Leu?Leu?Asp?Val?Lys?Phe?Asp
1 5 10 15
Thr?Lys?Arg?Phe?Val?Ala?Ile?Ala?Thr?His?Gly?Pro?Lys?Asn?Phe?Pro
20 25 30
Asp?Ala?Glu?Gly?Arg?Lys?Phe?Phe?Ala?Asp?His?Phe?Asp?Val?Thr?Ile
35 40 45
Gln?Ala?Ser?Ile?Leu?Tyr?Met?Val?Val?Val?Phe?Gly?Thr?Lys?Trp?Phe
50 55 60
Met?Arg?Asn?Arg?Gln?Pro?Phe?Gln?Leu?Thr?Ile?Pro?Leu?Asn?Ile?Trp
65 70 75 80
Asn?Phe?Ile?Leu?Ala?Ala?Phe?Ser?Ile?Ala?Gly?Ala?Val?Lys?Met?Thr
85 90 95
Pro?Glu?Phe?Phe?Gly?Thr?Ile?Ala?Asn?Lys?Gly?Ile?Val?Ala?Ser?Tyr
100 105 110
Cys?Lys?Val?Phe?Asp?Phe?Thr?Lys?Gly?Glu?Asn?Gly?Tyr?Trp?Val?Trp
115 120 125
Leu?Phe?Met?Ala?Ser?Lys?Leu?Phe?Glu?Leu?Val?Asp?Thr?Ile?Phe?Leu
130 135 140
Val?Leu?Arg?Lys?Arg?Pro?Leu?Met?Phe?Leu?His?Trp?Tyr?His?His?Ile
145 150 155 160
Leu?Thr?Met?Ile?Tyr?Ala?Trp?Tyr?Ser?His?Pro?Leu?Thr?Pro?Gly?Phe
165 170 175
Asn?Arg?Tyr?Gly?Ile?Tyr?Leu?ASn?Phe?Val?Val?His?Ala?Phe?Met?Tyr
180 185 190
Ser?Tyr?Tyr?Phe?Leu?Arg?Ser?Met?Lys?Ile?Arg?Val?Pro?Gly?Phe?Ile
195 200 205
Ala?Gln?Ala?Ile?Thr?Ser?Leu?Gln?Ile?Val?Gln?Phe?Ile?Ile?Ser?Cys
210 215 220
Ala?Val?Leu?Ala?His?Leu?Gly?Tyr?Leu?Met?His?Phe?Thr?Asn?Ala?Asn
225 230 235 240
Cys?Asp?Phe?Glu?Pro?Ser?Val?Phe?Lys?Leu?Ala?Val?Phe?Met?Asp?Thr
245 250 255
Thr?Tyr?Leu?Ala?Leu?Phe?Val?Asn?Phe?Phe?Leu?Gln?Ser?Tyr?Val?Leu
260 265 270
Arg?Gly?Gly?Lys?Asp?Lys?Tyr?Lys?Ala?Val?Pro?Lys?Lys?Lys?Asn?Asn
275 280 285
<210>15
<211>444
<212>PRT
<213>Danio?rerio
<400>15
Met?Gly?Gly?Gly?Gly?Gln?Gln?Thr?Asp?Arg?Ile?Thr?Asp?Thr?Asn?Gly
1 5 10 15
Arg?Phe?Ser?Ser?Tyr?Thr?Trp?Glu?Glu?Val?Gln?Lys?His?Thr?Lys?His
20 25 30
Gly?Asp?Gln?Trp?Val?Val?Val?Glu?Arg?Lys?Val?Tyr?Asn?Val?Ser?Gln
35 40 45
Trp?Val?Lys?Arg?His?Pro?Gly?Gly?Leu?Arg?Ile?Leu?Gly?His?Tyr?Ala
50 55 60
Gly?Glu?Asp?Ala?Thr?Glu?Ala?Phe?Thr?Ala?Phe?His?Pro?Asn?Leu?Gln
65 70 75 80
Leu?Val?Arg?Lys?Tyr?Leu?Lys?Pro?Leu?Leu?Ile?Gly?Glu?Leu?Glu?Ala
85 90 95
Ser?Glu?Pro?Ser?Gln?Asp?Arg?Gln?Lys?Asn?Ala?Ala?Leu?Val?Glu?Asp
100 105 110
Phe?Arg?Ala?Leu?Arg?Glu?Arg?Leu?Glu?Ala?Glu?Gly?Cys?Phe?Lys?Thr
115 120 125
Gln?Pro?Leu?Phe?Phe?Ala?Leu?His?Leu?Gly?His?Ile?Leu?Leu?Leu?Glu
130 135 140
Ala?Ile?Ala?Phe?Met?Met?Val?Trp?Tyr?Phe?Gly?Thr?Gly?Trp?Ile?Asn
145 150 155 160
Thr?Leu?Ile?Val?Ala?Val?Ile?Leu?Ala?Thr?Ala?Gln?Ser?Gln?Ala?Gly
165 170 175
Trp?Leu?Gln?His?Asp?Phe?Gly?His?Leu?Ser?Val?Phe?Lys?Thr?Ser?Gly
180 185 190
Met?Asn?His?Leu?Val?His?Lys?Phe?Val?Ile?Gly?His?Leu?Lys?Gly?Ala
195 200 205
Ser?Ala?Gly?Trp?Trp?Asn?His?Arg?His?Phe?Gln?His?His?Ala?Lys?Pro
210 215 220
Asn?Ile?Phe?Lys?Lys?Asp?Pro?Asp?Val?Asn?Met?Leu?Asn?Ala?Phe?Val
225 230 235 240
Val?Gly?Asn?Val?Gln?Pro?Val?Glu?Tyr?Gly?Val?Lys?Lys?Ile?Lys?His
245 250 255
Leu?Pro?Tyr?Asn?His?Gln?His?Lys?Tyr?Phe?Phe?Phe?Ile?Gly?Pro?Pro
260 265 270
Leu?Leu?Ile?Pro?Val?Tyr?Phe?Gln?Phe?Gln?Ile?Phe?His?Asn?Met?Ile
275 280 285
Ser?His?Gly?Met?Trp?Val?Asp?Leu?Leu?Trp?Cys?Ile?Ser?Tyr?Tyr?Val
290 295 300
Arg?Tyr?Phe?Leu?Cys?Tyr?Thr?Gln?Phe?Tyr?Gly?Val?Phe?Trp?Ala?Ile
305 310 315 320
Ile?Leu?Phe?Asn?Phe?Val?Arg?Phe?Met?Glu?Ser?His?Trp?Phe?Val?Trp
325 330 335
Val?Thr?Gln?Met?Ser?His?Ile?Pro?Met?Asn?Ile?Asp?Tyr?Glu?Lys?Asn
340 345 350
Gln?Asp?Trp?Leu?Ser?Met?Gln?Leu?Val?Ala?Thr?Cys?Asn?Ile?Glu?Gln
355 360 365
Ser?Ala?Phe?Asn?Asp?Trp?Phe?Ser?Gly?His?Leu?Asn?Phe?Gln?Ile?Glu
370 375 380
His?His?Leu?Phe?Pro?Thr?Val?Pro?Arg?His?Asn?Tyr?Trp?Arg?Ala?Ala
385 390 395 400
Pro?Arg?Val?Arg?Ala?Leu?Cys?Glu?Lys?Tyr?Gly?Val?Lys?Tyr?Gln?Glu
405 410 415
Lys?Thr?Leu?Tyr?Gly?Ala?Phe?Ala?Asp?Ile?Ile?Arg?Ser?Leu?Glu?Lys
420 425 430
Ser?Gly?Glu?Leu?Trp?Leu?Asp?Ala?Tyr?Leu?Asn?Lys
435 440
<210>16
<211>444
<212>PRT
<213>Homo?sapiens
<400>16
Met?Ala?Pro?Asp?Pro?Leu?Ala?Ala?Glu?Thr?Ala?Ala?Gln?Gly?Leu?Thr
1 5 10 15
Pro?Arg?Tyr?Phe?Thr?Trp?Asp?Glu?Val?Ala?Gln?Arg?Ser?Gly?Cys?Glu
20 25 30
Glu?Arg?Trp?Leu?Val?Ile?Asp?Arg?Lys?Val?Tyr?Asn?Ile?Ser?Glu?Phe
35 40 45
Thr?Arg?Arg?His?Pro?Gly?Gly?Ser?Arg?Val?Ile?Ser?His?Tyr?Ala?Gly
50 55 60
Gln?Asp?Ala?Thr?Asp?Pro?Phe?Val?Ala?Phe?His?Ile?Asn?Lys?Gly?Leu
65 70 75 80
Val?Lys?Lys?Tyr?Met?Asn?Ser?Leu?Leu?Ile?Gly?Glu?Leu?Ser?Pro?Glu
85 90 95
Gln?Pro?Ser?Phe?Glu?Pro?Thr?Lys?Asn?Lys?Glu?Leu?Thr?Asp?Glu?Phe
100 105 110
Arg?Glu?Leu?Arg?Ala?Thr?Val?Glu?Arg?Met?Gly?Leu?Met?Lys?Ala?Asn
115 120 125
His?Val?Phe?Phe?Leu?Leu?Tyr?Leu?Leu?His?Ile?Leu?Leu?Leu?Asp?Gly
130 135 140
Ala?Ala?Trp?Leu?Thr?Leu?Trp?Val?Phe?Gly?Thr?Ser?Phe?Leu?Pro?Phe
145 150 155 160
Leu?Leu?Cys?Ala?Val?Leu?Leu?Ser?Ala?Val?Gln?Ala?Gln?Ala?Gly?Trp
165 170 175
Leu?Gln?His?Asp?Phe?Gly?His?Leu?Ser?Val?Phe?Ser?Thr?Ser?Lys?Trp
180 185 190
Asn?His?Leu?Leu?His?His?Phe?Val?Ile?Gly?His?Leu?Lys?Gly?Ala?Pro
195 200 205
Ala?Ser?Trp?Trp?Asn?His?Met?His?Phe?Gln?His?His?Ala?Lys?Pro?Asn
210 215 220
Cys?Phe?Arg?Lys?Asp?Pro?Asp?Ile?Asn?Met?His?Pro?Phe?Phe?Phe?Ala
225 230 235 240
Leu?Gly?Lys?Ile?Leu?Ser?Val?Glu?Leu?Gly?Lys?Gln?Lys?Lys?Asn?Tyr
245 250 255
Met?Pro?Tyr?Asn?His?Gln?His?Lys?Tyr?Phe?Phe?Leu?Ile?Gly?Pro?Pro
260 265 270
Ala?Leu?Leu?Pro?Leu?Tyr?Phe?Gln?Trp?Tyr?Ile?Phe?Tyr?Phe?Val?Ile
275 280 285
Gln?Arg?Lys?Lys?Trp?Val?Asp?Leu?Ala?Trp?Met?Ile?Thr?Phe?Tyr?Val
290 295 300
Arg?Phe?Phe?Leu?Thr?Tyr?Val?Pro?Leu?Leu?Gly?Leu?Lys?Ala?Phe?Leu
305 310 315 320
Gly?Leu?Phe?Phe?Ile?Val?Arg?Phe?Leu?Glu?Ser?Asn?Trp?Phe?Val?Trp
325 330 335
Val?Thr?Gln?Met?Asn?His?Ile?Pro?Met?His?Ile?Asp?His?Asp?Arg?Asn
340 345 350
Met?Asp?Trp?Val?Ser?Thr?Gln?Leu?Gln?Ala?Thr?Cys?Asn?Val?His?Lys
355 360 365
Ser?Ala?Phe?Asn?Asp?Trp?Phe?Ser?Gly?His?Leu?Asn?Phe?Gln?Ile?Glu
370 375 380
His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?His?Asn?Tyr?His?Lys?Val?Ala
385 390 395 400
Pro?Leu?Val?Gln?Ser?Leu?Cys?Ala?Lys?His?Gly?Ile?Glu?Tyr?Gln?Ser
405 410 415
Lys?Pro?Leu?Leu?Ser?Ala?Phe?Ala?Asp?Ile?Ile?His?Ser?Leu?Lys?Glu
420 425 430
Ser?Gly?Gln?Leu?Trp?Leu?Asp?Ala?Tyr?Leu?His?Gln
435 440
<210>17
<211>456
<212>PRT
<213>Pythium?irregulare
<400>17
Met?Gly?Thr?Asp?Gln?Gly?Lys?Thr?Phe?Thr?Trp?Gln?Glu?Val?Ala?Lys
1 5 10 15
His?Asn?Thr?Ala?Lys?Ser?Ala?Trp?Val?Ile?Ile?Arg?Gly?Glu?Val?Tyr
20 25 30
Asp?Val?Thr?Glu?Trp?Ala?Asp?Lys?His?Pro?Gly?Gly?Ser?Glu?Leu?Ile
35 40 45
Val?Leu?His?Ser?Gly?Arg?Glu?Cys?Thr?Asp?Thr?Phe?Tyr?Ser?Tyr?His
50 55 60
Pro?Phe?Ser?ASn?Arg?Ala?Asp?Lys?Ile?Leu?Ala?Lys?Tyr?Lys?Ile?Gly
65 70 75 80
Lys?Leu?Val?Gly?Gly?Tyr?Glu?Phe?Pro?Val?Phe?Lys?Pro?Asp?Ser?Gly
85 90 95
Phe?Tyr?Lys?Glu?Cys?Ser?Glu?Arg?Val?Ala?Glu?Tyr?Phe?Lys?Thr?Asn
100 105 110
Asn?Leu?Asp?Pro?Lys?Ala?Ala?Phe?Ala?Gly?Leu?Trp?Arg?Met?Val?Phe
115 120 125
Val?Phe?Ala?Val?Ala?Ala?Leu?Ala?Tyr?Met?Gly?Met?Asn?Glu?Leu?Ile
130 135 140
Pro?Gly?Asn?Val?Tyr?Ala?Gln?Tyr?Ala?Trp?Gly?Val?Val?Phe?Gly?Val
145 150 155 160
Phe?Gln?Ala?Leu?Pro?Leu?Leu?His?Val?Met?His?Asp?Ser?Ser?His?Ala
165 170 175
Ala?Cys?Ser?Ser?Ser?Pro?Ala?Met?Trp?Gln?Ile?Ile?Gly?Arg?Gly?Val
180 185 190
Met?Asp?Trp?Phe?Ala?Gly?Ala?Ser?Met?Val?Ser?Trp?Leu?Asn?Gln?His
195 200 205
Val?Val?Gly?His?His?Ile?Tyr?Thr?Asn?Val?Ala?Gly?Ala?Asp?Pro?Asp
210 215 220
Leu?Pro?Val?Asp?Phe?Glu?Ser?Asp?Val?Arg?Arg?Ile?Val?His?Arg?Gln
225 230 235 240
Val?Leu?Leu?Pro?Ile?Tyr?Lys?Phe?Gln?His?Ile?Tyr?Leu?Pro?Pro?Leu
245 250 255
Tyr?Gly?Val?Leu?Gly?Leu?Lys?Phe?Arg?Ile?Gln?Asp?Val?Phe?Glu?Thr
260 265 270
Phe?Val?Ser?Leu?Thr?Asn?Gly?Pro?Val?Arg?Val?Asn?Pro?His?Pro?Val
275 280 285
Ser?Asp?Trp?Val?Gln?Mer?Ile?Phe?Ala?Lys?Ala?Phe?Trp?Thr?Phe?Tyr
290 295 300
Arg?Ile?Tyr?Ile?Pro?Leu?Val?Trp?Leu?Lys?Ile?Thr?Pro?Ser?Thr?Phe
305 310 315 320
Trp?Gly?Val?Phe?Phe?Leu?Ala?Glu?Phe?Thr?Thr?Gly?Trp?Tyr?Leu?Ala
325 330 335
Phe?Asn?Phe?Gln?Val?Ser?His?Val?Ser?Thr?Glu?Cys?Glu?Tyr?Pro?Cys
340 345 350
Gly?Asp?Ala?Pro?Ser?Ala?Glu?Val?Gly?Asp?Glu?Trp?Ala?Ile?Ser?Gln
355 360 365
Val?Lys?Ser?Ser?Val?Asp?Tyr?Ala?His?Gly?Ser?Pro?Leu?Ala?Ala?Phe
370 375 380
Leu?Cys?Gly?Ala?Leu?Asn?Tyr?Gln?Val?Thr?His?His?Leu?Tyr?Pro?Gly
385 390 395 400
Ile?Ser?Gln?Tyr?His?Tyr?Pro?Ala?Ile?Ala?Pro?Ile?Ile?Ile?Asp?Val
405 410 415
Cys?Lys?Lys?Tyr?Asn?Ile?Lys?Tyr?Thr?Val?Leu?Pro?Thr?Phe?Thr?Glu
420 425 430
Ala?Leu?Leu?Ala?His?Phe?Lys?His?Leu?Lys?Asn?Met?Gly?Glu?Leu?Gly
435 440 445
Lys?Pro?Val?Glu?Ile?His?Met?Gly
450 455
<210>18
<211>439
<212>PRT
<213>Thraustochytrium?sp.
<400>18
Met?Gly?Lys?Gly?Ser?Glu?Gly?Arg?Ser?Ala?Ala?Arg?Glu?Met?Thr?Ala
1 5 10 15
Glu?Ala?Asn?Gly?Asp?Lys?Arg?Lys?Thr?Ile?Leu?Ile?Glu?Gly?Val?Leu
20 25 30
Tyr?Asp?Ala?Thr?Asn?Phe?Lys?His?Pro?Gly?Gly?Ser?Ile?Ile?Asn?Phe
35 40 45
Leu?Thr?Glu?Gly?Glu?Ala?Gly?Val?Asp?Ala?Thr?Gln?Ala?Tyr?Arg?Glu
50 55 60
Phe?His?Gln?Arg?Ser?Gly?Lys?Ala?Asp?Lys?Tyr?Leu?Lys?Ser?Leu?Pro
65 70 75 80
Lys?Leu?Asp?Ala?Ser?Lys?Val?Glu?Ser?Arg?Phe?Ser?Ala?Lys?Glu?Gln
85 90 95
Ala?Arg?Arg?Asp?Ala?Met?Thr?Arg?Asp?Tyr?Ala?Ala?Phe?Arg?Glu?Glu
100 105 110
Leu?Val?Ala?Glu?Gly?Tyr?Phe?Asp?Pro?Ser?Ile?Pro?His?Met?Ile?Tyr
115 120 125
Arg?Val?Val?Glu?Ile?Val?Ala?Leu?Phe?Ala?Leu?Ser?Phe?Trp?Leu?Met
130 135 140
Ser?Lys?Ala?Ser?Pro?Thr?Ser?Leu?Val?Leu?Gly?Val?Val?Met?Asn?Gly
145 150 155 160
Ile?Ala?Gln?Gly?Arg?Cys?Gly?Trp?Val?Met?His?Glu?Met?Gly?His?Gly
165 170 175
Ser?Phe?Thr?Gly?Val?Ile?Trp?Leu?Asp?Asp?Arg?Met?Cys?Glu?Phe?Phe
180 185 190
Tyr?Gly?Val?Gly?Cys?Gly?Met?Ser?Gly?His?Tyr?Trp?Lys?Asn?Gln?His
195 200 205
Ser?Lys?His?His?Ala?Ala?Pro?ASn?Arg?Leu?Glu?His?Asp?Val?Asp?Leu
210 215 220
Asn?Thr?Leu?Pro?Leu?Val?Ala?Phe?Asn?Glu?Arg?Val?Val?Arg?Lys?Val
225 230 235 240
Lys?Pro?Gly?Ser?Leu?Leu?Ala?Leu?Trp?Leu?Arg?Val?Gln?Ala?Tyr?Leu
245 250 255
Phe?Ala?Pro?Val?Ser?Cys?Leu?Leu?Ile?Gly?Leu?Gly?Trp?Thr?Leu?Tyr
260 265 270
Leu?His?Pro?Arg?Tyr?Met?Leu?Arg?Thr?Lys?Arg?His?Met?Glu?Phe?Val
275 280 285
Trp?Ile?Phe?Ala?Arg?Tyr?Ile?Gly?Trp?Phe?Ser?Leu?Met?Gly?Ala?Leu
290 295 300
Gly?Tyr?Ser?Pro?Gly?Thr?Ser?Val?Gly?Met?Tyr?Leu?Cys?Ser?Phe?Gly
305 310 315 320
Leu?Gly?Cys?Ile?Tyr?Ile?Phe?Leu?Gln?Phe?Ala?Val?Ser?His?Thr?His
325 330 335
Leu?Pro?Val?Thr?Asn?Pro?Glu?Asp?Gln?Leu?His?Trp?Leu?Glu?Tyr?Ala
340 345 350
Ala?Asp?His?Thr?Val?Asn?Ile?Ser?Thr?Lys?Ser?Trp?Leu?Val?Thr?Trp
355 360 365
Trp?Met?Ser?Asn?Leu?Asn?Phe?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Thr
370 375 380
Ala?Pro?Gln?Phe?Arg?Phe?Lys?Glu?Ile?Ser?Pro?Arg?Val?Glu?Ala?Leu
385 390 395 400
Phe?Lys?Arg?His?Asn?Leu?Pro?Tyr?Tyr?Asp?Leu?Pro?Tyr?Thr?Ser?Ala
405 410 415
Val?Ser?Thr?Thr?Phe?Ala?Asn?Leu?Tyr?Ser?Val?Gly?His?Ser?Val?Gly
420 425 430
Ala?Asp?Thr?Lys?Lys?Gln?Asp
435
<210>19
<211>446
<212>PRT
<213>Mortierella?alpina
<400>19
Met?Gly?Thr?Asp?Gln?Gly?Lys?Thr?Phe?Thr?Trp?Glu?Glu?Leu?Ala?Ala
1 5 10 15
His?Asn?Thr?Lys?Gly?Asp?Leu?Phe?Leu?Ala?Ile?Arg?Gly?Arg?Val?Tyr
20 25 30
Asp?Val?Thr?Lys?Phe?Leu?Ser?Arg?His?Pro?Gly?Gly?Val?Asp?Thr?Leu
35 40 45
Leu?Leu?Gly?Ala?Gly?Arg?Asp?Val?Thr?Pro?Val?Phe?Glu?Met?Tyr?His
50 55 60
Ala?Phe?Gly?Ala?Ala?Asp?Ala?Ile?Met?Lys?Lys?Tyr?Tyr?Val?Gly?Thr
65 70 75 80
Leu?Val?Ser?Asn?Glu?Leu?Pro?Val?Phe?Pro?Glu?Pro?Thr?Val?Phe?His
85 90 95
Lys?Thr?Ile?Lys?Thr?Arg?Val?Glu?Gly?Tyr?Phe?Thr?Asp?Arg?Asp?Ile
100 105 110
Asp?Pro?Lys?Asn?Arg?Pro?Glu?Ile?Trp?Gly?Arg?Tyr?Ala?Leu?Ile?Phe
115 120 125
Gly?Ser?Leu?Ile?Ala?Ser?Tyr?Tyr?Ala?Gln?Leu?Phe?Val?Pro?Phe?Val
130 135 140
Val?Glu?Arg?Thr?Trp?Leu?Gln?Val?Val?Phe?Ala?Ile?Ile?Met?Gly?Phe
145 150 155 160
Ala?Cys?Ala?Gln?Val?Gly?Leu?Asn?Pro?Leu?His?Asp?Ala?Ser?His?Phe
165 170 175
Ser?Val?Thr?His?Asn?Pro?Thr?Val?Trp?Lys?Ile?Leu?Gly?Ala?Thr?His
180 185 190
Asp?Phe?Phe?Asn?Gly?Ala?Ser?Tyr?Leu?Val?Trp?Met?Tyr?Gln?His?Met
195 200 205
Leu?Gly?His?His?Pro?Tyr?Thr?Asn?Ile?Ala?Gly?Ala?Asp?Pro?Asp?Val
210 215 220
Ser?Thr?Phe?Glu?Pro?Asp?Val?Arg?Arg?Ile?Lys?Pro?Asn?Gln?Lys?Trp
225 230 235 240
Phe?Val?Asn?His?Ile?Asn?Gln?Asp?Met?Phe?Val?Pro?Phe?Leu?Tyr?Gly
245 250 255
Leu?Leu?Ala?Phe?Lys?Val?Arg?Ile?Gln?Asp?Ile?Asn?Ile?Leu?Tyr?Phe
260 265 270
Val?Lys?Thr?Asn?Asp?Ala?Ile?Arg?Val?Asn?Pro?Ile?Ser?Thr?Trp?His
275 280 285
Thr?Val?Met?Phe?Trp?Gly?Gly?Lys?Ala?Phe?Phe?Val?Trp?Tyr?Arg?Leu
290 295 300
Ile?Val?Pro?Leu?Gln?Tyr?Leu?Pro?Leu?Gly?Lys?Val?Leu?Leu?Leu?Phe
305 310 315 320
Thr?Val?Ala?Asp?Met?Val?Ser?Ser?Tyr?Trp?Leu?Ala?Leu?Thr?Phe?Gln
325 330 335
Ala?Asn?His?Val?Val?Glu?Glu?Val?Gln?Trp?Pro?Leu?Pro?Asp?Glu?Asn
340 345 350
Gly?Ile?Ile?Gln?Lys?Asp?Trp?Ala?Ala?Met?Gln?Val?Glu?Thr?Thr?Gln
355 360 365
Asp?Tyr?Ala?His?Asp?Ser?His?Leu?Trp?Thr?Ser?Ile?Thr?Gly?Ser?Leu
370 375 380
Asn?Tyr?Gln?Ala?Val?His?His?Leu?Phe?Pro?Asn?Val?Ser?Gln?His?His
385 390 395 400
Tyr?Pro?Asp?Ile?Leu?Ala?Ile?Ile?Lys?Asn?Thr?Cys?Ser?Glu?Tyr?Lys
405 410 415
Val?Pro?Tyr?Leu?Val?Lys?Asp?Thr?Phe?Trp?Gln?Ala?Phe?Ala?Ser?His
420 425 430
Leu?Glu?His?Leu?Arg?Val?Leu?Gly?Leu?Arg?Pro?Lys?Glu?Glu
435 440 445
<210>20
<211>447
<212>PRT
<213>Caenorhabditis?elegans
<400>20
Met?Val?Leu?Arg?Glu?Gln?Glu?His?Glu?Pro?Phe?Phe?Ile?Lys?Ile?Asp
1 5 10 15
Gly?Lys?Trp?Cys?Gln?Ile?Asp?Asp?Ala?Val?Leu?Arg?Ser?His?Pro?Gly
20 25 30
Gly?Ser?Ala?Ile?Thr?Thr?Tyr?Lys?Asn?Met?Asp?Ala?Thr?Thr?Val?Phe
35 40 45
His?Thr?Phe?His?Thr?Gly?Ser?Lys?Glu?Ala?Tyr?Gln?Trp?Leu?Thr?Glu
50 55 60
Leu?Lys?Lys?Glu?Cys?Pro?Thr?Gln?Glu?Pro?Glu?Ile?Pro?Asp?Ile?Lys
65 70 75 80
Asp?Asp?Pro?Ile?Lys?Gly?Ile?Asp?Asp?Val?Asn?Met?Gly?Thr?Phe?Asn
85 90 95
Ile?Ser?Glu?Lys?Arg?Ser?Ala?Gln?Ile?Asn?Lys?Ser?Phe?Thr?Asp?Leu
100 105 110
Arg?Met?Arg?Val?Arg?Ala?Glu?Gly?Leu?Met?Asp?Gly?Ser?Pro?Leu?Phe
115 120 125
Tyr?Ile?Arg?Lys?Ile?Leu?Glu?Thr?Ile?Phe?Thr?Ile?Leu?Phe?Ala?Phe
130 135 140
Tyr?Leu?Gln?Tyr?His?Thr?Tyr?Tyr?Leu?Pro?Ser?Ala?Ile?Leu?Met?Gly
145 150 155 160
Val?Ala?Trp?Gln?Gln?Leu?Gly?Trp?Leu?Ile?His?Glu?Phe?Ala?His?His
165 170 175
Gln?Leu?Phe?Lys?Asn?Arg?Tyr?Tyr?Asn?Asp?Leu?Ala?Ser?Tyr?Phe?Val
180 185 190
Gly?Asn?Phe?Leu?Gln?Gly?Phe?Ser?Ser?Gly?Gly?Trp?Lys?Glu?Gln?His
195 200 205
Asn?Val?His?His?Ala?Ala?Thr?Asn?Val?Val?Gly?Arg?Asp?Gly?Asp?Leu
210 215 220
Asp?Leu?Val?Pro?Phe?Tyr?Ala?Thr?Val?Ala?Glu?His?Leu?Asn?Asn?Tyr
225 230 235 240
Ser?Gln?Asp?Ser?Trp?Val?Met?Thr?Leu?Phe?Arg?Trp?Gln?His?Val?His
245 250 255
Trp?Thr?Phe?Met?Leu?Pro?Phe?Leu?Arg?Leu?Ser?Trp?Leu?Leu?Gln?Ser
260 265 270
Ile?Ile?Phe?Val?Ser?Gln?Met?Pro?Thr?His?Tyr?Tyr?Asp?Tyr?Tyr?Arg
275 280 285
Asn?Thr?Ala?Ile?Tyr?Glu?Gln?Val?Gly?Leu?Ser?Leu?His?Trp?Ala?Trp
290 295 300
Ser?Leu?Gly?Gln?Leu?Tyr?Phe?Leu?Pro?Asp?Trp?Ser?Thr?Arg?Ile?Met
305 310 315 320
Phe?Phe?Leu?Val?Ser?His?Leu?Val?Gly?Gly?Phe?Leu?Leu?Ser?His?Val
325 330 335
Val?Thr?Phe?Asn?His?Tyr?Ser?Val?Glu?Lys?Phe?Ala?Leu?Ser?Ser?Asn
340 345 350
Ile?Met?Ser?Asn?Tyr?Ala?Cys?Leu?Gln?Ile?Met?Thr?Thr?Arg?Asn?Met
355 360 365
Arg?Pro?Gly?Arg?Phe?Ile?Asp?Trp?Leu?Trp?Gly?Gly?Leu?Asn?Tyr?Gln
370 375 380
Ile?Glu?His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?His?Asn?Leu?Asn?Thr
385 390 395 400
Val?Met?Pro?Leu?Val?Lys?Glu?Phe?Ala?Ala?Ala?Asn?Gly?Leu?Pro?Tyr
405 410 415
Met?Val?Asp?Asp?Tyr?Phe?Thr?Gly?Phe?Trp?Leu?Glu?Ile?Glu?Gln?Phe
420 425 430
Arg?Asn?Ile?Ala?Asn?Val?Ala?Ala?Lys?Leu?Thr?Lys?Lys?Ile?Ala
435 440 445
<210>21
<211>444
<212>PRT
<213>Homo?sapiens
<400>21
Met?Gly?Lys?Gly?Gly?Asn?Gln?Gly?Glu?Gly?Ala?Ala?Glu?Arg?Glu?Val
1 5 10 15
Ser?Val?Pro?Thr?Phe?Ser?Trp?Glu?Glu?Ile?Gln?Lys?His?Asn?Leu?Arg
20 25 30
Thr?Asp?Arg?Trp?Leu?Val?Ile?Asp?Arg?Lys?Val?Tyr?Asn?Ile?Thr?Lys
35 40 45
Trp?Ser?Ile?Gln?His?Pro?Gly?Gly?Gln?Arg?Val?Ile?Gly?His?Tyr?Ala
50 55 60
Gly?Glu?Asp?Ala?Thr?Asp?Ala?Phe?Arg?Ala?Phe?His?Pro?Asp?Leu?Glu
65 70 75 80
Phe?Val?Gly?Lys?Phe?Leu?Lys?Pro?Leu?Leu?Ile?Gly?Glu?Leu?Ala?Pro
85 90 95
Glu?Glu?Pro?Ser?Gln?Asp?His?Gly?Lys?Asn?Ser?Lys?Ile?Thr?Glu?Asp
100 105 110
Phe?Arg?Ala?Leu?Arg?Lys?Thr?Ala?Glu?Asp?Met?Asn?Leu?Phe?Lys?Thr
115 120 125
Asn?His?Val?Phe?Phe?Leu?Leu?Leu?Leu?Ala?His?Ile?Ile?Ala?Leu?Glu
130 135 140
Ser?Ile?Ala?Trp?Phe?Thr?Val?Phe?Tyr?Phe?Gly?Asn?Gly?Trp?Ile?Pro
145 150 155 160
Thr?Leu?Ile?Thr?Ala?Phe?Val?Leu?Ala?Thr?Ser?Gln?Ala?Gln?Ala?Gly
165 170 175
Trp?Leu?Gln?His?Asp?Tyr?Gly?His?Leu?Ser?Val?Tyr?Arg?Lys?Pro?Lys
180 185 190
Trp?Asn?His?Leu?Val?His?Lys?Phe?Val?Ile?Gly?His?Leu?Lys?Gly?Ala
195 200 205
Ser?Ala?Asn?Trp?Trp?Asn?His?Arg?His?Phe?Gln?His?His?Ala?Lys?Pro
210 215 220
Asn?Ile?Phe?His?Lys?Asp?Pro?Asp?Val?Asn?Met?Leu?His?Val?Phe?Val
225 230 235 240
Leu?Gly?Glu?Trp?Gln?Pro?Ile?Glu?Tyr?Gly?Lys?Lys?Lys?Leu?Lys?Tyr
245 250 255
Leu?Pro?Tyr?Asn?His?Gln?His?Glu?Tyr?Phe?Phe?Leu?Ile?Gly?Pro?Pro
260 265 270
Leu?Leu?Ile?Pro?Met?Tyr?Phe?Gln?Tyr?Gln?Ile?Ile?Met?Thr?Met?Ile
275 280 285
Val?His?Lys?Asn?Trp?Val?Asp?Leu?Ala?Trp?Ala?Val?Ser?Tyr?Tyr?Ile
290 295 300
Arg?Phe?Phe?Ile?Thr?Tyr?Ile?Pro?Phe?Tyr?Gly?Ile?Leu?Gly?Ala?Leu
305 310 315 320
Leu?Phe?Leu?Asn?Phe?Ile?Arg?Phe?Leu?Glu?Ser?His?Trp?Phe?Val?Trp
325 330 335
Val?Thr?Gln?Met?Asn?His?Ile?Val?Met?Glu?Ile?Asp?Gln?Glu?Ala?Tyr
340 345 350
Arg?Asp?Trp?Phe?Ser?Ser?Gln?Leu?Thr?Ala?Thr?Cys?Asn?Val?Glu?Gln
355 360 365
Ser?Phe?Phe?Asn?Asp?Trp?Phe?Ser?Gly?His?Leu?Asn?Phe?Gln?Ile?Glu
370 375 380
His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?His?Asn?Leu?His?Lys?Ile?Ala
385 390 395 400
Pro?Leu?Val?Lys?Ser?Leu?Cys?Ala?Lys?His?Gly?Ile?Glu?Tyr?Gln?Glu
405 410 415
Lys?Pro?Leu?Leu?Arg?Ala?Leu?Leu?Asp?Ile?Ile?Arg?Ser?Leu?Lys?Lys
420 425 430
Ser?Gly?Lys?Leu?Trp?Leu?Asp?Ala?Tyr?Leu?His?Lys
435 440
<210>22
<211>444
<212>PRT
<213>Mus?musculus
<400>22
Met?Gly?Lys?Gly?Gly?Asn?Gln?Gly?Glu?Gly?Ser?Thr?Glu?Arg?Gln?Ala
1 5 10 15
Pro?Met?Pro?Thr?Phe?Arg?Trp?Glu?Glu?Ile?Gln?Lys?His?Asn?Leu?Arg
20 25 30
Thr?Asp?Arg?Trp?Leu?Val?Ile?Asp?Arg?Lys?Val?Tyr?Asn?Val?Thr?Lys
35 40 45
Trp?Ser?Gln?Arg?His?Pro?Gly?Gly?His?Arg?Val?Ile?Gly?His?Tyr?Ser
50 55 60
Gly?Glu?Asp?Ala?Thr?Asp?Ala?Phe?Arg?Ala?Phe?His?Leu?Asp?Leu?Asp
65 70 75 80
Phe?Val?Gly?Lys?Phe?Leu?Lys?Pro?Leu?Leu?Ile?Gly?Glu?Leu?Ala?Pro
85 90 95
Glu?Glu?Pro?Ser?Leu?Asp?Arg?Gly?Lys?Ser?Ser?Gln?Ile?Thr?Glu?Asp
100 105 110
Phe?Arg?Ala?Leu?Lys?Lys?Thr?Ala?Glu?Asp?Met?Asn?Leu?Phe?Lys?Thr
115 120 125
Asn?His?Leu?Phe?Phe?Phe?Leu?Leu?Leu?Ser?His?Ile?Ile?Val?Met?Glu
130 135 140
Ser?Leu?Ala?Trp?Phe?Ile?Leu?Ser?Tyr?Phe?Gly?Thr?Gly?Trp?Ile?Pro
145 150 155 160
Thr?Leu?Val?Thr?Ala?Phe?Val?Leu?Ala?Thr?Ser?Gln?Ala?Gln?Ala?Gly
165 170 175
Trp?Leu?Gln?His?Asp?Tyr?Gly?His?Leu?Ser?Val?Tyr?Lys?Lys?Ser?Ile
180 185 190
Trp?Asn?His?Val?Val?His?Lys?Phe?Val?Ile?Gly?His?Leu?Lys?Gly?Ala
195 200 205
Ser?Ala?Ash?Trp?Trp?Asn?His?Arg?His?Phe?Gln?His?His?Ala?Lys?Pro
210 215 220
Asn?Ile?Phe?His?Lys?Asp?Pro?Asp?Ile?Lys?Ser?Leu?His?Val?Phe?Val
225 230 235 240
Leu?Gly?Glu?Trp?Gln?Pro?Leu?Glu?Tyr?Gly?Lys?Lys?Lys?Leu?Lys?Tyr
245 250 255
Leu?Pro?Tyr?Asn?His?Gln?His?Glu?Tyr?Phe?Phe?Leu?Ile?Gly?Pro?Pro
260 265 270
Leu?Leu?Ile?Pro?Met?Tyr?Phe?Gln?Tyr?Gln?Ile?Ile?Met?Thr?Met?Ile
275 280 285
Ser?Arg?Arg?Asp?Trp?Val?Asp?Leu?Ala?Trp?Ala?Ile?Ser?Tyr?Tyr?Met
290 295 300
Arg?Phe?Phe?Tyr?Thr?Tyr?Ile?Pro?Phe?Tyr?Gly?Ile?Leu?Gly?Ala?Leu
305 310 315 320
Val?Phe?Leu?Asn?Phe?Ile?Arg?Phe?Leu?Glu?Ser?His?Trp?Phe?Val?Trp
325 330 335
Val?Thr?Gln?Met?Asn?His?Leu?Val?Met?Glu?Ile?Asp?Leu?Asp?His?Tyr
340 345 350
Arg?Asp?Trp?Phe?Ser?Ser?Gln?Leu?Ala?Ala?Thr?Cys?Asn?Val?Glu?Gln
355 360 365
Ser?Phe?Phe?Asn?Asp?Trp?Phe?Ser?Gly?His?Leu?Asn?Phe?Gln?Ile?Glu
370 375 380
His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?His?Asn?Leu?His?Lys?Ile?Ala
385 390 395 400
Pro?Leu?Val?Lys?Ser?Leu?Cys?Ala?Lys?His?Gly?Ile?Glu?Tyr?Gln?Glu
405 410 415
Lys?Pro?Leu?Leu?Arg?Ala?Leu?Ile?Asp?Ile?Val?Ser?Ser?Leu?Lys?Lys
420 425 430
Ser?Gly?Glu?Leu?Trp?Leu?Asp?Ala?Tyr?Leu?His?Lys
435 440
<210>23
<211>459
<212>PRT
<213>Pythium?irregulare
<400>23
Met?Val?Asp?Leu?Lys?Pro?Gly?Val?Lys?Arg?Leu?Val?Ser?Trp?Lys?Glu
1 5 10 15
Ile?Arg?Glu?His?Ala?Thr?Pro?Ala?Thr?Ala?Trp?Ile?Val?Ile?His?His
20 25 30
Lvs?Val?Tyr?Asp?Ile?Ser?Lys?Trp?Asp?Ser?His?Pro?Gly?Gly?Ser?Val
35 40 45
Met?Leu?Thr?Gln?Ala?Gly?Glu?Asp?Ala?Thr?Asp?Ala?Phe?Ala?Val?Phe
50 55 60
His?Pro?Ser?Ser?Ala?Leu?Lys?Leu?Leu?Glu?Gln?Phe?Tyr?Val?Gly?Asp
65 70 75 80
Val?Asp?Glu?Thr?Ser?Lys?Ala?Glu?Ile?Glu?Gly?Glu?Pro?Ala?Ser?Asp
85 90 95
Glu?Glu?Arg?Ala?Arg?Arg?Glu?Arg?Ile?Asn?Glu?Phe?Ile?Ala?Ser?Tyr
100 105 110
Arg?Arg?Leu?Arg?Val?Lys?Val?Lys?Gly?Met?Gly?Leu?Tyr?Asp?Ala?Ser
115 120 125
Ala?Leu?Tyr?Tyr?Ala?Trp?Lys?Leu?Val?Ser?Thr?Phe?Gly?Ile?Ala?Val
130 135 140
Leu?Ser?Met?Ala?Ile?Cys?Phe?Phe?Phe?Asn?Ser?Phe?Ala?Met?Tyr?Met
145 150 155 160
Val?Ala?Gly?Val?Ile?Met?Gly?Leu?Phe?Tyr?Gln?Gln?Ser?Gly?Trp?Leu
165 170 175
Ala?His?Asp?Phe?Leu?His?Asn?Gln?Val?Cys?Glu?ASn?Arg?Thr?Leu?Gly
180 185 190
Asn?Leu?Ile?Gly?Cys?Leu?Val?Gly?Asn?Ala?Trp?Gln?Gly?Phe?Ser?Val
195 200 205
Gln?Trp?Trp?Lys?Asn?Lys?His?Asn?Leu?His?His?Ala?Val?Pro?Asn?Leu
210 215 220
His?Ser?Ala?Lys?Asp?Glu?Gly?Phe?Ile?Gly?Asp?Pro?Asp?Ile?Asp?Thr
225 230 235 240
Met?Pro?Leu?Leu?Ala?Trp?Ser?Lys?Glu?Met?Ala?Arg?Lys?Ala?Phe?Glu
245 250 255
Ser?Ala?His?Gly?Pro?Phe?Phe?Ile?Arg?Asn?Gln?Ala?Phe?Leu?Tyr?Phe
260 265 270
Pro?Leu?Leu?Leu?Leu?Ala?Arg?Leu?Ser?Trp?Leu?Ala?Gln?Ser?Phe?Phe
275 280 285
Tyr?Val?Phe?Thr?Glu?Phe?Ser?Phe?Gly?Ile?Phe?Asp?Lys?Val?Glu?Phe
290 295 300
Asp?Gly?Pro?Glu?Lys?Ala?Gly?Leu?Ile?Val?His?Tyr?Ile?Trp?Gln?Leu
305 310 315 320
Ala?Ile?Pro?Tyr?Phe?Cys?Asn?Met?Ser?Leu?Phe?Glu?Gly?Val?Ala?Tyr
325 330 335
Phe?Leu?Met?Gly?Gln?Ala?Ser?Cys?Gly?Leu?Leu?Leu?Ala?Leu?Val?Phe
340 345 350
Ser?Ile?Gly?His?Asn?Gly?Met?Ser?Val?Tyr?Glu?Arg?Glu?Thr?Lys?Pro
355 360 365
Asp?Phe?Trp?Gln?Leu?Gln?Val?Thr?Thr?Thr?Arg?Asn?Ile?Arg?Ala?Ser
370 375 380
Val?Phe?Met?Asp?Trp?Phe?Thr?Gly?Gly?Leu?Asn?Tyr?Gln?Ile?Asp?His
385 390 395 400
His?Leu?Phe?Pro?Leu?Val?Pro?Arg?His?Asn?Leu?Pro?Lys?Val?Asn?Val
405 410 415
Leu?Ile?Lys?Ser?Leu?Cys?Lys?Glu?Phe?Asp?Ile?Pro?Phe?His?Glu?Thr
420 425 430
Gly?Phe?Trp?Glu?Gly?Ile?Tyr?Glu?Val?Val?Asp?His?Leu?Ala?Asp?Ile
435 440 445
Ser?Lys?Glu?Phe?Ile?Thr?Glu?Phe?Pro?Ala?Met
450 455
<210>24
<211>448
<212>PRT
<213>Borago?officinalis
<400>24
Met?Ala?Ala?Gln?Ile?Lys?Lys?Tyr?Ile?Thr?Ser?Asp?Glu?Leu?Lys?Asn
1 5 10 15
His?Asp?Lys?Pro?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Ala?Tyr
20 25 30
Asp?Val?Ser?Asp?Trp?Val?Lys?Asp?His?Pro?Gly?Gly?Ser?Phe?Pro?Leu
35 40 45
Lys?Ser?Leu?Ala?Gly?Gln?Glu?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His
50 55 60
Pro?Ala?Ser?Thr?Trp?Lys?Asn?Leu?Asp?Lys?Phe?Phe?Thr?Gly?Tyr?Tyr
65 70 75 80
Leu?Lys?Asp?Tyr?Ser?Val?Ser?Glu?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu
85 90 95
Val?Phe?Glu?Phe?Ser?Lys?Met?Gly?Leu?Tyr?Asp?Lys?Lys?Gly?His?Ile
100 105 110
Met?Phe?Ala?Thr?Leu?Cys?Phe?Ile?Ala?Met?Leu?Phe?Ala?Met?Ser?Val
115 120 125
Tyr?Gly?Val?Leu?Phe?Cys?Glu?Gly?Val?Leu?Val?His?Leu?Phe?Ser?Gly
130 135 140
Cys?Leu?Met?Gly?Phe?Leu?Trp?Ile?Gln?Ser?Gly?Trp?Ile?Gly?His?Asp
145 150 155 160
Ala?Gly?His?Tyr?Met?Val?Val?Ser?Asp?Ser?Arg?Leu?Asn?Lys?Phe?Met
165 170 175
Gly?Ile?Phe?Ala?Ala?Asn?Cys?Leu?Ser?Gly?Ile?Ser?Ile?Gly?Trp?Trp
180 185 190
Lys?Trp?Asn?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Glu?Tyr
195 200 205
Asp?Pro?Asp?Leu?Gln?Tyr?Ile?Pro?Phe?Leu?Val?Val?Ser?Ser?Lys?Phe
210 215 220
Phe?Gly?Ser?Leu?Thr?Ser?His?Phe?Tyr?Glu?Lys?Arg?Leu?Thr?Phe?Asp
225 230 235 240
Ser?Leu?Ser?Arg?Phe?Phe?Val?Ser?Tyr?Gln?His?Trp?Thr?Phe?Tyr?Pro
245 250 255
Ile?Met?Cys?Ala?Ala?Arg?Leu?Asr?Met?Tyr?Val?Gln?Ser?Leu?Ile?Met
260 265 270
Leu?Leu?Thr?Lys?Arg?Asn?Val?Ser?Tyr?Arg?Ala?Gln?Glu?Leu?Leu?Gly
275 280 285
Cys?Leu?Val?Phe?Ser?Ile?Trp?Tyr?Pro?Leu?Leu?Val?Ser?Cys?Leu?Pro
290 295 300
Asn?Trp?Gly?Glu?Arg?Ile?Met?Phe?Val?Ile?Ala?Ser?Leu?Ser?Val?Thr
305 310 315 320
Gly?Met?Gln?Gln?Val?Gln?Phe?Ser?Leu?Asr?His?Phe?Ser?Ser?Ser?Val
325 330 335
Tyr?Val?Gly?Lys?Pro?Lys?Gly?Asn?Asn?Trp?Phe?Glu?Lys?Gln?Thr?Asp
340 345 350
Gly?Thr?Leu?Asp?Ile?Ser?Cys?Pro?Pro?Trp?Met?Asp?Trp?Phe?His?Gly
355 360 365
Gly?Leu?Gln?Phe?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Lys?Met?Pro?Arg
370 375 380
Cys?Asn?Leu?Arg?Lys?Ile?Ser?Pro?Tyr?Val?Ile?Glu?Leu?Cys?Lys?Lys
385 390 395 400
His?Asn?Leu?Pro?Tyr?Asn?Tyr?Ala?Ser?Phe?Ser?Lys?Ala?Asn?Glu?Met
405 410 415
Thr?Leu?Arg?Thr?Leu?Arg?Asn?Thr?Ala?Leu?Gln?Ala?Arg?Asp?Ile?Thr
420 425 430
Lys?Pro?Leu?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?His?Thr?His?Gly
435 440 445
<210>25
<211>446
<212>PRT
<213>Anemone?leveillei
<400>25
Met?Ala?Glu?Lys?Arg?Arg?Ser?Ile?Ser?Ser?Asp?Asp?Leu?Arg?Ser?His
1 5 10 15
Asn?Lys?Pro?Gly?Asp?Val?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Ile?Tyr?Asp
20 25 30
Val?Thr?Glu?Trp?Gly?Lys?Asp?His?Pro?Gly?Gly?Glu?Gly?Pro?Leu?Leu
35 40 45
Asn?Leu?Ala?Gly?Gln?Asp?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His?Pro
50 55 60
Gly?Ser?Ala?Trp?Lys?Asn?Leu?Asp?Lys?Phe?His?Ile?Gly?Tyr?Leu?Gln
65 70 75 80
Asp?Tyr?Val?Val?Ser?Asp?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu?Val?Ser
85 90 95
Glu?Phe?Ser?Lys?Ala?Gly?Leu?Tyr?Glu?Lys?Lys?Gly?His?Gly?His?Leu
100 105 110
Ile?Arg?Leu?Leu?Val?Met?Ser?Leu?Val?Phe?Ile?Ala?Ser?Val?Ser?Gly
115 120 125
Val?Val?Leu?Ser?Asp?Lys?Thr?Ser?Val?His?Val?Gly?Ser?Ala?Val?Leu
130 135 140
Leu?Ala?Val?Ile?Trp?Met?Gln?Phe?Gly?Phe?Ile?Gly?His?Asp?Ser?Gly
145 150 155 160
His?Tyr?Asn?Ile?Met?Thr?Ser?Pro?Glu?Leu?Asn?Arg?Tyr?Met?Gln?Ile
165 170 175
Phe?Ser?Val?Asn?Val?Val?Ser?Gly?Val?Ser?Val?Gly?Trp?Trp?Lys?Arg
180 185 190
Tyr?His?Asn?Ala?His?His?Ile?Ala?Val?Asn?Ser?Leu?Glu?Tyr?Asp?Pro
195 200 205
Asp?Leu?Gln?Tyr?Val?Pro?Phe?Leu?Val?Val?Ser?Thr?Ala?Ile?Phe?Asp
210 215 220
Ser?Leu?Thr?Ser?His?Phe?Tyr?Arg?Lys?Lys?Met?Thr?Phe?Asp?Ala?Val
225 230 235 240
Ala?Arg?Phe?Leu?Val?Ser?Phe?Gln?His?Trp?Thr?Phe?Tyr?Pro?Leu?Met
245 250 255
Ala?Ile?Gly?Arg?Val?Ser?Phe?Leu?Ala?Gln?Ser?Ile?Gly?Val?Leu?Leu
260 265 270
Ser?Lys?Lys?Pro?Leu?Pro?Asp?Arg?His?Leu?Glu?Trp?Phe?Gly?Leu?Val
275 280 285
Val?Phe?Trp?Ala?Trp?Tyr?Ser?Leu?Leu?Ile?Ser?Cys?Leu?Pro?Asn?Trp
290 295 300
Trp?Glu?Arg?Val?Ile?Phe?Ile?Ala?Val?Asn?Phe?Ala?Val?Thr?Gly?Ile
305 310 315 320
Gln?His?Val?Gln?Phe?Cys?Leu?Asn?His?Tyr?Ser?Ala?Gln?Thr?Tyr?Ile
325 330 335
Gly?Ala?Pro?Cys?Ala?Asn?Asp?Trp?Phe?Glu?Lys?Gln?Thr?Lys?Gly?Ser
340 345 350
Ile?Asp?Ile?Ser?Cys?Ser?Pro?Trp?Thr?Asp?Trp?Phe?His?Gly?Gly?Leu
355 360 365
Gln?Phe?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Arg?Met?Pro?Arg?Cys?Asn
370 375 380
Leu?Arg?Lys?Ile?Ser?Pro?Phe?Val?Lys?Glu?Leu?Cys?Arg?Lys?His?Asn
385 390 395 400
Leu?Val?Tyr?Thr?Ser?Val?Ser?Phe?Phe?Glu?Gly?Asn?Arg?Arg?Thr?Leu
405 410 415
Ala?Thr?Leu?Lys?Asn?Ala?Ala?Leu?Lys?Ala?Arg?Asp?Leu?Thr?Ser?Pro
420 425 430
Ile?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Val?His?Thr?His?Gly
435 440 445
<210>26
<211>520
<212>PRT
<213>Ceratodon?purpureus
<400>26
Met?Val?Ser?Gln?Gly?Gly?Gly?Leu?Ser?Gln?Gly?Ser?Ile?Glu?Glu?Asn
1 5 10 15
Ile?Asp?Val?Glu?His?Leu?Ala?Thr?Mer?Pro?Leu?Val?Ser?Asp?Phe?Leu
20 25 30
Asn?Val?Leu?Gly?Thr?Thr?Leu?Gly?Gln?Trp?Ser?Leu?Ser?Thr?Thr?Phe
35 40 45
Ala?Phe?Lys?Arg?Leu?Thr?Thr?Lys?Lys?His?Ser?Ser?Asp?Ile?Ser?Val
50 55 60
Glu?Ala?Gln?Lys?Glu?Ser?Val?Ala?Arg?Gly?Pro?Val?Glu?Asn?Ile?Ser
65 70 75 80
Gln?Ser?Val?Ala?Gln?Pro?Ile?Arg?Arg?Arg?Trp?Val?Gln?Asp?Lys?Lys
85 90 95
Pro?Val?Thr?Tyr?Ser?Leu?Lys?Asp?Val?Ala?Ser?His?Asp?Met?Pro?Gln
100 105 110
Asp?Cys?Trp?Ile?Ile?Ile?Lys?Glu?Lys?Val?Tyr?Asp?Val?Ser?Thr?Phe
115 120 125
Ala?Glu?Gln?His?Pro?Gly?Gly?Thr?Val?Ile?Asn?Thr?Tyr?Phe?Gly?Arg
130 135 140
Asp?Ala?Thr?Asp?Val?Phe?Ser?Thr?Phe?His?Ala?Ser?Thr?Ser?Trp?Lys
145 150 155 160
Ile?Leu?Gln?Asn?Phe?Tyr?Ile?Gly?Asn?Leu?Val?Arg?Glu?Glu?Pro?Thr
165 170 175
Leu?Glu?Leu?Leu?Lys?Glu?Tyr?Arg?Glu?Leu?Arg?Ala?Leu?Phe?Leu?Arg
180 185 190
Glu?Gln?Leu?Phe?Lys?Ser?Ser?Lys?Ser?Tyr?Tyr?Leu?Phe?Lys?Thr?Leu
195 200 205
Ile?Asn?Val?Ser?Ile?Val?Ala?Thr?Ser?Ile?Ala?Ile?Ile?Ser?Leu?Tyr
210 215 220
Lys?Ser?Tyr?Arg?Ala?Val?Leu?Leu?Ser?Ala?Ser?Leu?Met?Gly?Leu?Phe
225 230 235 240
Ile?Gln?Gln?Cys?Gly?Trp?Leu?Ser?His?Asp?Phe?Leu?His?His?Gln?Val
245 250 255
Phe?Glu?Thr?Arg?Trp?Leu?Asn?Asp?Val?Val?Gly?Tyr?Val?Val?Gly?ASn
260 265 270
Val?Val?Leu?Gly?Phe?Ser?Val?Ser?Trp?Trp?Lys?Thr?Lys?His?Asn?Leu
275 280 285
His?His?Ala?Ala?Pro?Asn?Glu?Cys?Asp?Gln?Lys?Tyr?Thr?Pro?Ile?Asp
290 295 300
Glu?Asp?Ile?Asp?Thr?Leu?Pro?Ile?Ile?Ala?Trp?Ser?Lys?Asp?Leu?Leu
305 310 315 320
Ala?Thr?Val?Glu?Ser?Lys?Thr?Met?Leu?Arg?Val?Leu?Gln?Tyr?Gln?His
325 330 335
Leu?Phe?Phe?Leu?Val?Leu?Leu?Thr?Phe?Ala?Arg?Ala?Ser?Trp?Leu?Phe
340 345 350
Trp?Ser?Ala?Ala?Phe?Thr?Leu?Arg?Pro?Glu?Leu?Thr?Leu?Gly?Glu?Lys
355 360 365
Leu?Leu?Glu?Arg?Gly?Thr?Met?Ala?Leu?His?Tyr?Ile?Trp?Phe?ASn?Ser
370 375 380
Val?Ala?Phe?Tyr?Leu?Leu?Pro?Gly?Trp?Lys?Pro?Val?Val?Trp?Met?Val
385 390 395 400
Val?Ser?Glu?Leu?Met?Ser?Gly?Phe?Leu?Leu?Gly?Tyr?Val?Phe?Val?Leu
405 410 415
Ser?His?Asn?Gly?Met?Glu?Val?Tyr?Asn?Thr?Ser?Lys?Asp?Phe?Val?Asn
420 425 430
Ala?Gln?Ile?Ala?Ser?Thr?Arg?Asp?Ile?Lys?Ala?Gly?Val?Phe?Asn?Asp
435 440 445
Trp?Phe?Thr?Gly?Gly?Leu?Asn?Arg?Gln?Ile?Glu?His?His?Leu?Phe?Pro
450 455 460
Thr?Met?Pro?Arg?His?Asn?Leu?Asn?Lys?Ile?Ser?Pro?His?Val?Glu?Thr
465 470 475 480
Leu?Cys?Lys?Lys?His?Gly?Leu?Val?Tyr?Glu?Asp?Val?Ser?Met?Ala?Ser
485 490 495
Gly?Thr?Tyr?Arg?Val?Leu?Lys?Thr?Leu?Lys?Asp?Val?Ala?Asp?Ala?Ala
500 505 510
Ser?His?Gln?Gln?Leu?Ala?Ala?Ser
515 520
<210>27
<211>525
<212>PRT
<213>Physcomitrella?patens
<400>27
Met?Val?Phe?Ala?Gly?Gly?Gly?Leu?Gln?Gln?Gly?Ser?Leu?Glu?Glu?Asn
1 5 10 15
Ile?Asp?Val?Glu?His?Ile?Ala?Ser?Met?Ser?Leu?Phe?Ser?Asp?Phe?Phe
20 25 30
Ser?Tyr?Val?Ser?Ser?Thr?Val?Gly?Ser?Trp?Ser?Val?His?Ser?Ile?Gln
35 40 45
Pro?Leu?Lys?Arg?Leu?Thr?Ser?Lys?Lys?Arg?Val?Ser?Glu?Ser?Ala?Ala
50 55 60
Val?Gln?Cys?Ile?Ser?Ala?Glu?Val?Gln?Arg?Asn?Ser?Ser?Thr?Gln?Gly
65 70 75 80
Thr?Ala?Glu?Ala?Leu?Ala?Glu?Ser?Val?Val?Lys?Pro?Thr?Arg?Arg?Arg
85 90 95
Ser?Ser?Gln?Trp?Lys?Lys?Ser?Thr?His?Pro?Leu?Ser?Glu?Val?Ala?Val
100 105 110
His?Asn?Lys?Pro?Ser?Asp?Cys?Trp?Ile?Val?Val?Lys?Asn?Lys?Val?Tyr
115 120 125
Asp?Val?Ser?Asn?Phe?Ala?Asp?Glu?His?Pro?Gly?Gly?Ser?Val?Ile?Ser
130 135 140
Thr?Tyr?Phe?Gly?Arg?Asp?Gly?Thr?Asp?Val?Phe?Ser?Ser?Phe?His?Ala
145 150 155 160
Ala?Ser?Thr?Trp?Lys?Ile?Leu?Gln?Asp?Phe?Tyr?Ile?Gly?Asp?Val?Glu
165 170 175
Arg?Val?Glu?Pro?Thr?Pro?Glu?Leu?Leu?Lys?Asp?Phe?Arg?Glu?Met?Arg
180 185 190
Ala?Leu?Phe?Leu?Arg?Glu?Gln?Leu?Phe?Lys?Ser?Ser?Lys?Leu?Tyr?Tyr
195 200 205
Val?Met?Lys?Leu?Leu?Thr?Asn?Val?Ala?Ile?Phe?Ala?Ala?Ser?Ile?Ala
210 215 220
Ile?Ile?Cys?Trp?Ser?Lys?Thr?Ile?Ser?Ala?Val?Leu?Ala?Ser?Ala?Cys
225 230 235 240
Met?Met?Ala?Leu?Cys?Phe?Gln?Gln?Cys?Gly?Trp?Leu?Ser?His?Asp?Phe
245 250 255
Leu?His?Asn?Gln?Val?Phe?Glu?Thr?Arg?Trp?Leu?Asn?Glu?Val?Val?Gly
260 265 270
Tyr?Val?Ile?Gly?Asn?Ala?Val?Leu?Gly?Phe?Ser?Thr?Gly?Trp?Trp?Lys
275 280 285
Glu?Lys?His?Asn?Leu?His?His?Ala?Ala?Pro?Asn?Glu?Cys?Asp?Gln?Thr
290 295 300
Tyr?Gln?Pro?Ile?Asp?Glu?Asp?Ile?Asp?Thr?Leu?Pro?Leu?Ile?Ala?Trp
305 3l0 315 320
Ser?Lys?Asp?Ile?Leu?Ala?Thr?Val?Glu?Asn?Lys?Thr?Phe?Leu?Arg?Ile
325 330 335
Leu?Gln?Tyr?Gln?His?Leu?Phe?Phe?Met?Gly?Leu?Leu?Phe?Phe?Ala?Arg
340 345 350
Gly?Ser?Trp?Leu?Phe?Trp?Ser?Trp?Arg?Tyr?Thr?Ser?Thr?Ala?Val?Leu
355 360 365
Ser?Pro?Val?Asp?Arg?Leu?Leu?Glu?Lys?Gly?Thr?Val?Leu?Phe?His?Tyr
370 375 380
Phe?Trp?Phe?Val?Gly?Thr?Ala?Cys?Tyr?Leu?Leu?Pro?Gly?Trp?Lys?Pro
385 390 395 400
Leu?Val?Trp?Met?Ala?Val?Thr?Glu?Leu?Met?Ser?Gly?Met?Leu?Leu?Gly
405 410 415
Phe?Val?Phe?Val?Leu?Ser?His?Asn?Gly?Met?Glu?Val?Tyr?Asn?Ser?Ser
420 425 430
Lys?Glu?Phe?Val?Ser?Ala?Gln?Ile?Val?Ser?Thr?Arg?Asp?Ile?Lys?Gly
435 440 445
Asn?Ile?Phe?Asn?Asp?Trp?Phe?Thr?Gly?Gly?Leu?Asn?Arg?Gln?Ile?Glu
450 455 460
His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?His?Asn?Leu?Asn?Lys?Ile?Ala
465 470 475 480
Pro?Arg?Val?Glu?Val?Phe?Cys?Lys?Lys?His?Gly?Leu?Val?Tyr?Glu?Asp
485 490 495
Val?Ser?Ile?Ala?Thr?Gly?Thr?Cys?Lys?Val?Leu?Lys?Ala?Leu?Lys?Glu
500 505 510
Val?Ala?Glu?Ala?Ala?Ala?Glu?Gln?His?Ala?Thr?Thr?Ser
515 520 525
<210>28
<211>457
<212>PRT
<213>Mortierella?alpina
<400>28
Met?Ala?Ala?Ala?Pro?Ser?Val?Arg?Thr?Phe?Thr?Arg?Ala?Glu?Ile?Leu
1 5 10 15
Asn?Ala?Glu?Ala?Leu?Asn?Glu?Gly?Lys?Lys?Asp?Ala?Glu?Ala?Pro?Phe
20 25 30
Leu?Met?Ile?Ile?Asp?Asn?Lys?Val?Tyr?Asp?Val?Arg?Glu?Phe?Val?Pro
35 40 45
Asp?His?Pro?Gly?Gly?Ser?Val?Ile?Leu?Thr?His?Val?Gly?Lys?Asp?Gly
50 55 60
Thr?Asp?Val?Phe?Asp?Thr?Phe?His?Pro?Glu?Ala?Ala?Trp?Glu?Thr?Leu
65 70 75 80
Ala?Asn?Phe?Tyr?Val?Gly?Asp?Ile?Asp?Glu?Ser?Asp?Arg?Ala?Ile?Lys
85 90 95
Asn?Asp?Asp?Phe?Ala?Ala?Glu?Val?Arg?Lys?Leu?Arg?Thr?Leu?Phe?Gln
100 105 110
Ser?Leu?Gly?Tyr?Tyr?Asp?Ser?Ser?Lys?Ala?Tyr?Tyr?Ala?Phe?Lys?Val
115 120 125
Ser?Phe?Asn?Leu?Cys?Ile?Trp?Gly?Leu?Ser?Thr?Phe?Ile?Val?Ala?Lys
130 135 140
Trp?Gly?Gln?Thr?Ser?Thr?Leu?Ala?Asn?Val?Leu?Ser?Ala?Ala?Leu?Leu
145 150 155 160
Gly?Leu?Phe?Trp?Gln?Gln?Cys?Gly?Trp?Leu?Ala?His?Asp?Phe?Leu?His
165 170 175
His?Gln?Val?Phe?Gln?Asp?Arg?Phe?Trp?Gly?Asp?Leu?Phe?Gly?Ala?Phe
180 185 190
Leu?Gly?Gly?Val?Cys?Gln?Gly?Phe?Ser?Ser?Ser?Trp?Trp?Lys?Asp?Lys
195 200 205
His?Asn?Thr?His?His?Ala?Ala?Pro?Asn?Val?His?Gly?Glu?Asp?Pro?Asp
210 215 220
Ile?Asp?Thr?His?Pro?Leu?Leu?Thr?Trp?Ser?Glu?His?Ala?Leu?Glu?Met
225 230 235 240
Phe?Ser?Asp?Val?Pro?Asp?Glu?Glu?Leu?Thr?Arg?Met?Trp?Ser?Arg?Phe
245 250 255
Met?Val?Leu?Asn?Gln?Thr?Trp?Phe?Tyr?Phe?Pro?Ile?Leu?Ser?Phe?Ala
260 265 270
Arg?Leu?Ser?Trp?Cys?Leu?Gln?Ser?Ile?Met?Phe?Val?Leu?Pro?Asn?Gly
275 280 285
Gln?Ala?His?Lys?Pro?Ser?Gly?Ala?Arg?Val?Pro?Ile?Ser?Leu?Val?Glu
290 295 300
Gln?Leu?Ser?Leu?Ala?Met?His?Trp?Thr?Trp?Tyr?Leu?Ala?Thr?Met?Phe
305 310 315 320
Leu?Phe?Ile?Lys?Asp?Pro?Val?Asn?Met?Ile?Val?Tyr?Phe?Leu?Val?Ser
325 330 335
Gln?Ala?Val?Cys?Gly?Asn?Leu?Leu?Ala?Ile?Val?Phe?Ser?Leu?Asn?His
340 345 350
Asn?Gly?Met?Pro?Val?Ile?Ser?Lys?Glu?Glu?Ala?Val?Asp?Met?Asp?Phe
355 360 365
Phe?Thr?Lys?Gln?Ile?Ile?Thr?Gly?Arg?Asp?Val?His?Pro?Gly?Leu?Phe
370 375 380
Ala?Asn?Trp?Phe?Thr?Gly?Gly?Leu?Asn?Tyr?Gln?Ile?Glu?His?His?Leu
385 390 395 400
Phe?Pro?Ser?Met?Pro?Arg?His?Asn?Phe?Ser?Lys?Ile?Gln?Pro?Ala?Val
405 410 415
Glu?Thr?Leu?Cys?Lys?Lys?Tyr?Gly?Val?Arg?Tyr?His?Thr?Thr?Gly?Met
420 425 430
Ile?Glu?Gly?Thr?Ala?Glu?Val?Phe?Ser?Arg?Leu?Asn?Glu?Val?Ser?Lys
435 440 445
Ala?Ala?Ser?Lys?Met?Gly?Lys?Ala?Gln
450 455
<210>29
<211>443
<212>PRT
<213>Caenorhabditis?elegans
<400>29
Met?Val?Val?Asp?Lys?Asn?Ala?Ser?Gly?Leu?Arg?Met?Lys?Val?Asp?Gly
1 5 10 15
Lys?Trp?Leu?Tyr?Leu?Ser?Glu?Glu?Leu?Val?Lys?Lys?His?Pro?Gly?Gly
20 25 30
Ala?Val?Ile?Glu?Gln?Tyr?Arg?Asn?Ser?Asp?Ala?Thr?His?Ile?Phe?His
35 40 45
Ala?Phe?His?Glu?Gly?Ser?Ser?Gln?Ala?Tyr?Lys?Gln?Leu?Asp?Leu?Leu
50 55 60
Lys?Lys?His?Gly?Glu?His?Asp?Glu?Phe?Leu?Glu?Lys?Gln?Leu?Glu?Lys
65 70 75 80
Arg?Leu?Asp?Lys?Val?Asp?Ile?Asn?Val?Ser?Ala?Tyr?Asp?Val?Ser?Val
85 90 95
Ala?Gln?Glu?Lys?Lys?Met?Val?Glu?Ser?Phe?Glu?Lys?Leu?Arg?Gln?Lys
100 105 110
Leu?His?Asp?Asp?Gly?Leu?Met?Lys?Ala?Asn?Glu?Thr?Tyr?Phe?Leu?Phe
115 120 125
Lys?Ala?Ile?Ser?Thr?Leu?Ser?Ile?Met?Ala?Phe?Ala?Phe?Tyr?Leu?Gln
130 135 140
Tyr?Leu?Gly?Trp?Tyr?Ile?Thr?Ser?Ala?Cys?Leu?Leu?Ala?Leu?Ala?Trp
145 150 155 160
Gln?Gln?Phe?Gly?Trp?Leu?Thr?His?Glu?Phe?Cys?His?Gln?Gln?Pro?Thr
165 170 175
Lys?Asn?Arg?Pro?Leu?Asn?Asp?Thr?Ile?Ser?Leu?Phe?Phe?Gly?Asn?Phe
180 185 190
Leu?Gln?Gly?Phe?Ser?Arg?Asp?Trp?Trp?Lys?Asp?Lys?His?Asn?Thr?His
195 200 205
His?Ala?Ala?Thr?Asn?Val?Ile?Asp?His?Asp?Gly?Asp?Ile?Asp?Leu?Ala
210 215 220
Pro?Leu?Phe?Ala?Phe?Ile?Pro?Gly?Asp?Leu?Cys?Lys?Tyr?Lys?Ala?Ser
225 230 235 240
Phe?Glu?Lys?Ala?Ile?Leu?Lys?Ile?Val?Pro?Tyr?Gln?His?Leu?Tyr?Phe
245 250 255
Thr?Ala?Met?Leu?Pro?Met?Leu?Arg?Phe?Ser?Trp?Thr?Gly?Gln?Ser?Val
260 265 270
Gln?Trp?Val?Phe?Lys?Glu?Asn?Gln?Met?Glu?Tyr?Lys?Val?Tyr?Gln?Arg
275 280 285
Asn?Ala?Phe?Trp?Glu?Gln?Ala?Thr?Ile?Val?Gly?His?Trp?Ala?Trp?Val
290 295 300
Phe?Tyr?Gln?Leu?Phe?Leu?Leu?Pro?Thr?Trp?Pro?Leu?Arg?Val?Ala?Tyr
305 310 315 320
Phe?Ile?Ile?Ser?Gln?Met?Gly?Gly?Gly?Leu?Leu?Ile?Ala?His?Val?Val
325 330 335
Thr?Phe?Asn?His?Asn?Ser?Val?Asp?Lys?Tyr?Pro?Ala?Asn?Ser?Arg?Ile
340 345 350
Leu?Asn?Asn?Phe?Ala?Ala?Leu?Gln?Ile?Leu?Thr?Thr?Arg?Asn?Met?Thr
355 360 365
Pro?Ser?Pro?Phe?Ile?Asp?Trp?Leu?Trp?Gly?Gly?Leu?Asn?Tyr?Gln?Ile
370 375 380
Glu?His?His?Leu?Phe?Pro?Thr?Met?Pro?Arg?Cys?Asn?Leu?Asn?Ala?Cys
385 390 395 400
Val?Lys?Tyr?Val?Lys?Glu?Trp?Cys?Lys?Glu?Asn?Asn?Leu?Pro?Tyr?Leu
405 410 415
Val?Asp?Asp?Tyr?Phe?Asp?Gly?Tyr?Ala?Met?Asn?Leu?Gln?Gln?Leu?Lys
420 425 430
Asn?Met?Ala?Glu?His?Ile?Gln?Ala?Lys?Ala?Ala
435 440
<210>30
<211>299
<212>PRT
<213>Homo?sapiens
<400>30
Met?Glu?His?Phe?Asp?Ala?Ser?Leu?Ser?Thr?Tyr?Phe?Lys?Ala?Leu?Leu
1 5 10 15
Gly?Pro?Arg?Asp?Thr?Arg?Val?Lys?Gly?Trp?Phe?Leu?Leu?Asp?ASn?Tyr
20 25 30
Ile?Pro?Thr?Phe?Ile?Cys?Ser?Val?Ile?Tyr?Leu?Leu?Ile?Val?Trp?Leu
35 40 45
Gly?Pro?Lys?Tyr?Met?Arg?Asn?Lys?Gln?Pro?Phe?Ser?Cys?Arg?Gly?Ile
50 55 60
Leu?Val?Val?Tyr?Asn?Leu?Gly?Leu?Thr?Leu?Leu?Ser?Leu?Tyr?Met?Phe
65 70 75 80
Cys?Glu?Leu?Val?Thr?Gly?Val?Trp?Glu?Gly?Lys?Tyr?Asn?Phe?Phe?Cys
85 90 95
Gln?Gly?Thr?Arg?Thr?Ala?Gly?Glu?Ser?Asp?Met?Lys?Ile?Ile?Arg?Val
100 105 110
Leu?Trp?Trp?Tyr?Tyr?Phe?Ser?Lys?Leu?Ile?Glu?Phe?Met?Asp?Thr?Phe
115 120 125
Phe?Phe?Ile?Leu?Arg?Lys?Asn?Asn?His?Gln?Ile?Thr?Val?Leu?His?Val
130 135 140
Tyr?His?His?Ala?Ser?Met?Leu?Asn?Ile?Trp?Trp?Phe?Val?Met?Asn?Trp
145 150 155 160
Val?Pro?Cys?Gly?His?Ser?Tyr?Phe?Gly?Ala?Thr?Leu?Asn?Ser?Phe?Ile
165 170 175
His?Val?Leu?Met?Tyr?Ser?Tyr?Tyr?Gly?Leu?Ser?Ser?Val?Pro?Ser?Met
180 185 190
Arg?Pro?Tyr?Leu?Trp?Trp?Lys?Lys?Tyr?Ile?Thr?Gln?Gly?Gln?Leu?Leu
195 200 205
Gln?Phe?Val?Leu?Thr?Ile?Ile?Gln?Thr?Ser?Cys?Gly?Val?Ile?Trp?Pro
210 215 220
Cys?Thr?Phe?Pro?Leu?Gly?Trp?Leu?Tyr?Phe?Gln?Ile?Gly?Tyr?Met?Ile
225 230 235 240
Ser?Leu?Ile?Ala?Leu?Phe?Thr?Asn?Phe?Tyr?Ile?Gln?Thr?Tyr?Asn?Lys
245 250 255
Lys?Gly?Ala?Ser?Arg?Arg?Lys?Asp?His?Leu?Lys?Asp?His?Gln?Asn?Gly
260 265 270
Ser?Met?Ala?Ala?Val?Asn?Gly?His?Thr?Asn?Ser?Phe?Ser?Pro?Leu?Glu
275 280 285
Asn?Asn?Val?Lys?Pro?Arg?Lys?Leu?Arg?Lys?Asp
290 295
<210>31
<211>290
<212>PRT
<213>Physcomitrella?patens
<400>31
Met?Glu?Val?Val?Glu?Arg?Phe?Tyr?Gly?Glu?Leu?Asp?Gly?Lys?Val?Ser
1 5 10 15
Gln?Gly?Val?Asn?Ala?Leu?Leu?Gly?Ser?Phe?Gly?Val?Glu?Leu?Thr?Asp
20 25 30
Thr?Pro?Thr?Thr?Lys?Gly?Leu?Pro?Leu?Val?Asp?Ser?Pro?Thr?Pro?Ile
35 40 45
Val?Leu?Gly?Val?Ser?Val?Tyr?Leu?Thr?Ile?Val?Ile?Gly?Gly?Leu?Leu
50 55 60
Trp?Ile?Lys?Ala?Arg?Asp?Leu?Lys?Pro?Arg?Ala?Ser?Glu?Pro?Phe?Leu
65 70 75 80
Leu?Gln?Ala?Leu?Val?Leu?Val?His?Asn?Leu?Phe?Cys?Phe?Ala?Leu?Ser
85 90 95
Leu?Tyr?Met?Cys?Val?Gly?Ile?Ala?Tyr?Gln?Ala?Ile?Thr?Trp?Arg?Tyr
100 105 110
Ser?Leu?Trp?Gly?Asn?Ala?Tyr?Asn?Pro?Lys?His?Lys?Glu?Met?Ala?Ile
115 120 125
Leu?Val?Tyr?Leu?Phe?Tyr?Met?Ser?Lys?Tyr?Val?Glu?Phe?Met?Asp?Thr
130 135 140
Val?Ile?Met?Ile?Leu?Lys?Arg?Ser?Thr?Arg?Gln?Ile?Ser?Phe?Leu?His
145 150 155 160
Val?Tyr?His?His?Ser?Ser?Ile?Ser?Leu?Ile?Trp?Trp?Ala?Ile?Ala?His
165 170 175
His?Ala?Pro?Gly?Gly?Glu?Ala?Tyr?Trp?Ser?Ala?Ala?Leu?Asn?Ser?Gly
180 185 190
Val?His?Val?Leu?Met?Tyr?Ala?Tyr?Tyr?Phe?Leu?Ala?Ala?Cys?Leu?Arg
195 200 205
Ser?Ser?Pro?Lys?Leu?Lys?Asn?Lys?Tyr?Leu?Phe?Trp?Gly?Arg?Tyr?Leu
210 215 220
Thr?Gln?Phe?Gln?Met?Phe?Gln?Phe?Met?Leu?Asn?Leu?Val?Gln?Ala?Tyr
225 230 235 240
Tyr?Asp?Met?Lys?Thr?Asn?Ala?Pro?Tyr?Pro?Gln?Trp?Leu?Ile?Lys?Ile
245 250 255
Leu?Phe?Tyr?Tyr?Met?Ile?Ser?Leu?Leu?Phe?Leu?Phe?Gly?Asn?Phe?Tyr
260 265 270
Val?Gln?Lys?Tyr?Ile?Lys?Pro?Ser?Asp?Gly?Lys?Gln?Lys?Gly?Ala?Lys
275 280 285
Thr?Glu
290
<210>32
<211>318
<212>PRT
<213>Mortierella?alpina
<400>32
Met?Glu?Ser?Ile?Ala?Pro?Phe?Leu?Pro?Ser?Lys?Met?Pro?Gln?Asp?Leu
1 5 10 15
Phe?Met?Asp?Leu?Ala?Thr?Ala?Ile?Gly?Val?Arg?Ala?Ala?Pro?Tyr?Val
20 25 30
Asp?Pro?Leu?Glu?Ala?Ala?Leu?Val?Ala?Gln?Ala?Glu?Lys?Tyr?Ile?Pro
35 40 45
Thr?Ile?Val?His?His?Thr?Arg?Gly?Phe?Leu?Val?Ala?Val?Glu?Ser?Pro
50 55 60
Leu?Ala?Arg?Glu?Leu?Pro?Leu?Met?Asn?Pro?Phe?His?Val?Leu?Leu?Ile
65 70 75 80
Val?Leu?Ala?Tyr?Leu?Val?Thr?Val?Phe?Val?Gly?Met?Gln?Ile?Met?Lys
85 90 95
Asn?Phe?Glu?Arg?Phe?Glu?Val?Lys?Thr?Phe?Ser?Leu?Leu?His?Asn?Phe
100 105 110
Cys?Leu?Val?Ser?Ile?Ser?Ala?Tyr?Met?Cys?Gly?Gly?Ile?Leu?Tyr?Glu
115 120 125
Ala?Tyr?Gln?Ala?Asn?Tyr?Gly?Leu?Phe?Glu?Asn?Ala?Ala?Asp?His?Thr
130 135 140
Phe?Lys?Gly?Leu?Pro?Met?Ala?Lys?Met?Ile?Trp?Leu?Phe?Tyr?Phe?Ser
145 150 155 160
Lys?Ile?Met?Glu?Phe?Val?Asp?Thr?Met?Ile?Met?Val?Leu?Lys?Lys?Asn
165 170 175
Asn?Arg?Gln?Ile?Ser?Phe?Leu?His?Val?Tyr?His?His?Ser?Ser?Ile?Phe
180 185 190
Thr?Ile?Trp?Trp?Leu?Val?Thr?Phe?Val?Ala?Pro?Asn?Gly?Glu?Ala?Tyr
195 200 205
Phe?Ser?Ala?Ala?Leu?Asn?Ser?Phe?Ile?His?Val?Ile?Met?Tyr?Gly?Tyr
210 215 220
Tyr?Phe?Leu?Ser?Ala?Leu?Gly?Phe?Lys?Gln?Val?Ser?Phe?Ile?Lys?Phe
225 230 235 240
Tyr?Ile?Thr?Arg?Ser?Gln?Met?Thr?Gln?Phe?Cys?Met?Met?Ser?Val?Gln
245 250 255
Ser?Ser?Trp?Asp?Met?Tyr?Ala?Met?Lys?Val?Leu?Gly?Arg?Pro?Gly?Tyr
260 265 270
Pro?Phe?Phe?Ile?Thr?Ala?Leu?Leu?Trp?Phe?Tyr?Met?Trp?Thr?Met?Leu
275 280 285
Gly?Leu?Phe?Tyr?Asn?Phe?Tyr?Arg?Lys?Asn?Ala?Lys?Leu?Ala?Lys?Gln
290 295 300
Ala?Lys?Ala?Asp?Ala?Ala?Lys?Glu?Lys?Ala?Arg?Lys?Leu?Gln
305 310 315
<210>33
<211>519
<212>PRT
<213>Thraustochytrium?sp.
<400>33
Met?Thr?Val?Gly?Tyr?Asp?Glu?Glu?Ile?Pro?Phe?Glu?Gln?Val?Arg?Ala
1 5 10 15
His?Asn?Lys?Pro?Asp?Asp?Ala?Trp?Cys?Ala?Ile?His?Gly?His?Val?Tyr
20 25 30
Asp?Val?Thr?Lys?Phe?Ala?Ser?Val?His?Pro?Gly?Gly?Asp?Ile?Ile?Leu
35 40 45
Leu?Ala?Ala?Gly?Lys?Glu?Ala?Thr?Val?Leu?Tyr?Glu?Thr?Tyr?His?Val
50 55 60
Arg?Gly?Val?Ser?Asp?Ala?Val?Leu?Arg?Lys?Tyr?Arg?Ile?Gly?Lys?Leu
65 70 75 80
Pro?Asp?Gly?Gln?Gly?Gly?Ala?Asn?Glu?Lys?Glu?Lys?Arg?Thr?Leu?Ser
85 90 95
Gly?Leu?Ser?Ser?Ala?Ser?Tyr?Tyr?Thr?Trp?Asn?Ser?Asp?Phe?Tyr?Arg
100 105 110
Val?Met?Arg?Glu?Arg?Val?Val?Ala?Arg?Leu?Lys?Glu?Arg?Gly?Lys?Ala
115 120 125
Arg?Arg?Gly?Gly?Tyr?Glu?Leu?Trp?Ile?Lys?Ala?Phe?Leu?Leu?Leu?Val
130 135 140
Gly?Phe?Trp?Ser?Ser?Leu?Tyr?Trp?Met?Cys?Thr?Leu?Asp?Pro?Ser?Phe
145 150 155 160
Gly?Ala?Ile?Leu?Ala?Ala?Met?Ser?Leu?Gly?Val?Phe?Ala?Ala?Phe?Val
l65 170 175
Gly?Thr?Cys?Ile?Gln?His?Asp?Gly?Asn?His?Gly?Ala Phe?Ala?Gln?Ser
180 185 190
Arg?Trp?Val?Asn?Lys?Val?Ala?Gly?Trp?Thr?Leu?Asp?Met?Ile?Gly?Ala
195 200 205
Ser?Gly?Met?Thr?Trp?Glu?Phe?Gln?His?Val?Leu?Gly?His?His?Pro?Tyr
210 215 220
Thr?Asn?Leu?Ile?Glu?Glu?Glu?Asn?Gly?Leu?Gln?Lys?Val?Ser?Gly?Lys
225 230 235 240
Lys?Met?Asp?Thr?Lys?Leu?Ala?Asp?Gln?Glu?Ser?Asp?Pro?Asp?Val?Phe
245 250 255
Ser?Thr?Tyr?Pro?Met?Met?Arg?Leu?His?Pro?Trp?His?Gln?Lys?Arg?Trp
260 265 270
Tyr?His?Arg?Phe?Gln?His?Ile?Tyr?Gly?Pro?Phe?Ile?Phe?Gly?Phe?Met
275 280 285
Thr?Ile?Asn?Lys?Val?Val?Thr?Gln?Asp?Val?Gly?Val?Val?Leu?Arg?Lys
290 295 300
Arg?Leu?Phe?Gln?Ile?Asp?Ala?Glu?Cys?Arg?Tyr?Ala?Ser?Pro?Met?Tyr
305 310 315 320
Val?Ala?Arg?Phe?Trp?Ile?Met?Lys?Ala?Leu?Thr?Val?Leu?Tyr?Met?Val
325 330 335
Ala?Leu?Pro?Cys?Tyr?Met?Gln?Gly?Pro?Trp?His?Gly?Leu?Lys?Leu?Phe
340 345 350
Ala?Ile?Ala?His?Phe?Thr?Cys?Gly?Glu?Val?Leu?Ala?Thr?Met?Phe?Ile
355 360 365
Val?Asn?His?Ile?Ile?Glu?Gly?Val?Ser?Tyr?Ala?Ser?Lys?Asp?Ala?Val
370 375 380
Lys?Gly?Thr?Met?Ala?Pro?Pro?Lys?Thr?Met?His?Gly?Val?Thr?Pro?Met
385 390 395 400
Asn?Asn?Thr?Arg?Lys?Glu?Val?Glu?Ala?Glu?Ala?Ser?Lys?Ser?Gly?Ala
405 410 415
Val?Val?Lys?Ser?Val?Pro?Leu?Asp?Asp?Trp?Ala?Val?Val?Gln?Cys?Gln
420 425 430
Thr?Ser?Val?Asn?Trp?Ser?Val?Gly?Ser?Trp?Phe?Trp?Asn?His?Phe?Ser
435 440 445
Gly?Gly?Leu?Asn?His?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Gly?Leu?Ser
450 455 460
His?Glu?Thr?Tyr?Tyr?His?Ile?Gln?Asp?Val?Phe?Gln?Ser?Thr?Cys?Ala
465 470 475 480
Glu?Tyr?Gly?Val?Pro?Tyr?Gln?His?Glu?Pro?Ser?Leu?Trp?Thr?Ala?Tyr
485 490 495
Trp?Lys?Met?Leu?Glu?His?Leu?Arg?Gln?Leu?Gly?Asn?Glu?Glu?Thr?His
500 505 510
Glu?Ser?Trp?Gln?Arg?Ala?Ala
515
<210>34
<211>541
<212>PRT
<213>Euglena?gracilis
<400>34
Met?Leu?Val?Leu?Phe?Gly?Asn?Phe?Tyr?Val?Lys?Gln?Tyr?Ser?Gln?Lys
1 5 10 15
Asn?Gly?Lys?Pro?Glu?Asn?Gly?Ala?Thr?Pro?Glu?Asn?Gly?Ala?Lys?Pro
20 25 30
Gln?Pro?Cys?Glu?Asn?Gly?Thr?Val?Glu?Lys?Arg?Glu?Asn?Asp?Thr?Ala
35 40 45
Asn?Val?Arg?Pro?Thr?Arg?Pro?Ala?Gly?Pro?Pro?Pro?Ala?Thr?Tyr?Tyr
50 55 60
Asp?Ser?Leu?Ala?Val?Ser?Gly?Gln?Gly?Lys?Glu?Arg?Leu?Phe?Thr?Thr
65 70 75 80
Asp?Glu?Val?Arg?Arg?His?Ile?Leu?Pro?Thr?Asp?Gly?Trp?Leu?Thr?Cys
85 90 95
His?Glu?Gly?Val?Tyr?Asp?Val?Thr?Asp?Phe?Leu?Ala?Lys?His?Pro?Gly
100 105 110
Gly?Gly?Val?Ile?Thr?Leu?Gly?Leu?Gly?Arg?Asp?Cys?Thr?Ile?Leu?Ile
115 120 125
Glu?Ser?Tyr?His?Pro?Ala?Gly?Arg?Pro?Asp?Lys?Val?Met?Glu?Lys?Tyr
130 135 140
Arg?Ile?Gly?Thr?Leu?Gln?Asp?Pro?Lys?Thr?Phe?Tyr?Ala?Trp?Gly?Glu
145 150 155 160
Ser?Asp?Phe?Tyr?Pro?Glu?Leu?Lys?Arg?Arg?Ala?Leu?Ala?Arg?Leu?Lys
165 170 175
Glu?Ala?Gly?Gln?Ala?Arg?Arg?Gly?Gly?Leu?Gly?Val?Lys?Ala?Leu?Leu
180 l85 190
Val?Leu?Thr?Leu?Phe?Phe?Val?Ser?Trp?Tyr?Met?Trp?Val?Ala?His?Lys
195 200 205
Ser?Phe?Leu?Trp?Ala?Ala?Val?Trp?Gly?Phe?Ala?Gly?Ser?His?Val?Gly
210 215 220
Leu?Ser?Ile?Gln?His?Asp?Gly?Asn?His?Gly?Ala?Phe?Ser?Arg?Asn?Thr
225 230 235 240
Leu?Val?Asn?Arg?Leu?Ala?Gly?Trp?Gly?Met?Asp?Leu?Ile?Gly?Ala?Ser
245 250 255
Ser?Thr?Val?Trp?Glu?Tyr?Gln?His?Val?Ile?Gly?His?His?Gln?Tyr?Thr
260 265 270
Asn?Leu?Val?Ser?Asp?Thr?Leu?Phe?Ser?Leu?Pro?Glu?Asn?Asp?Pro?Asp
275 280 285
Val?Phe?Ser?Ser?Tyr?Pro?Leu?Met?Arg?Met?His?Pro?Asp?Thr?Ala?Trp
290 295 300
Gln?Pro?His?His?Arg?Phe?Gln?His?Leu?Phe?Ala?Phe?Pro?Leu?Phe?Ala
305 310 3l5 320
Leu?Met?Thr?Ile?Ser?Lys?Val?Leu?Thr?Ser?Asp?Phe?Ala?Val?Cys?Leu
325 330 335
Ser?Met?Lys?Lys?Gly?Ser?Ile?Asp?Cys?Ser?Ser?Arg?Leu?Val?Pro?Leu
340 345 350
Glu?Gly?Gln?Leu?Leu?Phe?Trp?Gly?Ala?Lys?Leu?Ala?Asn?Phe?Leu?Leu
355 360 365
Gln?Ile?Val?Leu?Pro?Cys?Tyr?Leu?His?Gly?Thr?Ala?Met?Gly?Leu?Ala
370 375 380
Leu?Phe?Ser?Val?Ala?His?Leu?Val?Ser?Gly?Glu?Tyr?Leu?Ala?Ile?Cys
385 390 395 400
Phe?Ile?Ile?Asn?His?Ile?Ser?Glu?Ser?Cys?Glu?Phe?Met?Asn?Thr?Ser
405 410 415
Phe?Gln?Thr?Ala?Ala?Arg?Arg?Thr?Glu?Met?Leu?Gln?Ala?Ala?His?Gln
420 425 430
Ala?Ala?Glu?Ala?Lys?Lys?Val?Lys?Pro?Thr?Pro?Pro?Pro?Asn?Asp?Trp
435 440 445
Ala?Val?Thr?Gln?Val?Gln?Cys?Cys?Val?Asn?Trp?Arg?Ser?Gly?Gly?Val
450 455 460
Leu?Ala?Asn?His?Leu?Ser?Gly?Gly?Leu?Asn?His?Gln?Ile?Glu?His?His
465 470 475 480
Leu?Phe?Pro?Ser?Ile?Ser?His?Ala?Asn?Tyr?Pro?Thr?Ile?Ala?Pro?Val
485 490 495
Val?Lys?Glu?Val?Cys?Glu?Glu?Tyr?Gly?Leu?Pro?Tyr?Lys?Asn?Tyr?Val
500 505 510
Thr?Phe?Trp?Asp?Ala?Val?Cys?Gly?Met?Val?Gln?His?Leu?Arg?Leu?Met
515 520 525
Gly?Ala?Pro?Pro?Val?Pro?Thr?Asn?Gly?Asp?Lys?Lys?Ser
530 535 540
<210>35
<211>263
<212>PRT
<213>Isochrysis?galbana
<400>35
Met?Ala?Leu?Ala?Asn?Asp?Ala?Gly?Glu?Arg?Ile?Trp?Ala?Ala?Val?Thr
1 5 10 15
Asp?Pro?Glu?Ile?Leu?Ile?Gly?Thr?Phe?Ser?Tyr?Leu?Leu?Leu?Lys?Pro
20 25 30
Leu?Leu?Arg?Asn?Ser?Gly?Leu?Val?Asp?Glu?Lys?Lys?Gly?Ala?Tyr?Arg
35 40 45
Thr?Ser?Met?Ile?Trp?Tyr?Asn?Val?Leu?Leu?Ala?Leu?Phe?Ser?Ala?Leu
50 55 60
Ser?Phe?Tyr?Val?Thr?Ala?Thr?Ala?Leu?Gly?Trp?Asp?Tyr?Gly?Thr?Gly
65 70 75 80
Ala?Trp?Leu?Arg?Arg?Gln?Thr?Gly?Asp?Thr?Pro?Gln?Pro?Leu?Phe?Gln
85 90 95
Cys?Pro?Ser?Pro?Val?Trp?Asp?Ser?Lys?Leu?Phe?Thr?Trp?Thr?Ala?Lys
100 105 110
Ala?Phe?Tyr?Tyr?Ser?Lys?Tyr?Val?Glu?Tyr?Leu?Asp?Thr?Ala?Trp?Leu
115 120 125
Val?Leu?Lys?Gly?Lys?Arg?Val?Ser?Phe?Leu?Gln?Ala?Phe?His?His?Phe
130 135 140
Gly?Ala?Pro?Trp?Asp?Val?Tyr?Leu?Gly?Ile?Arg?Leu?His?Asn?Glu?Gly
145 150 155 160
Val?Trp?Ile?Phe?Met?Phe?Phe?Asn?Ser?Phe?Ile?His?Thr?Ile?Met?Tyr
165 170 175
Thr?Tyr?Tyr?Gly?Leu?Thr?Ala?Ala?Gly?Tyr?Lys?Phe?Lys?Ala?Lys?Pro
180 185 190
Leu?Ile?Thr?Ala?Met?Gln?Ile?Cys?Gln?Phe?Val?Gly?Gly?Phe?Leu?Leu
195 200 205
Val?Trp?Asp?Tyr?Ile?Asn?Val?Pro?Cys?Phe?Asn?Ser?Asp?Lys?Gly?Lys
210 215 220
Leu?Phe?Ser?Trp?Ala?Phe?Asn?Tyr?Ala?Tyr?Val?Gly?Ser?Val?Phe?Leu
225 230 235 240
Leu?Phe?Cys?His?Phe?Phe?Tyr?Gln?Asp?Asn?Leu?Ala?Thr?Lys?Lys?Ser
245 250 255
Ala?Lys?Ala?Gly?Lys?Gln?Leu
260
<210>36
<211>419
<212>PRT
<213>Euglena?gracilis
<400>36
Met?Lys?Ser?Lys?Arg?Gln?Ala?Leu?Ser?Pro?Leu?Gln?Leu?Met?Glu?Gln
1 5 10 15
Thr?Tyr?Asp?Val?Val?Asn?Phe?His?Pro?Gly?Gly?Ala?Glu?Ile?Ile?Glu
20 25 30
Asn?Tyr?Gln?Gly?Arg?Asp?Ala?Thr?Asp?Ala?Phe?Met?Val?Met?His?Phe
35 40 45
Gln?Glu?Ala?Phe?Asp?Lys?Leu?Lys?Arg?Met?Pro?Lys?Ile?Asn?Pro?Ser
50 55 60
Phe?Glu?Leu?Pro?Pro?Gln?Ala?Ala?Val?Asn?Glu?Ala?Gln?Glu?Asp?Phe
65 70 75 80
Arg?Lys?Leu?Arg?Glu?Glu?Leu?Ile?Ala?Thr?Gly?Met?Phe?Asp?Ala?Ser
85 90 95
Pro?Leu?Trp?Tyr?Ser?Tyr?Lys?Ile?Ser?Thr?Thr?Leu?Gly?Leu?Gly?Val
100 105 110
Leu?Gly?Tyr?Phe?Leu?Met?Val?Gln?Tyr?Gln?Met?Tyr?Phe?Ile?Gly?Ala
115 120 125
Val?Leu?Leu?Gly?Met?His?Tyr?Gln?Gln?Met?Gly?Trp?Leu?Ser?His?Asp
130 135 140
Ile?Cys?His?His?Gln?Thr?Phe?Lys?Asn?Arg?Asn?Trp?Asn?Asn?Leu?Val
145 150 155 160
Gly?Leu?Val?Phe?Gly?Asn?Gly?Leu?Gln?Gly?Phe?Ser?Val?Thr?Cys?Trp
165 170 175
Lys?Asp?Arg?His?Asn?Ala?His?His?Ser?Ala?Thr?Asn?Val?Gln?Gly?His
180 185 190
Asp?Pro?Asp?Ile?Asp?Asn?Leu?Pro?Pro?Leu?Ala?Trp?Ser?Glu?Asp?Asp
195 200 205
Val?Thr?Arg?Ala?Ser?Pro?Ile?Ser?Arg?Lys?Leu?Ile?Gln?Phe?Gln?Gln
210 215 220
Tyr?Tyr?Phe?Leu?Val?Ile?Cys?Ile?Leu?Leu?Arg?Phe?Ile?Trp?Cys?Phe
225 230 235 240
Gln?Cys?Val?Leu?Thr?Val?Arg?Ser?Leu?Lys?Asp?Arg?Asp?Asn?Gln?Phe
245 250 255
Tyr?Arg?Ser?Gln?Tyr?Lys?Lys?Glu?Ala?Ile?Gly?Leu?Ala?Leu?His?Trp
260 265 270
Thr?Leu?Lys?Ala?Leu?Phe?His?Leu?Phe?Phe?Met?Pro?Ser?Ile?Leu?Thr
275 280 285
Ser?Leu?Leu?Val?Phe?Phe?Val?Ser?Glu?Leu?Val?Gly?Gly?Phe?Gly?Ile
290 295 300
Ala?Ile?Val?Val?Phe?Met?Asn?His?Tyr?Pro?Leu?Glu?Lys?Ile?Gly?Asp
305 310 315 320
Pro?Val?Trp?Asp?Gly?His?Gly?Phe?Ser?Val?Gly?Gln?Ile?His?Glu?Thr
325 330 335
Met?Asn?Ile?Arg?Arg?Gly?Ile?Ile?Thr?Asp?Trp?Phe?Phe?Gly?Gly?Leu
340 345 350
Asn?Tyr?Gln?Ile?Glu?His?His?Leu?Trp?Pro?Thr?Leu?Pro?Arg?His?Asn
355 360 365
Leu?Thr?Ala?Val?Ser?Tyr?Gln?Val?Glu?Gln?Leu?Cys?Gln?Lys?His?Asn
370 375 380
Leu?Pro?Tyr?Arg?Asn?Pro?Leu?Pro?His?Glu?Gly?Leu?Val?Ile?Leu?Leu
385 390 395 400
Arg?Tyr?Leu?Ala?Val?Phe?Ala?Arg?Met?Ala?Glu?Lys?Gln?Pro?Ala?Gly
405 410 415
Lys?Ala?Leu
<210>37
<211>867
<212>DNA
<213>Caenorhabditis?elegans
<400>37
atggctcagc?atccgctcgt?tcaacggctt?ctcgatgtca?aattcgacac?gaaacgattt 60
gtggctattg?ctactcatgg?gccaaagaat?ttccctgacg?cagaaggtcg?caagttcttt 120
gctgatcact?ttgatgttac?tattcaggct?tcaatcctgt?acatggtcgt?tgtgttcgga 180
acaaaatggt?tcatgcgtaa?tcgtcaacca?ttccaattga?ctattccact?caacatctgg 240
aatttcatcc?tcgccgcatt?ttccatcgca?ggagctgtca?aaatgacccc?agagttcttt 300
ggaaccattg?ccaacaaagg?aattgtcgca?tcctactgca?aagtgtttga?tttcacgaaa 360
ggagagaatg?gatactgggt?gtggctcttc?atggcttcca?aacttttcga?acttgttgac 420
accatcttct?tggttctccg?taaacgtcca?ctcatgttcc?ttcactggta?tcaccatatt 480
ctcaccatga?tctacgcctg?gtactctcat?ccattgaccc?caggattcaa?cagatacgga 540
atttatctta?actttgtcgt?ccacgccttc?atgtactctt?actacttcct?tcgctcgatg 600
aagattcgcg?tgccaggatt?catcgcccaa?gctatcacat?ctcttcaaat?cgttcaattc 660
atcatctctt?gcgccgttct?tgctcatctt?ggttatctca?tgcacttcac?caatgccaac 720
tgtgatttcg?agccatcagt?attcaagctc?gcagttttca?tggacacaac?atacttggct 780
cttttcgtca?acttcttcct?ccaatcatat?gttctccgcg?gaggaaaaga?caagtacaag 840
gcagtgccaa?agaagaagaa?caactaa 867
<210>38
<211>1335
<212>DNA
<213>Danio?rerio
<400>38
atgggtggcg?gaggacagca?gacagaccga?atcaccgaca?ccaacggcag?attcagcagc 60
tacacctggg?aggaggtgca?gaaacacacc?aaacatggag?atcagtgggt?ggtggtggag 120
aggaaggttt?ataacgtcag?ccagtgggtg?aagagacacc?ccggaggact?gaggatcctc 180
ggacactatg?ctggagaaga?cgccacggag?gcgttcactg?cgtttcatcc?aaaccttcag 240
ctggtgagga?aatacctgaa?gccgctgcta?atcggagagc?tggaggcgtc?tgaacccagt 300
caggaccggc?agaaaaacgc?tgctctcgtg?gaggatttcc?gagccctgcg?tgagcgtctg 360
gaggctgaag?gctgttttaa?aacgcagccg?ctgtttttcg?ctctgcattt?gggccacatt 420
ctgctcctgg?aggccatcgc?tttcatgatg?gtgtggtatt?tcggcaccgg?ttggatcaac 480
acgctcatcg?tcgctgttat?tctggctact?gcacagtcac?aagctggatg?gttgcagcat 540
gacttcggtc?atctgtccgt?gtttaaaacc?tctggaatga?atcatttggt?gcacaaattt 600
gtcatcggac?acctgaaggg?agcgtctgcg?ggctggtgga?accatcggca?cttccagcat 660
cacgctaaac?ccaacatctt?caagaaggac?ccggacgtca?acatgctgaa?cgcctttgtg 720
gtgggaaacg?tgcagcccgt?ggagtatggc?gttaagaaga?tcaagcatct?gccctacaac 780
catcagcaca?agtacttctt?cttcattggt?cctcccctgc?tcatcccagt?gtatttccag 840
ttccaaatct?ttcacaatat?gatcagtcat?ggcatgtggg?tggacctgct?gtggtgtatc 900
agctactacg?tccgatactt?cctttgttac?acgcagttct?acggcgtctt?ttgggctatt 960
atcctcttta?atttcgtcag?gtttatggag?agccactggt?ttgtttgggt?cacacagatg 1020
agccacatcc?ccatgaacat?tgactatgag?aaaaatcagg?actggctcag?catgcagctg 1080
gtcgcgacct?gtaacatcga?gcagtctgcc?ttcaacgact?ggttcagcgg?acacctcaac 1140
ttccagatcg?agcatcatct?ctttcccaca?gtgcctcggc?acaactactg?gcgcgccgct 1200
ccacgggtgc?gagcgttgtg?tgagaaatac?ggagtcaaat?accaagagaa?gaccttgtac 1260
ggagcatttg?cggatatcat?taggtctttg?gagaaatctg?gcgagctctg?gctggatgcg 1320
tatctcaaca?aataa 1335
<210>39
<211>31
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>39
cccaagctta?ctatgggtgg?cggaggacag?c 31
<210>40
<211>27
<212>DNA
<213>Artificial sequence
<220>
<223>Oligonucleotide?primer
<400>40
ccgctggagt?tatttgttga?gatacgc 27
<210>41
<211>27
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>41
gcgggtacca?tggctcagca?tccgctc 27
<210>42
<211>27
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>42
gcgggatcct?tagttgttct?tcttctt 27
<210>43
<211>6
<212>PRT
<213>Artificial?sequence
<220>
<223>Conserved?region
<400>43
Asp?His?Pro?Gly?Gly?Ser
1 5
<210>44
<211>7
<212>PRT
<213>Artificial sequence
<220>
<223>Conserved?region
<400>44
Trp?Trp?Lys?Asp?Lys?His?Asn
1 5
<210>45
<211>7
<212>PRT
<213>Artificial?sequence
<220>
<223>Conserved?region
<400>45
Gln?Ile?Glu?His?His?Leu?Phe
1 5
<210>46
<211>21
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>46
tggtggaarc?ayaarcayaa?y 21
<210>47
<211>30
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<220>
<221>misc_feature
<222>(19)..(19)
<223>n＝any?nucleotide
<400>47
gcgagggatc?caaggraana?rrtgrtgytc 30
<210>48
<211>6
<212>PRT
<213>Artificial?sequence
<220>
<223>Conserved?region
<220>
<221>MISC_FEATURE
<222>(4)..(4)
<223>X＝any?amino?acid
<400>48
Phe?Leu?His?Xaa?Tyr?His
1 5
<210>49
<211>6
<212>PRT
<213>Artificial sequence
<220>
<223>Conserved?region
<220>
<221>MISC_FEATURE
<222>(3)..(3)
<223>X＝any?aminoacid
<400>49
Met?Tyr?Xaa?Tyr?Tyr?Phe
1 5
<210>50
<211>25
<212>DNA
<213>Artificial sequence
<220>
<223>0ligonucleotide?primer
<220>
<220>misc_feature
<222>(14)..(14)
<223>n＝any?nucleotide
<220>
<221>misc_feature
<222>(18)..(18)
<223>n＝any?nucleotide
<220>
<221>misc_feature
<222>(19)..(19)
<223>n＝any?nuc1eotide
<220>
<221>misc_feature
<222>(20)..(20)
<223>n＝any?nucleotide
<400>50 25
caggatcctt?yytncatnnn?tayca
<210>51
<211>26
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<220>
<221>misc_feature
<222>(18)..(18)
<223>n＝any?nucleotide
<220>
<221>misc_feature
<222>(19)..(19)
<223>n＝any?nucleotide
<220>
<221>misc_feature
<222>(20)..(20)
<223>n＝any?nucleotide
<400>51
gatctagara?artartannn?rtacat 26
<210>52
<211>4
<212>PRT
<213>Artificial?sequence
<220>
<223>Conserved?region
<400>52
His?Pro?Gly?Gly
1
<210>53
<211>21
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>53 21
agcacgacgs?sarccacggc?g
<210>54
<211>20
<212>DNA
<213>Artificial?sequence
<220>
<223>Oligonucleotide?primer
<400>54
gtggtgcayc?abcacgtgct 20
<210>55
<211>642
<212>DNA
<213>Pavlova?salina
<220>
<221>misc_feature
<222>(13)..(13)
<223>n＝unknown
<220>
<221>misc_feature
<222>(39)..(39)
<223>n＝unknown
<220>
<221>misc_feature
<222>(51)..(51)
<223>n＝unknown
<220>
<221>misc_feature
<222>(77)..(77)
<223>n＝unknown
<220>
<221>misc_feature
<222>(302)..(302)
<223>n＝unknown
<220>
<221>misc_feature
<222>(639)..(639)
<223>n＝unknown
<400>55
ggctgcgcaa?ctnttggaag?ggcgatcggt?gcgggcctnt?tcgttattac?nccagctggc 60
gaaaggggga?tgtgctncaa?ggcgattaag?ttgggtaacg?ccaggttttc?ccagtcacga 120
cgttgtaaaa?cgacggccag?tgaattgtaa?tacgactcac?tatagggcga?attgggtacc 180
gggccccccc?tcgagaagtc?gggtcgcatc?ctgcggggcg?acaagatctg?gcagattggc 240
tttggcagtg?ggttcaagtg?caactcggcc?gtgtggcagg?cgaacaggag?cgttgagcca 300
tntgagctcg?actgacgagc?tcggagctgc?ggtacagaca?ctgtcggcgg?ctcgagaggg 360
ctgcgacttc?agacgtgatc?gggagattgt?gcattggtgc?gccgccgggc?gcggcctgcc 420
gcccgggcgc?tgcacgtcat?cgtcagtagt?cacggtcggc?atcagcgccc?ggcccgtggt 480
tggtacgtgg?tagcgcaggc?tgcgcagctg?ccaacagccg?ccgcccgagg?tgggtggtgg 540
gactccgggt?gtcagtcaca?ctcagtggcg?gccgccggca?gtaggccgtg?actctgccgt 600
ggcgttagta?tcagtggcag?tcagctgctg?tcgtcaatnt?tt 642
<210>56
<211>100
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>56
tgggttgagt?actcggccaa?ccacacgacc?aactgcgcgc?cctcgtggtg?gtgcgactgg 60
tggatgtctt?acctcaacta?ccagatcgag?catcatctgt 100
<210>57
<211>100
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>57
atagtgcagc?ccgtgcttct?cgaagagcgc?cttgacgcgc?ggcgcgatcg?tcgggtggcg 60
gaattgcggc?atggacggga?acagatgatg?ctcgatctgg 100
<210>58
<211>1612
<212>DNA
<213>Pavlova?salina
<400>58
gccttctgga?cgactgtcat?gccgccgcgc?gatagctact?cgtacgccgc?cccgccgtcg 60
gcccagctgc?acgaggtcga?taccccgcag?gagcatgata?agaaggagct?cgtcatcggt 120
gaccgcgcgt?acgacgtgac?caactttgtg?aagcgccacc?cgggtggcaa?gatcatcgca 180
taccaggttg?gcacagatgc?gacggacgcg?tacaagcagt?tccatgtgcg?gtctgccaag 240
gcggacaaga?tgctcaagtc?gctgccttcg?cgcccggtgc?acaagggcta?ctcgccccgc 300
cgcgctgacc?tcattgccga?cttccaggag?ttcaccaagc?agctggaggc?ggagggcatg 360
tttgagccgt?cgctgccgca?cgtggcatac?cgcctggcgg?aggtgatcgc?gatgcacgtg 420
gccggcgccg?cgctcatctg?gcacgggtac?accttcgcgg?gcattgccat?gctcggcgtt 480
gtgcagggcc?gctgcggctg?gctcatgcac?gagggcggcc?actactcgct?cacgggcaac 540
attgcttttg?accgtgccat?ccaagtcgcg?tgctacggcc?ttggctgcgg?catgtcgggc 600
gcgtggtggc?gcaaccagca?caacaagcac?cacgcgacgc?cgcagaagtt?gcagcacgac 660
gtcgacctcg?acaccctccc?gctcgtcgcc?ttccacgagc?ggatagccgc?caaggtgaag 720
agccccgcga?tgaaggcgtg?gcttagtatg?caggcgaagc?tcttcgcgcc?agtgaccacg 780
ctgctggtcg?cgctgggctg?gcagctgtac?ctgcacccgc?gccatatgct?gcgcaccaag 840
cactacgacg?agctcgcgat?gctcggcatt?cgctacggcc?ttgtcggcta?cctcgcggcg 900
aactacggcg?cggggtacgt?gctcgcgtgc?tacctgctgt?acgtgcagct?cggcgccatg 960
tacatcttct?gcaactttgc?cgtgtcgcac?acacacctgc?cggttgtcga?gcctaacgag 1020
cacgcaacgt?gggtggagta?cgccgcgaac?cacacgacca?actgctcgcc?ctcgtggtgg 1080
tgcgactggt?ggatgtcgta?cctcaactac?cagatcgagc?accacctcta?cccgtccatg 1140
ccgcagttcc?gccacccgaa?gattgcgccg?cgggtgaagc?agctcttcga?gaagcacggc 1200
ctgcactacg?acgtgcgtgg?ctacttcgag?gccatggcgg?acacgtttgc?caaccttgac 1260
aacgtcgcgc?acgcgccgga?gaagaagatg?cagtgagcgc?gcgagtgagc?aacgccaagc 1320
gtccaccgcg?gagtcgcccg?tggtcctcct?gccgatcgcg?gcctgtctct?ccagctgaca 1380
tctctgcttt?gcttgcccat?gatcgacgtc?gcctccctct?ctctccacac?gatgtgcctg 1440
acgaatgacc?tgcgggataa?tcagcgctcg?catgcccatg?ccagcgccaa?tggcagctgc 1500
tgcggcagcc?gccaagtggt?aatccatgac?acgctgctcc?acgacgcgca?cgccttccat 1560
cttgacaatc?agcatggacg?tagcatcatc?agttcagtga?ctaattcctt?tc 1612
<210>59
<211>1278
<212>DNA
<213>Pavlova?salina
<400>59
atgccgccgc?gcgatagcta?ctcgtacgcc?gccccgccgt?cggcccagct?gcacgaggtc 60
gataccccgc?aggagcatga?taagaaggag?ctcgtcatcg?gtgaccgcgc?gtacgacgtg 120
accaactttg?tgaagcgcca?cccgggtggc?aagatcatcg?cataccaggt?tggcacagat 180
gcgacggacg?cgtacaagca?gttccatgtg?cggtctgcca?aggcggacaa?gatgctcaag 240
tcgctgcctt?cgcgcccggt?gcacaagggc?tactcgcccc?gccgcgctga?cctcattgcc 300
gacttccagg?agttcaccaa?gcagctggag?gcggagggca?tgtttgagcc?gtcgctgccg 360
cacgtggcat?accgcctggc?ggaggtgatc?gcgatgcacg?tggccggcgc?cgcgctcatc 420
tggcacgggt?acaccttcgc?gggcattgcc?atgctcggcg?ttgtgcaggg?ccgctgcggc 480
tggctcatgc?acgagggcgg?ccactactcg?ctcacgggca?acattgcttt?tgaccgtgcc 540
atccaagtcg?cgtgctacgg?ccttggctgc?ggcatgtcgg?gcgcgtggtg?gcgcaaccag 600
cacaacaagc?accacgcgac?gccgcagaag?ttgcagcacg?acgtcgacct?cgacaccctc 660
ccgctcgtcg?ccttccacga?gcggatagcc?gccaaggtga?agagccccgc?gatgaaggcg 720
tggcttagta?tgcaggcgaa?gctcttcgcg?ccagtgacca?cgctgctggt?cgcgctgggc 780
tggcagctgt?acctgcaccc?gcgccatatg?ctgcgcacca?agcactacga?cgagctcgcg 840
atgctcggca?ttcgctacgg?ccttgtcggc?tacctcgcgg?cgaactacgg?cgcggggtac 900
gtgctcgcgt?gctacctgct?gtacgtgcag?ctcggcgcca?tgtacatctt?ctgcaacttt 960
gccgtgtcgc?acacacacct?gccggttgtc?gagcctaacg?agcacgcaac?gtgggtggag 1020
tacgccgcga?accacacgac?caactgctcg?ccctcgtggt?ggtgcgactg?gtggatgtcg 1080
tacctcaact?accagatcga?gcaccacctc?tacccgtcca?tgccgcagtt?ccgccacccg 1140
aagattgcgc?cgcgggtgaa?gcagctcttc?gagaagcacg?gcctgcacta?cgacgtgcgt 1200
ggctacttcg?aggccatggc?ggacacgttt?gccaaccttg?acaacgtcgc?gcacgcgccg 1260
gagaagaaga?tgcagtga 1278
<210>60
<211>425
<212>PRT
<213>Pavlova?salina
<400>60
Met?Pro?Pro?Arg?Asp?Ser?Tyr?Ser?Tyr?Ala?Ala?Pro?Pro?Ser?Ala?Gln
1 5 10 15
Leu?His?Glu?Val?Asp?Thr?Pro?Gln?Glu?His?Asp?Lys?Lys?Glu?Leu?Val
20 25 30
Ile?Gly?Asp?Arg?Ala?Tyr?Asp?Val?Thr?Asn?Phe?Val?Lys?Arg?His?Pro
35 40 45
Gly?Gly?Lys?Ile?Ile?Ala?Tyr?Gln?Val?Gly?Thr?Asp?Ala?Thr?Asp?Ala
50 55 60
Tyr?Lys?Gln?Phe?His?Val?Arg?Ser?Ala?Lys?Ala?Asp?Lys?Met?Leu?Lys
65 70 75 80
Ser?Leu?Pro?Ser?Arg?Pro?Val?His?Lys?Gly?Tyr?Ser?Pro?Arg?Arg?Ala
85 90 95
Asp?Leu?Ile?Ala?Asp?Phe?Gln?Glu?Phe?Thr?Lys?Gln?Leu?Glu?Ala?Glu
100 105 110
Gly?Met?Phe?Glu?Pro?Ser?Leu?Pro?His?Val?Ala?Tyr?Arg?Leu?Ala?Glu
115 120 125
Val?Ile?Ala?Met?His?Val?Ala?Gly?Ala?Ala?Leu?Ile?Trp?His?Gly?Tyr
130 135 140
Thr?Phe?Ala?Gly?Ile?Ala?Met?Leu?Gly?Val?Val?Gln?Gly?Arg?Cys?Gly
145 150 155 160
Trp?Leu?Met?His?Glu?Gly?Gly?His?Tyr?Ser?Leu?Thr?Gly?Asn?Ile?Ala
165 170 175
Phe?Asp?Arg?Ala?Ile?Gln?Val?Ala?Cys?Tyr?Gly?Leu?Gly?Cys?Gly?Met
180 185 190
Ser?Gly?Ala?Trp?Trp?Arg?Asn?Gln?His?Asn?Lys?His?His?Ala?Thr?Pro
195 200 205
Gln?Lys?Leu?Gln?His?Asp?Val?Asp?Leu?Asp?Thr?Leu?Pro?Leu?Val?Ala
210 215 220
Phe?His?Glu?Arg?Ile?Ala?Ala?Lys?Val?Lys?Ser?Pro?Ala?Met?Lys?Ala
225 230 235 240
Trp?Leu?Ser?Met?Gln?Ala?Lys?Leu?Phe?Ala?Pro?Val?Thr?Thr?Leu?Leu
245 250 255
Val?Ala?Leu?Gly?Trp?Gln?Leu?Tyr?Leu?His?Pro?Arg?His?Met?Leu?Arg
260 265 270
Thr?Lys?His?Tyr?Asp?Glu?Leu?Ala?Met?Leu?Gly?Ile?Arg?Tyr?Gly?Leu
275 280 285
Val?Gly?Tyr?Leu?Ala?Ala?Asn?Tyr?Gly?Ala?Gly?Tyr?Val?Leu?Ala?Cys
290 295 300
Tyr?Leu?Leu?Tyr?Val?Gln?Leu?Gly?Ala?Met?Tyr?Ile?Phe?Cys?Asn?Phe
305 310 315 320
Ala?Val?Ser?His?Thr?His?Leu?Pro?Val?Val?Glu?Pro?Asn?Glu?His?Ala
325 330 335
Thr?Trp?Val?Glu?Tyr?Ala?Ala?Asn?His?Thr?Thr?Asn?Cys?Ser?Pro?Ser
340 345 350
Trp?Trp?Cys?Asp?Trp?Trp?Met?Ser?Tyr?Leu?Asn?Tyr?Gln?Ile?Glu?His
355 360 365
His?Leu?Tyr?Pro?Ser?Met?Pro?Gln?Phe?Arg?His?Pro?Lys?Ile?Ala?Pro
370 375 380
Arg?Val?Lys?Gln?Leu?Phe?Glu?Lys?His?Gly?Leu?His?Tyr?Asp?Val?Arg
385 390 395 400
Gly?Tyr?Phe?Glu?Ala?Met?Ala?Asp?Thr?Phe?Ala?Asn?Leu?Asp?Asn?Val
405 410 415
Ala?His?Ala?Pro?Glu?Lys?Lys?Met?Gln
420 425
<210>61
<211>8
<212>PRT
<213>Echium?pitardii
<400>61
Met?Ala?Asn?Ala?Ile?Lys?Lys?Tyr
1 5
<210>62
<211>7
<212>PRT
<213>Echium?pitardii
<400>62
Glu?Ala?Leu?Asn?Thr?His?Gly
1 5
<210>63
<211>1347
<212>DNA
<213>Echium?plantagineum
<400>63
atggctaatg?caatcaagaa?gtacattact?gcagaggagc?tgaagaagca?tgataaagca 60
ggggatctct?ggatctccat?tcaaggaaaa?atctatgatg?tttcagattg?gttgaaggac 120
catccaggtg?ggaacttccc?cttgctgagc?cttgctggcc?aagaggtaac?tgatgcattt 180
gttgcatttc?attctggtac?aacttggaag?cttcttgaaa?aattcttcac?tggttattac 240
cttaaagatt?actctgtttc?tgaggtgtcc?aaagattaca?ggaagcttgt?gtttgagttt 300
aataaaatgg?gcttgtttga?caaaaagggt?catattgttc?ttgtgactgt?cttgtttata 360
gctatgttgt?ttggtatgag?tgtttatggg?gttttgtttt?gtgagggtgt?tttggtacat 420
ttgcttgctg?gggggttgat?gggttttgtc?tggattcaga?gtggttggat?tggtcatgat 480
gctgggcatt?atattgttat?gcctgatgct?aggcttaata?agcttatggg?tattgttgct 540
gccaattgtt?tatctggaat?aagcattggt?tggtggaaat?ggaaccataa?tgcacatcac 600
attgcctgta?atagcctcga?ttacgacccg?gatttgcagt?acattccgtt?tcttgttgtg 660
tcgtccaagt?tgtttagctc?gctcacctct?catttctatg?aaaagaaact?gacatttgac 720
tctttatcga?gattctttgt?aagccatcag?cattggacgt?tttacccggt?tatgtgtatg 780
gctagggtta?atatgtttgt?gcagtctctg?ataatgttgt?tgactaagcg?aaatgtgttc 840
tatagaagtc?aagaactgtt?gggattggtg?gtgttttgga?tttggtaccc?gttgcttgtt 900
tcttgcttgc?ctaattgggg?agaacgagta?atgttcgttg?ttgctagtct?ctcggtgact 960
ggaatgcaac?aagtgcagtt?ctctttgaac?catttctcgt?cgagtgttta?tgttggtcag 1020
cctaaaggga?acgattggtt?cgagaaacaa?acatgtggga?cgctcgacat?ttcttgccct 1080
tcgtggatgg?attggtttca?tggtggattg?caattccaag?ttgagcatca?tttgttccct 1140
aagctgccca?gatgccacct?tcggaaaatc?tccccgttcg?tgatggagtt?atgcaagaag 1200
cataatttgt?cttacaattg?tgcatctttc?tccgaggcca?acaatatgac?actcagaaca 1260
ttaagggaca?cagcattgca?agctcgcgat?ttaaccaagc?cgctccccaa?gaatttggta 1320
tgggaagctc?ttaatactca?tggttga 1347
<210>64
<211>448
<212>PRT
<213>Echium?plantagineum
<400>64
Met?Ala?Asn?Ala?Ile?Lys?Lys?Tyr?Ile?Thr?Ala?Glu?Glu?Leu?Lys?Lys
1 5 10 15
His?Asp?Lys?Ala?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Ile?Tyr
20 25 30
Asp?Val?Ser?Asp?Trp?Leu?Lys?Asp?His?Pro?Gly?Gly?Asn?Phe?Pro?Leu
35 40 45
Leu?Ser?Leu?Ala?Gly?Gln?Glu?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His
50 55 60
Ser?Gly?Thr?Thr?Trp?Lys?Leu?Leu?Glu?Lys?Phe?Phe?Thr?Gly?Tyr?Tyr
65 70 75 80
Leu?Lys?Asp?Tyr?Ser?Val?Ser?Glu?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu
85 90 95
Val?Phe?Glu?Phe?Asn?Lys?Met?Gly?Leu?Phe?Asp?Lys?Lys?Gly?His?Ile
100 105 110
Val?Leu?Val?Thr?Val?Leu?Phe?Ile?Ala?Met?Leu?Phe?Gly?Met?Ser?Val
115 120 125
Tyr?Gly?Val?Leu?Phe?Cys?Glu?Gly?Val?Leu?Val?His?Leu?Leu?Ala?Gly
130 135 140
Gly?Leu?Met?Gly?Phe?Val?Trp?Ile?Gln?Ser?Gly?Trp?Ile?Gly?His?Asp
145 150 155 160
Ala?Gly?His?Tyr?Ile?Val?Met?Pro?Asp?Ala?Arg?Leu?Asn?Lys?Leu?Met
165 170 175
Gly?Ile?Val?Ala?Ala?Asn?Cys?Leu?Ser?Gly?Ile?Ser?Ile?Gly?Trp?Trp
180 185 190
Lys?Trp?Asn?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp?Tyr
195 200 205
Asp?Pro?Asp?Leu?Gln?Tyr?Ile?Pro?Phe?Leu?Val?Val?Ser?Ser?Lys?Leu
210 215 220
Phe?Ser?Ser?Leu?Thr?Ser?His?Phe?Tyr?Glu?Lys?Lys?Leu?Thr?Phe?Asp
225 230 235 240
Ser?Leu?Ser?Arg?Phe?Phe?Val?Ser?His?Gln?His?Trp?Thr?Phe?Tyr?Pro
245 250 255
Val?Met?Cys?Met?Ala?Arg?Val?Asn?Met?Phe?Val?Gln?Ser?Leu?Ile?Met
260 265 270
Leu?Leu?Thr?Lys?Arg?Asn?Val?Phe?Tyr?Arg?Ser?Gln?Glu?Leu?Leu?Gly
275 280 285
Leu?Val?Val?Phe?Trp?Ile?Trp?Tyr?Pro?Leu?Leu?Val?Ser?Cys?Leu?Pro
290 295 300
Asn?Trp?Gly?Glu?Arg?Val?Met?Phe?Val?Val?Ala?Ser?Leu?Ser?Val?Thr
305 310 315 320
Gly?Met?Gln?Gln?Val?Gln?Phe?Ser?Leu?Asn?His?Phe?Ser?Ser?Ser?Val
325 330 335
Tyr?Val?Gly?Gln?Pro?Lys?Gly?Asn?Asp?Trp?Phe?Glu?Lys?Gln?Thr?Cys
340 345 350
Gly?Thr?Leu?Asp?Ile?Ser?Cys?Pro?Ser?Trp?Met?Asp?Trp?Phe?His?Gly
355 360 365
Gly?Leu?Gln?Phe?Gln?Val?Glu?His?His?Leu?Phe?Pro?Lys?Leu?Pro?Arg
370 375 380
Cys?His?Leu?Arg?Lys?Ile?Ser?Pro?Phe?Val?Met?Glu?Leu?Cys?Lys?Lys
385 390 395 400
His?Asn?Leu?Ser?Tyr?Asn?Cys?Ala?Ser?Phe?Ser?Glu?Ala?Asn?Asn?Met
405 410 415
Thr?Leu?Arg?Thr?Leu?Arg?Asp?Thr?Ala?Leu?Gln?Ala?Arg?Asp?Leu?Thr
420 425 430
Lys?Pro?Leu?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?Asn?Thr?His?Gly
435 440 445
<210>65
<211>448
<212>PRT
<213>Echium?gentianoides
<400>65
Met?Ala?Asn?Ala?Ile?Lys?Lys?Tyr?Ile?Thr?Ala?Glu?Glu?Leu?Lys?Lys
1 5 10 15
His?Asp?Lys?Glu?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Val?Tyr
20 25 30
Asp?Val?Ser?Asp?Trp?Leu?Lys?Asp?His?Pro?Gly?Gly?Lys?Phe?Pro?Leu
35 40 45
Leu?Ser?Leu?Ala?Gly?Gln?Glu?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His
50 55 60
Ser?Gly?Ser?Thr?Trp?Lys?Phe?Leu?Asp?Ser?Phe?Phe?Thr?Gly?Tyr?Tyr
65 70 75 80
Leu?Lys?Asp?Tyr?Ser?Val?Ser?Glu?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu
85 90 95
Val?Phe?Glu?Phe?Asn?Lys?Met?Gly?Leu?Phe?Asp?Lys?Lys?Gly?His?Ile
100 105 110
Val?Leu?Val?Thr?Val?Leu?Phe?Ile?Ala?Met?Met?Phe?Ala?Met?Ser?Val
115 120 125
Tyr?Gly?Val?Leu?Phe?Cys?Glu?Gly?Val?Leu?Val?His?Leu?Leu?Ala?Gly
130 135 140
Gly?Leu?Met?Gly?Phe?Val?Trp?Ile?Gln?Ser?Gly?Trp?Ile?Gly?His?Asp
145 150 155 160
Ala?Gly?His?Tyr?Ile?Val?Met?Pro?Asn?Pro?Arg?Leu?Asn?Lys?Leu?Met
165 170 175
Gly?Ile?Val?Ala?Gly?Asn?Cys?Leu?Ser?Gly?Ile?Ser?Ile?Gly?Trp?Trp
180 185 190
Lys?Trp?Asn?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp?Tyr
195 200 205
Asp?Pro?Asp?Leu?Gln?Tyr?Ile?Pro?Phe?Leu?Val?Val?Ser?Ser?Lys?Leu
210 215 220
Phe?Ser?Ser?Leu?Thr?Ser?His?Phe?Tyr?Glu?Lys?Lys?Leu?Thr?Phe?Asp
225 230 235 240
Ser?Leu?Ser?Arg?Phe?Phe?Val?Ser?His?Gln?His?Trp?Thr?Phe?Tyr?Pro
245 250 255
Val?Met?Cys?Ser?Ala?Arg?Val?Asn?Met?Phe?Val?Gln?Ser?Leu?Ile?Met
260 265 270
Leu?Leu?Thr?Lys?Arg?Asn?Val?Phe?Tyr?Arg?Ser?Gln?Glu?Leu?Leu?Gly
275 280 285
Leu?Val?Val?Phe?Trp?Ile?Trp?Tyr?Pro?Leu?Leu?Val?Ser?Cys?Leu?Pro
290 295 300
Asn?Trp?Gly?Glu?Arg?Ile?Met?Phe?Val?Val?Ala?Ser?Leu?Ser?Val?Thr
305 310 315 320
Gly?Met?Gln?Gln?Val?Gln?Phe?Ser?Leu?Asn?His?Phe?Ser?Ala?Ser?Val
325 330 335
Tyr?Val?Gly?Gln?Pro?Lys?Gly?Asn?Asp?Trp?Phe?Glu?Lys?Gln?Thr?Cys
340 345 350
Gly?Thr?Leu?Asp?Ile?Ser?Cys?Pro?Ser?Trp?Met?Asp?Trp?Phe?His?Gly
355 360 365
Gly?Leu?Gln?Phe?Gln?Val?Glu?His?His?Leu?Phe?Pro?Lys?Leu?Pro?Arg
370 375 380
Cys?His?Leu?Arg?Lys?Ile?Ser?Pro?Phe?Val?Met?Glu?Leu?Cys?Lys?Lys
385 390 395 400
His?Asn?Leu?Ser?Tyr?Asn?Cys?Ala?Ser?Phe?Ser?Glu?Ala?Asn?Glu?Met
405 410 415
Thr?Leu?Arg?Thr?Leu?Arg?Asp?Thr?Ala?Leu?Gln?Ala?Arg?Asp?Leu?Thr
420 425 430
Lys?Pro?Leu?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?Asn?Thr?His?Gly
435 440 445
<210>66
<211>448
<212>PRT
<213>Echium?pitardii
<400>66
Met?Ala?Asn?Ala?Ile?Lys?Lys?Tyr?Ile?Thr?Ala?Glu?Glu?Leu?Lys?Lys
1 5 10 15
His?Asp?Lys?Glu?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Val?Tyr
20 25 30
Asp?Val?Ser?Asp?Trp?Leu?Lys?Asp?His?Pro?Gly?Gly?Lys?Phe?Pro?Leu
35 40 45
Leu?Ser?Leu?Ala?Gly?Gln?Glu?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His
50 55 60
Ser?Gly?Ser?Thr?Trp?Lys?Leu?Leu?Asp?Ser?Phe?Phe?Thr?Gly?Tyr?Tyr
65 70 75 80
Leu?Lys?Asp?Tyr?Ser?Val?ser?Glu?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu
85 90 95
Val?Phe?Glu?Phe?Asn?Lys?Met?Gly?Leu?Phe?Asp?Lys?Lys?Gly?His?Ile
100 105 110
Val?Leu?Val?Thr?Val?Phe?Phe?Ile?Ala?Met?Met?Phe?Ala?Met?Ser?Val
115 120 125
Tyr?Gly?Val?Leu?Phe?Cys?Glu?Gly?Val?Leu?Val?His?Leu?Leu?Ala?Gly
130 135 140
Gly?Leu?Met?Gly?Phe?Val?Trp?Ile?Gln?Ser?Gly?Trp?Ile?Gly?His?Asp
145 150 155 160
Ala?Gly?His?Tyr?Ile?Val?Met?Pro?Asn?Pro?Lys?Leu?Asn?Lys?Leu?Met
165 170 175
Gly?Ile?Val?Ala?Ser?Asn?Cys?Leu?Ser?Gly?Ile?Ser?Ile?Gly?Trp?Trp
180 185 190
Lys?Trp?Asn?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp?Tyr
195 200 205
Asp?Pro?Asp?Leu?Gln?Tyr?Ile?Pro?Phe?Leu?Val?Val?Ser?Ser?Lys?Leu
210 215 220
Phe?Ser?Ser?Leu?Thr?Ser?His?Phe?Tyr?Glu?Lys?Lys?Leu?Thr?Phe?Asp
225 230 235 240
Ser?Leu?Ser?Arg?Phe?Phe?Val?Ser?His?Gln?His?Trp?Thr?Phe?Tyr?Pro
245 250 255
Val?Met?Cys?Ser?Ala?Arg?Val?Asn?Met?Phe?Val?Gln?Ser?Leu?Ile?Met
260 265 270
Leu?Leu?Thr?Lys?Arg?Asn?Val?Phe?Tyr?Arg?Ser?Gln?Glu?Leu?Leu?Gly
275 280 285
Leu?Val?Val?Phe?Trp?Ile?Trp?Tyr?Pro?Leu?Leu?Val?Ser?Cys?Leu?Pro
290 295 300
Asn?Trp?Gly?Glu?Arg?Ile?Met?Phe?Val?Val?Ala?Ser?Leu?Ser?Val?Thr
305 310 315 320
Gly?Leu?Gln?Gln?Val?Gln?Phe?Ser?Leu?Asn?His?Phe?Ala?Ala?Ser?Val
325 330 335
Tyr?Val?Gly?Gln?Pro?Lys?Gly?Ile?Asp?Trp?Phe?Glu?Lys?Gln?Thr?Cys
340 345 350
Gly?Thr?Leu?Asp?Ile?Ser?Cys?Pro?Ser?Trp?Met?Asp?Trp?Phe?His?Gly
355 360 365
Gly?Leu?Gln?Phe?Gln?Val?Glu?His?His?Leu?Phe?Pro?Lys?Leu?Pro?Arg
370 375 380
Cys?His?Leu?Arg?Lys?Ile?Ser?Pro?Phe?Val?Met?Glu?Leu?Cys?Lys?Lys
385 390 395 400
His?Asn?Leu?Ser?Tyr?Asn?Cys?Ala?Ser?Phe?Ser?Gln?Ala?Asn?Glu?Met
405 410 415
Thr?Leu?Arg?Thr?Leu?Arg?Asp?Thr?Ala?Leu?Gln?Ala?Arg?Asp?Leu?Thr
420 425 430
Lys?Pro?Leu?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?Asn?Thr?His?Gly
435 440 445
<210>67
<211>448
<212>PRT
<213>Borago?officinalis
<400>67
Met?Ala?Ala?Gln?Ile?Lys?Lys?Tyr?Ile?Thr?Ser?Asp?Glu?Leu?Lys?Asn
1 5 10 15
His?Asp?Lys?Pro?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Ala?Tyr
20 25 30
Asp?Val?Ser?Asp?Trp?Val?Lys?Asp?His?Pro?Gly?Gly?Ser?Phe?Pro?Leu
35 40 45
Lys?Ser?Leu?Ala?Gly?Gln?Glu?Val?Thr?Asp?Ala?Phe?Val?Ala?Phe?His
50 55 60
Pro?Ala?Ser?Thr?Trp?Lys?Asn?Leu?Asp?Lys?Phe?Phe?Thr?Gly?Tyr?Tyr
65 70 75 80
Leu?Lys?Asp?Tyr?Ser?Val?Ser?Glu?Val?Ser?Lys?Asp?Tyr?Arg?Lys?Leu
85 90 95
Val?Phe?Glu?Phe?Ser?Lys?Met?Gly?Leu?Tyr?Asp?Lys?Lys?Gly?His?Ile
100 105 110
Met?Phe?Ala?Thr?Leu?Cys?Phe?Ile?Ala?Met?Leu?Phe?Ala?Met?Ser?Val
115 120 125
Tyr?Gly?Val?Leu?Phe?Cys?Glu?Gly?Val?Leu?Val?His?Leu?Phe?Ser?Gly
130 135 140
Cys?Leu?Met?Gly?Phe?Leu?Trp?Ile?Gln?Ser?Gly?Trp?Ile?Gly?His?Asp
145 150 155 160
Ala?Gly?His?Tyr?Met?Val?Val?Ser?Asp?Ser?Arg?Leu?Asn?Lys?Phe?Met
165 170 175
Gly?Ile?Phe?Ala?Ala?Asn?Cys?Leu?Ser?Gly?Ile?Ser?Ile?Gly?Trp?Trp
180 185 190
Lys?Trp?Asn?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Glu?Tyr
195 200 205
Asp?Pro?Asp?Leu?Gln?Tyr?Ile?Pro?Phe?Leu?Val?Val?Ser?Ser?Lys?Phe
210 215 220
Phe?Gly?Ser?Leu?Thr?Ser?His?Phe?Tyr?Glu?Lys?Arg?Leu?Thr?Phe?Asp
225 230 235 240
Ser?Leu?Ser?Arg?Phe?Phe?Val?Ser?Tyr?Gln?His?Trp?Thr?Phe?Tyr?Pro
245 250 255
Ile?Met?Cys?Ala?Ala?Arg?Leu?Asn?Met?Tyr?Val?Gln?Ser?Leu?Ile?Met
260 265 270
Leu?Leu?Thr?Lys?Arg?Asn?Val?Ser?Tyr?Arg?Ala?His?Glu?Leu?Leu?Gly
275 280 285
Cys?Leu?Val?Phe?Ser?Ile?Trp?Tyr?Pro?Leu?Leu?Val?Ser?Cys?Leu?Pro
290 295 300
Asn?Trp?Gly?Glu?Arg?Ile?Met?Phe?Val?Ile?Ala?Ser?Leu?Ser?Val?Thr
305 310 315 320
Gly?Met?Gln?Gln?Val?Gln?Phe?Ser?Leu?Asn?His?Phe?Ser?Ser?Ser?Val
325 330 335
Tyr?Val?Gly?Lys?Pro?Lys?Gly?Asn?Asn?Trp?Phe?Glu?Lys?Gln?Thr?Asp
340 345 350
Gly?Thr?Leu?Asp?Ile?Ser?Cys?Pro?Pro?Trp?Met?Asp?Trp?Phe?His?Gly
355 360 365
Gly?Leu?Gln?Phe?Gln?Ile?Glu?His?His?Leu?Phe?Pro?Lys?Met?Pro?Arg
370 375 380
Cys?Asn?Leu?Arg?Lys?Ile?Ser?Pro?Tyr?Val?Ile?Glu?Leu?Cys?Lys?Lys
385 390 395 400
His?Asn?Leu?Pro?Tyr?Asn?Tyr?Ala?Ser?Phe?Ser?Lys?Ala?Asn?Glu?Met
405 410 415
Thr?Leu?Arg?Thr?Leu?Arg?Asn?Thr?Ala?Leu?Gln?Ala?Arg?Asp?Ile?Thr
420 425 430
Lys?Pro?Leu?Pro?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?His?Thr?His?Gly
435 440 445
<210>68
<211>446
<212>PRT
<213>Borago?officinalis
<400>68
Met?Glu?Gly?Thr?Lys?Lys?Tyr?Ile?Ser?Val?Gly?Glu?Leu?Glu?Lys?His
1 5 10 15
Asn?Gln?Leu?Gly?Asp?Val?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Val?Tyr?Asn
20 25 30
Val?Thr?Asp?Trp?Ile?Lys?Lys?His?Pro?Gly?Gly?Asp?Val?Pro?Ile?Met
35 40 45
Asn?Leu?Ala?Gly?Gln?Asp?Ala?Thr?Asp?Ala?Phe?Ile?Ala?Tyr?His?Pro
50 55 60
Gly?Thr?Ala?Trp?Lys?Asn?Leu?Glu?Asn?Leu?Phe?Thr?Gly?Tyr?His?Leu
65 70 75 80
Glu?Asp?Tyr?Leu?Val?Ser?Glu?Ile?Ser?Lys?Asp?Tyr?Arg?Lys?Leu?Ala
85 90 95
Ser?Glu?Phe?Ser?Lys?Ala?Gly?Leu?Phe?Glu?Lys?Lys?Gly?His?Thr?Val
100 105 1l0
Ile?Tyr?Cys?Leu?Ser?Phe?Ile?Ala?Leu?Leu?Leu?Cys?Gly?Cys?Val?Tyr
115 120 125
Gly?Val?Leu?Cys?Ser?Asn?Ser?Leu?Trp?Val?His?Met?Leu?Ser?Gly?Ala
130 135 140
Met?Leu?Gly?Met?Cys?Phe?Ile?Gln?Ala?Ala?Tyr?Leu?Gly?His?Asp?Ser
145 150 155 160
Gly?His?Tyr?Thr?Met?Met?Ser?Ser?Lys?Gly?Tyr?Asn?Lys?Phe?Ala?Gln
165 170 175
Val?Leu?Asn?Gly?Asn?Cys?Leu?Thr?Gly?Ile?Ser?Ile?Ala?Trp?Trp?Lys
180 185 190
Trp?Thr?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp?Tyr?Asp
195 200 205
Pro?Asp?Leu?Gln?His?Leu?Pro?Val?Phe?Ala?Val?Pro?Ser?Ser?Phe?Phe
210 215 220
Lys?Ser?Leu?Thr?Ser?Arg?Phe?Tyr?Gly?Arg?Glu?Leu?Thr?Phe?Asp?Gly
225 230 235 240
Leu?Ser?Arg?Phe?Leu?Val?Ser?Tyr?Gln?His?Phe?Thr?Ile?Tyr?Leu?Val
245 250 255
Met?Ile?Phe?Gly?Arg?Ile?Asn?Leu?Tyr?Val?Gln?Thr?Phe?Leu?Leu?Leu
260 265 270
Phe?Ser?Thr?Arg?Lys?Val?Pro?Asp?Arg?Ala?Leu?Asn?Ile?Ile?Gly?Ile
275 280 285
Leu?Val?Tyr?Trp?Thr?Trp?Phe?Pro?Tyr?Leu?Val?Ser?Cys?Leu?Pro?Asn
290 295 300
Trp?Asn?Glu?Arg?Val?Leu?Phe?Val?Leu?Thr?Cys?Phe?Ser?Val?Thr?Ala
305 310 315 320
Leu?Gln?His?Ile?Gln?Phe?Thr?Leu?Asn?His?Phe?Ala?Ala?Asp?Val?Tyr
325 330 335
Val?Gly?Pro?Pro?Thr?Gly?Thr?Asn?Trp?Phe?Glu?Lys?Gln?Ala?Ala?Gly
340 345 350
Thr?Ile?Asp?Ile?Ser?Cys?Ser?Ser?Trp?Met?Asp?Trp?Phe?Phe?Gly?Gly
355 360 365
Leu?Gln?Phe?Gln?Leu?Glu?His?His?Leu?Phe?Pro?Arg?Met?Pro?Arg?Cys
370 375 380
Gln?Leu?Arg?Asn?Ile?Ser?Pro?Ile?Val?Gln?Asp?Tyr?Cys?Lys?Lys?His
385 390 395 400
Asn?Leu?Pro?Tyr?Arg?Ser?Leu?Ser?Phe?Phe?Asp?Ala?Asn?Val?Ala?Thr
405 4l0 415
Ile?Lys?Thr?Leu?Arg?Thr?Ala?Ala?Leu?Gln?Ala?Arg?Asp?Leu?Thr?Val
420 425 430
Val?Pro?Gln?Asn?Leu?Leu?Trp?Glu?Ala?Phe?Asn?Thr?His?Gly
435 440 445
<210>69
<211>458
<212>PRT
<213>Helianthus?annus
<400>69
Met?Val?Ser?Pro?Ser?Ile?Glu?Val?Leu?Asn?Ser?Ile?Ala?Asp?Gly?Lys
1 5 10 15
Lys?Tyr?Ile?Thr?Ser?Lys?Glu?Leu?Lys?Lys?His?Asn?Asn?Pro?Asn?Asp
20 25 30
Leu?Trp?Ile?Ser?Ile?Leu?Gly?Lys?Val?Tyr?Asn?Val?Thr?Glu?Trp?Ala
35 40 45
Lys?Glu?His Pro?Gly?Gly?Asp?Ala?Pro?Leu?Ile?Asn?Leu?Ala?Gly?Gln
50 55 60
Asp?Val?Thr?Asp?Ala?Phe?Ile?Ala?Phe?His?Pro?Gly?Thr?Ala?Trp?Lys
65 70 75 80
His?Leu?Asp?Lys?Leu?Phe?Thr?Gly?Tyr?His?Leu?Lys?Asp?Tyr?Gln?Val
85 90 95
Ser?Asp?Ile?Ser?Arg?Asp?Tyr?Arg?Lys?Leu?Ala?Ser?Glu?Phe?Ala?Lys
100 105 110
Ala?Gly?Met?Phe?Glu?Lys?Lys?Gly?His?Gly?Val?Ile?Tyr?Ser?Leu?Cys
115 120 125
Phe?Val?Ser?Leu?Leu?Leu?Ser?Ala?Cys?Val?Tyr?Gly?Val?Leu?Tyr?Ser
130 135 140
Gly?Ser?Phe?Trp?Ile?His?Met?Leu?Ser?Gly?Ala?Ile?Leu?Gly?Leu?Ala
145 150 155 160
Trp?Met?Gln?Ile?Ala?Tyr?Leu?Gly?His?Asp?Ala?Gly?His?Tyr?Gln?Met
165 170 175
Met?Ala?Thr?Arg?Gly?Trp?Asn?Lys?Phe?Ala?Gly?Ile?Phe?Ile?Gly?Asn
180 185 190
Cys?Ile?Thr?Gly?Ile?Ser?Ile?Ala?Trp?Trp?Lys?Trp?Thr?His?Asn?Ala
195 200 205
His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp?Tyr?Asp?Pro?Asp?Leu?Gln?His
210 215 220
Leu?Pro?Met?Leu?Ala?Val?Ser?Ser?Lys?Leu?Phe?Asn?Ser?Ile?Thr?Ser
225 230 235 240
Val?Phe?Tyr?Gly?Arg?Gln?Leu?Thr?Phe?Asp?Pro?Leu?Ala?Arg?Phe?Phe
245 250 255
Val?Ser?Tyr?Gln?His?Tyr?Leu?Tyr?Tyr?Pro?Ile?Met?Cys?Val?Ala?Arg
260 265 270
Val?Asn?Leu?Tyr?Leu?Gln?Thr?Ile?Leu?LeuLeu?Ile?Ser?Lys?Arg?Lys
275 280 285
Ile?Pro?Asp?Arg?Gly?Leu?Asn?Ile?Leu?Gly?Thr?Leu?Ile?Phe?Trp?Thr
290 295 300
Trp?Phe?Pro?Leu?Leu?Val?Ser?Arg?Leu?Pro?Asn?Trp?Pro?Glu?Arg?Val
305 310 315 320
Ala?Phe?Val?Leu?Val?Ser?Phe?Cys?Val?Thr?Gly?Ile?Gln?His?Ile?Gln
325 330 335
Phe?Thr?Leu?Asn?His?Phe?Ser?Gly?Asp?Val?Tyr?Val?Gly?Pro?Pro?Lys
340 345 350
Gly?Asp?Asn?Trp?Phe?Glu?Lys?Gln?Thr?Arg?Gly?Thr?Ile?Asp?Ile?Ala
355 360 365
Cys?Ser?Ser?Trp?Met?Asp?Trp?Phe?Phe?Gly?Gly?Leu?Gln?Phe?Gln?Leu
370 375 380
Glu?His?His?Leu?Phe?Pro?Arg?Leu?Pro?Arg?Cys?His?Leu?Arg?Ser?Ile
385 390 395 400
Ser?Pro?Ile?Cys?Arg?Glu?Leu?Cys?Lys?Lys?Tyr?Asn?Leu?Pro?Tyr?Val
405 410 415
Ser?Leu?Ser?Phe?Tyr?Asp?Ala?Asn?Val?Thr?Thr?Leu?Lys?Thr?Leu?Arg
420 425 430
Thr?Ala?Ala?Leu?Gln?Ala?Arg?Asp?Leu?Thr?Asn?Pro?Ala?Pro?Gln?Asn
435 440 445
Leu?Ala?Trp?Glu?Ala?Phe?Asn?Thr?His?Gly
450 455
<210>70
<211>449
<212>PRT
<213>Arabidopsis?thaliana
<400>70
Met?Ala?Asp?Gln?Thr?Lys?Lys?Arg?Tyr?Val?Thr?Ser?Glu?Asp?Leu?Lys
1 5 10 15
Lys?His?Asn?Lys?Pro?Gly?Asp?Leu?Trp?Ile?Ser?Ile?Gln?Gly?Lys?Val
20 25 30
Tyr?Asp?Val?Ser?Asp?Trp?Val?Lys?Ser?His?Pro?Gly?Gly?Glu?Ala?Ala
35 40 45
Ile?Leu?Asn?Leu?Ala?Gly?Gln?Asp?Val?Thr?Asp?Ala?Phe?Ile?Ala?Tyr
50 55 60
His?Pro?Gly?Thr?Ala?Trp?His?His?Leu?Glu?Lys?Leu?His?Asn?Gly?Tyr
65 70 75 80
His?Val?Arg?Asp?His?His?Val?Ser?Asp?Val?Ser?Arg?Asp?Tyr?Arg?Arg
85 90 95
Leu?Ala?Ala?Glu?Phe?Ser?Lys?Arg?Gly?Leu?Phe?Asp?Lys?Lys?Gly?His
100 105 110
Val?Thr?Leu?Tyr?Thr?Leu?Thr?Cys?Val?Gly?Val?Met?Leu?Ala?Ala?Val
115 120 125
Leu?Tyr?Gly?Val?Leu?Ala?Cys?Thr?Ser?Ile?Trp?Ala?His?Leu?Ile?Ser
130 135 140
Ala?Val?Leu?Leu?Gly?Leu?Leu?Trp?Ile?Gln?Ser?Ala?Tyr?Val?Gly?His
145 150 155 160
Asp?Ser?Gly?His?Tyr?Thr?Val?Thr?Ser?Thr?Lys?Pro?Cys?Asn?Lys?Leu
165 170 175
Ile?Gln?Leu?Leu?Ser?Gly?Asn?Cys?Leu?Thr?Gly?Ile?Ser?Ile?Ala?Trp
180 185 190
Trp?Lys?Trp?Thr?His?Asn?Ala?His?His?Ile?Ala?Cys?Asn?Ser?Leu?Asp
195 200 205
His?Asp?Pro?Asp?Leu?Gln?His?Ile?Pro?Ile?Phe?Ala?Val?Ser?Thr?Lys
210 215 220
Phe?Phe?Asn?Ser?Met?Thr?Ser?Arg?Phe?Tyr?Gly?Arg?Lys?Leu?Thr?Phe
225 230 235 240
Asp?Pro?Leu?Ala?Arg?Phe?Leu?Ile?Ser?Tyr?Gln?His?Trp?Thr?Phe?Tyr
245 250 255
Pro?Val?Met?Cys?Val?Gly?Arg?Ile?Asn?Leu?Phe?Ile?Gln?Thr?Phe?Leu
260 265 270
Leu?Leu?Phe?Ser?Lys?Arg?His?Val?Pro?Asp?Arg?Ala?Leu?Asn?Ile?Ala
275 280 285
Gly?Ile?Leu?Val?Phe?Trp?Thr?Trp?Phe?Pro?Leu?Leu?Val?Ser?Phe?Leu
290 295 300
Pro?Asn?Trp?Gln?Glu?Arg?Phe?Ile?Phe?Val?Phe?Val?Ser?Phe?Ala?Val
305 310 315 320
Thr?Ala?Ile?Gln?His?Val?Gln?Phe?Cys?Leu?Asn?His?Phe?Ala?Ala?Asp
325 330 335
Val?Tyr?Thr?Gly?Pro?Pro?Asn?Gly?Asn?Asp?Trp?Phe?Glu?Lys?Gln?Thr
340 345 350
Ala?Gly?Thr?Leu?Asp?Ile?Ser?Cys?Arg?Ser?Phe?Met?Asp?Trp?Phe?Phe
355 360 365
Gly?Gly?Leu?Gln?Phe?Gln?Leu?Glu?His?His?Leu?Phe?Pro?Arg?Leu?Pro
370 375 380
Arg?Cys?His?Leu?Arg?Thr?Val?Ser?Pro?Val?Val?Lys?Glu?Leu?Cys?Lys
385 390 395 400
Lys?His?Asn?Leu?Pro?Tyr?Arg?Ser?Leu?Ser?Trp?Trp?Glu?Ala?Asn?Val
405 410 415
Trp?Thr?Ile?Arg?Thr?Leu?Lys?Asn?Ala?Ala?Ile?Gln?Ala?Arg?Asp?Ala
420 425 430
Thr?Asn?Pro?Val?Leu?Lys?Asn?Leu?Leu?Trp?Glu?Ala?Val?Asn?Thr?His
435 440 445
Gly
<210>71
<211>449
<212>PRT
<213>Arabidopsis?thaliana
<400>71
Met?Ala?Glu?Glu?Thr?Glu?Lys?Lys?Tyr?Ile?Thr?Asn?Glu?Asp?Leu?Lys
1 5 10 15
Lys?His?Asn?Lys?Ser?Gly?Asp?Leu?Trp?Ile?Ala?Ile?Gln?Gly?Lys?Val
20 25 30
Tyr?Asn?Val?Ser?Asp?Trp?Ile?Lys?Thr?His?Pro?Gly?Gly?Asp?Thr?Val
35 40 45
Ile?Leu?Asn?Leu?Val?Gly?Gln?Asp?Val?Thr?Asp?Ala?Phe?Ile?Ala?Phe
50 55 60
His?Pro?Gly?Thr?Ala?Trp?His?His?Leu?Asp?His?Leu?Phe?Thr?Gly?Tyr
65 70 75 80
His?Ile?Arg?Asp?Phe?Gln?Val?Ser?Glu?Val?Ser?Arg?Asp?Tyr?Arg?Arg
85 90 95
Met?Ala?Ala?Glu?Phe?Arg?Lys?Leu?Gly?Leu?Phe?Glu?Asn?Lys?Gly?His
100 105 110
Val?Thr?Leu?Tyr?Thr?Leu?Ala?Phe?Val?Ala?Ala?Met?Phe?Leu?Gly?Val
115 120 125
Leu?Tyr?Gly?Val?Leu?Ala?Cys?Thr?Ser?Val?Phe?Ala?His?Gln?Ile?Ala
130 135 140
Ala?Ala?Leu?Leu?Gly?Leu?Leu?Trp?Ile?Gln?Ser?Ala?Tyr?Ile?Gly?His
145 150 155 160
Asp?Ser?Gly?His?Tyr?Val?Ile?Met?Ser?Asn?Lys?Ser?Tyr?Asn?Arg?Phe
165 l70 175
Ala?Gln?Leu?Leu?Ser?Gly?Asn?Cys?Leu?Thr?Gly?Ile?Ser?Ile?Ala?Trp
180 185 190
Trp?Lys?Trp?Thr?His?Asn?Ala?His?His?Leu?Ala?Cys?Asn?Ser?Leu?Asp
195 200 205
Tyr?Asp?Pro?Asp?Leu?Gln?His?Ile?Pro?Val?Phe?Ala?Val?Ser?Thr?Lys
210 215 220
Phe?Phe?Ser?Ser?Leu?Thr?Ser?Arg?Phe?Tyr?Asp?Arg?Lys?Leu?Thr?Phe
225 230 235 240
Asp?Pro?Val?Ala?Arg?Phe?Leu?Val?Ser?Tyr?Gln?His?Phe?Thr?Tyr?Tyr
245 250 255
Pro?Val?Met?Cys?Phe?Gly?Arg?Ile?Asn?Leu?Phe?Ile?Gln?Thr?Phe?Leu
260 265 270
Leu?Leu?Phe?Ser?Lys?Arg?Glu?Val?Pro?Asp?Arg?Ala?Leu?Asn?Phe?Ala
275 280 285
Gly?Ile?Leu?Val?Phe?Trp?Thr?Trp?Phe?Pro?Leu?Leu?Val?Ser?Cys?Leu
290 295 300
Pro?Asn?Trp?Pro?Glu?Arg?Phe?Phe?Phe?Val?Phe?Thr?Ser?Phe?Thr?Val
305 310 315 320
Thr?Ala?Leu?Gln?His?Ile?Gln?Phe?Thr?Leu?Asn?His?Phe?Ala?Ala?Asp
325 330 335
Val?Tyr?Val?Gly?Pro?Pro?Thr?Gly?Ser?Asp?Trp?Phe?Glu?Lys?Gln?Ala
340 345 350
Ala?Gly?Thr?Ile?Asp?Ile?Ser?Cys?Arg?Ser?Tyr?Met?Asp?Trp?Phe?Phe
355 360 365
Gly?Gly?Leu?Gln?Phe?Gln?Leu?Glu?His?His?Leu?Phe?Pro?Arg?Leu?Pro
370 375 380
Arg?Cys?His?Leu?Arg?Lys?Val?Ser?Pro?Val?Val?Gln?Glu?Leu?Cys?Lys
385 390 395 400
Lys?His?Asn?Leu?Pro?Tyr?Arg?Ser?Met?Ser?Trp?Phe?Glu?Ala?Asn?Val
405 410 415
Leu?Thr?Ile?Asn?Thr?Leu?Lys?Thr?Ala?Ala?Tyr?Gln?Ala?Arg?Asp?Val
420 425 430
Ala?Asn?Pro?Val?Val?Lys?Asn?Leu?Val?Trp?Glu?Ala?Leu?Asn?Thr?His
435 440 445
Gly
<210>72
<211>4
<212>PRT
<213>Artificial?Sequence
<220>
<223>Conserved?motif
<400>72
His?Pro?Gly?Gly
1
<210>73
<211>5
<212>PRT
<213>Artificial?Sequence
<220>
<223>Conserved?motif
<220>
<221>MISC_FEATURE
<222>(2)..(2)
<223>X＝any?amino?acid
<220>
<221>MISC_FEATURE
<222>(3)..(3)
<223>X＝any?amino?acid
<400>73
Gln?Xaa?Xaa?His?His
1 5
<210>74
<211>271
<212>PRT
<213>Thraustochytrium?sp.
<400>74
Met?Met?Glu?Pro?Leu?Asp?Arg?Tyr?Arg?Ala?Leu?Ala?Glu?Leu?Ala?Ala
1 5 10 15
Arg?Tyr?Ala?Ser?Ser?Ala?Ala?Phe?Lys?Trp?Gln?Val?Thr?Tyr?Asp?Ala
20 25 30
Lys?Asp?Ser?Phe?Val?Gly?Pro?Leu?Gly?Ile?Arg?Glu?Pro?Leu?Gly?Leu
35 40 45
Leu?Val?Gly?Ser?Val?Val?Leu?Tyr?Leu?Ser?Leu?Leu?Ala?Val?Val?Tyr
50 55 60
Ala?Leu?Arg?Asn?Tyr?Leu?Gly?Gly?Leu?Met?Ala?Leu?Arg?Ser?Val?His
65 70 75 80
Asn?Leu?Gly?Leu?Cys?Leu?Phe?Ser?Gly?Ala?Val?Trp?Ile?Tyr?Thr?Ser
85 90 95
Tyr?Leu?Met?Ile?Gln?Asp?Gly?His?Phe?Arg?Ser?Leu?Glu?Ala?Ala?Thr
100 105 110
Cys?Glu?Pro?Leu?Lys?His?Pro?His?Phe?Gln?Leu?Ile?Ser?Leu?Leu?Phe
115 120 125
Ala?Leu?Ser?Lys?Ile?Trp?Glu?Trp?Phe?Asp?Thr?Val?Leu?Leu?Ile?Val
130 135 140
Lys?Gly?Asn?Lys?Leu?Arg?Phe?Leu?His?Val?Leu?His?His?Ala?Thr?Thr
145 150 155 160
Phe?Trp?Leu?Tyr?Ala?Ile?Asp?His?Ile?Phe?Leu?Ser?Ser?Ile?Lys?Tyr
165 170 175
Gly?Val?Ala?Val?Asn?Ala?Phe?Ile?His?Thr?Val?Met?Tyr?Ala?His?Tyr
180 185 190
Phe?Arg?Pro?Phe?Pro?Lys?Gly?Leu?Arg?Pro?Leu?Ile?Thr?Gln?Leu?Gln
195 200 205
Ile?Val?Gln?Phe?Ile?Phe?Ser?Ile?Gly?Ile?His?Thr?Ala?Ile?Tyr?Trp
210 215 220
His?Tyr?Asp?Cys?Glu?Pro?Leu?Val?His?Thr?His?Phe?Trp?Glu?Tyr?Val
225 230 235 240
Thr?Pro?Tyr?Leu?Phe?Val?Val?Pro?Phe?Leu?Ile?Leu?Phe?Phe?Asn?Phe
245 250 255
Tyr?Leu?Gln?Gln?Tyr?Val?Leu?Ala?Pro?Ala?Lys?Thr?Lys?Lys?Ala
260 265 270
<210>75
<211>266
<212>PRT
<213>Dabio?rerio
<400>75
Met?Ser?Val?Leu?Ala?Leu?Gln?Glu?Tyr?Glu?Phe?Glu?Arg?Gln?Phe?Asn
1 5 10 15
Glu?Asp?Glu?Ala?Ile?Arg?Trp?Met?Gln?Glu?Asn?Trp?Lys?Lys?Ser?Phe
20 25 30
Leu?Phe?Ser?Ala?Leu?Tyr?Ala?Ala?Cys?Ile?Leu?Gly?Gly?Arg?His?Val
35 40 45
Met?Lys?Gln?Arg?Glu?Lys?Phe?Glu?Leu?Arg?Lys?Pro?Leu?Val?Leu?Trp
50 55 60
Ser?Leu?Thr?Leu?Ala?Ala?Phe?Ser?Ile?Phe?Gly?Ala?Ile?Arg?Thr?Gly
65 70 75 80
Gly?Tyr?Met?Val?Asn?Ile?Leu?Met?Thr?Lys?Gly?Leu?Lys?Gln?Ser?Val
85 90 95
Cys?Asp?Gln?Ser?Phe?Tyr?Asn?Gly?Pro?Val?Ser?Lys?Phe?Trp?Ala?Tyr
100 105 110
Ala?Phe?Val?Leu?Ser?Lys?Ala?Pro?Glu?Leu?Gly?Asp?Thr?Leu?Phe?Ile
115 120 125
Val?Leu?Arg?Lys?Gln?Lys?Leu?Ile?Phe?Leu?His?Trp?Tyr?His?His?Ile
130 135 140
Thr?Val?Leu?Leu?Tyr?Ser?Trp?Tyr?Ser?Tyr?Lys?Asp?Met?Val?Ala?Gly
145 150 155 160
Gly?Gly?Trp?Phe?Met?Thr?Met?Asn?Tyr?Leu?Val?His?Ala?Val?Met?Tyr
165 170 175
Ser?Tyr?Tyr?Ala?Leu?Arg?Ala?Ala?Gly?Phe?Lys?Ile?Ser?Arg?Lys?Phe
180 185 190
Ala?Met?Phe?Ile?Thr?Leu?Thr?Gln?Ile?Thr?Gln?Met?Val?Met?Gly?Cys
195 200 205
Val?Val?Asn?Tyr?Leu?Val?Tyr?Leu?Trp?Met?Gln?Gln?Gly?Gln?Glu?Cys
210 215 220
Pro?Ser?His?Val?Gln?Asn?Ile?Val?Trp?Ser?Ser?Leu?Met?Tyr?Leu?Ser
225 230 235 240
Tyr?Phe?Val?Leu?Phe?Cys?Gln?Phe?Phe?Phe?Glu?Ala?Tyr?Ile?Thr?Lys
245 250 255
Arg?Lys?Ser?Asn?Ala?Ala?Lys?Lys?Ser?Gln
260 265
<210>76
<211>320
<212>PRT
<213>Pavlova?lutheri
<400>76
His?Glu?Ala?Ser?Cys?Arg?Ile?Arg?His?Glu?Ala?Ala?Leu?Trp?Ser?Trp
1 5 10 15
Leu?Pro?Thr?Tyr?Asp?Glu?Phe?Val?Asp?Gly?Leu?Ser?Phe?Val?Asp?Arg
20 25 30
Glu?Lys?Ile?Gly?Val?His?Met?Val?Asp?Gln?Gly?Val?Ile?Thr?Ser?Ala
35 40 45
Glu?Trp?Ala?Ala?Ile?Ser?Val?Asp?Lys?His?Met?Ser?Phe?Phe?Ser?Asp
50 55 60
Ala?Ala?Glu?Phe?Thr?Gly?Asp?His?Trp?Ile?Ile?Pro?Leu?Val?Ala?Val
65 70 75 80
Ala?Leu?Tyr?Leu?Val?Met?Ile?Val?Val?Gly?Pro?Met?Ile?Met?Ala?Asn
85 90 95
Arg?Pro?Pro?Leu?Pro?Val?Asn?Gly?Leu?Ala?Cys?Ala?Trp?Asn?Trp?Phe
100 105 110
Leu?Ala?Ala?Phe?Ser?Thr?Phe?Gly?Val?Ala?Cys?Thr?Trp?His?Cys?Ile
115 120 125
Phe?Thr?Arg?Leu?Arg?Ser?Arg?Gly?Phe?Glu?Ser?Thr?Thr?Cys?Gly?Ser
130 135 140
Ala?Met?Phe?Met?Ser?Gln?Gly?Tyr?Val?Gly?Leu?Ala?Met?Leu?Leu?Phe
145 150 155 160
Ile?Tyr?Ser?Lys?Leu?Phe?Glu?Leu?Ile?Asp?Thr?Phe?Phe?Leu?Ile?Ala
165 170 175
Lys?Lys?Ala?Asp?Val?Ile?Phe?Leu?His?Trp?Tyr?His?His?Val?Thr?Val
180 185 190
Leu?Leu?Tyr?Cys?Trp?His?Ser?His?Ser?Val?Arg?Ile?Pro?Ser?Gly?Ile
195 200 205
Trp?Phe?Ala?Ala?Met?Asn?Tyr?Phe?Val?His?Ala?Ile?Met?Tyr?Ser?Tyr
210 215 220
Phe?Ala?Met?Thr?Gln?Met?Gly?Pro?Arg?Tyr?Arg?Lys?Leu?Val?Arg?Pro
225 230 235 240
Tyr?Ala?Arg?Leu?Ile?Thr?Thr?Leu?Gln?Ile?Ser?Gln?Met?Phe?Val?Gly
245 250 255
Leu?Ile?Val?Asn?Gly?Ser?Ile?Ile?Tyr?Phe?Thr?Ser?Leu?Gly?His?Ala
260 265 270
Cys?Lys?Ser?Ser?Lys?Thr?Asn?Thr?Ile?Leu?Ser?Trp?Leu?Met?Tyr?Leu
275 280 285
Ser?Tyr?Phe?Val?Leu?Phe?Gly?Leu?Leu?Tyr?Leu?Arg?Asn?Tyr?Ile?Leu
290 295 300
Gly?Thr?His?Gly?Lys?Pro?Ala?Gly?Lys?Arg?Ala?Lys?Gly?Lys?Ala?Glu
305 310 315 320
<210>77
<211>282
<212>PRT
<213>Danio?rerio
<400>77
Met?Glu?Thr?Phe?Ser?His?Arg?Val?Asn?Ser?Tyr?Ile?Asp?Ser?Trp?Met
1 5 10 15
Gly?Pro?Arg?Asp?Leu?Arg?Val?Thr?Gly?Trp?Phe?Leu?Leu?Asp?Asp?Tyr
20 25 30
Ile?Pro?Thr?Phe?Ile?Phe?Thr?Val?Met?Tyr?Leu?Leu?Ile?Val?Trp?Met
35 40 45
Gly?Pro?Lys?Tyr?Met?Lys?Asn?Arg?Gln?Ala?Tyr?Ser?Cys?Arg?Ala?Leu
50 55 60
Leu?Val?Pro?Tyr?Asn?Leu?Cys?Leu?Thr?Leu?Leu?Ser?Leu?Tyr?Met?Phe
65 70 75 80
Tyr?Glu?Leu?Val?Met?Ser?Val?Tyr?Gln?Gly?Gly?Tyr?Asn?Phe?Phe?Cys
85 90 95
Gln?Asn?Thr?His?Ser?Gly?Gly?Asp?Ala?Asp?Asn?Arg?Met?Met?Asn?Val
100 105 110
Leu?Trp?Trp?Tyr?Tyr?Phe?Ser?Lys?Leu?Ile?Glu?Phe?Met?Asp?Thr?Phe
115 120 125
Phe?Phe?Ile?Leu?Arg?Lys?Asn?Asn?His?Gln?Ile?Thr?Phe?Leu?His?Val
130 135 140
Tyr?His?His?Ala?Thr?Met?Leu?Asn?Ile?Trp?Trp?Phe?Val?Met?Asn?Trp
145 150 155 160
Val?Pro?Cys?Gly?His?Ser?Tyr?Phe?Gly?Ala?Thr?Phe?Asn?Ser?Phe?Ile
165 170 175
His?Val?Leu?Met?Tyr?Ser?Tyr?Tyr?Gly?Leu?Ser?Ala?Val?Pro?Ala?Leu
180 185 190
Arg?Pro?Tyr?Leu?Trp?Trp?Lys?Lys?Tyr?Ile?Thr?Gln?Gly?Gln?Leu?Val
195 200 205
Gln?Phe?Val?Leu?Thr?Met?Phe?Gln?Thr?Ser?Cys?Ala?Val?Val?Trp?Pro
210 215 220
Cys?Gly?Phe?Pro?Met?Gly?Trp?Leu?Tyr?Phe?Gln?Ile?Ser?Tyr?Met?Val
225 230 235 240
Thr?Leu?Ile?Leu?Leu?Phe?Ser?Asn?Phe?Tyr?Ile?Gln?Thr?Tyr?Lys?Lys
245 250 255
Arg?Ser?Gly?Ser?Val?Asn?Gly?His?Thr?Asn?Gly?Val?Met?Ser?Ser?Glu
260 265 270
Lys?Ile?Lys?His?Arg?Lys?Ala?Arg?Ala?Asp
275 280
<210>78
<211>396
<212>PRT
<213>Pavlova?lutheri
<400>78
Arg?Gly?Leu?Val?Pro?Asn?Ser?Ala?Arg?Gly?Leu?Arg?Asp?Asp?Lys?Asp
1 5 10 15
Asp?Gly?Ser?Leu?Ser?Ala?Thr?Ser?Asp?Phe?Phe?Arg?Ser?Thr?Ile?Thr
20 25 30
Asp?Cys?Gly?Asn?Phe?Cys?Asp?Glu?Ser?Val?Asp?Phe?Gln?Met?Lys?Leu
35 40 45
Phe?Glu?Arg?Asn?Gln?Ile?Ser?Glu?Arg?Cys?Tyr?Phe?Pro?Pro?Gly?Ile
50 55 60
Arg?Ala?Tyr?Arg?Lys?Gly?Glu?Arg?Asp?Phe?Asp?Phe?Ser?Met?Ala?Ala
65 70 75 80
Ala?Arg?Lys?Glu?Phe?Glu?Thr?Val?Val?Phe?Thr?Thr?Val?Asp?Glu?Leu
85 90 95
Leu?Ala?Lys?Thr?Gly?Val?Lys?Pro?Arg?Asp?Ile?Asp?Ile?Leu?Val?Val
100 105 110
Asn?Cys?Ser?Leu?Phe?Asn?Pro?Thr?Pro?Ser?Leu?Ala?Ala?Ile?Val?Ile
115 120 125
Asn?His?Tyr?Gln?Met?Lys?Asp?Ser?Val?Gln?Ser?Tyr?Ser?Leu?Gly?Gly
130 135 140
Met?Gly?Cys?Ser?Ala?Gly?Leu?Ile?Ser?Ile?His?Leu?Ala?Lys?Asp?Leu
145 150 155 160
Leu?Gln?Val?Tyr?Pro?Arg?Lys?Arg?Ala?Leu?Val?Ile?Ser?Thr?Glu?Asn
165 170 175
Ile?Thr?Gln?Asn?Phe?Tyr?Gln?Gly?Asn?Glu?Lys?Ser?Met?Leu?Ile?Ser
180 185 190
Asn?Thr?Leu?Phe?Arg?Met?Gly?Gly?Ala?Ala?Val?Leu?Leu?Ser?Gly?Arg
195 200 205
His?Ala?Asp?Arg?Arg?Val?Ala?Lys?Tyr?Gln?Leu?Leu?His?Thr?Val?Arg
210 215 220
Thr?His?Lys?Gly?Ala?Asp?Pro?Asp?Ala?Tyr?Arg?Cys?Val?Phe?Gln?Glu
225 230 235 240
Glu?Asp?Lys?Ala?Gly?His?Val?Gly?Val?Arg?Leu?Ser?Lys?Asp?Val?Met
245 250 255
Glu?Cys?Ala?Gly?Ala?Ala?Met?Lys?Thr?Asn?Ile?Ser?Val?Leu?Ala?Pro
260 265 270
Leu?Ile?Leu?Pro?Val?Ser?Glu?Gln?Val?Arg?Phe?Leu?Ala?Asn?Tyr?Val
275 280 285
Ala?Arg?Lys?Trp?Leu?Arg?Met?Lys?Gly?Val?Lys?Gly?Tyr?Val?Pro?Asp
290 295 300
Phe?Thr?Thr?Ala?Val?Gln?His?Phe?Cys?Ile?His?Thr?Gly?Gly?Arg?Ala
305 310 315 320
Val?Leu?Asp?Ala?Leu?Gln?Ala?Asn?Leu?Ser?Leu?Ser?Asp?Tyr?Tyr?Leu
325 330 335
Glu?Pro?Ser?Arg?Tyr?Ser?Leu?Trp?Arg?Trp?Gly?Asn?Val?Ser?Ser?Ala
340 345 350
Ser?Val?Trp?Tyr?Glu?Leu?Asp?Trp?Leu?Glu?Lys?Ser?Gly?Arg?Ile?Arg
355 360 365
Arg?Gly?Asp?Lys?Val?Trp?Gln?Ile?Gly?Phe?Gly?Ser?Gly?Phe?Lys?Cys
370 375 380
Asn?Ser?Ala?Val?Trp?Arg?Ala?Cys?Arg?Ala?Met?Pro
385 390 395
<210>79
<211>315
<212>DNA
<213>Heterocapsa?niei
<400>79
gattcaggat?cctttttgca?taggtaccac?tccaccatgt?ttccgatctg?gtagggttgt 60
gtgcgtggtc?cacgcctctt?cacttggaca?agtgccgtcg?ggccaagtgc?cgtcgggcca 120
agtgccgtcg?ggccaaggaa?agcactccag?cgctcacaac?cacctcaccc?ccccctcccg 180
ccccccgctt?cgttttcgct?tgctttcagg?tggatggggg?cccgctgggt?gcctggaggc 240
cagtcgtatt?tttgtgcgac?catcaattcc?accgtgcatg?ttgtcatgta?cgcctattac 300
ttttctagat?caatc 315
<210>80
<211>100
<212>PRT
<213>Artificial?Sequence
<220>
<223>Protein?encoded?by?SEQID?NO：79?which?comprises?a?stop?codonbetween?residues?17?and?18?suggesting?the?presence?of?an?intron
<400>80
Asp?Ser?Gly?Ser?Phe?Leu?His?Arg?Tyr?His?Ser?Thr?Met?Phe?Pro?Ile
1 5 10 15
Trp?Gly?Cys?Val?Arg?Gly?Pro?Arg?Leu?Phe?Thr?Trp?Thr?Ser?Ala?Val
20 25 30
Gly?Pro?Ser?Ala?Val?Gly?Pro?Ser?Ala?Val?Gly?Pro?Arg?Lys?Ala?Leu
35 40 45
Gln?Arg?Ser?Gln?Pro?Pro?His?Pro?Pro?Leu?Pro?Pro?Pro?Ala?Ser?Phe
50 55 60
Ser?Leu?Ala?Phe?Arg?Trp?Met?Gly?Ala?Arg?Trp?Val?Pro?Gly?Gly?Gln
65 70 75 80
Ser?Tyr?Phe?Cys?Ala?Thr?Ile?Asn?Ser?Thr?Val?His?Val?Val?Met?Tyr
85 90 95
Ala?Tyr?Tyr?Phe
100
<210>81
<211>46
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>81
gctacgcccg?gggatcctcg?aggctggcgc?aacgcaatta?atgtga 46
<210>82
<211>84
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>82
cacaggaaac?agcttgacat?cgattaccgg?caattgtacg?gcggccgcta?cggatatcct 60
cgctcgagct?cgcccggggt?agct 84
<210>83
<211>46
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>83
agcacatcga?tgaaggagat?atacccatgg?ctaatgcaat?caagaa 46
<210>84
<211>36
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>84
acgatgcggc?cgctcaacca?tgagtattaa?gagctt 36
<210>85
<211>294
<212>PRT
<213>Pavlova?salina
<400>85
Met?Pro?Thr?Trp?Gly?Glu?Phe?Val?Ala?Gly?Leu?Thr?Tyr?Val?Glu?Arg
1 5 10 15
Gln?Gln?Met?Ser?Glu?Glu?Leu?Val?Arg?Ala?Asn?Lys?Leu?Pro?Leu?Ser
20 25 30
Leu?Ile?Pro?Glu?Val?Asp?Phe?Phe?Thr?Ile?Ala?Ser?Val?Tyr?Val?Gly
35 40 45
Asp?His?Trp?Arg?Ile?Pro?Phe?Thr?Ala?Ile?Ser?Ala?Tyr?Leu?Val?Leu
50 55 60
Ile?Thr?Leu?Gly?Pro?Gln?Leu?Met?Ala?Arg?Arg?Pro?Pro?Leu?Pro?Ile
65 70 75 80
Asn?Thr?Leu?Ala?Cys?Leu?Trp?Asn?Phe?Ala?Leu?Ser?Leu?Phe?Ser?Phe
85 90 95
Val?Gly?Met?Ile?Val?Thr?Trp?Thr?Thr?Ile?Gly?Glu?Arg?Leu?Trp?Lys
100 105 110
Asn?Gly?Ile?Glu?Asp?Thr?Val?Cys?Gly?His?Pro?Ile?Phe?Met?Gly?Tyr
115 120 125
Gly?Trp?Ile?Gly?Tyr?Val?Met?Leu?Ala?Phe?Ile?Trp?Ser?Lys?Leu?Phe
130 135 140
Glu?Leu?Ile?Asp?Thr?Val?Phe?Leu?Val?Ala?Lys?Lys?Ala?Asp?Val?Ile
145 150 155 160
Phe?Leu?His?Trp?Tyr?His?His?Val?Thr?Val?Leu?Leu?Tyr?Cys?Trp?His
165 170 175
Ser?Tyr?Ala?Val?Arg?Ile?Pro?Ser?Gly?Ile?Trp?Phe?Ala?Ala?Met?Asn
180 185 190
Tyr?Phe?Val?His?Ala?Ile?Met?Tyr?Ala?Tyr?Phe?Gly?Met?Thr?Gln?Ile
195 200 205
Gly?Pro?Arg?Gln?Arg?Lys?Leu?Val?Arg?Pro?Tyr?Ala?Arg?Leu?Ile?Thr
210 215 220
Thr?Phe?Gln?Leu?Ser?Gln?Met?Gly?Val?Gly?Leu?Ala?Val?Asn?Gly?Leu
225 230 235 240
Ile?Ile?Arg?Tyr?Pro?Ser?Ile?Gly?His?His?Cys?His?Ser?Asn?Lys?Thr
245 250 255
Asn?Thr?Ile?Leu?Ser?Trp?Ile?Met?Tyr?Ala?Ser?Tyr?Phe?Val?Leu?Phe
260 265 270
Ala?Ala?Leu?Tyr?Val?Lys?Asn?Tyr?Ile?Phe?Ser?Lys?Leu?Lys?Ser?Pro
275 280 285
Lys?Arg?Lys?Lys?Val?Glu
290
<210>86
<211>276
<212>PRT
<213>Pavlova?salina
<400>86
Met?Ser?Glu?Glu?Leu?Val?Arg?Ala?Asn?Lys?Leu?Pro?Leu?Ser?Leu?Ile
1 5 10 15
Pro?Glu?Val?Asp?Phe?Phe?Thr?Ile?Ala?Ser?Val?Tyr?Val?Gly?Asp?His
20 25 30
Trp?Arg?Ile?Pro?Phe?Thr?Ala?Ile?Ser?Ala?Tyr?Leu?Val?Leu?Ile?Thr
35 40 45
Leu?Gly?Pro?Gln?Leu?Met?Ala?Arg?Arg?Pro?Pro?Leu?Pro?Ile?Asn?Thr
50 55 60
Leu?Ala?Cys?Leu?Trp?Asn?Phe?Ala?Leu?Ser?Leu?Phe?Ser?Phe?Val?Gly
65 70 75 80
Met?Ile?Val?Thr?Trp?Thr?Thr?Ile?Gly?Glu?Arg?Leu?Trp?Lys?Asn?Gly
85 90 95
Ile?Glu?Asp?Thr?Val?Cys?Gly?His?Pro?Ile?Phe?Met?Gly?Tyr?Gly?Trp
100 105 110
Ile?Gly?Tyr?Val?Met?Leu?Ala?Phe?Ile?Trp?Ser?Lys?Leu?Phe?Glu?Leu
115 120 125
Ile?Asp?Thr?Val?Phe?Leu?Val?Ala?Lys?Lys?Ala?Asp?Val?Ile?Phe?Leu
130 135 140
His?Trp?Tyr?His?His?Val?Thr?Val?Leu?Leu?Tyr?Cys?Trp?His?Ser?Tyr
145 150 155 160
Ala?Val?Arg?Ile?Pro?Ser?Gly?Ile?Trp?Phe?Ala?Ala?Met?Asn?Tyr?Phe
165 170 175
Val?His?Ala?Ile?Met?Tyr?Ala?Tyr?Phe?Gly?Met?Thr?Gln?Ile?Gly?Pro
180 185 190
Arg?Gln?Arg?Lys?Leu?Val?Arg?Pro?Tyr?Ala?Arg?Leu?Ile?Thr?Thr?Phe
195 200 205
Gln?Leu?Ser?Gln?Met?Gly?Val?Gly?Leu?Ala?Val?Asn?Gly?Leu?Ile?Ile
210 215 220
Arg?Tyr?Pro?Ser?Ile?Gly?His?His?Cys?His?Ser?Asn?Lys?Thr?Asn?Thr
225 230 235 240
Ile?Leu?Ser?Trp?Ile?Met?Tyr?Ala?Ser?Tyr?Phe?Val?Leu?Phe?Ala?Ala
245 250 255
Leu?Tyr?Val?Lys?Asn?Tyr?Ile?Phe?Ser?Lys?Leu?Lys?Ser?Pro?Lys?Arg
260 265 270
Lys?Lys?Val?Glu
275
<210>87
<211>20
<212>DNA
<213>Artificial?Sequence
<220>
<223>Oligonucleotide?primer
<400>87
cgctctagaa?ctagtggatc 20
<210>88
<211>223
<212>PRT
<213>Melosira?sp.
<400>88
Thr?Ile?Phe?Lys?Ser?Asn?Ala?Val?Pro?Ala?Leu?Asp?Pro?Tyr?Pro?Ile
1 5 10 15
Lys?Phe?Val?Tyr?Asn?Val?Ser?Gln?Ile?Met?Met?Cys?Ala?Tyr?Met?Thr
20 25 30
Ile?Glu?Ala?Gly?Leu?Val?Ala?Tyr?Arg?Ser?Gly?Tyr?Thr?Val?Met?Pro
35 40 45
Cys?Asn?Asp?Tyr?Asn?Thr?Asn?Asn?Pro?Pro?Val?Gly?Asn?Leu?Leu?Trp
50 55 60
Leu?Phe?Tyr?Ile?Ser?Lys?Val?Trp?Asp?Phe?Trp?Asp?Thr?Ile?Phe?Ile
65 70 75 80
Val?Ile?Gly?Lys?Lys?Trp?Lys?Gln?Leu?Ser?Phe?Leu?His?Val?Tyr?His
85 90 95
His?Thr?Thr?Ile?Phe?Leu?Phe?Tyr?Trp?Leu?Asn?Ser?His?Val?Asn?Tyr
100 105 110
Asp?Gly?Asp?Ile?Tyr?Leu?Thr?Ile?Leu?Leu?Asn?Gly?Phe?Ile?His?Thr
115 120 125
Val?Met?Tyr?Thr?Tyr?Tyr?Phe?Val?Cys?Met?His?Thr?Lys?Val?Pro?Glu
130 135 140
Thr?Gly?Lys?Ser?Leu?Pro?Ile?Trp?Trp?Lys?Ser?Ser?Leu?Thr?Met?Met
145 150 155 160
Gln?Met?Ile?Gln?Phe?Val?Thr?Met?Met?Ser?Gln?Ala?Ser?Tyr?Leu?Leu
165 170 175
Val?Thr?Asn?Cys?Glu?Lys?Thr?Ser?Arg?Gly?Val?Val?Ile?Ala?Tyr?Phe
180 185 190
Val?Tyr?Ile?Phe?Thr?Leu?Leu?Val?Leu?Phe?Ala?Gln?Phe?Phe?Arg?Ala
195 200 205
Ser?Tyr?Met?Lys?Pro?Lys?Gly?Lys?Lys?Ala?Lys?Met?Lys?Lys?Val
210 215 220
<210>89
<211>683
<212>DNA
<213>Melosira?sp.
<400>89
acgatcttca?agtcaaacgc?cgtccctgcc?ctggatccat?accccatcaa?attcgtttac 60
aatgtgtccc?agatcatgat?gtgcgcgtac?atgacgatcg?aggcaggcct?ggtggcctac 120
cgcagtggct?atactgtcat?gccatgcaac?gactacaaca?ccaacaaccc?ccctgtcggg 180
aacctgctgt?ggctgtttta?catttccaaa?gtttgggact?tttgggacac?catctttatc 240
gtgattggca?aaaagtggaa?gcagctgagc?ttcttgcacg?tgtaccacca?caccaccatc 300
tttttgttct?actggctcaa?ctcgcatgtc?aactacgacg?gagatattta?tctgacgatt 360
ctgttgaacg?gcttcatcca?caccgtcatg?tacacttatt?acttcgtttg?catgcacacg 420
aaggtgcccg?agactggaaa?gtcgttgccc?atttggtgga?aatccagtct?caccatgatg 480
caaatgatcc?aattcgtcac?catgatgagc?caggcttcgt?acttgctcgt?gacgaactgc 540
gaaaagacca?gtcggggggt?cgttattgcg?tactttgtgt?acattttcac?tctactcgtc 600
ttatttgctc?agttcttccg?agcatcttac?atgaagccca?agggaaagaa?ggcgaaaatg 660
aagaaggtat?aagctgctgg?cat 683
Claims (221)
1. can synthesis of long-chain polyunsaturated fatty acids the reconstitution cell of (LC-PUFA), it comprises the polynucleotide of at least two kinds of enzymes of one or more codings, each described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein said reconstitution cell is derived from the cell that can not synthesize described LC-PUFA.
2. with respect to the reconstitution cell that waits the non-reconstitution cell of gene to have enhanced synthesis of long-chain polyunsaturated fatty acids ability, it comprises the polynucleotide of at least two kinds of enzymes of one or more codings, each described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide operably are connected with one or more promotors that can express described polynucleotide in described reconstitution cell.
3. the cell of claim 1 or claim 2, wherein at least a enzyme are that Δ 5 prolongs enzymes.
4. the cell of claim 3, wherein Δ 5 prolongs enzymes and also has Δ 6 and prolong enzymic activitys, and wherein with from the synthetic ETA of SDA compares, and described prolongation enzyme is more effectively from the synthetic DPA of EPA.
5. the cell of claim 3 or claim 4, wherein Δ 5 prolongs enzymes and comprises:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
6. the cell of claim 5, wherein Δ 5 prolongs enzymes and comprises:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 90% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
7. each cell in the claim 3 to 6, but wherein Δ 5 prolongs the enzyme purifying from algae.
8. the cell of claim 1 or claim 2, wherein at least a enzyme are that Δ 9 prolongs enzymes.
9. the cell of claim 8, wherein Δ 9 prolongs enzymes and also has Δ 6 and prolong enzymic activitys.
10. the cell of claim 9 wherein with from the synthetic ETA of SDA is compared, and Δ 9 prolongs enzyme more effectively from the synthetic ETrA of ALA.
11. the cell of claim 9 or 10, wherein Δ 9 prolongs enzymes and can be in yeast cell SDA be extended for ETA, GLA be extended for DGLA or both all can.
12. each cell in the claim 9 to 11, wherein Δ 9 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii).
13. the cell of claim 12, wherein Δ 9 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
The aminoacid sequence that ii) has at least 90% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii).
14. each cell in the claim 9 to 13, but wherein Δ 9 prolongs the enzyme purifying from algae or fungi.
15. the cell of claim 1 or claim 2, wherein at least a enzyme are Δ 5/ Δ, 6 difunctional desaturases or Δ 5/ Δ 6 difunctional prolongation enzymes.
16. the cell of claim 15, wherein Δ 5/ Δ 6 difunctional desaturases comprise:
I) aminoacid sequence that provides as SEQ ID NO:15;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:15; Or
Iii) i) or biological active fragment ii).
17. the cell of claim 15 or claim 16, wherein Δ 5/ Δ 6 difunctional desaturases are by the natural generation of fresh-water fishes species.
18. the cell of claim 15, wherein Δ 5/ Δ 6 difunctional prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2 or SEQ ID NO:14;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2 or SEQ ID NO:14; Or
Iii) i) or biological active fragment ii).
19. the cell of claim 1 or claim 2, wherein at least a enzyme are Δ 5 desaturases.
20. the cell of claim 1 or claim 2, wherein at least a enzyme are Δ 8 desaturases.
21. each cell in the claim 1 to 20, it comprise at least a in cell synthetic C20 LC-PUFA, and wherein the total fatty acids of cell comprises at least 2%, at least 4.7% or at least 7.9% C20 LC-PUFA.
22. each cell in the claim 1 to 21, it comprise at least a in cell synthetic ω 3 C20 LC-PUFA, and wherein the total fatty acids of cell comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
23. each cell in the claim 1 to 22, it comprises ω 3 polyunsaturated fatty acids, the product of the product of Δ 6 desaturation that described ω 3 polyunsaturated fatty acids are ALA and/or the Δ 9 prolongation effects of ALA, described product is synthetic in cell, and wherein intracellular ALA is at least 22% or at least 24% to the transformation efficiency of described product.
24. each cell in the claim 1 to 23, wherein LC-PUFA is docosahexenoic acid (DHA).
25. the cell of claim 24,3 kinds or 4 kinds enzymes of the polynucleotide encoding of wherein being introduced, described enzyme are selected from Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzyme and Δ 4 desaturases.
26. the cell of claim 25, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ 6 difunctional desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme, Δ 6 prolongs enzyme and Δ 4 desaturases; Or
Iii) Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases.
27. the cell of claim 24, five kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 4 desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 4 desaturases, Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongation enzymes.
28. the cell of claim 24, wherein cell is the cell of the organism that is suitable for fermenting, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzymes, Δ 6 prolongs enzyme and Δ 4 desaturases at least.
29. the cell in the claim 1 to 23, wherein LC-PUFA is clupanodonic acid (DPA).
30. the cell of claim 29, polynucleotide encoding two or three enzyme of wherein being introduced, described enzyme are selected from Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme and Δ 6 prolongs enzyme.
31. the cell of claim 30, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ, 6 difunctional desaturases and Δ 5/ Δ 6 difunctional prolongation enzymes;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Iii) Δ 5 desaturases, Δ 6 desaturases and Δ 5/ Δ 6 difunctional prolongation enzymes.
32. the cell of claim 29, four kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongation enzymes.
33. the cell of claim 29, wherein cell is the cell of the organism that is suitable for fermenting, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzymes and Δ 6 prolongs enzymes at least.
34. each cell in the claim 29 to 33, it is included in synthetic DPA in the cell, and wherein the total fatty acids of cell comprises at least 0.1%, at least 0.13% or at least 0.5% DPA.
35. each cell in the claim 29 to 34, it is interior from EPA synthetic DPA that it is included in cell, and wherein intracellular EPA is at least 5% or at least 7% to the transformation efficiency of DPA.
36. each cell in the claim 1 to 23, wherein LC-PUFA is timnodonic acid (EPA).
37. the cell of claim 36, polynucleotide encoding Δ 5/ Δ, the 6 difunctional desaturases of wherein being introduced and Δ 5/ Δ 6 difunctional prolongation enzymes.
38. the cell of claim 36, three kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5 desaturases, Δ 6 desaturases and Δ 6 prolong enzyme; Or
Ii) Δ 5 desaturases, Δ 8 desaturases and Δ 9 prolong enzyme.
39. each cell in the claim 36 to 38, it is included in synthetic EPA in the cell, and wherein the total fatty acids of cell comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
40. each cell in the claim 36 to 39, it is included in synthetic EPA in the cell, and wherein intracellular ALA is at least 2% or at least 14.6% to the transformation efficiency of EPA.
41. each cell in the claim 1 to 40, wherein
I) the intracellular EPA of at least a Δ 5 prolongation enzyme catalysiss transforms to DPA; Or
The ii) at least a desaturase that can act on the aliphatic alcohol substrate; Or
Iii) at least a from vertebrate desaturase or its variant desaturase; Or
Iv) i), ii) or any combination iii).
42. the cell of claim 41, wherein Δ 5 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
43. the cell of claim 41 or 42, wherein at least a desaturase comprises:
I) aminoacid sequence that provides as SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22; Or
Iii) i) or biological active fragment ii).
44. each cell in the claim 1 to 43, the linolic acid (LA) that wherein said cell can produce from endogenous, alpha-linolenic acid (ALA) or both produce described LC-PUFA.
45. the cell of claim 44, wherein the ALA of endogenous generation and the ratio of LA are at least 1: 1 or at least 2: 1.
46. each cell in the claim 1 to 45, wherein cell be vegetable cell, from the cell in angiospermous vegetable cell, oilseeds vegetable cell or the seed.
47. the cell of claim 46, wherein at least a promotor is a seed specific promoters.
48. each cell in the claim 1 to 45, wherein cell is a unicellular microorganism.
49. the cell of claim 48, wherein unicellular microorganism is suitable for fermentation.
50. the cell of claim 49, wherein microorganism is a yeast.
51. each cell in the claim 1 to 45, wherein cell is non-human animal's a cell or external human cell.
52. each cell in the claim 1 to 51, its generation are integrated in the interior LC-PUFA of triacylglycerol of described cell.
53. the cell of claim 52, wherein at least 50% LC-PUFA that produces in described cell is integrated in the triacylglycerol.
54. each cell in the claim 1 to 53, protein-coding regions wherein at least a, two or more polynucleotide derive from the algae gene.
55. the cell of claim 54, wherein the algae gene belongs to from Ba Fuzao (Pavlova), for example from Pavlova salina.
56. can produce the reconstitution cell of DHA from lipid acid, described lipid acid is any combination or the miscellany of ALA, LA, GLA, ARA, SDA, ETA, EPA or these lipid acid, wherein said reconstitution cell is derived from the cell that can not synthesize DHA.
57. can produce the reconstitution cell of DPA from lipid acid, described lipid acid is any combination or the miscellany of ALA, LA, GLA, ARA, SDA, ETA, EPA or these lipid acid, wherein said reconstitution cell is derived from the cell that can not synthesize DPA.
58. can produce the reconstitution cell of EPA from lipid acid, described lipid acid is any combination or the miscellany of ALA, LA, GLA, SDA, ETA or these lipid acid, wherein said reconstitution cell is derived from the cell that can not synthesize EPA.
59. reconstitution cell, it can produce ETrA and produce ETA from SDA from ALA, and can produce EPA from lipid acid, described lipid acid is any combination or the miscellany of ALA, LA, GLA, SDA, ETA or these lipid acid, and wherein said reconstitution cell is derived from not synthesizing ETrA, ETA or both cells.
60. be applicable to the reconstitution cell of the organism of fermentation process, wherein said cell can produce DPA from any combination or the miscellany of LA, ALA, arachidonic acid (ARA), eicosatetraenoic acid (ETA) or these lipid acid, and wherein said reconstitution cell is derived from the cell that can not synthesize DPA.
61. the recombinant plant cell that can produce DPA from any combination or the miscellany of LA, ALA, EPA or these lipid acid, wherein vegetable cell is from angiosperm.
62. the vegetable cell of claim 61, it can also produce DHA.
63. can synthesize the reconstitution cell of DGLA, it comprises the polynucleotide of one or both polypeptide that coding is following:
A) peptide species, it is that the Δ 9 that is selected from as next group prolongs enzyme:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
The aminoacid sequence that ii) has at least 40% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii); And/or
B) peptide species, it is Δ 8 desaturases that are selected from as next group:
I) aminoacid sequence that provides as SEQ ID NO:1;
The aminoacid sequence that ii) has at least 40% homogeny with SEQ ID NO:1; Or
Iii) i) or biological active fragment ii),
Wherein said polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein said reconstitution cell is derived from the cell that can not synthesize DGLA.
64. the cell of claim 63, wherein cell can change into ARA with DGLA.
65. the cell of claim 64, wherein cell also comprises the polynucleotide of coded delta 5 desaturases, wherein the polynucleotide of coded delta 5 desaturases can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein cell can produce ARA.
66. each cell in the claim 63 to 65, wherein cell lacks ω 3 desaturase activity, and can not produce ALA.
67. each cell in the claim 63 to 66, wherein cell is the cell of vegetable cell or the organism that is suitable for fermenting.
68. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:1;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 40% homogeny with SEQ ID NO:1; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 8 desaturase activity.
69. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:2;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 60% homogeny with SEQ ID NO:2; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 5 prolongation enzymes and/or Δ 6 prolongation enzymic activitys.
70. the polypeptide of claim 69, wherein polypeptide has Δ 5 prolongation enzymes and Δ 6 prolongation enzymic activitys, and wherein with from the synthetic ETA of SDA compares, and described polypeptide is more effectively from the synthetic DPA of EPA.
71. the polypeptide of claim 69 or 70, but wherein said polypeptide purifying is from algae.
72. each polypeptide in the claim 69 to 71 when it is expressed in yeast cell, is compared with prolonging C22 LC-PUFA, it more effectively prolongs C20 LC-PUFA.
73. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 40% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; With
Iii) i) or biological active fragment ii),
Wherein said polypeptide has Δ 9 and prolongs enzyme and/or Δ 6 prolongation enzymic activitys.
74. the polypeptide of claim 73, wherein polypeptide has Δ 9 prolongation enzymes and Δ 6 prolongation enzymic activitys.
75. the polypeptide of claim 74 wherein with from the synthetic ETA of SDA is compared, described polypeptide is more effectively from the synthetic ETrA of ALA.
76. each polypeptide in the claim 73 to 75, but wherein said polypeptide purifying is from algae or fungi.
77. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:4;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 70% homogeny with SEQ ID NO:4; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 4 desaturase activity.
78. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:60;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 55% homogeny with SEQ ID NO:60; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 5 desaturase activity.
79. be selected from polypeptide with the purifying basically of next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:64;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 90% homogeny with SEQ ID NO:64; With
Iii) i) or biological active fragment ii),
Wherein polypeptide has Δ 6 desaturase activity.
80. each polypeptide in the claim 68 to 78, it can separate from the species of crust husband Trentepohlia and obtains.
81. each polypeptide in the claim 68 to 80, it is also to comprise at least a other the fusion rotein of peptide sequence.
82. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:5 or SEQ ID NO:6;
The sequence of the polypeptide of claim of ii) encoding 68 or claim 81;
The nucleotide sequence that iii) has at least 50% homogeny with SEQ ID NO:5 or SEQ ID NO:6; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
83. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:7 or SEQ ID NO:8;
The sequence of each polypeptide in claim 69 to 72 or the claim 81 of ii) encoding;
The nucleotide sequence that iii) has at least 51% homogeny with SEQ ID NO:7 or SEQ ID NO:8; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
84. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:9 or SEQ ID NO:10;
The sequence of each polypeptide in claim 73 to 76 or the claim 81 of ii) encoding;
The nucleotide sequence that iii) has at least 51% homogeny with SEQ ID NO:9 or SEQ ID NO:10; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
85. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13;
The sequence of the polypeptide of claim of ii) encoding 77 or claim 81;
The nucleotide sequence that iii) has at least 70% homogeny with SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:13; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
86. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:58 or SEQ ID NO:59;
The sequence of the polypeptide of claim of ii) encoding 78 or claim 81;
The nucleotide sequence that iii) has at least 55% homogeny with SEQ ID NO:58 or SEQ ID NO:59; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
87. isolating polynucleotide, it comprises the nucleotide sequence that is selected from as next group:
I) nucleotide sequence that provides as SEQ ID NO:63;
The sequence of the polypeptide of claim of ii) encoding 79 or claim 81;
The nucleotide sequence that iii) has at least 90% homogeny with SEQ ID NO:63; With
Iv) under high stringency with i) the sequence of arbitrary sequence hybridization in iii).
88. a carrier, it comprise or the claim 82 to 87 of encoding in each polynucleotide.
89. the carrier of claim 88, wherein polynucleotide operably are connected with seed specific promoters.
90. a reconstitution cell, it comprises in the claim 82 to 87 each separation polynucleotide.
91. produce the method that to synthesize the cell of one or more LC-PUFA, described method comprises the polynucleotide of introducing at least two kinds of enzymes of one or more codings in cell, each enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzymes, Δ 4 desaturases, Δ 9 prolongation enzyme or Δ 8 desaturases, and wherein said one or more polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more.
92. produce the method for reconstitution cell with synthetic one or more LC-PUFA abilities of enhanced, described method comprises the polynucleotide of introducing at least two kinds of enzymes of one or more codings in first cell, each enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide can instruct described polynucleotide expression promoter in reconstitution cell operably to be connected with one or more, and wherein said reconstitution cell has the ability of synthetic described one or more LC-PUFA of enhanced with respect to first cell.
93. being Δs 5, the method for claim 91 or 92, wherein at least a enzyme prolong enzyme.
94. the method for claim 93, wherein Δ 5 prolongation enzymes also have Δ 6 prolongation enzymic activitys, and wherein with from the synthetic ETA of SDA compare, and prolong enzyme more effectively from the synthetic DPA of EPA.
95. the method for claim 93 or 94, wherein Δ 5 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
96. the method for claim 95, wherein Δ 5 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 90% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
97. each method in the claim 93 to 96, but wherein Δ 5 prolongs the enzyme purifying from algae.
98. being Δs 9, the method for claim 91 or claim 92, wherein at least a enzyme prolong enzyme.
99. the method for claim 98, wherein Δ 9 prolongation enzymes also have Δ 6 prolongation enzymic activitys.
100. the method for claim 99 wherein with from the synthetic ETA of SDA is compared, Δ 9 prolongs enzyme more effectively from the synthetic ETrA of ALA.
101. the method for claim 99 or claim 100, wherein Δ 9 prolongs enzymes and can in yeast cell SDA be extended for ETA, GLA is extended for DGLA or both all can.
102. each method in the claim 99 to 101, wherein Δ 9 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii).
103. the method for claim 102, wherein Δ 9 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
The aminoacid sequence that ii) has at least 90% homogeny with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86; Or
Iii) i) or biological active fragment ii).
104. each method in the claim 99 to 103, but wherein said Δ 9 prolongs the enzyme purifying from algae or fungi.
105. the method for claim 91 or claim 92, wherein at least a enzyme are Δ 5/ Δ, 6 difunctional desaturases or Δ 5/ Δ 6 difunctional prolongation enzymes.
106. the method for claim 105, wherein Δ 5/ Δ 6 difunctional desaturases comprise:
I) aminoacid sequence that provides as SEQ ID NO:15;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:15; Or
Iii) i) or biological active fragment ii).
107. the method for claim 105 or claim 106, wherein Δ 5/ Δ 6 difunctional desaturases are by the natural generation of fresh-water fishes species.
108. the method for claim 105, wherein Δ 5/ Δ 6 difunctional prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2 or SEQ ID NO:14;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2 or SEQ ID NO:14; Or
Iii) i) or biological active fragment ii).
109. the method for claim 91 or claim 92, wherein at least a enzyme are Δ 5 desaturases.
110. the method for claim 91 or claim 92, wherein at least a enzyme are Δ 8 desaturases.
111. each method in the claim 91 to 110, wherein LC-PUFA is docosahexenoic acid (DHA).
112. the cell of claim 111, three kinds or four kinds enzymes of the polynucleotide encoding of wherein being introduced, described enzyme are selected from Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongation enzymes, Δ 6 prolongation enzyme and Δ 4 desaturases.
113. the method for claim 112, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ 6 difunctional desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme, Δ 6 prolongs enzyme and Δ 4 desaturases; Or
Iii) Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ, 6 difunctional prolongation enzymes and Δ 4 desaturases.
114. the method for claim 111,5 kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 4 desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 4 desaturases; Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongs enzyme.
115. the method for claim 111, wherein cell is the cell of the organism that is suitable for fermenting, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzymes, Δ 6 prolongs enzyme and Δ 4 desaturases at least.
116. each method in the claim 91 to 110, wherein LC-PUFA is clupanodonic acid (DPA).
117. the method for claim 116, polynucleotide encoding two or three enzyme of wherein being introduced, described enzyme are selected from Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme and Δ 6 prolongs enzyme.
118. the method for claim 117, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5/ Δ, 6 difunctional desaturases and Δ 5/ Δ 6 difunctional prolongation enzymes;
Ii) Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Iii) Δ 5 desaturases, Δ 6 desaturases and Δ 5/ Δ 6 difunctional prolongation enzymes.
119. the method for claim 116,4 kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5 desaturases, Δ 6 desaturases, Δ 5 prolong enzyme and Δ 6 prolongation enzymes; Or
Ii) Δ 5 desaturases, Δ 8 desaturases, Δ 5 prolong enzyme and Δ 9 prolongation enzymes.
120. the method for claim 116, wherein cell is the cell of the organism that is suitable for fermenting, and described enzyme is that Δ 5/ Δ 6 difunctional desaturases, Δ 5 prolong enzymes and Δ 6 prolongs enzymes at least.
121. each method in the claim 91 to 110, wherein LC-PUFA is timnodonic acid (EPA).
122. the method for claim 121, polynucleotide encoding Δ 5/ Δ, the 6 difunctional desaturases of wherein being introduced and Δ 5/ Δ 6 difunctional prolongation enzymes.
123. the method for claim 121,3 kinds of enzymes of the polynucleotide encoding of wherein being introduced, wherein enzyme is the arbitrary combination in the following combination:
I) Δ 5 desaturases, Δ 6 desaturases and Δ 6 prolong enzyme; Or
Ii) Δ 5 desaturases, Δ 8 desaturases and Δ 9 prolong enzyme.
124. each method in the claim 91 to 123, wherein
I) one of them kind enzyme is the Δ 5 prolongation enzymes that the intracellular EPA of catalysis changes into DPA; Or
Ii) one of them is planted desaturase and can act on the aliphatic alcohol substrate; Or
Iii) at least a desaturase is from vertebrates or its variant; Or
Iv) i), ii) or any combination iii).
125. the method for claim 124, wherein Δ 5 prolongation enzymes comprise:
I) aminoacid sequence that provides as SEQ ID NO:2;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:2; Or
Iii) i) or biological active fragment ii).
126. the method for claim 124 or claim 125, wherein at least a desaturase comprises:
I) aminoacid sequence that provides as SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22;
The aminoacid sequence that ii) has at least 50% homogeny with SEQ ID NO:16, SEQ ID NO:21 or SEQ ID NO:22; Or
Iii) i) or biological active fragment ii).
127. each method in the claim 91 to 126, the linolic acid (LA) that wherein said cell can produce from endogenous, alpha-linolenic acid (ALA) or both produce described LC-PUFA.
128. the cell of claim 1274, wherein the ALA of endogenous generation and the ratio of LA are at least 1: 1 or at least 2: 1.
129. each method in the claim 91 to 128, wherein cell be vegetable cell, from the cell in angiospermous vegetable cell, oilseeds vegetable cell or the seed.
130. the method for claim 129, wherein at least a promotor is a seed specific promoters.
131. each method in the claim 91 to 128, wherein cell is a unicellular microorganism.
132. the method for claim 131, wherein unicellular microorganism is suitable for fermentation.
133. the method for claim 132, wherein microorganism is a yeast.
134. each method in the claim 91 to 128, wherein cell is non-human animal's a cell or external human cell.
135. each method in the claim 91 to 134, wherein said cell produces the LC-PUFA in the triacylglycerol that is integrated in described cell.
136. the method for claim 135, wherein at least 50% LC-PUFA that produces in described cell is integrated in the triacylglycerol.
137. each method in the claim 91 to 136, protein-coding regions wherein at least a, two or more polynucleotide derive from the algae gene.
138. the method for claim 137, wherein the algae gene is from crust husband Trentepohlia, for example from Pavlova salina.
139. produce the method that can synthesize the cell of DGLA, described method comprises the polynucleotide of introducing following one or both polypeptide of coding in cell:
A) peptide species, it is that the Δ 9 that is selected from as next group prolongs enzyme:
I) aminoacid sequence that provides as SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86;
Ii) with SEQ ID NO:3, SEQ ID NO:85 or SEQ ID NO:86 have to
The aminoacid sequence of few 40% homogeny; With
Iii) i) or biological active fragment ii); And/or
B) peptide species, it is Δ 8 desaturases that are selected from as next group:
I) aminoacid sequence that provides as SEQ ID NO:1;
The aminoacid sequence that ii) has at least 40% homogeny with SEQ ID NO:1; With
Iii) i) or biological active fragment ii),
Wherein said polynucleotide can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein said reconstitution cell is derived from the cell that can not synthesize DGLA.
140. the cell of claim 139, wherein cell can change into ARA with DGLA.
141. the cell of claim 140, wherein cell also comprises the polynucleotide of coded delta 5 desaturases, wherein the polynucleotide of coded delta 5 desaturases can instruct described polynucleotide operably to be connected in the promotor of cell inner expression with one or more, and wherein cell can produce ARA.
142. each cell in the claim 139 to 141, wherein cell lacks ω 3 desaturase activity, and can not produce ALA.
143. each cell in the claim 139 to 142, wherein cell is the cell of vegetable cell or the organism that is suitable for fermenting.
144. each method in the claim 91 to 143 also is included in described one or more polynucleotide of introducing and determines the fatty acid content of described cell or the step of composition afterwards.
145. each method in the claim 91 to 144, also comprise identify or screening with respect to etc. the gene non-transformed cell have the step of the cell of improved fatty acid content or composition.
146. reconstitution cell with each method generation in the claim 91 to 145.
147. transgenic plant, it comprises each described cell at least a claim 1 to 47,52 to 59,61 to 67,90 or 146.
148. the plant of claim 147, wherein plant is an angiosperm.
149. the plant of claim 147 or claim 148, it comprises the plant part of at least one synthetic EPA, and the total fatty acids of wherein said plant part comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
150. each plant in the claim 147 to 149, it comprises the plant part of at least one synthetic DPA, and the total fatty acids of plant part comprises at least 0.1%, at least 0.13% or at least 0.5% DPA.
151. each plant in the claim 147 to 150, it comprises the plant part of at least one synthetic DHA.
152. each plant in the claim 147 to 151, it comprises the plant part of at least one synthetic at least a ω 3 C20 LC-PUFA, and the total fatty acids of wherein said plant part comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
153. each plant in the claim 147 to 152, it comprises the plant part of at least one synthetic EPA, and the ALA in the wherein said plant part is at least 2% or at least 14.6% to the transformation efficiency of EPA.
154. each plant in the claim 147 to 153, it comprises the plant part of at least one synthetic ω 3 polyunsaturated fatty acid, the product of the product of Δ 6 desaturation that described ω 3 polyunsaturated fatty acids are ALA and/or the Δ 9 prolongation effects of ALA, and wherein the ALA in the plant part is at least 22% or at least 24% to the transformation efficiency of described product.
155. each plant in the claim 147 to 154, it comprises at least one plant part from the synthetic DPA of EPA, and the EPA in the wherein said plant part is at least 5% or at least 7% to the transformation efficiency of DPA.
156. each plant in the claim 147 to 155, wherein plant is the oilseeds plants.
157. the method for production of oil seed, described method comprises:
I) the transgenosis oilseeds plant of growth claim 156 under appropriate condition; With
Ii) collect the seed of plant.
158. the part of each transgenic plant in the claim 147 to 156, wherein with respect to the corresponding section that waits the non-conversion of gene plant, described part comprises the LC-PUFA that level raises in its lipid acid.
159. the plant part of claim 158, it is seed, leaf, stem, flower, pollen, root or special storage organ.
160. a transgenic seed, it comprises LC-PUFA.
161. the seed of claim 160, wherein LC-PUFA is selected from by with next group:
i)EPA；
ii)DPA；
iii)DHA；
Iv) EPA and DPA; With
V) EPA, DHA and DPA.
162. the seed of claim 160 or claim 161, its be derived from produce LA and/or ALA etc. gene non-transgenic seed.
163. the seed of claim 162, the concentration of the ALA that wherein said seed such as non-transgenic such as gene such as grade comprises in its lipid acid is higher than the concentration of LA.
164. the seed of claim 162 or claim 163, the wherein said gene non-transgenic seed that waits comprises in its total fatty acids at least about 13% ALA or at least about 27% ALA or at least about 50% ALA.
165. each seed in the claim 160 to 164, wherein the total fatty acids in the oil of seed comprises at least 9% C20 lipid acid.
166. each seed in the claim 160 to 165, wherein seed source is from the oilseeds plant.
167. the seed of claim 166, wherein the oilseeds plant is oilseed rape, corn, Sunflower Receptacle, soybean, jowar, flax, beet, cotton, peanut, opium poppy, leaf mustard, Semen Ricini, sesame or safflower.
168. each seed in the claim 160 to 167, wherein said seed have and wait the substantially the same percentage of germination of gene non-transgenic seed.
169. each seed in the claim 160 to 168, it is included in synthetic EPA in the described seed, and the total fatty acids of wherein said seed comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
170. each seed in the claim 160 to 169, it is included in synthetic DPA in the described seed, and the total fatty acids of wherein said seed comprises at least 0.1%, at least 0.13% or at least 0.5% DPA.
171. each seed in the claim 160 to 170, it is included in synthetic DHA in the described seed.
172. each seed in the claim 160 to 171, its comprise at least a in described seed synthetic ω 3 C20 LC-PUFA, and the total fatty acids of wherein said seed comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
173. each seed in the claim 160 to 172, it is included in synthetic EPA in the described seed, and the ALA in the wherein said seed is at least 2% or at least 14.6% to the transformation efficiency of EPA.
174. each seed in the claim 160 to 173, it comprises ω 3 polyunsaturated fatty acids, the product of the product of Δ 6 desaturation that described ω 3 polyunsaturated fatty acids are ALA and/or the Δ 9 prolongation effects of ALA, described product is a synthetic in described seed, and the ALA in the wherein said seed is at least 22% or at least 24% to the transformation efficiency of described product.
175. each seed in the claim 160 to 174, it is included in the described seed from EPA synthetic DPA, and the EPA in the wherein said seed is at least 5% or at least 7% to the transformation efficiency of DPA.
176. each seed in the claim 160 to 175, the LC-PUFA of at least 25% or at least 50% or at least 75% in the wherein said seed forms the triacylglycerol part.
177. extract, its from the claim 147 to 156 each transgenic plant or the part of claim 158 or claim 159 or claim 160 to 176 in each seed, wherein with respect to the corresponding extract from plant such as non-conversion such as gene such as grade, described extract comprises the LC-PUFA that level raises in its lipid acid.
178. the extract of claim 177, it is the oil that comprises the purifying basically of at least 50% triacylglycerol.
179. the extract of claim 177 or claim 178 wherein comprises at least 1.5%, at least 2.1% or 2.5%EPA at least in the total fatty acid content.
180. each extract in the claim 177 to 179 wherein comprises at least 0.1%, at least 0.13% or 0.5%DPA at least in the total fatty acid content.
181. each extract in the claim 177 to 180 wherein comprises DHA in the total fatty acid content.
182. each extract in the claim 177 to 181 wherein comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA in the total fatty acid content.
183. each extract in the claim 177 to 182, it comprises arbitrary miscellany of ARA, EPA, DPA, DHA or these lipid acid in triacylglycerol.
184. inhuman transgenic animal, it comprises at least a claim 1 to 45,51 to 59,63 to 66,90 or 146 each reconstitution cell.
185. produce the method for LC-PUFA, described method is included in the reconstitution cell of cultivating in the claim 1 to 67,90 or 146 each under the appropriate condition.
186. the method for claim 185, wherein cell is the cell that is applicable to the organism of fermentation, and described method also comprises cellular exposure at least a LC-PUFA precursor.
187. the method for claim 186, wherein the LC-PUFA precursor is at least a linolic acid or alpha-linolenic acid.
188. the method for claim 186 or claim 187 wherein provides the LC-PUFA precursor in vegetables oil.
189. the method for claim 185, wherein cell is an alga cells, and described method also is included under the appropriate condition alga cells that growth is used to produce described LC-PUFA.
190. each method in the claim 185 to 189, wherein said cell comprise at least a C20 LC-PUFA, and the total fatty acids of wherein said cell comprises at least 2%, at least 4.7% or at least 7.9% C20 LC-PUFA.
191. each method in the claim 185 to 190, wherein said cell comprise at least a ω 3 C20 LC-PUFA, and the total fatty acids of wherein said cell comprises at least 2.5% or at least 4.1% ω 3 C20 LC-PUFA.
192. each method in the claim 185 to 191, wherein said cell comprises ω 3 polyunsaturated fatty acids, the product of the product of Δ 6 desaturation that described ω 3 polyunsaturated fatty acids are ALA and/or the Δ 9 prolongation effects of ALA, and wherein said intracellular ALA is at least 22% or at least 24% to the transformation efficiency of described product.
193. each method in the claim 185 to 192, wherein said cell comprises DPA, and the total fatty acids of wherein said cell comprises at least 0.1%, at least 0.13% or at least 0.5% DPA.
194. each method in the claim 185 to 193, wherein said cell comprises DPA, and wherein said intracellular EPA is at least 5% or at least 7% to the transformation efficiency of DPA.
195. each method in the claim 185 to 194, wherein said cell comprises EPA, and the total fatty acids of wherein said cell comprises at least 1.5%, at least 2.1% or at least 2.5% EPA.
196. each method in the claim 185 to 195, wherein said cell comprises EPA, and wherein said intracellular ALA is at least 2% or at least 14.6% to the transformation efficiency of EPA.
197. produce the method for one or more LC-PUFA, described method is included under the appropriate condition transgenic plant of cultivating in the claim 147 to 156 each.
198. produce the method for the oil that comprises at least a LC-PUFA, the seed that comprises in the plant part of the transgenic plant that obtain in the claim 147 to 156 each or claim 158 or claim 159 or the claim 160 to 176 each, and from described plant, plant part or seed extract oil.
199. the method for claim 198, wherein said oil extracts from seed by squeezing described seed.
200. produce the method for DPA from EPA, described method is included under the appropriate condition polypeptide and the lipid acid precursor that EPA is exposed in the claim 68 to 81 each.
201. the method for claim 200, wherein said method is carried out in the cell that utilizes the generation EPA of polyketide sample system.
202. a fermentation process, it may further comprise the steps:
I) provide the container that contains liquid composition, described liquid composition comprises in the claim 1 to 44,49 to 60,63 to 76,90 or 146 each cell and fermentation and the synthetic required component of fatty acid biological; With
Ii) provide the condition of the fermentation that helps the contained liquid composition of described container.
203. the fermentation process of claim 202, wherein the synthetic required component of fermentation and fatty acid biological is LA.
204. a composition, it comprises in the claim 1 to 67,90 or 146 each cell or its extract that comprises LC-PUFA or part and suitable carrier.
205. a composition, it comprise in the claim 147 to 156 each transgenic plant or the plant part of claim 158 or claim 159 or claim 160 to 176 in each seed or their extract that comprises LC-PUFA or part and suitable carrier.
206. a feed, it comprises in the claim 1 to 67,90 or 146 in the plant part, claim 160 to 176 of each plant, claim 158 or claim 159 in each the cell, claim 147 to 156 in each the seed, claim 177 to 183 product of the fermentation process of product, claim 202 or the claim 203 of each method in each the extract, claim 185 to 201 or the composition of claim 204 or claim 205.
207. the feed of claim 206, it comprises DPA at least, wherein carries out the enzyme reaction of at least a production DPA in cell with recombinase.
208. prepare the method for feed, described method comprises the composition and the suitable carriers of the product of the fermentation process of product, claim 202 or the claim 203 of each method in each the extract, claim 185 to 201 in each the seed, claim 177 to 183 in the plant part of each plant, claim 158 or claim 159 in each the cell, claim 147 to 156 in the claim 1 to 67,90 or 146, the claim 160 to 176 or claim 204 or claim 205 mixed.
209. increase the method for the level of LC-PUFA in the organism, described method comprises to organism uses claim 1 to 67, each cell in 90 or 146, each plant in the claim 147 to 156, the plant part of claim 158 or claim 159, each seed in the claim 160 to 176, each extract in the claim 177 to 183, the product of each method in the claim 185 to 201, the product of the fermentation process of claim 202 or claim 203, or the composition of claim 204 or claim 205, or the feed of claim 206 or claim 207.
210. the method for claim 209, wherein route of administration is oral.
211. the method for claim 209 or claim 210, wherein organism is a vertebrates.
212. the method for the disease that treatment or prevention can benefit from LC-PUFA, described method comprises to object uses claim 1 to 67, each cell in 90 or 146, each plant in the claim 147 to 156, the plant part of claim 158 or claim 159, each seed in the claim 160 to 176, each extract in the claim 177 to 183, the product of each method in the claim 185 to 201, the product of the fermentation process of claim 202 or claim 203, or the composition of claim 204 or claim 205, or the feed of claim 206 or claim 207.
213. the method for claim 212, wherein disease is an irregular pulse, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stone, AIDS, multiple sclerosis, rheumatoid arthritis, the Crohn disease, schizophrenia, cancer, fetal alcohol syndrome, attention-deficit hyperactivity disease, cystic fibrosis, pku, unipolar depression, offensiveness hostility (aggressivehostility), adrenoleukodystrophy, coronary artery disease, hypertension, diabetes, obesity, the Alzheimer disease, chronic obstructive pulmonary disease, ulcerative colitis, postangioplasty restenosis, eczema, hypertension, platelet aggregation, gastrointestinal hemorrhage, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, confirmed fatigue or eye disease behind the virus infection.
214. claim 1 to 67, each cell in 90 or 146, each plant in the claim 147 to 156, the plant part of claim 158 or claim 159, each seed in the claim 160 to 176, each extract in the claim 177 to 183, the product of each method in the claim 185 to 201, the product of the fermentation process of claim 202 or claim 203, or the composition of claim 204 or claim 205, the feed of claim 206 or claim 207 production be used for the treatment of or the medicine of the disease preventing from LC-PUFA, to benefit in purposes.
215. a production comprises the method for the unbranched LC-PUFA of 22 carbon atoms, described method comprises that the LC-PUFA with unbranched 20 carbon atoms carries out incubation with the polypeptide that is selected from next group:
I) comprise the polypeptide of the aminoacid sequence that provides as SEQ ID NO:2 or SEQ ID NO:14;
Ii) comprise the polypeptide that has the aminoacid sequence of at least 50% homogeny with SEQ ID NO:2 or SEQ ID NO:14; With
Iii) i) or biological active fragment ii),
Wherein polypeptide also has Δ 6 prolongation enzymic activitys.
216. the method for claim 215 wherein saidly comprises that the unbranched LC-PUFA of 22 carbon atoms is DPA, and the LC-PUFA of unbranched 20 carbon atoms is EPA.
217. the method for claim 215 or claim 216 is wherein carried out described method in the reconstitution cell that produces described polypeptide and EPA.
218. antibody purified basically or its fragment with each polypeptide specific combination in the claim 68 to 81.
219. identify the reconstitution cell that can synthesize one or more LC-PUFA, the method of tissue or organism, described method comprises the described cell of detection, the polynucleotide that whether have at least two kinds of enzymes of one or more codings in tissue or the organism, each described enzyme is Δ 5/ Δ 6 difunctional desaturases, Δ 5 desaturases, Δ 6 desaturases, Δ 5/ Δ 6 difunctional prolongation enzymes, Δ 5 prolongs enzyme, Δ 6 prolongs enzyme, Δ 4 desaturases, Δ 9 prolongs enzyme, or Δ 8 desaturases, wherein said one or more polynucleotide and one or more can instruct described polynucleotide at described cell, expression promoter operably connects in tissue or the organism.
220. the method for claim 219, it comprises nucleic acid amplification step, nucleic acid hybridization step, detects whether have genetically modified step or the fatty acid content of definite described cell, tissue or organism or the step of composition in described cell, tissue or the organism.
221. the method for claim 219 or claim 220, wherein organism is animal, plant, angiosperm or microorganism.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210006139.8A CN102559364B (en) | 2004-04-22 | 2005-04-22 | Use recombinant cell synthesis of long-chain polyunsaturated fatty acids |
| CN201310392524.5A CN103451246B (en) | 2004-04-22 | 2005-04-22 | With recombinant cell synthesis of long-chain polyunsaturated fatty acids |
Applications Claiming Priority (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US56462704P | 2004-04-22 | 2004-04-22 | |
| US60/564,627 | 2004-04-22 | ||
| US61386104P | 2004-09-27 | 2004-09-27 | |
| US60/613,861 | 2004-09-27 | ||
| US66870505P | 2005-04-05 | 2005-04-05 | |
| AU2005901673A AU2005901673A0 (en) | 2005-04-05 | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells | |
| AU2005901673 | 2005-04-05 | ||
| US60/668,705 | 2005-04-05 | ||
| PCT/AU2005/000571 WO2005103253A1 (en) | 2004-04-22 | 2005-04-22 | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210006139.8A Division CN102559364B (en) | 2004-04-22 | 2005-04-22 | Use recombinant cell synthesis of long-chain polyunsaturated fatty acids |
| CN201310392524.5A Division CN103451246B (en) | 2004-04-22 | 2005-04-22 | With recombinant cell synthesis of long-chain polyunsaturated fatty acids |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101018862A true CN101018862A (en) | 2007-08-15 |
| CN101018862B CN101018862B (en) | 2013-10-09 |
Family
ID=38727204
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2005800206963A Active CN101018862B (en) | 2004-04-22 | 2005-04-22 | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101018862B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102186876A (en) * | 2008-10-14 | 2011-09-14 | 孟山都技术公司 | Utilization of fatty acid desaturases from hemiselmis spp. |
| CN102438468A (en) * | 2009-04-17 | 2012-05-02 | 赛拉维斯塔制药有限公司 | Compositions rich in omega-3 fatty acids with a low content in phytanic acid |
| CN102803289A (en) * | 2009-06-16 | 2012-11-28 | 纳幕尔杜邦公司 | Improved optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| CN104853596A (en) * | 2012-06-15 | 2015-08-19 | 联邦科学技术研究组织 | Production of long chain polyunsaturated fatty acids in plant cells |
| CN107858204A (en) * | 2008-11-18 | 2018-03-30 | 联邦科学技术研究组织 | Produce the enzyme and method of omega-3 fatty acid |
| CN110066836A (en) * | 2011-02-02 | 2019-07-30 | 柯碧恩生物技术公司 | Originate from the customization oil of recombination oleaginous microorganism |
-
2005
- 2005-04-22 CN CN2005800206963A patent/CN101018862B/en active Active
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102186876B (en) * | 2008-10-14 | 2014-06-11 | 孟山都技术公司 | Utilization of fatty acid desaturases from hemiselmis spp. |
| CN103756972B (en) * | 2008-10-14 | 2019-05-10 | 孟山都技术公司 | The utilization of fatty acid desaturase from Hemiselmis Parke |
| CN102186876A (en) * | 2008-10-14 | 2011-09-14 | 孟山都技术公司 | Utilization of fatty acid desaturases from hemiselmis spp. |
| CN107858204A (en) * | 2008-11-18 | 2018-03-30 | 联邦科学技术研究组织 | Produce the enzyme and method of omega-3 fatty acid |
| CN107858204B (en) * | 2008-11-18 | 2021-10-29 | 联邦科学技术研究组织 | Enzymes and methods for producing omega-3 fatty acids |
| CN113957105A (en) * | 2008-11-18 | 2022-01-21 | 联邦科学技术研究组织 | Enzymes and methods for producing omega-3 fatty acids |
| CN113957054A (en) * | 2008-11-18 | 2022-01-21 | 联邦科学技术研究组织 | Enzymes and methods for producing omega-3 fatty acids |
| CN102438468A (en) * | 2009-04-17 | 2012-05-02 | 赛拉维斯塔制药有限公司 | Compositions rich in omega-3 fatty acids with a low content in phytanic acid |
| CN102803289B (en) * | 2009-06-16 | 2015-07-22 | 纳幕尔杜邦公司 | Improved optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| CN102803289A (en) * | 2009-06-16 | 2012-11-28 | 纳幕尔杜邦公司 | Improved optimized strains of yarrowia lipolytica for high eicosapentaenoic acid production |
| CN110066836A (en) * | 2011-02-02 | 2019-07-30 | 柯碧恩生物技术公司 | Originate from the customization oil of recombination oleaginous microorganism |
| CN104853596A (en) * | 2012-06-15 | 2015-08-19 | 联邦科学技术研究组织 | Production of long chain polyunsaturated fatty acids in plant cells |
| CN104853596B (en) * | 2012-06-15 | 2018-10-09 | 联邦科学技术研究组织 | Long-chain polyunsaturated fatty acid is generated in plant cell |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101018862B (en) | 2013-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11597953B2 (en) | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells | |
| US11220698B2 (en) | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells | |
| CN101018862B (en) | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells | |
| AU2005235627B2 (en) | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells | |
| AU2013204296B2 (en) | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |